LIPOSOME PREPARATION HAVING HIGH-CONTENT CATIONIC LIPID COMPOUND AND USE THEREOF

20190380963 ยท 2019-12-19

    Inventors

    Cpc classification

    International classification

    Abstract

    A liposome for delivery of nucleic acid is provided herein, comprising cationic lipid compound, a phospholipid and a PEGylated lipid, wherein the cationic lipid compound is in an amount from 50 wt % to 90 wt % and consist of a lipid compound and a cholesterol lipid compound. A nucleic acid liposome formulation comprising the said liposome and the nucleic acid encapsulated by the liposome and the method for preparing the same are provided therein. Increased amount of nucleic acid can be loaded into the nucleic acid liposome formulation as described therein. Thus, at the same dosage, intake of the cationic lipid compound is decreased, thereby decreasing toxicity.

    Claims

    1. A liposome for delivery of nucleic acids, comprising a cationic lipid compound, a phospholipid and a PEGylated lipid, wherein the cationic lipid compound is in an amount from 50 wt % to 90 wt %.

    2. The liposome of claim 1, wherein the cationic lipid compound is in an amount from 60 wt % to 90 wt %, or 70 wt % to 90 wt %, or 75 wt % to 90 wt %, or 80 wt % to 90 wt %, or 85 wt % to 90 wt %.

    3. The liposome of claim 1 or 2, wherein the cationic lipid compound consists of a lipid-type lipid compound and a cholesterol lipid compound.

    4. The liposome of claim 3, wherein the molar ratio of the lipid-type lipid compound to the cholesterol lipid compound ranges from 4:1 to 1:4.

    5. The liposome of claim 1 or 2, wherein the phospholipid is in an amount from 5 wt % to 10 wt %.

    6. The liposome of claim 1 or 2, wherein the PEGylated lipid is in an amount from 0 wt % to 10 wt %.

    7. The liposome of claim 3, wherein the lipid-type lipid compound has a chemical structure selected from the group consisting of Formula I, Formula II, Formula III and Formula IV: ##STR00003## wherein, R and R are C.sub.14-C.sub.22 saturated or unsaturated fatty acids, A and A are C.sub.1-C.sub.4 alkyl, n=1-4.

    8. The liposome of claim 3, wherein the cholesterol lipid compound has a chemical structure represented by Formula V: ##STR00004## wherein, Y(CO), (CS), (HN(O)C) or bond, A and A are C.sub.1-C.sub.4 alkyl, n=1-4.

    9. A nucleic acid liposome formulation, comprising the liposome of any one of claims 1 to 8, and a nucleic acid encapsulated by the liposome.

    10. The nucleic acid liposome formulation of claim 9, further comprising a pharmaceutically acceptable excipient.

    11. The nucleic acid liposome formulation of claim 9 or 10, wherein, the formulation is in the form of tablet, capsule, lotion, drop, power, solution or aerosol.

    12. The nucleic acid liposome formulation of claim 9 or 10, wherein the formulation is selected from the group consisting of an oral formulation, an intravascular injection formulation, an intramuscular injection formulation, a subcutaneous administration formulation, a parentenral administration formulation, and an intraperitoneal administration formulation.

    13. The nucleic acid liposome formulation of claim 9, wherein the nucleic acid is selected from the group consisting of small interfering nucleic acid, micro nucleic acid, non-coding nucleic acid, antisense nucleic acid, small ligand nucleic acid and small active nucleic acid.

    14. Use of the nucleic acid liposome formulation of any one of claims 9-13 in manufacturing a medicament for treating diseases associated with abnormal expression of genes.

    15. A method for preparing the nucleic acid liposome formulation of any one of claims 9-13, comprising: (1) providing a mixture solution of the cationic lipid compound, the phospholipid and the PEGylated lipid; (2) mixing the said mixture solution and a nucleic acid solution to obtain the nucleic acid liposome formulation, wherein the cationic lipid compound in the mixture solution are comprised from 50 wt % to 90 wt %.

    16. The method of claim 15, wherein, after step (1), the said mixture solution is subject to extrusion process to obtain empty liposome vesicles.

    17. The method of claim 16, wherein the nucleic acid solution is mixed with the empty liposome vesicles, such that the nucleic acid is loaded into the empty liposome vesicles to form the nucleic acid liposome formulation.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0148] FIG. 1 is a column diagram of mice body weights before and after administering the liposome formulation with the nucleic acid drug encapsulated therein according to one embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows mice body weights.

    [0149] FIG. 2 is a column diagram of relative mRNA expression level of ApoB gene in mice's liver before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to one embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows relative mRNA expression level of ApoB gene.

    [0150] FIG. 3 is a column diagram of total cholesterol level in mice's serum before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to one embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows total cholesterol level in mice's serum.

