RNA FOR USE IN THE TREATMENT OF LIGAMENT OR TENDON LESIONS
20190381193 · 2019-12-19
Inventors
Cpc classification
A61K9/0019
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
A61K48/0075
HUMAN NECESSITIES
A61K38/1875
HUMAN NECESSITIES
A61K48/0016
HUMAN NECESSITIES
A61K48/0066
HUMAN NECESSITIES
A61K48/005
HUMAN NECESSITIES
International classification
A61K48/00
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
Abstract
Described is a liquid composition containing naked RNA, such as mRNA encoding a polypeptide, for use in the treatment or prevention of ligament or tendon lesions as well as a method for treating ligament or tendon lesions comprising the administration of a liquid composition containing naked RNA, such as mRNA encoding a polypeptide, which is beneficial in the process of healing the ligament or tendon lesions.
Claims
1. A liquid composition containing naked RNA for use in the treatment or prevention of ligament or tendon lesions.
2. The composition for use of claim 1, wherein the RNA is mRNA encoding a polypeptide.
3. The composition for use of claim 2, wherein the polypeptide is a polypeptide which is therapeutically active in the healing process of ligament or tendon.
4. The composition for use of any one of claims 1 to 3, wherein the RNA is solved in water, or a buffered or unbuffered aqueous solution.
5. The composition for use of claim 4, wherein the aqueous solution is a NaCl solution or a Ringer's solution.
6. The composition for use of claim 4, wherein the buffered aqueous solution is a buffered glucose solution.
7. The composition for use of claim 6, wherein the buffered glucose solution is a HEPES buffered glucose solution.
8. The composition for use of any one of claims 1 to 7, wherein the concentration of the RNA in the composition is between 0.1 to 5.0 g/l.
9. The composition for use of any one of claims 1 to 8, wherein the composition is administered to the ligament or tendon by injection.
10. The composition for use of claim 9, wherein the injection is done by a syringe with a needle having a diameter in the range of 20 G to 27 G.
11. The composition for use of any one of claims 1 to 10, wherein the RNA is mRNA and wherein the polypeptide encoded by the mRNA is selected from the group consisting of platelet-derived growth factor (PDGF), basic fibroblast growth factor (bFGF), insulin-like growth factor 1 (IGF-1), transforming growth factor 1 (TGF-1), epidermal growth factor (EGF), a GDF, Early growth response protein-1 (Egr1), Early growth response protein-1 (Egr2), Scleraxis (SCX) and bone morphogenetic protein (BMP).
12. The composition for use according to claim 11, wherein the GDF is GDF 5, 6 (BMP-13), 7 (BMP-12), myostatin (GDF-8).
13. The composition for use according to claim 11, wherein the BMP is BMP-7.
14. The composition for use according to any one of claims 1 to 13, wherein said liquid composition is to be administered before or during the inflammatory phase which follows the said ligament or tendon lesions.
15. A therapeutic composition containing RNA which is therapeutically active in the healing process of ligament or tendon.
16. The therapeutic composition of claim 15 wherein the RNA is mRNA which encodes a polypeptide which is therapeutically active in the healing process of ligament or tendon.
17. The therapeutic composition of claim 16, wherein the composition is in liquid form and the mRNA is present as naked RNA.
18. The therapeutic composition of claim 17, which is a buffered glucose solution containing the mRNA in naked form.
Description
FIGURE LEGENDS
[0064] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092] In this specification, a number of documents including patent applications are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
[0093] The invention will now be described by reference to the following examples which are merely illustrative and are not to be construed as a limitation of the scope of the present invention.
EXAMPLES
Methodology of Ex Vivo Experiments (Especially Pertaining to Examples 1 to 9)
[0094] Tendon Harvest and Preparation Tendon tissue of either slaughtered or euthanized animals were harvested within one hour post mortem and rinsed in ice cold Dulbecco's PBS (1) containing 1% Penicillin/Streptomycin twice. Deep digital flexor tendons derived from cattle, horses or sheep and Achilles tendons derived from rats or pigs. Connective tissue was removed and major tendons were cut into slices (0.5 cm3 cm).
RNA Synthesis
[0095] A codon optimized DNA sequence (e.g. SEQ ID No. 2) with known flanking sequences was cloned into a standard expression vector for in vitro mRNA production. To generate the template for in vitro transcription, the plasmid was linearized downstream of the poly (A) tail and purified using chloroform extraction and sodium acetate precipitation as described by Sambrook et al. (Sambrook, J., Fritsch, E. F., and Maniatis, T (1989) in Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, N.Y. Vol 1, 2, 3). Complete linearization of plasmid template was confirmed by 1% agarose gel electrophoresis. In vitro transcription was carried out with RiboMAX Large Scale RNA Production SystemT7 (Promega, Germany) at 37 C. following the manufacturer's protocol. For in vitro transcription of chemically modified mRNA (cmRNA) 25% cytidine-5-triphosphate and 25% uridine-5-Triphosphate were replaced by 5-methylcytidine-5-triphosphate (TriLink, USA) and 2-thiouridine-5-triphosphate (TriLink, USA), respectively, in the reaction mixture (for more details see WO 2011/012316). Purification of mRNA was performed by chloroform extraction and size exclusion chromatography.
Ex Vivo Transfection and Cultivation
[0096] mRNA was diluted in different solvents and different concentrations before the injection was performed slowly in parallel direction of the tendon fibers by using a 23 G needle for major tendons and 30 G insulin syringes for rat Achilles tendons. Transfected tendon slices were stored in tissue culture flasks with vented caps in DMEM (1)+GlutaMAX medium containing 1% Penicillin/Streptomycin, 2% Nystatin and 10% FBS at 37 C. and 5% CO.sub.2 immediately after SNIM-RNA (WO 2011/012316) injection. Four to five samples were stowed per flask.
Bioluminescence Measurement
[0097] Firefly Luciferase (FFL) is a common reporter protein that is not endogenously present in mammals and can be detected easily by luminescent imaging. Luciferase catalyses the reaction of luciferin and oxygen which results in bioluminescence emission.
[0098] Bioluminescence was measured at indicated time points (24 h, 48 h, 72 h, 168 h) using a Xenogen IVIS In-Vivo Imaging System 100 (Caliper Life Science, USA). D-Luciferin substrate diluted in Dulbecco's PBS (1) was added to the cell culture flasks (100 g D-Luciferin/ml medium) one hour prior to the measurement of luciferase activity. The measurement was operated in the field of view A with high sensitivity (Binning 16) and an exposure time of 1 minute. Living Image 2.50 software was used for analysis.
Betagalactosidase (LacZ) Staining
[0099] Betagalactosidase is another common reporter protein used for analysis of gene expression. The cleavage of XgaI substrate results in a blue precipitate. Tendon slices were injected with 100 g modified LacZ-RNA dissolved in 250 l isotonic saline. LacZ staining was performed 24 hours post injection.
BMP7 Immunohistochemistry
[0100] Rat Achilles tendons were injected with 30 g modified BMP-7-mRNA (25% 2-thiouridine, 25% 5-methylcytidine) dissolved in 40 l 1 concentrated HEPES-buffered glucose (HBG, 25 mM HEPES, glucose 5% m/v) pH 7.4. After 24 hours of incubation tendons were embedded in Tissue-Tek, deep frozen in liquid nitrogen and stored at 80 C. Cryosectioning and Immuno-histochemistry were performed by Sophistolab AG (Muttenz, Switzerland).
Radioisotopic Imaging
[0101] I.sup.125 marked mRNA was injected into porcine tendon (Pierce Iodination Tubes). Measurement was performed with 11 Binning, FOV 10 and an exposure time of 1 min by using an In-Vivo Xtreme BI 4MP, X-ray System (Bruker).
[0102] The following Examples 1 to 9 represent ex vivo experiments.
Example 1: Comparison of Bioactivity of Naked mRNA with Lipid- and Polymer-Complexed mRNA after Injection into Bovine and Ovine Tendon Explants
[0103] 50 g of naked modified mRNA encoding firefly luciferase (FFL) (25% 2-thiouridine, 25% 5-methylcytidine) was injected into five bovine or ovine tendon explants, respectively, and compared with modified FFL mRNA complexed with DreamFect.sup.FM Gold (4 l/1 g RNA, bovine tendon explants) or branched PEI 25 kDa (N/P=10, ovine tendon explants). The results of this experiment are shown in
[0104] Luciferase expression of naked modified FFL mRNA was 295.5-fold higher than for DreamFect.sup.FM Gold and 122.5-fold higher than for branched PEI. The results of this experiment are shown in
Example 2: Bioactivity of Naked mRNA in Tendon Explants of Different Species
[0105] Modified FFL-mRNA (25% 2-thiouridine, 25% 5-methylcytidine) was injected in tendon explants derived from rats, cattle, sheep, horses and pigs. Either 30 g (rat tendons), 50 g (bovine, ovine and porcine tendons) or 100 g (equine and ovine tendons) of modified FFL-mRNA was injected. The results are shown in
Example 3: Expression kinetics of different mRNA at different doses
[0106] 200 g, 100 g, 50 g, 25 g and 12.5 g modified FFL-mRNA (25% 2-thiouridine, 25% 5-methylcytidine) were dissolved in 250 l isotonic saline. Bioluminescence was measured at determined time points (24 h, 48 h, 72 h, 168 h). The results are shown in
Example 4: Comparison of Different Solvents Used for Naked mRNA Injection into Tendon Explants
[0107] 50 g modified FFL-mRNA (25% 2-thiouridine, 25% 5-methylcytidine) was dissolved in 200 l (c=0.25 mg/ml) of different solvents and injected into five tendon explants per group. The results are shown in
Example 5: Comparison of Modified FFL-mRNA Dissolved in Isotonic Saline, Water for Injection and HEPES Buffered Glucose (HBG 1)
[0108] 50 g modified FFL-mRNA (25% 2-thiouridine, 25% 5-methylcytidine) was dissolved in 100 l (c=0.5 mg/ml) of HBG pH 7.4 (1; 25 mM HEPES, glucose 5%), isotonic saline and water for injection (WFI) and injected into eight bovine tendon explants. Expression was highest in HEPES buffered glucose. The results are shown in FIG. 5. After 24 hours bioluminescence levels were 6.3-fold higher when modified FFL-mRNA was dissolved in HBG pH 7.4 (1) compared to modified FFL-mRNA dissolved in isotonic saline and 7.8-fold higher compared to modified FFL-mRNA dissolved in WFI. After 48 hours the expression was 9-fold higher by using HBG pH 7.4 (1) compared to isotonic saline and 11-fold higher compared to WFI.
