1. Patent Search
  2. Details

GENERIC ASSAYS FOR DETECTION OF INFLUENZA VIRUSES

20190382854 ยท 2019-12-19

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to generic methods for the detection and quantification of influenza viruses. These may uses a reverse transcription (RT-PCR) real time (q-PCR) assay which amplifies a conserved region within influenza A or B strains. The assays allow the quantification of influenza virus RNA molecules or whole virus particles, irrespective of the particular virus strain (e.g. human, avian, swine flu). The methods are particularly applicable as diagnostic assays or in the monitoring of vaccine production processes.

    Claims

    1.-16. (canceled)

    17. A method of providing a doctor with an influenza diagnosis comprising: a) receiving a request from a doctor comprising a sample, b) detecting influenza virus RNA in the sample, wherein a conserved region within the influenza genome is amplified, and c) providing the doctor with an influenza diagnosis.

    18. The method of claim 17, wherein the conserved region encodes partly or completely an M protein of the influenza virus.

    19. The method of claim 17, wherein the conserved region comprises SEQ ID NO: 3 or SEQ ID NO: 9.

    20. The method of claim 17, wherein the conserved region is amplified by a one-step RT-qPCR.

    21. The method of claim 20, wherein the one-step RT-qPCR uses at least one primer selected from the group consisting of SEQ ID NOs: 1-11.

    22. The method of claim 17, wherein the influenza diagnosis in c) comprises quantifying the amount of intact virus particles in the sample.

    23. The method of claim 22, comprising comparing a signal generated for influenza virus RNA in the sample and a signal generated for a standard RNA, thereby quantifying the amount of intact virus particles in the sample.

    24. A method of ordering an influenza vaccine, comprising: a) receiving a sample during a fermentation step of an influenza vaccine production; b) removing free virus RNA from the sample; c) recording a first signal of influenza virus RNA in the sample after b); d) recording a second signal of influenza virus RNA in a control sample that contains a defined amount of influenza virus RNA; e) comparing the first signal to the second signal, thereby quantifying the amount of intact virus particles in the sample; and f) updating a user to indicate the amount of intact virus particles in the sample, thereby allowing the user to determine an optimal time for harvesting viruses for influenza vaccine production.

    25. The method of claim 24, wherein the recording in step c) and d) comprises amplifying a conserved region within the genome of the influenza virus.

    26. The method of claim 25, wherein the conserved region encodes partly or completely an M protein of the influenza virus.

    27. The method of claim 25, wherein the conserved region comprises SEQ ID NO: 3 or SEQ ID NO: 9.

    28. The method of claim 25, wherein the amplifying comprises performing a one-step RT-qPCR.

    29. The method of claim 28, wherein the one-step RT-qPCR uses at least one primer selected from the group consisting of SEQ ID NOs: 1-11.

    30. The method of claim 24, wherein the removing in step b) is performed by RNase treatment.

    31. The method of claim 24, further comprising: g) centrifuging and filtering the harvested viruses; h) purifying the viruses after g) by chromatography and ultra-/diafiltration steps, inactivating the viruses, and disrupting the viruses to solubilize the viral surface antigens HA and NA; i) filtering the HA and NA antigens to obtain a monovalent bulk; and j) optionally, blending the monovalent bulk into multivalent bulks and filling into a final container.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0045] FIG. 1 shows the correlation of qPCR virus particle measurements with known infectious virus kinetics, measured during infection. The x-axis indicates hours post infection. The y-axis shows the number of copies per mL as assessed by qPCR on a logarithmic scale. The figure illustrates that the curves of qPCR correspond to standard infectious virus titre kinetics at low m.o.i. In particular, virus offspring is measurable in supernatants after 16-24 hrs and maximum infectivity is seen after 48 hrs. Each line shows a different experiment.

    [0046] FIG. 2 shows the correlation of virus particles as assessed by transmission electron microscopy versus the number of virus particles as assessed by qPCR according to the present invention. The x-axis shows the number of TEM virus particle counts per mL and the y-axis shows the number of copies per mL as assessed by qPCR.

    MODES FOR CARRYING OUT THE INVENTION

    [0047] Detection of Different Influenza Subtypes

    [0048] Influenza virus strains are obtained from the German national reference center for animal influenza (Frierich Loeffler Institute, Riems). The strains are cultured on MDCK 33016PF cells and supernatants of passage one and two are analysed using the RT-PCR methods of the invention using either a Qiagen QuantiTect Virus kit or an Invitrogen Super Script III Platinum kit. The primers and probes used are those shown in table 1.