    [0151] FIG. 4 is a column diagram of mice body weights before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to another embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows mice body weights.

    [0152] FIG. 5 is a column diagram of relative mRNA expression level of ApoB gene in mice's liver before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to another embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows relative mRNA expression level of ApoB gene.

    [0153] FIG. 6 is a column diagram of total cholesterol level in mice's serum before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to another embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows total cholesterol level in mice's serum.

    [0154] FIG. 7 is a column diagram of mice body weights before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to yet another embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows mice body weights.

    [0155] FIG. 8 is a column diagram of relative mRNA expression level of ApoB gene in mice's liver before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to yet another embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows relative mRNA expression level of ApoB gene.

    [0156] FIG. 9 is a column diagram of total cholesterol level in mice's serum before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to yet another embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows total cholesterol level in mice's serum.

    [0157] FIG. 10 is a column diagram of mice body weights before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to still yet another embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows mice body weights.

    [0158] FIG. 11 is a column diagram of relative mRNA expression level of ApoB gene in mice's liver before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to still yet another embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows relative mRNA expression level of ApoB gene.

    [0159] FIG. 12 is a column diagram of total cholesterol level in mice's serum before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to still yet another embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows total cholesterol level in mice's serum.

    [0160] FIG. 13 is a column diagram of mice body weights before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to still yet another embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows mice body weights.

    [0161] FIG. 14 is a column diagram of relative mRNA expression level of ApoB gene in mice's liver before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to still yet another embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows relative mRNA expression level of ApoB gene.

    [0162] FIG. 15 is a column diagram of total cholesterol level in mice's serum before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to still yet another embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows total cholesterol level in mice's serum.

    [0163] FIG. 16 is a column diagram of mice body weights before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to still yet another embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows mice body weights.

    [0164] FIG. 17 is a column diagram of relative mRNA expression level of ApoB gene in mice's liver before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to still yet another embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows relative mRNA expression level of ApoB gene.

    [0165] FIG. 18 is a column diagram of total cholesterol level in mice's serum before and after administering the liposome formulation with the nucleic acid drug encapsulated therein to the mice according to still yet another embodiment as described herein, wherein, the horizontal axis shows respective experiment groups, and the vertical axis shows total cholesterol level in mice's serum.

    DETAILED DESCRIPTION OF THE INVENTION

    [0166] Several aspects of the invention are described below in details by reference to appended drawing and specific embodiments. The skilled in the art should understand that the embodiments are set forth to provide an illustration, rather than limit the scope of the present invention. The scope of the present invention is limited by the appended claims.

    [0167] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the singular forms a, an and the are intended to include the plural forms as well, unless the context clearly indicates otherwise.

    EXAMPLE 1

    [0168] The lipid-type lipid compound and the cholesterol lipid compound used in the liposome formulation as described herein were prepared according to the relevant reference documents, patents and patent applications or modified technologies in organic chemistry, synthetic chemistry and biological chemistry fields. For example, the lipid-type lipid compound (CL52) having Formula I wherein RR=linoleic acid group, n=1, A=A=CH.sub.3 was prepared according to the methods that can be found in Heyes J et. al., J Control Release 2005; 107:276-287. The lipid-type lipid compound (CL53) having Formula I wherein RR=oleic acid group, n=1, A=A=CH.sub.3 was prepared according to the methods that can be found in Heyes J et. al., J Control Release 2005; 107:276-287. The lipid-type lipid compound (CL54) having Formula II wherein RR=linoleic acid group, n=2, A=A=CH.sub.3 was prepared according to the methods that can be found in J Chen et al., PCT applications WO/2009/086558 and WO/2010/042877 or Semple S C et al., Nature Biotech, 2010; 28:172-176. The lipid-type lipid compound (CL51) having Formula III wherein RR=linoleic acid group, n=3, A=A=CH.sub.3 was prepared according to the methods that can be found in Jayaraman M et al., Angew Chem Int Ed Engl. 2012; 51:8529-33. The lipid-type lipid compound (CL55) having Formula IV wherein RR=linoleic acid group, n=1, A=A=CH.sub.3 was prepared according to the methods that can be found in Leventis R et al., Biochim Biophys Acta 1990; 1023:124-132. The lipid-type lipid compound (CL56) having Formula IV wherein RR=oleic acid group, n=1, A=A=CH.sub.3 was prepared according to the methods that can be found in Leventis R et al., Biochim Biophys Acta 1990; 1023:124-132. PEG-c-DMA was prepared according to the methods that can be found in J Chen et al., PCT applications WO/2009/086558 and WO/2010/042877 or Semple S C et al., Nature Biotech, 2010; 28:172-176.