Example 6: Comparison of Different HBG Concentrations
[0109] 50 g modified FFL-mRNA (25% 2-thiouridine, 25% 5-methylcytidine) was dissolved in 100 l (c=0.5 mg/ml) of 0.5, 0.75, 1 or 2 concentrated HBG pH 7.4 and was injected into five bovine tendon explants. The results are shown in
Example 7: Comparison of Different Modified FFL-mRNA Amounts
[0110] 50 g and 100 g modified FFL-mRNA (25% 2-thiouridine, 25% 5-methylcytidine) were dissolved in 100 l HBG pH 7.4 (1) and injected into ovine tendon explants. The results are shown in
Example 8: Comparison of Different mRNA Concentrations
[0111] 50 g modified FFL-mRNA (25% 2-thiouridine, 25% 5-methylcytidine) was dissolved in 100 l (c=0.5 mg/ml) and in 200 l (c=0.25 mg/ml) HBG pH 7.4 (1) and injected into bovine tendon explants. The results are shown in
Example 9: Comparison of Different Needle Sizes that were Used for Injection in Ovine Tendon Explants
[0112] The injection was performed with either 21 G, 23 G, 26 G, 27 G or 30 G needles. The results are shown in
[0113] The following Example 10 represents in vivo experiments.
Example 10: Luciferase Expression in Intact and Damaged Ovine Tendons
Methodology of In Vivo Experiments
Tendon Defect Induction
[0114] Either 500, 200 or 100 CDU (collagen digestion units) of collagenase type 1A was injected into the deep digital flexor tendons (hind limb) of mature female Merino sheep. The injection was performed under ultrasound guidance.
In Vivo Transfection and Tendon Harvest
[0115] Six days after the collagenase injection modified FFL-mRNA (25% 2-thiouridine, 25% 5-methylcytidine) diluted in HBG pH 7.4 (1) was injected into healthy and damaged deep digital flexor tendons. Modified FFL-mRNA (250 g) was applied in two separate injections of 150 l (proximal and distal of the defect) under ultrasound guidance.
[0116] On the next day tendons were harvested within one hour post euthanasia. Connective tissue and tendon sheath was removed.
Bioluminescence Measurement
[0117] Harvested tendons were immediately incubated in D-luciferin-solution (100 g D-luciferin/ml PBS (1)) at 37 C. and 5% CO.sub.2 for one hour before bioluminescence imaging was performed by using a Xenogen IVIS In-Vivo Imaging System 100 (Caliper Life Science, USA)
[0118] The measurement was operated in the field of view A with high sensitivity (Binning 16) and an exposure time of 1 minute. Living Image 2.50 software was used for analysis.
[0119] The results are shown in
Example 11: LacZ Expression in Ovine Tendons
[0120] Tendon explants were injected with 100 g modified LacZ-RNA dissolved in 250 l isotonic saline. LacZ staining was performed 24 hours post injection. The cleavage of XgaI substrate results in a blue precipitate. Untreated ovine tendon explants were used as controls. The results are shown in
Example 12: BMP-7 Expression in Rat Tendons
[0121] Rat Achilles tendons were injected with 30 g chemically modified BMP-7-mRNA (25% 2-thiouridine, 25% 5-methylcytidine; SEQ ID NO. 3) dissolved in 40 l 1 concentrated HEPES-buffered glucose (HBG, 25 mM HEPES, glucose 5% m/v) pH 7.4. After 24 hours of incubation tendons were embedded in Tissue-Tek, deep frozen in liquid nitrogen and stored at 80 C. Cryosectioning and BMP-7 immunohistochemistry was performed. The results are shown in
Example 13: Imaging of Radioisotopically Labeled mRNA
[0122] I.sup.125 marked mRNA was injected into porcine tendon (Pierce Iodination Tubes). Measurement was performed with 11 Binning, FOV 10 and an exposure time of 1 min by using an In-Vivo Xtreme BI 4MP, X-ray System (Bruker) 30 min after injection. The results are shown in
Further Materials and Methods (Especially Pertaining to Examples 14 to 18)
Ex Vivo Transfection, Cultivation and Bioluminescence Imaging
[0123] Deep Digital Flexor Tendons (DDFT) derived from horses, cattle, sheep or pigs and Achilles tendons derived from rats. Tendons were harvested within one hour after animals had been euthanized (horses, sheep, rats) or slaughtered (pigs and cattle) and rinsed twice in ice cold Dulbecco's phosphate-buffered saline (DPBS) (Life Technologies GmbH Darmstadt, Germany) containing 1% penicillin/streptomycin (PAA Laboratories GmbH Pasching, Austria). Chemically modified naked mRNA either encoding for luciferase (cmRNA.sup.LUC), -galactosidase (cmRNA.sup.LacZ) or human bone morphogenetic protein 7 (cmRNA.sup.BMP-7 (25% 2-thiouridine, 25% 5-methylcytidine); SEQ ID NO. 3) was diluted in different solvents and different concentrations. Injection of cmRNA was performed in parallel direction of tendon fibers using 23 G needles (Sterican, B.Braun Melsungen AG, Germany) and 1 ml Injekt-F syringes (B.Braun Melsungen AG, Germany) for major tendons and 30 G Insulin syringes (BD Micro-Fine, Becton, Dickinson and Company, Franklin Lakes, USA) for rat Achilles tendons. The cmRNA.sup.LUC was diluted in different solvents and prepared using commercially available solutions and standard laboratory chemicals (Table 2). Hepes-buffered-glucose (HBG) (Sigma-Aldrich Chemie Schnelldorf, Germany) was adjusted to pH 7.4 and prepared in four different concentrations, namely 2.5%, 3.75%, 5% and 10%. The cmRNA.sup.LacZ and the cmRNA.sup.BMP-7 were prepared in saline solution only. Complexed cmRNA.sup.LUC was prepared using Dreamfect.sup.FM Gold (OZ Biosciences Marseille, France) as recommended by the manufacturer (10 g cmRNA.sup.LUC/40 l Dreamfect.sup.FM Gold) and using branched polyethyleneimine (brPEI) 25 kDa (Sigma-Aldrich Schnelldorf, Germany) at an N/P-ratio of 1:10 using 25 g cmRNA.sup.LUC.
[0124] Transfected tendon specimen were stored in T75 tissue culture flasks (TPP Trasadingen, Switzerland) in 50 ml DMEM (1)+GlutaMAX medium (Life Technologies Darmstadt, Germany) containing 1% penicillin/streptomycin (PAA Laboratories GmbH Pasching, Austria), 2% nystatin (Sigma-Aldrich Chemie Schnelldorf, Germany) and 10% FBS (Life Technologies Darmstadt, Germany) at 37 C. and 5% CO.sub.2 immediately after cmRNA injection.
[0125] Bioluminescence imaging (BLI) was conducted at determined points of time, namely 24, 48 and 72 hours after transfection, using a Xenogen IVIS In-Vivo Imaging System 100 (Caliper Life Science, USA). D-Luciferin substrate (S039, SYNCHEM, Felsberg/Altenburg, Germany) diluted in Dulbecco's PBS (1) was added to the cell culture flasks (100 g D-Luciferin/ml medium) one hour prior to the measurement of luciferase activity. The measurement was operated in the field of view A with high sensitivity (Binning 16) and an exposure time of one minute. Living Image 2.50 software was used for data analysis.