    [0049] When the QuantiTect Virus kit is used the following temperature profiles are run:

    [0050] measurement of fluorescence signal: 60 C.

    [0051] ramp rate 2 C./sec

    [0052] RT step: 50 C. for 20 min

    [0053] Taq activation 95 C. for 5 min

    [0054] Main run: 45 cycles: 94 C. for 15 sec; 60 C. for 45 sec (2-step process) or [0055] 45 cycles: 94 C. for 15 sec; 60 C. for 30 sec; 72 C. for 30 sec (3-step process).

    [0056] When the Super Script III Platinum kit is used the following temperature profiles are run:

    [0057] measurement of fluorescence signal: 60 C.

    [0058] ramp rate 2 C./sec

    [0059] RT step: 50 C. for 15 min

    [0060] Taq activation 95 C. for 2 min

    [0061] Main run: 45 cycles: 94 C. for 15 sec, 60 C. for 45 sec

    [0062] The fluorescent signals are analysed using the respective real time software. The signals are quantified by comparing the generated fluorescent signal with the respective signal of a dilution series of an IVT. The results shown in table 2 demonstrate that all of the tested influenza virus subtypes can be identified with the same set of primer and probe. This shows that the methods of the invention are capable of detecting several different influenza subtypes. The inventors also tested the influenza strains shown in table 7.

    [0063] In order to assess the sensitivity of the methods of the invention, a serial dilution of samples containing either the A/Bayern/7/95 influenza strain or the B/Baden Wrttemberg/3/06 influenza strain is done. The samples are subjected to qPCR using either the QuantiTect Virus kit or Super Script III Platinum kit in accordance with the methods of the present invention (as described above) or the Cepheid Influenza Virus AB Primer and Probe Set following the manufacturer's protocol. The fluorescent signals are analysed using the respective real time software. The signals are quantified by comparing the generated fluorescent signal with the respective signal of a dilution series of an IVT. The results are shown in tables 5 and 6. For the influenza A strain, it is shown that virus particles are still detectable up to a dilution of 1:1000000 when using the methods of the invention wherein the Cepheid kit can detect virus particles only up to a dilution of 1:100000. For the influenza B strain, virus particles are still detectable up to a dilution of 1:1000000 wherein the Cepheid kit can detect virus particles only up to a dilution of 1:10000. The methods of the invention are therefore much more sensitive than the prior art methods.

    [0064] Quantification of Influenza Virus Particles in Sample

    [0065] Influenza virus particles are measured in a sample as outlined in FIG. 1. Briefly, a 21 l sample is subjected to RNase using a mixture of 15 U of RNase A and 7.5 U of T1. The sample is incubated with the RNase mixture for one hour. The pretreated sample is diluted at ratios of 1:100 to 1:10000 in order to obtain a dilution at which qPCR gives results in a linear range. The sample is subjected to qPCR in accordance with the methods of the invention. The results are compared a standard curve using an in vitro transcribed RNA (IVT). The results (illustrated in FIG. 1) show that the obtained curves of qPCR copy numbers correspond to standard infectious virus titre kinetics at low MOI. In particular, virus offspring is measurable in supernatants after 16-24 hours and maximum infectivity titres are observed after 48 hours.

    [0066] Correlation of Virus Particles as Assessed by Transmission Electron Microscopy and qPCR According to the Present Invention

    [0067] The influenza strains obtained are A/Bayern/7/95, A/New Caledonia/20/99, A/Hong Kong/8/68, B/Lee/40 and A/Puerto Rico/8/34 are obtained from ABI online. The number of virus particles is assessed by transmission electron microscopy (TEM). To this end, virus particles are applied to coated copper grids and air dried. The material is then fixed with 2.5% (v/v) glutaraldehyde, washed and stained with 2% (w/v) aqueous uranyl acetate and 2% (w/v) phosphotungstic acid (PTA) pH 6.5. The number of virus particles in the sample is determined by TEM. The number of viruses particles counted by TEM is compared to the number of virus particles as assessed by qPCR according to the present invention. The results (see FIG. 2) show that the methods of the invention accurately determine the number of virus particles in a sample for various different influenza strains.