    [0169] The cholesterol lipid compound (CL66) having Formula V wherein Y(CO), A=A=CH.sub.3, n=2 was prepared as follows.

    [0170] Cholesterol (1.1 g, 2.84 mmol) dissolved in DCM (20 mL) and material 11 (4-(dimethylamino)propionic acid hydrochloride, 0.7 g, 4.55 mmol) were added into 100 mL flask and then di-isopropyl ethylamine (1 mL) and DMAP (0.056 g, 0.56 mmol) were added thereto. The mixture in the flask was stirred for 5 min at room temperature and EDC.HCl (1.1 g, 5.6 mmol) was added and stirred overnight at room temperature. Progresses of reaction was detected by TLC (5% MeOH/DCM). After completing the reaction, 20 mL DCM was added to dilute the solution. 16 mL saturated NaHCO.sub.3, 16 mL water and 16 mL saturated saline were used to wash the solution. The organic phase was dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated, to yield 1.1 g crude product. The crude product was purified by using Flash column (90 g silica gel, loading by 210 mL DCM containing 0.1% TEA; the moving phases were respectively: 140 mL DCM containing 0.1% TEA, 560 ml 2% methanol+98% DCM containing 0.1% TEA; 140 mL 2.5% methanol+97.5% DCM containing 0.1% TEA, 420 mL 3% methanol +97% DCM containing 0.1 TEA) to yield purified product CL66.

    [0171] The cholesterol lipid compound (CL68) having Formula V wherein Y(CO), A=A=CH.sub.3, n=1 was prepared as follows.

    [0172] Cholesterol (1.1 g, 2.84 mmol) dissolved in DCM (20 mL) and material 13 (4-(dimethylamino)propionic acid hydrochloride, 0.7 g, 5.0 mmol) were added into 100 mL flask and then di-isopropyl ethylamine (1 mL) and DMAP (0.056 g, 0.56 mmol) were added thereto. The mixture in the flask was stirred for 5 min at room temperature and EDC.HCl (1.1 g, 5.6 mmol) was added and stirred overnight at room temperature. Progresses of reaction were detected by TLC (5% MeOH/DCM). After completing the reaction, 20 mL DCM was added to dilute the solution. 16 mL saturated NaHCO.sub.3, 16 mL water and 16 mL saturated saline were used to wash the solution. The organic phase was dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated, to yield 1.1 g crude product. The crude product was purified by using Flash column (90 g silica gel, loading by 210 mL DCM containing 0.1% TEA; the moving phases were repectively: 140 mL DCM containing 0.1% TEA, 560 ml 2% methanol +98% DCM with containing 0.1% TEA; 140 mL 2.5% methanol+97.5% DCM containing 0.1% TEA, 420 mL 3% methanol+97% DCM containing 0.1% TEA) to yield purified product CL68.

    EXAMPLE 2

    [0173] Preparation of Liposome Formulation

    [0174] 1. Reagents, Materials and Instruments

    [0175] 1.1 Reagents:

    [0176] The lipid-type lipid compound was compound CL51 having Formula III wherein RR=linoleic acid group and n=3.

    [0177] The cholesterol lipid compounds were compounds CL66 and CL68 prepared according to Example 1.

    [0178] The phospholipid was distearoyl phosphatidylcholine (DSPC) purchased from Shanghai Advanced Vehicle Technology L.T.D. Co.

    [0179] The PEGylated lipid was PEG-c-DMA prepared according to Example 1.

    [0180] The fluorescent dye, potassium 6-(p-toluidino)-2-naphthalenesulphonate (TNS), was purchased from Sigma-Aldrich Co.

    [0181] Other reagents including absolute ethanol, methanol, chloroform, citric acid, sodium citrate, NaCl and so on were imported or domestic analytical grade reagents.

    [0182] The exemplary nucleic acid medicament used in the present example was ApoB-siRNA synthesized by BIOMICS BIOTECHNOLOGIES CO., LTD. in the form of freeze-dried powder, with following sequence:

    TABLE-US-00001 ApB-S:5-GUCAUCACACUGAAUACCAAU-3; ApB-AS:5-AUUGGUAUUCAGUGUGAUGACAC-3.

    [0183] 1.2 Materials: ion exchanging column: Vivapure D Mini H (Sartorius stedim Co., USA), Ultracel-100 centrifugal ultrafiltration tube (Millipore Co., USA), dialysis membrane: Nuclepore Membrane Circles (80 nm) (Whatman Co., USA), dialysis bag and needle filter purchased from Sangon Biotech Co. Ltd., dialysis bag MD24 (MW: 20000, Shanghai Baoman Biotechnology Co. Ltd.), needle filter (Sangon Biotech Co. Ltd.), 50 mL Falcon tube (Corning Co., USA).