Histological Processing of Ex Vivo Cultivated Tendon Explants
[0126] Staining for -galactosidase activity was performed 24 hours after the corresponding cmRNA was injected according to the protocol of Dai et al. (Journal of orthopaedic research: official publication of the Orthopaedic Research Society. 2003; 21:604-9). Tendon specimen were fixed on ice for 30 minutes in 0.5% glutardialdehyde (Carl Roth Karlsruhe, Germany) and 2 mM magnesium chloride hexahydrate (Carl Roth Karlsruhe) in DPBS, adjusted to pH 7.4 and subsequently washed twice in rinsing buffer (100 mM HEPES, 5 mM DTT (Dithiotreitol, Sigma-Aldrich Chemie Schnelldorf, Germany), 1 mM MgSO.sub.4 (Magnesium sulfate heptahydrate, Carl Roth Karlsruhe), 2% Triton X-100 (Carl Roth Karlsruhe), pH 8.0) at room temperature for 30 minutes and then rinsed at 50 C. for one hour. Tendon specimen were subsequently incubated in X-Gal staining solution (1 mg/ml 5-Bromo-4-Chloro-3-indolyl 3, Sigma-Aldrich Chemie), 2 mM MgCl.sub.2, 5 mM K.sub.3Fe(CN).sub.6 (Potassium ferricyanide (III), Carl Roth Karlsruhe), 5 mM K.sub.4Fe(CN).sub.6 (Potassium hexacyanoferrate(II) trihydrate, Carl Roth Karlsruhe) in DPBS, pH 7.4) overnight in a non-CO.sub.2 incubator. Finally tendons were fixed in 4% formaldehyde (Roti Histofix, Carl Roth Karlsruhe), dehydrated, embedded in paraffin and counterstained for hematoxylin.
[0127] For BMP-7 immunohistochemistry (IHC) tendons were embedded in Tissue-Tek O.C.T. Compound (Sakura Finetek Staufen, Germany), snap frozen in liquid nitrogen and stored at 80 C. Cryosections were prepared and immunohistochemistry was performed by an external laboratory (Sophistolab AG Muttenz, Switzerland) using a rabbit polyclonal BMP-7 antibody (ab56023, abcam plc Cambridge, UK) as primary antibody.
In Vivo Studies in Intact and Injured Rat Achilles Tendons
[0128] All experiments were approved by the local ethics committee for animal experiments and adhered to the international guidelines for the care and treatment of laboratory animals. Female Sprague Dawley rats (4 month of age, bodyweight between 300 g and 340 g, Janvier Labs Saint-Berthevin, France) were group-housed under a 12:12 h light-dark circle with food and water ad libitum. 16 rats were used for Luciferase reporter protein kinetics in intact Achilles tendons and 24 rats were used to test the therapeutic potential of BMP-7 in injured Achilles tendons.
[0129] To determine Luciferase reporter protein expression in intact rat Achilles tendons, animals were anesthetized using isoflurane inhalation with air and O.sub.2 as carrier gases (isoflurane 3-5 vol % in an inhalation chamber for induction followed by 1.5-2.5 vol % using an inhalation mask for maintenance). Different doses of cmRNA.sup.LUC (0, 10, 20, 40 g; dose volume 10 l) were then injected into the right Achilles tendon (n=4 rats/dose group). At day 1, 2 and 7 post cmRNA.sup.LUC injection in vivo bioluminescence imaging was performed using Photon Imager (Biospace Lab Nesles la Valle, France). BLI was conducted 15 minutes after D-Luciferin substrate (L-8220 dissolved in 0.9% saline, Biosynth Staad, Switzerland) was administered intraperitoneally (150 mg/kg, 5 ml/kg). Images were acquired using 10 minutes of integration time. No filter was used. Quantification was performed using a region of interest defined manually (Achilles tendon) and the results were expressed as total counts. M.sup.3Vision software (Biospace Lab, Nesles la Valle, France) was used for data analysis. On day 7, rats were sacrificed with CO.sub.2, Achilles tendons were explanted immediately and Luciferase activity was measured again in tendon explants.
[0130] Therapeutic cmRNA.sup.BMP-7 (25% 2-thiouridine, 25% 5-methylcytidine; SEQ ID NO. 3) was applied directly into injured, i.e. dissected and surgically repaired Achilles tendons to investigate the influence on early tendon healing. Prior to surgery rats received a subcutaneous (sc.) injection of 0.05 mg/kg buprenorphine (Temgesic, Reckitt Benckiser Wallisellen, Switzerland). Surgery was performed under inhalation anesthesia as described above. The left leg was prepared for aseptic surgery and then fixed in a custom-made holder to stabilize the ankle at a 90 position with the foot facing downwards. An incision was made above the left Achilles tendon. The superficial Achilles tendon was exposed and was fully dissected in the midportion between the calcaneus side and the muscle insertion. The Plantaris tendon was left intact. An end-to-end anastomosis of the Achilles tendon stumps was then performed applying a Three Loop Pulley pattern suture using a non-absorbable monofil filament (Prolene 5-0, reverse cutting needle P3, Ethicon, Johnson & Johnson Medical, Norderstedt, Germany). Subsequently, either cmRNA.sup.BMP-7 (100 g) or vehicle was administered intra-tendinously proximal and distal to the anastomosis with a dose volume per injection site of 5 l (BD Micro-Fine 30 G Insulin Syringes, Becton, Dickenson and Company, Franklin Lakes, USA). The subcutaneous layer and the skin were then closed by a continuous suture technique with an interrupted intracutaneous suture using an absorbable synthetic thread (Safil 6-0, B. Braun Melsungen AG, Germany). Animals were then allowed to wake up on a heating pad to aid the return to normal body temperature. Buprenorphine was again administered every 8-12 h post-surgery for up to two days.
[0131] On day 1, 2, and 7 post-surgery each 4 cmRNA.sup.BMP-7-treated and 4 vehicle-treated rats were sacrificed with CO.sub.2 and both injured and intact contralateral Achilles tendons were explanted. Achilles tendons were fixed overnight in 4% paraformaldehyde (Sigma-Aldrich Chemie Buchs, Switzerland), dehydrated with an ascending ethanol series, and embedded in paraffin (Paraplast Xtra, Leica Wetzlar, Germany). For immunohistochemistry Anti-BMP-7 antibody (ab56023, abcam plc Cambridge, UK), polyclonal Anti-Collagen I antibody (ab 34710, abcam plc Cambridge, UK) and polyclonal Anti-Collagen III antibody (ab7778, abcam plc Cambridge, UK) were used as primary antibodies. Biotinylated Goat Anti-Rabbit IgG (BA-1000, Vector Laboratories, Peterborough, UK) were used as secondary antibodies. Staining was induced by peroxidase (biotin-labeled) activity. Sections were counterstained with hematoxylin (VWR International, Dietikon, Switzerland). DAB staining in microscopic images was thresholded and mean gray values of positive pixels were evaluated. Analysis was performed with Fiji/Image J Version 1.49k.
In Vivo Studies in an Ovine Model of Acute Tendon Injury
[0132] All experiments were approved by the local ethics committee for animal experiments and adhered to the international guidelines for the care and treatment of laboratory animals. For large animal experiments, nine female mature Merino sheep, 4-7 years of age, bearing between 72 kg and 87 kg, were group housed under a 12:12-h light-dark circle. Hay and water was provided ad libitum. All large animals had no clinical or ultrasonographic evidence of tendon injury.
[0133] For tendon defect induction a collagenase-gel model was chosen (Watts, Equine veterinary journal. 2012; 44:576-86; Smith, Equine veterinary journal. 2014; 46:4-9). The metatarsal area of both hind limbs was clipped, shaved and aseptically prepared before either 500, 200 or 100 collagen digestion units (CDU) of collagenase type 1A (from Clostridium histolyticum C0130, Sigma-Aldrich Chemie Schnelldorf, Germany) were injected into the Deep Digital Flexor Tendon (DDFT) of the left hind limb. Collagenase was diluted in Dulbecco's PBS (1), filter sterilized and merged with 50 l of thrombin solution (Component 2, Tissucol Duo S Immuno, Baxter UnterschleiRheim, Germany). The injection was performed with a lateral approach in the mid-tarsal area under ultrasound guidance (Mindray DP 50 vet; Sonoring Schmitt-Haverkamp, Germany) using a 23 gauge needle and a Duploject system (Baxter Germany) in which the collagenase-thrombin-solution was combined with 50 l fibrinogen-solution (Component 1, Tissucol Duo S Immuno, Baxter Germany) during injection.
[0134] Antibiotics (Veracin compositum 3 ml/50 kg, Albrecht, Aulendorf, Germany) were administered intramuscularly every second day for five days. 0.3 mg Buprenorphin-hydrochloride (Buprenovet Multidose 0.3 mg/ml, Bayer HealthCare, Leverkusen, Germany) was applied subcutaneously every twelve hours for two days and Ketoprofen 3 mg/kg (Romefen PR 10%, Merial, Hallbergmoos, Germany) every twenty-four hours for five days as analgesics. Frequent ultrasound and daily clinical examination was performed by two veterinarians. A portable Mindray DP 50 vet ultrasound machine (Sonoring Schmitt-Haverkamp, Germany) with a linear probe (5-12 MHz) was used. Ultrasound examinations were performed with the sheep bearing weight on the examined foot. Diameter of the DDFT was measured in the mid-tarsal area, 2 cm below the applied suture. External thickness was measured from medial to lateral in the same mid-tarsal area by using a digital caliper in group treated with 100 CDU.