    [0068] It will be understood that the invention has been described by way of example only and modifications may be made whilst remaining within the scope and spirit of the invention.

    TABLE-US-00001 TABLE1 preferredprimerandprobesequencesforthedetectionofinfluenza AandBvirus.TheprobesequencesareTaqman probes. SEQID Name NO (primer/probe) Sequence Genus Tm C. 1 InfBM_BR17(primer) gcagatagaggcaccaattagtg B 62.9 2 InfA_M_BR9(primer) caggccccctcaaag A 51.6 3 InfA_M_TMa(probe) aggtgacaggattggtcttgtctttagcc A 70.4 4 InfA_MBR11(primer) gcgtctacgctgcagtcc A 60.7 5 InfA_MBR12(primer) cttctaaccgaggtcgaaacg A 61.3 6 InfA_MBR13(primer) gaccaatcctgtcacctctgac A 6.0 7 InfAM_BR18(primer) caggccccctcaaagc A 55.8 8 InfB_M_BR8(primer) gtgctttytgtatatcagttargc B 60.1 9 InfB_M_TM(probe) agatggagaaggcaaagcagaactagc B 68.3 10 InfB_MBR10(primer) gatagaggcaccaattagtg B 56.4 11 InfBM_BR16(primer) gtttggagacacaattgcctacc B 62.9 12 BF(Youil) ctgtttggagacacaattgc B 13 BR(Youil) gtgctttytgtatatcag B 14 FluSwH1F236 tgggaaatccagagtgtgaatcact A 15 FluSwH1R318 cgttccattgtctgaactagrtgtt A 16 FluSwH1TM292 ccacaatgtaggaccatgagcttgctgt A 17 InfA_M_swine aggtgacaagattggtcttgtctttagcc A

    TABLE-US-00002 TABLE 2 HA-Test qPCR copies/ml Sub- Passage Passage type AIV-Strain 1 2 1 2 H5N6 A/duck/Potsdam/2243/84 128 64 2.9E+09 1.0E+09 H9N2 A/turkey/Germany/176/ 128 128 7.9E+08 3.0E+08 95 H3 R2076/3/07 64 64 6.8E+07 3.2E+08 H4N6 R2619/2/07 <2 <2 6.1E+02 <100 H6 R2707/2/07 <2 <2 4.9E+03 <100 H8 R2709/2/07 <2 <2 5.1E+02 <100 H2N1 R2711/2/07 <2 <2 2.0E+03 <100