    [0184] 1.3 Instruments: Vortex Mixer (VWR Co., USA), constant temperature water bath (Jiangsu Tianhong Instrument Co.), Centrifuge (Eppendorf Co., USA), UV-Vis Spectrophotometer (Shanghai Jingke Co.), Magnetic Stirrer (Shanghai Meiyingpu Instrument Co.), NLI Liposome Extruder (ATS Co., CA), Clean Bench (Suzhou Jinghua), High Speed Refrigerated Centrifuge (Saite Xiangyi), Fluorospectro Photometer (RF-5301PC, Shimadzu Co., JP) and so on.

    [0185] 2. Preparation of Liposome Formulation

    [0186] 2.1 Preparation of Reagents:

    [0187] 2.1.1 Preparation of Lipid Stock Solution

    [0188] The lipid-type lipid compound CL51, the cholesterol lipid compounds CL66 and CL68, the phospholipid DSPC, and the PEGylated lipid PEG-c-DMA were balanced at room temperature for about 30 min before weighting.

    [0189] The lipid-type lipid compound CL51 was formulated to 40 mg/mL stock solution by using 100% ethanol. The cholesterol lipid compounds CL66 and CL68 were formulated to 20 mg/mL stock solution by using 100% ethanol, respectively. DSPC was formulated to 20 mg/mL stock solution by using 100% ethanol. The PEGylated lipid PEG-c-DMA was formulated to 50 mg/mL stock solution by using 100% ethanol.

    [0190] 2.2 Preparation of Liposome Formulations

    [0191] The liposome formulations F61-F520 were prepared at the ratio of the lipid-type lipid compound CL51 to the cholesterol lipid compound CL68 as listed in Table 1 (wherein, the PEGylated lipid was PEG-c-DMA at amount of 10% and the remainder was DSPC to arrive at 100%, and the amounts of the PEGylated lipid and the phospholipid as mentioned above were used in following examples). In particular, the lipid-type lipid compound CL51, the cholesterol lipid compound CL68, the PEGylated lipid PEG-c-DMA and phospholipid DSPC at the ratios as listed in table 1 were formulated into ethanol solution by using absolute ethanol as solvent. After all of the lipids were dissolved, the ethanol solution of the lipids as mentioned above was added into buffer solution (50 mM citric acid, pH 4.0) with stirring, to obtain 30% (v/v) of final ethanol concentration. At room temperature, under pressure of 200 psi, extrusion was performed by using NLI liposome extruder equipped with two layers of Nuclepore Membrane Circles. Empty liposome vesicles with uniform diameter were obtained. The diameter of the empty liposome vesicles obtained through extruder was measured by particle size analyzer.

    TABLE-US-00002 TABLE 1 Amount of cationic Lipid-type lipd lipid compound:Cholesterol Cholesterol Formu- compound lipid Lipid lipid lation (%) compound compound compound F601 60 4:1 CL51 CL68 F602 60 2:2 CL51 CL68 F603 60 1:4 CL51 CL68 F608 60 2:1 CL51 CL68 F609 60 2:1 CL51 CL66 F610 60 1:1 CL51 CL66 F504 70 4:1 CL51 CL68 F505 75 4:1 CL51 CL68 F506 80 4:1 CL51 CL66 F507 80 2:2 CL51 CL68 F510 80 1:4 CL51 CL68 F511 83 4:1 CL51 CL68 F512 85 4:1 CL51 CL68 F513 88 4:1 CL51 CL68 F518 90 4:1 CL51 CL68 F519 90 2:2 CL51 CL66 F520 90 1:4 CL51 CL66

    [0192] 2.3 Preparation of Liposome Formulation with siRNA Encapsulated Therein

    [0193] 2.3.1 Preparation of siRNA Stock Solution:

    [0194] Dissolution of siRNA: ApoB-siRNA stock solution with 50 mg/mL of theorical final concentration was formulated by using solution of 10 mM citric acid/30 mM NaCl at pH of 6.0. ApoB-siRNA stock solution in a suitable amount was diluted 2000 times by PBS for detection of concentration of siRNA. Each sample was repeated in triplicate. A.sub.260 value was detected by UV-Vis Spectrophotometer to calculate actual concentration of ApoB-siRNA stock solution.

    [0195] The empty liposome vesicles at desired volume was added into 50 mL Falcon tube to prebalance in water bath at 35 C. for 4-5min. The ApoB-siRNA stock solution was formulated to siRNA/formulation buffer/ethanol solution to make sure that ethanol was comprised of 30% relative to total volume. The siRNA/formulation buffer/ethanol solution was slowly added to the empty liposome vesicles and incubated at 35 C. for 30min. After incubation, 600 L incubated product was used for A.sub.260 analysis. The siRNA liposome formulation was subject to dialysis overnight by using dialysis bag MD24 in 1 PBS. The dialyzed product was recovered and filtered by using a 0.2 m needle filter to remove bacteria. After removing bacteria, 600 L product was used for detection of encapsulation efficiency.