[0135] Six days after collagenase injection, cmRNA.sup.LUC diluted in HBG 5% was injected into healthy and damaged deep digital flexor tendons of both hind limbs. Procedure was again performed under general anesthesia. The cmRNA.sup.LUC was applied in two separate injections of 100 g (500 CDU group, n=2), 200 g (200 CDU group, n=2) or 250 g (100 CDU group, n=2) cmRNA (proximal and distal area of the defect) under ultrasound guidance. Some air was drawn in the syringe and injected in the end of the injection to ensure that syringe and needle were emptied completely. Ketoprofen 3 mg/kg (Romefen PR 10%) was administered intravenously during anesthesia.
[0136] On the next day, the sheep were euthanized by an intravenous overdose of pentobarbital (Euthadorm, CP-Pharma, Burgdorf, Germany) and tendons were harvested within one hour post euthanasia. Connective tissue and tendon sheath was removed. Harvested tendons were immediately incubated in D-Luciferin-solution (100 g D-Luciferin/ml PBS (1)) at 37 C. and 5% CO.sub.2 for one hour before bioluminescence imaging was performed by using a Xenogen IVIS in-vivo Imaging System 100 (Caliper Life Science, USA). The measurement was operated in the field of view A with high sensitivity (Binning 16) and an exposure time of one minute. Living Image 2.50 software was used for the analysis. Tendons were fixed in 4% paraformaldehyde for 24 hours, dehydrated with an ascending ethanol series, and embedded in paraffin. In intact tendons five parts of cmRNA.sup.LUC injected area were chosen, as well as parts 3 cm proximal and distal to the injection site. In injured tendons central and peripheral areas of the defect were selected. 3 m sections were stained with hematoxylin and eosin for histopathological examination.
[0137] Blood was taken on day 0, day 6 (before mRNA application) and day 7 (before euthanasia) and full blood count as well as liver and kidney test values were analyzed by an external veterinary laboratory.
Statistical Analysis
[0138] All statistical analyses were performed with GraphPad Prism 5. Results are presented as the meanSEM, with n equal to the number of samples per group. Differences between groups were analyzed for significance using Mann Whitney U test, with significance attained at p<0.05. Results in
Example 14: Injection of Naked cmRNA Results in High Protein Expression in Tendon Explants
[0139] Naked cmRNA dissolved in saline solution was injected into tendon explants to investigate, whether chemically modified messenger RNAs could transfect tendon tissue thereby resulting in the expression of therapeutic protein(s). An initial ex vivo experiment was conducted in explanted porcine tendons. Tendon tissue was transfected through direct injection of cmRNA.sup.LUC following which, the explants were then incubated (24 hours, 37 C., 5% CO.sub.2) and luciferase activity was measured subsequently. Using this methodology, Luciferase expression was detected in specimen injected with cmRNA.sup.LUC, but not in untreated control tendons or in tendons injected with saline solution only. Based on these promising findings, further experiments were conducted in explants of different animal species to investigate, whether the concept of ex vivo transfection could be successfully applied to more mammalians. Interestingly, besides expression in porcine tendon explants, injection of naked cmRNA.sup.LUC resulted also in distinct Luciferase expression in explanted tendons of sheep, cattle, horses, and rats (
[0140] In a next set of experiments, dose-dependent expression of Luciferase could be demonstrated in porcine tendons after injection of cmRNA.sup.LUC (
[0141] Encouraging results with reporter genes (Luciferase and -galactosidase) prompted us to investigate the applicability of this technology to produce therapeutic proteins. Human BMP-7 was selected as a therapeutic target, as its potential to increase healing processes due to stimulating effects on tenocytes has been discussed recently (Yeh, Journal of cellular biochemistry. 2008; 104:2107-22; Pauly, Journal of shoulder and elbow surgery/American Shoulder and Elbow Surgeons. 2012; 21:464-73). Further in vivo experiments were intended to be conducted in rats, hence cmRNA encoding for human BMP-7 was injected into rat Achilles tendons and BMP-7 immunohistochemistry (IHC) was performed after a cultivation period of 24 hours.
[0142] Using this methodology, BMP-7 positive signals were found in vascular walls, connective tissue and tenocytes in BMP-7 transfected tendon specimen (
Example 15: Glucose Enhances, Amino-Acids Impair Luciferase Expression in Tendon Explants
[0143] As initial experiments showed strongest expression in bovine tendon tissue it was continued by using bovine tendon explants for further experiments. Investigating expression kinetics, peak expression after 24 hours and clear drop off (2-fold) after 48 hours were observed. At 72 hours post injection, luciferase expression reduced to almost background levels (
[0144] It was further investigated if tendon transfection and transgene expression could be further potentiated via use of different commercially available and/or standard laboratory solutions containing amino acids, electrolytes and/or sugars. It was hypothesized that (1) osmotic gradients may increase intracellular electrolyte influx and thereby intracellular uptake of cmRNA, (2) providing cells with additional amino acids may enhance the translation of cmRNA, (3) precipitating mRNA with ammonium acetate may result in a depot effect thereby enabling relatively long-term expression. Furthermore, colloidal solutions were used to test the influence of large molecules on transfection of tendon tissue. As highest expression levels were observed 24 hours after cmRNA.sup.LUC injection, this point of time was selected for the comparison of different solvents.
[0145] Our results indeed reveal strong influence of the used solvent/electrolyte on the resulting Luciferase expression. This effect was most prominent when comparing electrolyte and/or glucose-containing solutions with solutions containing amino-acids (
[0146] As mRNA application was recently used to be conducted with mRNA formulated in carrier systems, transfection efficacy of cmRNA.sup.LUC complexed with lipid and polymer carriers in different species was furthermore examined. Interestingly, cmRNA.sup.LUC complexed with DreamFect Gold resulted in expression levels only comparable to w/t specimen. Moreover, Luciferase expression was 22-fold lower in tendons treated with cmRNA.sup.LUC complexed with brPEI compared to cmRNA.sup.LUC dissolved in saline solution.
Example 16: Naked Chemically Modified mRNA Efficiently Transfects Intact Rat Achilles Tendons In Vivo
[0147] To test the translation of our ex vivo findings in vivo cmRNA.sup.LUC dissolved in the best performing solution (HBG containing 5% glucose, adjusted to a pH of 7.4) was injected into Achilles tendons of rats at 4 different doses (40, 20, 10 and 0 g). Expression of Luciferase protein was measured by in vivo BLI at 1, 2 and 7 days post injection (
Example 17: Naked cmRNABMP-7 Positively Affects Early Healing in Injured Rat Achilles Tendons In Vivo
[0148] The therapeutic potential of human BMP-7 was investigated in rats on the healing of dissected and surgically repaired Achilles tendons. Histological examination of healing Achilles tendons was performed 1, 2 and 7 days after surgery and injection of mRNA.sup.BMP-7 (25% 2-thiouridine, 25% 5-methylcytidine; SEQ ID NO. 3) or vehicle (HBG 5%).
[0149] Tendon samples were stained for BMP-7 using immunohistochemistry (IHC) to evaluate, whether mRNA.sup.BMP-7 injection induced the expression of therapeutic protein. Compared to untreated intact contralateral Achilles tendons, BMP-7 expression increased in all tendons that underwent surgical procedure from day 1 until the end of the study at day 7, no matter whether they received cmRNA.sup.BMP-7 or vehicle. However, BMP-7 expression levels were higher during the whole experimental period in cmRNA.sup.BMP-7-treated tendons compared to vehicle-treated tendons (
[0150] At day 1 post-surgery histopathological examination of the injured Achilles tendon revealed an inflammatory reaction with immigration of granulocytes and more or less necrotic areas with or without hematoma in both groups. Increased mitotic activity of tenocytes and fibroblasts was observed in both groups, indeed more distinct in animals being treated with cmRNA.sup.BMP-7. At day 2 post-surgery comparable increase in inflammation and tissue proliferation was apparent in both groups. At day 7 post-surgery further proliferative progress was apparent, however all samples exhibited fibrous bridge-like tissue in the anastomosis region (
[0151] Analysis of IHC for collagen type I revealed a slight decrease in expression from day 1 to day 2 in tendons being treated with vehicle, whereas mean intensity in tendons treated with cmRNA.sup.BMP-7 remained stable. The decrease was followed by a very slight increase until day 7 in both groups. At day 2 and day 7 the intensity of collagen type I was thereby higher in tendons treated with cmRNA.sup.BMP-7 compared to tendons treated with vehicle only (
Example: 18: Naked cmRNA Efficiently Transfects Injured and Intact Tendons in Large Animals In Vivo
[0152] Tendinopathy is characterized by matrix disorganization, hypercellularity, fiber disorientation and vascular ingrowth. As these conditions could not be compared to those of intact or surgically injured tendons, cmRNA's capability of transfecting tendons in a large animal model of tendinopathy was ought to investigate. Collagenase-gel in three different doses (100 CDU, 200 CDU, 500 CDU) was therefore injected into the left Deep Digital Flexor Tendon (DDFT) of anesthetized elderly sheep to generate a defect with partial failure, resembling clinical characteristics of preliminary stages of tendinopathies in humans and horses. Subsequent clinical and ultrasound examination was performed at different time-points (
[0153] Tendon defects were investigated histologically at day 7 (animals euthanized on this day), revealing smaller necrotic areas with loss of fiber structure, conglomerations of red blood cells and some invading inflammatory cells in the central area of the defect (
[0154] At day 6, i.e. 24 hours before euthanasia, cmRNA.sup.LUC (500 g in 100 CDU group, 400 g in 200 CDU group and 200 g in 500 CDU group) was injected into the defect of the left injured (
[0155] With regard to side-effects it has to be mentioned, that animals were clinically examined every day. No adverse effects became apparent due to the application of cmRNA. Furthermore, blood analysis was performed before and 24 hours after the application of cmRNA. Indeed no pathological changes became apparent and measured values of blood leucocytes were within the physiological range after mRNA application (
Example 19: Further Discussion, Especially of Examples 14 to 18
[0156] Tendon injuries or degenerative tendinopathies are common in both animals and humans, especially in athletes (Kvist, Sports medicine (Auckland, NZ). 1994; 18:173-201). Achilles tendon and rotator cuff tendinopathies, for example, are frequently diagnosed among humans (Jarvinen, Foot and ankle clinics. 2005; 10:255-66, Herrmann, Acta chirurgiae orthopaedicae et traumatologiae Cechoslovaca. 2014; 81:256-66). The appearance of tendon damage is various. The occurrence is heterogenous and ranges from acute rupture to chronic tendinopathies. Medical reasons are multisided and predisposal factors are similar in humans and animals, such as overloading due to training or joint malposition, age, gender, genetics, body weight or endocrinopathies (Patterson-Kane, ILAR journal/National Research Council, Institute of Laboratory Animal Resources. 2014; 55:86-99, Perkins, New Zealand veterinary journal. 2005; 53:184-92, Baird, Connective tissue research. 2014; 55:275-81, Ippolito, Italian journal of orthopaedics and traumatology. 1975; 1:133-9, Magnan, Foot and ankle surgery: official journal of the European Society of Foot and Ankle Surgeons. 2014; 20:154-9). In numerous cases chronic damage caused by overuse or degenerative processes leads to an acute injury or even tendon rupture (Jarvinen, Scandinavian journal of medicine & science in sports. 1997; 7:86-95). Beside degenerative processes, a failed healing after tendon injury is also discussed as pathogenesis of tendinopathies (Rees, The American journal of sports medicine. 2009; 37:1855-67, Watts, Equine veterinary journal. 2012; 44:576-86).