    TABLE-US-00003 TABLE 3 A/Bangkok/1/1979(H3N2) (1027) A/Wellington/4/2003 (977) A/canine/Texas/1/2004(H3N8) (1026) A/Canterbury/152/2001 (1000) A/chicken/Bangli Bali/BBPV6-1/2004 (981) A/Chicken/California/9420/2001(H6N2) (1002) A/chicken/Germany/R28/03(H7N7) (982) A/Chicken/Shanghai/F/98(H9N2) (1027) A/Dk/ST/5048/2001(H3N8) (988) A/duck/Hokkaido/9/99 (H9N2) (986) A/Dunedin/10/2002 (977) A/equine/Ohio/1/2003(H3N8) (1027) A/FPV/Dobson/27 (H7N7) (1027) A/Hong Kong/1073/99 (1025) A/human/Zhejiang/16/2006(H5N1) (998) A/Leningrad/134/17/57 (1027) A/mallard/Alberta/24/01 (1027) A/Memphis/15/1983 (1000) A/New Caledonia/20/1999(H1N1) (985) A/New York/719/1994 (978) A/seal/Mass/1/80(H7N7) (1027) A/swan/Mongolia/2/06(H5N1) (987) A/swine/IN/PU542/04 (H3N1) (1030) A/swine/Iowa/15/1930 (1027) A/Thailand/1(KAN-1)/2004(H5N1) (1039) A/Thailand/676/2005(H5N1) (1003) A/USSR/90/1977(H1N1) (1027) A/USSR/90/77 (1000) A/Vietnam/CL119/2005(H5N1) (982) A/WDk/ST/1737/2000(H6N8) (990) A/WDk/ST/988/2000(H4N9) (815) AB166865 AB188819 AB189048 AB212651 AB239305 AF046082 AF073180 AF073181 AF073182 AF073185 AF073186 AF073187 AF073188 AF073189 AF073190 AF073192 AF073193 AF073195 AF073203 AF073205 AF156458 AF156459 AF156464 AF156466 AF156467 AF156468 AF203788 AF231360 AF231361 AF250486 AF262213 AF398876 AF401293 AF474049 AF474050 AF474051 AF474052 AF474053 AF474054 AF474055 AF474056 AF474057 AF474058 AF508687 AF508692 AF508693 AF508694 AF508695 AF508696 AF508697 AF508698 AF508700 AF508702 AY075029 AY130766 AY210030 AY210042 AY210047 AY210051 AY210053 AY210054 AY221537 AY241600 AY241612 AY684709 AY862620 AY210063 AY221538 AY241601 AY241613 AY724262 AY862621 AY210065 AY241591 AY241602 AY241614 AY724263 AY862622 AY210244 AY241592 AY241603 AY253755 AY737292 AY862623 AY210253 AY241593 AY241604 AY303652 AY737298 AY950237 AY210258 AY241594 AY241605 AY303653 AY770077 AY950238 AY210264 AY241595 AY241606 AY303654 AY770998 AY950239 AY210265 AY241596 AY241607 AY303655 AY800234 AY950240 AY221530 AY241597 AY241608 AY303656 AY818145 AY950241 AY221531 AY241598 AY241609 AY340091 AY862615 CY002955 AY221532 AY241599 AY241610 AY590578 AY862616 CY004584 AY221533 AY651391 AY241611 AY609315 AY862617 CY004722 AY221536 AY651413 CY007036 AY611525 CY007220 CY005445 CY005519 AY653194 CY007044 AY646079 CY007228 CY005448 CY005606 CY006956 CY007052 CY007132 CY007236 CY007356 CY005653 CY006964 CY007060 CY007140 CY007244 CY007364 CY005692 CY006972 CY007068 CY007148 CY007252 CY007372 CY005832 CY006980 CY007076 CY007156 CY007260 CY007380 CY005839 CY006988 CY007084 CY007164 CY007268 CY007388 CY006045 CY006996 CY007092 CY007172 CY007292 CY007396 CY006924 CY007004 CY007100 CY007188 CY007300 CY007404 CY006932 CY007012 CY007108 CY007196 CY007316 CY007412 CY006940 CY007020 CY007116 CY007204 CY007340 CY007420 CY006948 CY007028 CY007124 CY007212 CY007348 CY007428 CY007436 CY007668 CY007868 CY008084 CY008349 CY008589 CY007444 CY007676 CY007876 CY008092 CY008357 CY008597 CY007452 CY007684 CY007884 CY008100 CY008365 CY008605 CY007460 CY007692 CY007892 CY008108 CY008373 CY008613 CY007468 CY007700 CY007900 CY008132 CY008381 CY008621 CY007476 CY007708 CY007916 CY008140 CY008389 CY008629 CY007484 CY007716 CY007924 CY008157 CY008397 CY008637 CY007492 CY007724 CY007932 CY008197 CY008405 CY008645 CY007500 CY007732 CY007940 CY008221 CY008413 CY008653 CY007508 CY007740 CY007948 CY008229 CY008421 CY008749 CY007516 CY007748 CY007956 CY008237 CY008429 CY008757 CY007524 CY007756 CY007964 CY008245 CY008437 CY008765 CY007532 CY007764 CY007988 CY008253 CY008445 CY008773 CY007540 CY007772 CY007996 CY008261 CY008477 CY008781 CY007548 CY007780 CY008004 CY008269 CY008485 CY008789 CY007556 CY007788 CY008012 CY008277 CY008493 CY008797 CY007564 CY007796 CY008020 CY008285 CY008501 CY008805 CY007572 CY007804 CY008028 CY008293 CY008509 CY008821 CY007580 CY007812 CY008036 CY008301 CY008541 CY008829 CY007588 CY007820 CY008044 CY008309 CY008549 CY008837 CY007596 CY007828 CY008052 CY008317 CY008557 CY008845 CY007604 CY007844 CY008060 CY008325 CY008565 CY008853 CY007652 CY007852 CY008068 CY008341 CY008573 CY008861 CY007660 CY007860 CY008076 CY008333 CY008581 CY009021 CY009029 CY009581 CY010141 CY010413 CY015054 DQ064395 CY009037 CY009589 CY010149 CY010421 CY015074 DQ064396 CY009045 CY009597 CY010157 CY010429 CY015082 DQ064397 CY009077 CY009621 CY010165 CY010437 CY015097 DQ064398 CY009085 CY009757 CY010173 CY010445 CY015109 DQ064399 CY009093 CY009765 CY010181 CY010453 CY015116 DQ064402 CY009101 CY009789 CY010189 CY010461 CY015152 DQ064403 CY009109 CY009797 CY010197 CY010469 CY015444 DQ064404 CY009117 CY009805 CY010205 CY010477 CY016125 DQ064405 CY009133 CY009813 CY010213 CY010549 CY016277 DQ064406 CY009141 CY009821 CY010221 CY010557 CY016285 DQ064407 CY009149 CY009829 CY010229 CY010765 CY016293 DQ083661 CY009157 CY009845 CY010237 CY010773 CY016301 DQ083665 CY009165 CY009853 CY010245 CY010781 DQ009919 DQ083666 CY009181 CY009861 CY010253 CY011065 DQ021745 DQ083668 CY009189 CY009877 CY010261 CY011081 DQ021746 DQ083669 CY009197 CY009885 CY010269 CY011089 DQ021758 DQ083670 CY009213 CY009933 CY010277 CY011409 DQ064381 DQ083671 CY009221 CY009941 CY010285 CY011777 DQ064382 DQ083672 CY009229 CY009949 CY010293 CY011785 DQ064383 DQ083675 CY009277 CY009957 CY010301 CY012433 DQ064384 DQ083678 CY009389 CY009965 CY010309 CY013241 DQ064385 DQ083679 CY009397 CY009973 CY010317 CY014672 DQ064386 DQ083682 CY009413 CY009981 CY010325 CY014822 DQ064387 DQ083686 CY009421 CY010085 CY010333 CY014881 DQ064388 DQ083687 CY009437 CY010093 CY010341 CY014910 DQ064389 DQ083688 CY009533 CY010101 CY010349 CY015007 DQ064390 DQ083690 CY009541 CY010109 CY010365 CY015015 DQ064391 DQ083692 CY009549 CY010117 CY010381 CY015020 DQ064392 DQ083697 CY009557 CY010125 CY010389 CY015028 DQ064393 DQ094252 CY009573 CY010133 CY010397 CY015034 DQ064394 DQ094255 DQ094256 DQ094270 DQ095642 DQ320961 DQ320999 DQ376656 DQ094257 DQ095632 DQ095643 DQ320964 DQ321000 DQ376657 DQ094258 DQ095633 DQ095644 DQ320976 DQ321003 DQ376658 DQ094259 DQ095635 DQ095645 DQ320992 DQ321006 DQ376659 DQ094260 DQ095636 DQ095646 DQ320993 DQ323678 DQ376660 DQ094261 DQ095637 DQ236084 DQ320994 DQ351858 DQ376662 DQ094262 DQ095638 DQ237951 DQ320995 DQ351859 DQ376664 DQ094263 DQ095639 DQ320942 DQ320996 DQ351860 DQ376666 DQ094264 DQ095640 DQ320959 DQ320997 DQ366333 DQ376667 DQ094265 DQ095641 DQ320960 DQ320998 DQ376655 DQ376668 DQ376669 DQ376689 DQ492913 DQ492939 DQ492979 DQ997179 DQ376670 DQ449633 DQ492915 DQ492940 DQ508828 DQ997226 DQ376671 DQ482663 DQ492916 DQ492943 DQ508836 DQ997304 DQ376672 DQ482664 DQ492917 DQ492948 DQ643985 DQ997457 DQ376673 DQ482665 DQ492918 DQ492952 DQ650660 DQ997473 DQ376674 DQ485211 DQ492920 DQ492953 DQ650664 DQ997488 DQ376675 DQ485219 DQ492921 DQ492954 DQ676831 DQ997498 DQ376676 DQ485227 DQ492922 DQ492956 DQ676835 DQ997512 DQ376677 DQ492903 DQ492923 DQ492957 DQ676839 FLAM1A DQ376678 DQ492904 DQ492925 DQ492959 DQ849018 FLAM1M2A DQ376679 DQ492905 DQ492926 DQ492961 DQ997086 FLAM2C DQ376680 DQ492906 DQ492927 DQ492964 DQ997099 IAU49119 DQ376683 DQ492907 DQ492928 DQ492967 DQ997108 IAU65564 DQ376684 DQ492909 DQ492929 DQ492971 DQ997119 IAU65571 DQ376686 DQ492911 DQ492930 DQ492973 DQ997124 IAU65574 DQ376688 DQ492912 DQ492937 DQ492975 DQ997138