    [0196] 2.4 Detection of Encapsulation Efficiency

    [0197] 300 L product from which bacteria was removed passes through Vivapure D Mini H (ion exchange column), to obtain post-chromatography sample. The remainder 300 L product from which bacteria was removed was used as the sample without chromatography. The actual concentration coefficient (mg/mL) was calculated according to the actual A.sub.260 value, i.e., the actual concentration coefficient (mg/mL)=volume of the added ApoB-siRNA stock solution (mL)actual concentration of ApoB-siRNA stock solution (mg/mL)0.03 (mL)1000/(total volume of siRNA liposome formulation (mL)A.sub.260 value of incubated product1.1 (mL)). The encapsulation efficiency was calculated according to siRNA concentration. The encapsulation efficiency can be defined as encapsulation efficiency=(the medicaments encapsulated in the liposome/total amount of the medicaments in the liposome formulation)100%. The encapsulation efficiency can be calculated according to the equation: encapsulation efficiency=siRNA concentration of the post-chromatography sample/siRNA concentration of the sample without chromatography.


    Loading efficiency=(the amount of the medicaments encapsulated in the liposome/liposome+total amount of the medicaments in the liposome formulation)100%. 2.5

    [0198] 2.6 Detection of pKa of the Empty Liposome Vesicles

    [0199] The fluorescent dye TNS radiated no luminescence or weak luminescence in aqueous solution, while it radiated strong luminescence in organic environment. pKa value of the empty liposome vesicles can be detected by taking advantage of fluorescent characteristics of TNS. When TNS with negative charges was added into the solution of cationic liposomes, it aggregated on the surfaces of the liposomes to radiate fluorescence; while free TNS in the aqueous solution radiated no luminescence. Therefore, the fluorescent density of the solution (within a certain concentration range) exhibited positive proportion to the amount of the positive charges on the surfaces of the liposomes. As such, ionization extent of amino in the cation liposomes can be obtained by detecting the fluorescent density. According to the definition of the dissociation constant, when the ionization extent of the weak acid in the solution arrived at 50%, the pH value of the solution was the pKa value of the weak acid. Therefore, according to the diagram of the fluorescent density relative to the pH value, pH value corresponding to the middle point of the fluorescent density was the apparent pKa value of the cation solution.

    [0200] The particular detection method included: [0201] 1) adding 2 mL PBS solution to each sample flask and adjusting pH values of PBS solution in each sample flask to various pH values (2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0 respectively) by HCl and NaOH; [0202] 2) adding to each sample flask 80 L 250 mM 4-morpholine ethanesulfonic acid solution, 80 L 250 mM HEPES solution, 80 L 250 mM ammonium acetate solution, 80 L 3.85 M sodium chloride solution and 60 L PFV in turn; [0203] 3) adding 40 mL 83.5 M TNS solution to the sample flask containing PBS solution at pH value of 2.5 and stirring for 30 s, then removing the solution and measuring the fluorescent density thereof by using fluorospectro photometer (excitation wavelength is 321 nm, emission wavelength is 445 nm); [0204] 4) according to the steps as mentioned above, measuring fluorescent density of TNS under various pH values, plotting a diagram with horizontal axis of pH value and vertical axis of fluorescent density, wherein pH value corresponding to the middle point of the fluorescent density is apparent pKa value of PFV, thereby obtaining pKa value.

    [0205] 2.7 Analysis of Particle Size

    [0206] Particle sizes of the empty liposome vesicles and siRNA liposome formulations were measured by Nicomp 370 particle size analyser.

    [0207] Table 2 listed the particle sizes, pKa values of the empty liposome vesicles prepared as mentioned above and encapsulation efficiencies and loading efficiencies of the empty liposome vesicles for siRNA.

    TABLE-US-00003 TABLE 2 Encapsulation Loading Particle Size Efficiency Efficiencies Formulation (nm) pKa Value for siRNA for siRNA F601 63.35 5.77 65.9 68.9 F602 62.01 6.01 66.1 67.3 F603 65.09 5.93 63.4 69.4 F608 63.15 6.55 67.9 65.2 F609 69.31 7.32 55.4 68.3 F610 68.13 7.45 36.6 69.0 F504 69.35 6.31 71.5 70.3 F505 66.29 7.32 69.3 78.7 F506 65.49 7.51 65.5 76.3 F507 68.75 6.55 69.7 77.9 F510 69.33 6.54 70.9 78.6 F511 65.29 5.98 65.3 79.8 F512 69.54 6.11 68.4 80.8 F513 78.11 6.87 67.9 81.3 F518 79.21 6.73 70.2 87.5 F519 81.32 5.99 69.5 85.1 F520 80.10 6.31 71.3 88.0