[0157] The natural healing potential of tendon tissue is low due to hypocellularity, hypovascularity and a low metabolic rate compared to other soft tissues (Bray, Journal of anatomy. 1996; 188 (Pt 1):87-95, Sharma, Journal of musculoskeletal & neuronal interactions. 2006; 6:181-90, Liu, Tissue engineering Part B, Reviews. 2011; 17:165-76). The healing process is therefore extremely slow (James, The Journal of hand surgery. 2008; 33:102-12, Williams, Sports medicine (Auckland, NZ). 1986; 3:114-35); it usually takes months or years. The healing process moreover normally results only in tissue repair instead of regeneration as the original tensile strength and elasticity is usually not regained (Sharma, Foot and ankle clinics. 2005; 10:383-97). Recovery is therefore rarely fully functional (Sharma, Journal of musculoskeletal & neuronal interactions. 2006; 6:181-90, Hogan, The Journal of the American Academy of Orthopaedic Surgeons. 2011; 19:134-42) and the risk of re-injury or even a tendon rupture is highly increased (Mast, The Surgical clinics of North America. 1997; 77:529-47).
[0158] Treatment methods are numerous and can be categorized in conservative and surgical therapy. Besides rest and bandaging followed by controlled exercise in cases of acute injury, conservative therapy methods can also be intra lesion application of various substances such as corticosteroids (Muto, Journal of orthopaedic research: official publication of the Orthopaedic Research Society. 2014; 32:1297-304, Hart, Clinical journal of sport medicine: official journal of the Canadian Academy of Sport Medicine. 2011; 21:540-1), which is highly controversial; hyaluronic acid (Muneta, Journal of orthopaedic science: official journal of the Japanese Orthopaedic Association. 2012; 17:425-31, Foland, American journal of veterinary research. 1992; 53:2371-6) or glycosaminoglycans (Moraes, The Veterinary record. 2009; 165:203-5) that are components of the extracellular matrix in tendons. Furthermore, physical methods such as electromagnetic stimulation or shockwave therapy (Bosch, Equine veterinary journal. 2007; 39:226-31, Seeliger, European journal of medical research. 2014; 19:37) are used. Also various approaches using stem cell-based (Smith, Disability and rehabilitation. 2008; 30:1752-8, Martinello, Journal of orthopaedic research: official publication of the Orthopaedic Research Society. 2013; 31:306-14, Renzi, Research in veterinary science. 2013; 95:272-7) and growth factor-based therapies are investigated (Witte, Journal of the American Veterinary Medical Association. 2011; 239:992-7, Shah, Journal of orthopaedic research: official publication of the Orthopaedic Research Society. 2013; 31:413-20, Arguelles, The Veterinary record. 2008; 162:208-11, de Vos, British journal of sports medicine. 2011; 45:387-92).
[0159] The assumption that cytokines and growth factors play a key role during the healing process generated considerable research interest in growth-factor based gene therapy, namely that they stimulate cell proliferation as well as cell differentiation and formation of extracellular matrix components (Molloy, Sports medicine (Auckland, NZ). 2003; 33:381-94, Evans, Sports medicine (Auckland, NZ). 1999; 28:71-6, Grotendorst, International journal of tissue reactions. 1988; 10:337-44). Various ex vivo and in vivo experiments provided promising results, for example improved tendon healing in a rat Achilles tendon healing model after BMP-12 gene transfer (Majewski, Gene therapy. 2008; 15:1139-46) or a positive influence of platelet-rich plasma on core lesions of Superficial Digital Flexor Tendons (SDFT) in horses (Bosch, Journal of orthopaedic research: official publication of the Orthopaedic Research Society. 2010; 28:211-7). In recent years much research has been focused on DNA gene transfer in the field of growth factor based therapies (Majewski, Gene therapy. 2008; 15:1139-46, Nakamura, Gene therapy. 1998; 5:1165-70, Evans, International orthopaedics. 2014, Lou, Journal of orthopaedic research: official publication of the Orthopaedic Research Society. 2001; 19:1199-202), which are not very efficient due to limitations of nuclear entry in non-dividing cells (Tong, Current gene therapy. 2009; 9:495-502), and carry potential risk of mutagenesis. Messenger RNA on the other hand has been successfully applied in several mouse models. Kormann et al. reported raising hematocrit levels after single intramuscular injection of modified murine erythropoietin encoding mRNA and in addition, aerosol application containing surfactant B protein encoding mRNA in a congenital mouse disease model reconditioned large parts of the lung (Kormann, Nature biotechnology. 2011; 29:154-7). Furthermore, human VEGF encoding modified mRNA improved heart function and long-term survival in a mouse model of myocardial infarction (Zangi, Nature biotechnology. 2013; 31:898-907). In the context of the invention a focus was set on application of chemically modified naked mRNA (cmRNA) in intact as well as in surgically and chemically injured tendons.
[0160] Chemically modified mRNAs represent a novel platform technology for transfecting tissues and consequently expressing therapeutic proteins within the body for the treatment of various pathological conditions (Kormann, Nature biotechnology. 2011; 29:154-7, Zangi, Nature biotechnology. 2013; 31:898-907). It is reported herein for the first time that there is feasibility of using cmRNA technology as a therapeutic approach for effective expression of physiologically active proteins in intact and injured tendons. A self established ex vivo transfection method enabled us to screen transfection efficacy of cmRNA in a variety of species (sheep, cattle, horses, hogs and rats), to optimize transfection conditions and to evaluate expression of several proteins (Luciferase, -Galactosidase and BMP-7) in a cost efficient and rapid manner. Reporter protein expression was species independent and expression levels were significantly higher when naked cmRNA was applied compared to cmRNA complexed with common lipid and polymer carriers. Furthermore, transgene expression could be optimized when using naked mRNA dissolved in glucose-containing solvents, which could possibly be explained by nutrition effects as tendons are poorly provided with blood due to the low incidence of blood vessels.
[0161] Results of our ex vivo studies were confirmed in vivo in intact rat Achilles tendons and subsequently in a Achilles tendon injury model of dissected and surgically repaired Achilles tendons in rats as well as in a collagenase-gel induced tendon defect model in sheep. Injection of cmRNA.sup.LUC into healthy tendons resulted in considerable Luciferase expression, peaking after 24 hours and fading out within 7 days in a dose-dependent manner. These observations resembled expression kinetics observed in our ex vivo studies. Injection of cmRNA.sup.BMP-7 into injured Achilles tendons in turn, resulted in a BMP-7 expression pattern with proceedingly increasing BMP-7 levels up to day 7. Additionally certain background expression of BMP-7 was detected in healthy rat tendons ex vivo and in vivo, as the antibody used cross reacted with endogenous rat BMP-7. Furthermore, expression of endogenous BMP-7 was strongly increased, due to the surgical procedure during rat Achilles tenotomy. Indeed increased expression of BMP-7 as a consequence to harming insults on tendons has already been described by others in various animal studies and patient derived tissue specimen of tendinopathic tendons (Eliasson, Clinical orthopaedics and related research. 2008; 466:1592-7, Yee, Journal of orthopaedic research: official publication of the Orthopaedic Research Society. 2011; 29:816-21, Rui, Knee surgery, sports traumatology, arthroscopy: official journal of the ESSKA. 2012; 20:1409-17, Yu, Arthroscopy: the journal of arthroscopic & related surgery: official publication of the Arthroscopy Association of North America and the International Arthroscopy Association. 2007; 23:205-10, Lui, BMC musculoskeletal disorders. 2013; 14:248). However, a trend of increased BMP-7 expression was observed in tendons being treated with cmRNA.sup.BMP-7 compared to tendons being treated with vehicle at all points of time after injury. Therefore it was reasoned that injecting cmRNA.sup.BMP-7 can contribute to increased and prolonged BMP-7 expression in injured tendons.