    TABLE-US-00004 TABLE 4 B/Aichi/5/88 (1142) B/Ann Arbor/1/1986 (1155) B/Bangkok/460/03 (1074) B/Barcelona/215/03 (1088) B/Beijing/184/93 (1096) B/Bucharest/795/03 (1087) B/England/23/04 (1053) B/Hong Kong/05/1972 (1154) B/Hong Kong/330/2001 (1190) B/Houston/1/91 (1079) B/Ibaraki/2/85 (1141) B/Jiangsu/10/03 (1059) B/Lee/40 (1191) B/Los Angeles/1/02 (1076) B/Memphis/13/03 (1076) B/Nanchang/6/96 (1076) B/Oslo/71/04 (1095) B/Panama/45/90(1139) B/Singapore/222/79 (1187) B/Trento/3/02 (1077) B/Victoria/504/2000 (1190) B/Yamagata/1/73 (1188) B/Yamagata/K519/2001 (1076) AB036878 AF100375 AF100377 AF100380 AF100381 AF100382 AF100383 AF100384 AF100385 AF100386 AF100387 AF100388 AJ783377 AJ783379 AJ783381 AJ783382 AJ783383 AJ783384 AJ783386 AJ783387 AJ783388 AJ783392 AJ783393 AJ783394 AJ783395 AY260941 AY260955 AY504613 AY504621 AY581971 AY581982 AY581983 AY687399 DQ508916 DQ508924 FLBMO NC_002210