    [0208] From the measurements of encapsulation efficiencies and loading efficiencies for siRNA as listed in Table 2, it can be seen that the encapsulation efficiencies and loading efficiencies for siRNA were increased as increase of the content of cationic lipid compound in the liposome formulation. The nucleic acid with negative charges loaded into the liposome formulation was increased due to increase of the content of the cationic lipid compound. Therefore, loading amount for the nucleic acid medicaments can be greatly increased by using the liposome formulation as described herein. As a result, increased amount of nucleic acid medicaments can be loaded into the unit lipid vesicles of the liposome formulation as described herein. In the case of administration of medicaments at the same dosage, intake of the cationic lipid compound was decreased due to increased loading amount for the nucleic acid medicaments, so as to decrease use of lipid and toxicity.

    EXAMPLE 3

    [0209] Efficiency of the Liposome Formulation

    [0210] 1. Reagents, Materials and Instruments

    [0211] 1.1 Reagents and Materials: liposome formulation (as prepared according to Example 2), sodium chloride injection solution (Shandong Kangning Pharmaceutical Co. Ltd.), RISO RNA extraction reagent (BIOMICS BIOTECHNOLOGIES CO., LTD), 1 mL sterilized syringe (Henan Shuguangjianshi Medical Device Co. Ltd.), total cholesterol (CHO enzyme test) detection kit (Nanjing Jiancheng Biology Co.).

    [0212] 1.2 Experiment Animals: 4-6 weeks female ICR mice, 18-22 g, purchased from Comparison Medical Center of Nantong University.

    [0213] 1.3 Instruments: LightCycler 480 Real-time fluorescence quantification PCR analyser (Roche Co., USA), UV-Vis Spectrophotometer UV759 (Shanghai Jingke Co.).

    [0214] 2. Experimental Method

    [0215] 2.1 Experimental Grouping: weighting mice body weight before administration and grouping the mice according to the body weight into 3 groups: siRNA liposome formulation treated group (Table 1), saline treated group. [0216] siRNA liposome formulation treated group: the injection amount was calculated according to 3 mg/kg of siRNA in the liposome; [0217] saline treated group: 300 L sodium chloride injection solution.

    [0218] 2.2 Administration: fixing mice by fixer and injecting liposome formulation in an amount of 3 mg/kg siRNA in the liposome formulation via tail vein of mice using 1 mL sterilized syringe; injecting 300 L sodium chloride injection solution for control group.

    [0219] 2.3 Testing of Total Cholesterol Content in Serum Of Mice

    [0220] Mice body weight was weighted at 48h upon administration. About 800 L of blood of mice was collected by removing eyes and placed at 4 C. for 1 h. Serum was separated by centrifugation at 3000 rpm for 10 min for test. Total cholesterol in 10 L separated mice serum was detected according to the instruction of the total cholesterol (CHO enzyme test) detection kit and absorbancy at 500 nm was detected.

    [0221] Cholesterol content was calculated according to the equation that cholesterol content=(A.sub.500 value of the testing sample/A.sub.500 value of the standard sample) x concentration of standard solution (200 mg/dL (5.17 mM)).

    [0222] 2.4 Real-time quantification PCR (RT-qPCR) was used to detect mRNA expression level of ApoB gene in mice liver.

    [0223] At 48 h upon injection of liposome formulation, mice were sacrificed and three blocks of tissues from various positions in liver were removed from mice. Total RNA of mice liver was extracted by using RISO RNA extraction reagent according to the manufacture's instruction. mRNA expression level of ApoB gene in mice liver was detected by RT-qPCR.

    [0224] mRNA expression level of ApoB gene in the sample was detected by using primer with gene specificity and housekeeping gene GAPDH was amplified for internal reference. ApoB gene and internal reference gene GAPDH for each sample were amplified at the same time in triplicate. OneStep qPCR kit was used for quantification of reaction. The following reaction system was established: 2 L RNA template, 12.5 L 2 Master Mix, 0.5 L for each 5-end primer (10 M) and 3-end primer (10 M), 0.5 L 50 SYBR Green I Solution. The volume of the system was supplemented to 25 L by using water without RNase. After mixing, the system was placed on the quantification PCR analyser for reaction.

    [0225] The sequence of 5-end primer for detection of mRNA of ApoB gene was AAGCACCTCCGAAAGTACGTG, and the sequence of 3-end primer for detection of mRNA of ApoB gene is CTCCAGCTCTACCTTACAGTTGA. The sequence of 5-end primer for detection of the housekeeping gene GAPDH was GTATGACTCCACTCACGGCAAA and the sequence of 3-end primer for detection of the housekeeping gene GAPDH was GGTCTCGCTCCTGGAAGATG. All of the primers were synthesized by BIOMICS BIOTECHNOLOGIES CO., LTD.