[0162] Increased catabolism of collagen type I is considered to be a critical parameter in the inflammatory and early proliferative phase (day 1 to day 7 post injury) of tendon healing, though strong decrease of collagen type I is suspected to be associated with increased formation of non-functional scar tissue, instead of functional tendon tissue (Sharma, The surgeon: journal of the Royal Colleges of Surgeons of Edinburgh and Ireland. 2005; 3:309-16, Loiselle, PloS one. 2012; 7:e40602). In contrast, collagen type III is associated with characteristics of scar-like tissue, namely loss of tensile strength and elasticity compared to intact tendon tissue (Sharma, Foot and ankle clinics. 2005; 10:383-97). A preferably small content of collagen type III is therefore desirable. In our present study, a tendency of collagen type I catabolism in the vehicle group until day 2 post-surgery was detected, whereas the collagen type I content in tendons being treated with cmRNA.sup.BMP-7 remained stable during the whole experiment. A strong increase in collagen type III content was observed in the vehicle group from day 2 to day 7 post-surgery, while in tendons being treated with cmRNA.sup.BMP-7 the increase was less prominent. Consequently, a trend towards a higher ratio of collagen type I to collagen type III was detected in cmRNA.sup.BMP-7 treated tendons. The histopathological assessment revealed an increased cellular infiltration in cmRNA.sup.BMP-7 treated animals at day 1 post injury. However no differences regarding inflammation and callus formation became apparent after day 2 and day 7.
[0163] Taking these findings together, cmRNA.sup.BMP-7-induced expression of physiologically functional BMP-7 protein apparently supports tendon healing, through more cellular infiltration and less fulminant collagen III formation. In principle, our present results provide insights into the early healing phase of acute Achilles tendon injury in rats. However, long term studies could be conducted to further clarify, whether cmRNA.sup.BMP-7 intervention at early time points would be beneficial in all phases of the entire healing process. Although opinions might be discordant as to the question whether BMP-7 enhances tendon healing or impairs it by inducing heterotopic ossification or cartilage formation (Yeh, Journal of cellular biochemistry. 2008; 104:2107-22, Yee, Journal of orthopaedic research: official publication of the Orthopaedic Research Society. 2011; 29:816-21, Forslund, Acta orthopaedica Scandinavica. 1998; 69:622-6, Lui, Rheumatology (Oxford, England). 2013; 52:2116-26), the findings provided herein suggest that overexpression of BMP-7 during the inflammatory phase of tendon regeneration positively influences healing, due to chemotactic attraction of cells, less pronounced collagen type I degradation and decreased collagen type III formation.
[0164] Tendon rupture can occur spontaneously, and patients might not have suffered from symptoms before (Kvist, Sports medicine (Auckland, NZ). 1994; 18:173-201, Jozsa, Champaign, Ill.: Human Kinetics; 1997). Degenerative processes are thought to be responsible, which may lead to an altered structure in tendinopathic tissue compared to intact tendons (Riley, Matrix biology: journal of the International Society for Matrix Biology. 2002; 21:185-95). Transformed tissue is characterized by disintegration of collagen fibers, loss of matrix organization and at most mild inflammatory processes in chronic stages (Pecina, Acta chirurgiae orthopaedicae et traumatologiae Cechoslovaca. 2010; 77:277-83). One explanation for this kind of degeneration might be an upregulation of collagenolytic enzymes, such as specific matrix metalloproteinases (MMPs), as it has been detected in chronically altered tendinopathic tendons of humans and animals (Castagna, Muscles, ligaments and tendons journal. 2013; 3:132-8, Jones, Arthritis and rheumatism. 2006; 54:832-42, Muir, Veterinary Surgery. 2005; 34:482-90, Nomura, J Vet Med Sci. 2007; 69:637-9). Similar MMP expression patterns had also been observed in experimentally affected tendons by collagenase-gel injection in horses (Watts, Equine veterinary journal. 2012; 44:576-86). However, in human and veterinary medicine, patients are often presented with symptoms such as pain and discomfort, at a clinical stage before tendons are ruptured. In cases of overuse this symptoms probably result from microtraumatic fiber disruption and subsequent inflammation (Kannus, Scandinavian journal of medicine & science in sports. 1997; 7:78-85). Based on these assumptions a defect model with partial failure could be generated with injection of 100 CDU, imitating clinical characteristics of preliminary stages of tendinopathies in humans and horses. It has to be mentioned that defects induced by 200 CDU or 500 CDU caused a detrimental pathology, which is not considered to represent the clinical situation.
[0165] From the herein disclosed ex vivo experiments using -galactosidase encoding cmRNA it can be seen that transgene expression is distributed tube-like, within fibrils in healthy specimen. Thus it was reasoned, whether this distribution pattern would be the same in pathologically altered tendons, with disintegrated fiber structure due to prior collagenase injection. To clarify this question, cmRNA.sup.LUC was injected into injured regions of tendons in a highly translational sheep model of tendonitis. Indeed it was observed in tendons treated with 100 CDU, that transfection efficacy in injured tendons reached equal levels as in intact tendons. Moreover, transgene expression was more widely distributed and intensive in injured tendons. Without being bound by theory, this observation is most likely due to an increased cell number and a raised metabolic activity in injured tendons as compared to intact tendon. Another possible explanation, but again without being bound by theory, could be the circumstance that parts of the extracellular matrix were disintegrated in injured tendons and as a consequence, connections between fibers were loosened. Indeed injected cmRNA may spread more widely between fibers and therefore reached a larger number of cells.
[0166] With respect to biological compatibility, intact tendons were examined histopathologically 24 hours after injection of cmRNA.sup.Luc. The examination showed only a mild unspecific inflammatory reaction near the injection site. It can't be excluded that the cmRNA itself, the expressed protein, mechanical stress due to volume injection, or trauma caused by needle insertion, induced a mild unspecific local immune response, however. Liver and kidney test values as well as full blood count were conducted to investigate cmRNA's pharmaceutical safety in large animals after local application into tendons. In our short term studies mRNA did not lead to organ damage in liver or kidney and did not relevantly affect the immune system as determined values remained within the physiological range 24 hours after cmRNA application or have already slightly differed beforehand. It is readily possible to evaluate mRNA's therapeutic potential in chemically disintegrated tendons by application of cmRNA encoding for therapeutic proteins in an established defect model with partial failure as, for example, disclosed herein.
[0167] These results indicate that cmRNAs has the potential as a novel pro-drug, which could be used for expressing therapeutic proteins in injured tendons. Further long-term investigations can be made on the therapeutic potential, of, for example, BMP-7, for the treatment of tendon disorders.
[0168] The present invention refers to the following supplemental Tables:
TABLE-US-00002 TABLE 2 Solutions used for cmRNA dilution. A selection of primary ingredients is listed. Description Label Primary Ingredients Nitrogen compound Ammonium acetate solution.sup.1 Ammonium acetate containing Aminosteril plus.sup.1 Total aminoacids 100 g/l, K, Ca, Mg, Cl, Phosphate, Acetate Aminoven 15%.sup.1 Total aminoacids 150 g/l Colloidal solutions HAES steril 10%.sup.1 Hydroxyethyl starch 100 g/l, Na, Cl Gelafundin 4%.sup.1 Gelatine polysuccinate 40 g/l, Na, Cl HEPES buffered glucose 12.5 mM HEPES, Glucose 25 g/l 2.5%.sup.2 Glucose containing HEPES buffered glucose 18.75 mM HEPES, Glucose 37.5 g/l 3.75%.sup.2 HEPES buffered glucose 5%.sup.2 25 mM HEPES, Glucose 50 g/l HEPES buffered glucose 10%.sup.2 50 mM HEPES, Glucose 100 g/l Isotonic saline (NaCl).sup.2 Glucose, Na, Cl Elektrolyte containing Ringer acetate.sup.1 Na, K, Ca, Mg, Cl, Acetate Ringer lactate.sup.1 Na, K, Ca, Cl, Lactate Elektrolyte and Isotonic saline + 5% glucose.sup.2 Glucose 50 g/l, Na, Cl glucose containing (NaCl + 5% Gluc) .sup.1commercially available, .sup.2standard chemical solutions made in-house, HEPES: 2-(4-(2-hydroxyethyl)-1-piperazinethansulfonic acid.