    TABLE-US-00005 TABLE 5 A/Bayern/7/95 C.sub.t C.sub.t C.sub.t C.sub.t Super- Cepheid Quantitect Virus script Influenza Virus TCID50/mL (Field-Test) III A/B Primer and Dilution (8.1) 3-step 2-step Platinum Probe Set ASR undiluted 125.892.541 14.26 13.05 12.43 15.76 1:10 12.589.254 17.49 16.18 15.96 18.52 1:100 1.258.925 20.70 19.92 20.29 22.14 1:1000 125.893 24.50 22.77 23.22 25.23 1:10000 12.589 27.72 26.55 26.31 28.96 1:100000 1.259 31.12 30.14 29.25 33.26 1:1000000 126 35.57 36.68 32.99 0.00

    TABLE-US-00006 TABLE 6 B/Baden-Wrttemberg/3/06 C.sub.t C.sub.t C.sub.t C.sub.t Super- Cepheid Quantitect Virus script Influenza Virus TCID50/mL (Field-Test) III A/B Primer and Dilution (7.9) 3-step 2-step Platinum Probe Set ASR Undiluted 79.432.823 15.47 14.49 13.59 16.91 1:10 7.943.282 18.61 18.10 16.99 19.45 1:100 794.328 22.20 21.32 20.96 23.29 1:1000 79.433 25.28 24.27 24.66 27.10 1:10000 7.943 28.92 28.11 28.16 30.96 1:100000 794 0.00 31.54 31.07 0.00 1:1000000 79 0.00 36.96 34.77 0.00 1:10000000 8

    TABLE-US-00007 TABLE 7 A/Bayem/7/95 A/New Caledonia/20/99 B/Brisbane/60/2008 A/Brisbane/59/2007 IVR 148 A/PR/8/34 B/BadenWuerttemberg/3/2006 A/Brisbane/10/2007 IVR 147 A/Solomon Islands/03/2006 B/Florida/04/2006 A/California/04/2009 A/Uruguay 716/07 X-175C B/Fujian/1272/2008 A/California/07/2009 X179A A/Uruguay/716/07 B/Lee/40 A/HH/01/2009 A/Wisconsin/67/2005 B/Malaysia/2506/2004 A/HK/8/68 B/Bangladesh/3333/2007 B/Perth/210/2008 A/Mexiko/4108/2009 B/Brisbane/33/2008