    [0226] Reaction condition comprises: reverse transcription for 30 min at 42 C., initial denaturation for 5 min at 95 C., denaturation for 20 sec at 95 C., anneal for 30 sec at 58 C., extension for 30 sec at 72 C., circulation for 45 times. Dissolution curve reaction is performed under95 C./5 min, 58 C./5 min and the temperature is increased to 95 C. at 0.5 C./5 sec.

    [0227] 2.5 Statistical Analysis

    [0228] SPSS 14.0 statistical software was used and the data was shown as xs. Significant difference among groups was detected by single factor variance analysis. Comparison between two groups was performed by t test. P value<0.05 was considered to be statistically significant.

    [0229] 3. Experimental Results

    [0230] 3.1 Variation of mice body weight. Variation of mice body weight before and after injection of liposome formulation was detected to indirectly reflect toxicity. As shown in FIG. 1, no significant variation of mice body weight was shown in each group before and after administration, indicating that the liposome formulation as described herein had no significant toxicity.

    [0231] 3.2 Variation of mRNA level of ApoB gene. As shown in FIG. 2, the liposome formation as described herein effectively inhibited expression of ApoB mRNA in liver.

    [0232] 3.3 Variation of total cholesterol content. As shown in FIG. 3, in comparison with the control group, the total cholesterol level in serum of mice was decreased by using the liposome formulation as described herein.

    [0233] In sum, it can be seen that the liposome formulation of the present invention was able to deliver nucleic acid medicaments such as siRNA to target tissues or organs so as to facilitate the nucleic acid medicaments to play their role.

    EXAMPLE 4

    [0234] 1. Preparation of Liposome Formulation with siRNAs Encapsulated Therein

    [0235] 1.1 The cationic lipid compound consisted of lipid compound CL52 and cholesterol lipid compound CL68. Phospholipid was DSPC purchased from Shanghai Shanghai Advanced Vehicle Technology L.T.D. Co. The PEGylated lipid was PEG-c-DMA.

    [0236] 1.2 The liposome formulation with siRNAs encapsulated therein was prepared according to the steps as described in Example 2 and parameters were detected. The ratios of the lipid-type lipid compound to the cholesterol lipid compound were listed in Table 3. Table 4 listed particle sizes and pKa values of the liposome formulations and the encapsulation efficiencies and loading efficiencies of the liposome formulations with siRNA encapsulated therein.

    TABLE-US-00004 TABLE 3 Content of cationic Lipid-type lipd lipid compound:Cholesterol Cholesterol Formu- compound lipid Lipid lipid lations (%) compound compound compound F611 40 2:1 CL52 CL68 F612 60 2:1 CL52 CL68 F613 80 2:1 CL52 CL68 F614 90 2:1 CL52 CL68

    TABLE-US-00005 TABLE 4 siRNA siRNA Encapsulation Loading Formulations Particle Size (nm) pKa value Efficiency Efficiency F611 88.30 6.52 66.3 48.1 F612 85.49 6.87 60.8 67.3 F613 79.63 6.51 79.3 79.5 F614 69.97 6.79 75.6 87.9

    [0237] From the above table 4, it can be seen that siRNA encapsulation efficiency and loading efficiency were increased with increase of the content of cationic lipid compound in the liposome formulation. This indicated that the nucleic acid with negative charges loaded into the liposome was increased due to the increase of the the content of cationic lipid compound. Therefore, the loading efficiency for nucleic acid medicaments was greatly increased by using the liposome formulation as described herein. Therefore, increased nucleic acid medicament was loaded into the unit lipid vesicles of the liposome formulation as described herein. At the same dosage, intake of cationic lipid compound was decreased due to increased loading amount, thereby reducing use of the lipid and toxicity.

    [0238] 2. Efficiency of the Liposome Formulation with siRNAs Encapsulated Therein

    [0239] The efficiency of the liposome formulation with siRNAs encapsulated therein as prepared in this example was detected according to the method as described in Example 3.

    [0240] 3. Experimental Results

    [0241] 3.1 Variation of mice body weight. As shown in FIG. 4, no significant variation of mice body weight was shown in each group before and after administration, indicating that the liposome formulation as described herein had no significant toxicity.

    [0242] 3.2 Variation of mRNA level of ApoB. As shown in FIG. 5, the liposome formation as described herein effectively inhibited expression of ApoB mRNA in liver.

    [0243] 3.3 Variation of total cholesterol content. As shown in FIG. 6, in comparison with control group, the total cholesterol level in serum of mice was decreased by using the liposome formulation as described herein.