TABLE-US-00003 TABLE 3 Analysis of blood count and organ test values. 400 g 800 g 1000 g amount of cmRNA d 0 d 6 d 7 d 0 d 6 d 7 d 0 d 6 d 7 Blood count WBC [G/l].sup.1 7.4 6.2 7.6* 6.8* 5.2 6.1 4.2 3.6 4.2 2.0 0.6 0.5 0.6 0.2 0.1 0.7 HCT [%].sup.2 48.3 51.7 43.9* 41.5 35.5 40.0 29.5 29.0 36.0 3.3 4.2 0.7 2.1 1.4 6.4 4.2 0.0 PLT [G/L].sup.3 409* 500 461* 450 554 562 521 421 564 87 152 192 172 52 25 43 Kidney blood urea nitrogen 21* 11 7.5 17 13.5 6 14 12 7.5 [mg/dl].sup.4 0.0 0.7 4.2 3.5 0.7 1.4 2.8 2.1 Creatinine [mg/dl].sup.5 1.1* 1.0 1.1 1.1 1.2 1.1 0.8 0.7 0.7 0.0 0.1 0.1 0.3 0.0 0.1 0.0 0.1 Liver alkaline phosphatase 79* 61 49 102 88 89 69 74 89 (AP) [U/l].sup.6 5 9 38 34 47 21 36 63 aspartate amino- 109* 161 152 99 177 139 81 78 92 transferase(AST)[U/l].sup.7 23 21 21 55 10 6 13 35 -glutamyltransferase 75* 68 61 73 78 65 63 59 57 (-GT) [U/l].sup.8 5.7 5.7 11 21 1 6.4 4.2 3.5 glutamate 3* 4.5 7 6 3.5 3 6.5 6.5 6.5 dehydrogenase 2.1 4.2 1.4 0.7 0.0 0.7 3.5 3.5 (GLDH) [U/l] .sup.9 bile acids [mol/l].sup.10 4.3* 8.6 12.4 12 2.7 10.4 4.5 4.6 26.6 10.5 6.9 9.5 1.8 7.6 3.5 4.2 26.4 total bilirubin 0.3* 0.3 0.4 0.2 0.35 0.2 0.3 0.25 40.2 [mg/dl].sup.11 0.1 0.0 0.0 0.1 0.0 0.1 0.1 0.0 serum albumin 3.8* 3.7 3.5 3.7 3.8 3.2 3.1 2.9 2.9 [g/dl].sup.12 0.4 0.2 0.5 0.8 0.1 0.3 0.3 0.2 Results are presented as the mean SD (n = 2, *n = 1). Reference ranges: .sup.14-11 G/l, .sup.227-40%, .sup.3280-650 G/l, .sup.45-11 mg/dl, .sup.5<1.9 mg/dl, .sup.6,7<180 U/l, .sup.8<32 U/l, .sup.9 <9 U/l, .sup.10postprandial < 40 mol/l, .sup.11<0.4 mg/dl, .sup.122-3 g/dl.
[0169] The present invention refers to the following nucleotide sequences:
TABLE-US-00004 SEQIDNO.1: NucleotidesequenceencodingHomosapiensbonemorphogeneticprotein7(BMP7) Pubmedaccessionnumber:NM_001719 Version:NM_001719.2GI:187608319 AGCGCGTACCACTCTGGCGCTCCCGAGGCGGCCTCTTGTGCGATCCAGGGCGCACAAGGCTGGGAGAGCGCCCCG GGGCCCCTGCTATCCGCGCCGGAGGTTGGAAGAGGGTGGGTTGCCGCCGCCCGAGGGCGAGAGCGCCAGAGGAGC GGGAAGAAGGAGCGCTCGCCCGCCCGCCTGCCTCCTCGCTGCCTCCCCGGCGTTGGCTCTCTGGACTCCTAGGCT TGCTGGCTGCTCCTCCCACCCGCGCCCGCCTCCTCACTCGCCTTTTCGTTCGCCGGGGCTGCTTTCCAAGCCCTG CGGTGCGCCCGGGCGAGTGCGGGGCGAGGGGCCCGGGGCCAGCACCGAGCAGGGGGCGGGGGTCCGGGCAGAGCG CGGCCGGCCGGGGAGGGGCCATGTCTGGCGCGGGCGCAGCGGGGCCCGTCTGCAGCAAGTGACCGAGCGGCGCGG ACGGCCGCCTGCCCCCTCTGCCACCTGGGGCGGTGCGGGCCCGGAGCCCGGAGCCCGGGTAGCGCGTAGAGCCGG CGCGATGCACGTGCGCTCACTGCGAGCTGCGGCGCCGCACAGCTTCGTGGCGCTCTGGGCACCCCTGTTCCTGCT GCGCTCCGCCCTGGCCGACTTCAGCCTGGACAACGAGGTGCACTCGAGCTTCATCCACCGGCGCCTCCGCAGCCA GGAGCGGCGGGAGATGCAGCGCGAGATCCTCTCCATTTTGGGCTTGCCCCACCGCCCGCGCCCGCACCTCCAGGG CAAGCACAACTCGGCACCCATGTTCATGCTGGACCTGTACAACGCCATGGCGGTGGAGGAGGGCGGCGGGCCCGG CGGCCAGGGCTTCTCCTACCCCTACAAGGCCGTCTTCAGTACCCAGGGCCCCCCTCTGGCCAGCCTGCAAGATAG CCATTTCCTCACCGACGCCGACATGGTCATGAGCTTCGTCAACCTCGTGGAACATGACAAGGAATTCTTCCACCC ACGCTACCACCATCGAGAGTTCCGGTTTGATCTTTCCAAGATCCCAGAAGGGGAAGCTGTCACGGCAGCCGAATT CCGGATCTACAAGGACTACATCCGGGAACGCTTCGACAATGAGACGTTCCGGATCAGCGTTTATCAGGTGCTCCA GGAGCACTTGGGCAGGGAATCGGATCTCTTCCTGCTCGACAGCCGTACCCTCTGGGCCTCGGAGGAGGGCTGGCT GGTGTTTGACATCACAGCCACCAGCAACCACTGGGTGGTCAATCCGCGGCACAACCTGGGCCTGCAGCTCTCGGT GGAGACGCTGGATGGGCAGAGCATCAACCCCAAGTTGGCGGGCCTGATTGGGCGGCACGGGCCCCAGAACAAGCA GCCCTTCATGGTGGCTTTCTTCAAGGCCACGGAGGTCCACTTCCGCAGCATCCGGTCCACGGGGAGCAAACAGCG CAGCCAGAACCGCTCCAAGACGCCCAAGAACCAGGAAGCCCTGCGGATGGCCAACGTGGCAGAGAACAGCAGCAG CGACCAGAGGCAGGCCTGTAAGAAGCACGAGCTGTATGTCAGCTTCCGAGACCTGGGCTGGCAGGACTGGATCAT CGCGCCTGAAGGCTACGCCGCCTACTACTGTGAGGGGGAGTGTGCCTTCCCTCTGAACTCCTACATGAACGCCAC CAACCACGCCATCGTGCAGACGCTGGTCCACTTCATCAACCCGGAAACGGTGCCCAAGCCCTGCTGTGCGCCCAC GCAGCTCAATGCCATCTCCGTCCTCTACTTCGATGACAGCTCCAACGTCATCCTGAAGAAATACAGAAACATGGT GGTCCGGGCCTGTGGCTGCCACTAGCTCCTCCGAGAATTCAGACCCTTTGGGGCCAAGTTTTTCTGGATCCTCCA TTGCTCGCCTTGGCCAGGAACCAGCAGACCAACTGCCTTTTGTGAGACCTTCCCCTCCCTATCCCCAACTTTAAA GGTGTGAGAGTATTAGGAAACATGAGCAGCATATGGCTTTTGATCAGTTTTTCAGTGGCAGCATCCAATGAACAA GATCCTACAAGCTGTGCAGGCAAAACCTAGCAGGAAAAAAAAACAACGCATAAAGAAAAATGGCCGGGCCAGGTC ATTGGCTGGGAAGTCTCAGCCATGCACGGACTCGTTTCCAGAGGTAATTATGAGCGCCTACCAGCCAGGCCACCC AGCCGTGGGAGGAAGGGGGCGTGGCAAGGGGTGGGCACATTGGTGTCTGTGCGAAAGGAAAATTGACCCGGAAGT TCCTGTAATAAATGTCACAATAAAACGAATGAATGAAAATGGTTAGGACGTTACAGATATATTTTCCTAAACAAT TTATCCCCATTTCTCGGTTTATCCTGATGCGTAAACAGAAGCTGTGTCAAGTGGAGGGCGGGGAGGTCCCTCTCC ATTCCCTACAGTTTTCATCCTGAGGCTTGCAGAGGCCCAGTGTTTACCGAGGTTTGCCCAAATCCAAGATCTAGT GGGAGGGGAAAGAGCAAATGTCTGCTCCGAGGAGGGCGGTGTGTTGATCTTTGGAGGAAAAATATGTTCTGTTGT TCAGCTGGATTTGCCGTGGCAGAAATGAAACTAGGTGTGTGAAATACCCGCAGACATTTGGGATTGGCTTTTCAC CTCGCCCCAGTGGTAGTAAATCCATGTGAAATTGCAGAGGGGACAAGGACAGCAAGTAGGATGGAACTTGCAACT CAACCCTGTTGTTAAGAAGCACCAATGGGCCGGGCACAGTAGCTCCCACCTGTAATCCCAGCACTTTGGGAGGCT GAGGTGGGCGGATCATTTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACCCCATCTCTACTAAA AATACAAAAATTAGCCGGGCATGGTGGCACGCACCTGTAATCCCAGCTACTCTGGAGGCTGAGGCAGGAGAATTG CTTGAACCCCAGAGGTGGAGGTTGCAGTGAGCCAAGATCGTCCCACTGCACTCCAGCTTGGGTGACAAAACAAGA CTCCATCTCAAAAGAAAAAAAAAACAGCACCAATGAAGCCTAGTTCTCCACGGGAGTGGGGTGAGCAGGAGCACT GCACATCGCCCCAGTGGACCCTCTGGTCTTTGTCTGCAGTGGCATTCCAAGGCTGGGCCCTGGCAAGGGCACCCG TGGCTGTCTCTTCATTTGCAGACCCTGATCAGAAGTCTCTGCAAACAAATTTGCTCCTTGAATTAAGGGGGAGAT GGCATAATAGGAGGTCTGATGGGTGCAGGATGTGCTGGACTTACATTGCAAATAGAAGCCTTGTTGAGGGTGACA TCCTAACCAAGTGTCCCGATTTGGAGGTGGCATTTCTGACGTGGCTCTTGGTGTAAGCCTGCCTTGCCTTGGCTG GTGAGTCCCATAAATAGTATGCACTCAGCCTCCGGCCACAAACACAAGGCCTAGGGGAGGGCTAGACTGTCTGCA AACGTTTTCTGCATCTGTAAAGAAAACAAGGTGATCGAAAACTGTGGCCATGTGGAACCCGGTCTTGTGGGGGAC TGTTTCTCCATCTTGACTCAGACAGTTCCTGGAAACACCGGGGCTCTGTTTTTATTTTCTTTGATGTTTTTCTTC TTTAGTAGCTTGGGCTGCAGCCTCCACTCTCTAGTCACTGGGGAGGAGTATTTTTTGTTATGTTTGGTTTCATTT GCTGGCAGAGCTGGGGCTTTTTGTGTGATCCCTCTTGGTGTGAGTTTTCTGACCCAACCAGCCTCTGGTTAGCAT CATTTGTACATTTAAACCTGTAAATAGTTGTTACAAAGCAAAGAGATTATTTATTTCCATCCAAAGCTCTTTTGA ACACCCCCCCCCCTTTAATCCCTCGTTCAGGACGATGAGCTTGCTTTCCTTCAACCTGTTTGTTTTCTTATTTAA GACTATTTATTAATGGTTGGACCAATGTACTCACAGCTGTTGCGTCGAGCAGTCCTTAGTGAAAATTCTGTATAA ATAGACAAAATGAAAAGGGTTTGACCTTGCAATAAAAGGAGACGTTTGGTTCTGGCAAAAAAAAAAAAAAAAAA ORF(underlined)fromtheabovesequencemaybecodonoptimized(e.g.byEurofins). SEQIDNO.2: CodonoptimizedmRNAsequence(DNAFormat)resultingfromtheaboveSEQIDNO.1 GGGAGACCCAAGCTGGCTAGCGTTTAAACTTAAGCTTGGTACCGAGCTCGGATCCATGCACGTACGCAGTCTTAGGGCTGC TGCCCCACACAGCTTTGTGGCCCTGTGGGCACCCCTCTTTCTGCTTAGGTCTGCTCTTGCCGACTTTTCACTGGA CAACGAGGTCCATTCCTCATTTATCCACCGTCGACTGAGAAGCCAAGAGAGGCGGGAAATGCAGCGCGAGATTTT GTCTATCCTGGGATTGCCCCATAGACCTCGTCCCCATCTCCAAGGGAAACACAACTCTGCTCCCATGTTCATGCT GGATCTGTACAATGCCATGGCAGTGGAGGAAGGTGGTGGCCCAGGAGGACAGGGCTTCTCCTATCCGTACAAGGC CGTCTTTTCCACCCAAGGTCCACCGTTGGCGAGTCTCCAGGATTCCCATTTCCTGACCGATGCGGACATGGTGAT GTCATTCGTGAACCTGGTGGAACACGACAAAGAGTTCTTTCACCCCAGGTATCACCACAGAGAGTTCCGCTTCGA CTTGAGTAAAATCCCTGAGGGAGAAGCCGTTACTGCCGCCGAGTTTCGCATTTACAAGGACTACATTCGGGAGAG GTTCGATAACGAAACCTTCCGGATATCCGTGTATCAGGTGCTGCAAGAGCATCTGGGGAGAGAGTCCGATCTCTT CCTCCTGGACAGTAGGACACTGTGGGCGTCTGAGGAAGGCTGGCTTGTGTTCGACATAACTGCCACGAGCAATCA CTGGGTTGTAAACCCAAGGCATAACCTGGGGCTTCAGCTGTCTGTCGAGACACTGGATGGGCAGAGCATCAATCC CAAACTGGCTGGGTTGATCGGACGCCATGGTCCACAGAACAAACAGCCTTTCATGGTAGCTTTCTTTAAGGCCAC AGAAGTGCACTTTCGGAGTATTCGGAGCACTGGCAGCAAACAGAGAAGCCAGAATAGATCCAAGACCCCTAAGAA TCAGGAAGCCCTGCGGATGGCAAATGTGGCGGAGAATAGCAGCTCAGATCAGAGACAGGCTTGCAAGAAGCATGA ACTGTATGTGTCTTTTCGAGATCTCGGATGGCAGGACTGGATTATCGCACCAGAGGGCTATGCTGCCTACTATTG CGAAGGCGAGTGCGCATTTCCTCTGAACAGCTACATGAACGCAACCAATCATGCCATTGTCCAAACACTCGTTCA CTTCATCAATCCGGAAACTGTGCCTAAACCCTGTTGTGCACCTACGCAGCTGAACGCTATATCTGTTCTGTACTT TGACGATTCATCCAACGTCATCCTCAAGAAGTACCGCAATATGGTTGTCCGAGCATGCGGCTGTCACTGAGAATTC CTGCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCGGCC LargecapitallettersrepresenttheBMP-7ORF. SEQIDNO.3: cmRNAsequence(RNAFormat)resultingfromtheaboveSEQIDNO.1 GGGAGACCCAAGCUGGCUAGCGUUUAAACUUAAGCUUGGUACCGAGCUCGGAUCCAUGCACGUACGCAGUCUUAGGGCUGC UGCCCCACACAGCULTUGUGGCCCUGUGGGCACCCCUCUUUCIJGCETUAGGUCUGCUCUUGCCGACULTUUCACUGGA CAACGAGGUCCAUUCCUCAUUUAUCCACCGUCGACUGAGAAGCCAAGAGAGGCGGGAAAUGCAGCGCGAGAUUUU GUCUAUCCUGGGAUUGCCCCAUAGACCUCGUCCCCACUCCAAGGGAAACACAACUCUGCUCCCAUGUUCAUGCU GGAUCUGUACAAUGCCAUGGCAGUGGAGGAAGGUGGUGGCCCAGGAGGACAGGGCUUCUCCUAUCCGUACAAGGC CGUCUUUUCCACCCAAGGUCCACCGUUGGCGAGUCUCCAGGAUUCCCAUUUCCUGACCGAUGCGGACAUGGUGAU GUCAUUCGUGAACCUGGUGGAACACGACAAAGAGUUCUUUCACCCCAGGUAUCACCACAGAGAGUUCCGCUUCGA CUUGAGUAAAAUCCCUGAGGGAGAAGCCGUUACUGCCGCCGAGUUUCGCAUUUACAAGGACUACAUUCGGGAGAG GUUCGAUAACGAAACCUUCCGGAUAUCCGUGUAUCAGGUGCUGCAAGAGCAUCUGGGGAGAGAGUCCGAUCUCUU CCUCCUGGACAGUAGGACACUGUGGGCGUCUGAGGAAGGCUGGCUUGUGUUCGACAUAACUGCCACGAGCAAUCA CUGGGUUGUAAACCCAAGGCAUAACCUGGGGCUUCAGCUGUCUGUCGAGACACUGGAUGGGCAGAGCAUCAAUCC CAAACUGGCUGGGUUGAUCGGACGCCAUGGUCCACAGAACAAACAGCCUUUCAUGGUAGCUUUCUUUAAGGCCAC AGAAGUGCACUUUCGGAGUAUUCGGAGCACUGGCAGCAAACAGAGAAGCCAGAAUAGAUCCAAGACCCCUAAGAA UCAGGAAGCCCUGCGGAUGGCAAAUGUGGCGGAGAAUAGCAGCUCAGAUCAGAGACAGGCUUGCAAGAAGCAUGA ACUGUAUGUGUCUUUUCGAGAUCUCGGAUGGCAGGACUGGAUUAUCGCACCAGAGGGCUAUGCUGCCUACUAUUG CGAAGGCGAGUGCGCAUUUCCUCUGAACAGCUACAUGAACGCAACCAAUCAUGCCAUUGUCCAAACACUCGUUCA CUUCAUCAAUCCGGAAACUGUGCCUAAACCCUGUUGUGCACCUACGCAGCUGAACGCUAUAUCUGUUCUGUACUU UGACGAUUCAUCCAACGUCAUCCUCAAGAAGUACCGCAAUAUGGUUGUCCGAGCAUGCGGCUGUCACUGAGAAUUC CUGCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCGGCC LargecapitallettersrepresenttheBMP-7ORF.