    [0244] In sum, it can be seen that the liposome formulation of the present invention was able to deliver nucleic acid medicaments such as siRNA to target tissues or organs so as to facilitate the nucleic acid medicaments to play their role.

    EXAMPLE 5

    [0245] 1. Preparation of Liposome Formulation with siRNAs Encapsulated Therein

    [0246] 1.1 The cationic lipid compound consisted of lipid compound CL53 and cholesterol lipid compound CL68. Phospholipid was DSPC purchased from Shanghai Advanced Vehicle Technology L.T.D. Co. The PEGylated lipid was PEG-c-DMA.

    [0247] 1.2 The liposome formulation with siRNAs encapsulated therein was prepared according to the steps as described in Example 2. The lipid-type lipid compounds were listed in Table 5. Table 6 listed particle sizes and pKa values of the liposome formulations and the encapsulation efficiencies and loading efficiencies of the liposome formulations with siRNA encapsulated therein.

    TABLE-US-00006 TABLE 5 Content of cationic Lipid-type lipd lipid compound:Cholesterol Cholesterol Formu- compound lipid Lipid lipid lation (%) compound compound compound F615 40 2:1 CL53 CL68 F616 60 2:1 CL53 CL68 F617 80 2:1 CL53 CL68 F618 90 2:1 CL53 CL68

    TABLE-US-00007 TABLE 6 siRNA siRNA Particle Size Encapsulation Loading Formulation (nm) pKa value Efficiencies Efficiencies F615 68.12 6.55 56.5 51.3 F616 65.56 6.67 60.8 65.3 F617 69.34 6.59 69.5 78.5 F618 67.37 6.63 67.7 89.3

    [0248] From the above table 6, it can be seen that siRNA encapsulation efficiency and loading efficiency were increased with increase of the content of cationic lipid compound in the liposome formulation. This indicated that the nucleic acid with negative charges loaded into the liposome was increased due to increase of the content of the cationic lipid compound. Therefore, the loading efficiency for nucleic acid medicaments was greatly increased by using the liposome formulation as described herein. As such, increased nucleic acid medicament was loaded into the unit lipid vesicle of the liposome formulation as described herein. At the same dosage, intake of cationic lipid compound was decreased due to increased loading amount, thereby reducing use of the lipid and toxicity.

    [0249] 2. Efficiency of the Liposome Formulation with siRNAs Encapsulated Therein

    [0250] The efficiency of the liposome formulation with siRNAs encapsulated therein as prepared in this example was detected according to the method as described in Example 3.

    [0251] 3. Experimental Results

    [0252] 3.1 Variation of mice body weight. As shown in FIG. 7, no significant variation of mice body weight was shown in each group before and after administration, indicating that the liposome formulation as described herein had no significant toxicity.

    [0253] 3.2 Variation of mRNA level of ApoB. As shown in FIG. 8, the liposome formation as described herein effectively inhibited expression of ApoB mRNA in liver.

    [0254] 3.3 Variation of total cholesterol content. As shown in FIG. 9, in comparison with control group, the total cholesterol level in serum of mice was decreased by using the liposome formulation as described herein.

    [0255] In sum, it can be seen that the liposome formulation of the present invention was able to deliver nucleic acid medicaments such as siRNA to target tissues or organs so as to facilitate the nucleic acid medicaments to play their role.

    EXAMPLE 6

    [0256] 1. Preparation of Liposome Formulation with siRNAs Encapsulated Therein

    [0257] 1.1 The cationic lipid compound consisted of lipid compound CL54 and cholesterol lipid compound CL68. Phospholipid was DSPC purchased from Shanghai Advanced Vehicle Technology L.T.D. Co. The PEGylated lipid was PEG-c-DMA.

    [0258] 1.2 The liposome formulation with siRNAs encapsulated therein was prepared according to the steps as described in Example 2. The ratios of the lipid-type lipid compound to the cholesterol lipid compound were listed in Table 7. Table 8 listed particle sizes and pKa values of the liposome formulations and the encapsulation efficiencies and loading efficiencies of the liposome formulations with siRNAs encapsulated therein.

    TABLE-US-00008 TABLE 7 Content of cationic Lipid-type lipd lipid compound:Cholesterol Cholesterol Formu- compound lipid Lipid lipid lation (%) compound compound compound F619 40 2:1 CL54 CL68 F620 60 2:1 CL54 CL68 F621 80 2:1 CL54 CL68 F622 90 2:1 CL54 CL68

    TABLE-US-00009 TABLE 8 siRNA siRNA Encapsulation Loading Formulation Particle Size (nm) pKa Value Efficiency Efficiency F619 78.29 7.51 66.3 49.5 F620 83.33 6.97 50.2 55.3 F621 79.49 6.83 59.5 68.5 F622 77.73 6.68 61.9 79.8

    [0259] From the above table 8, it can be seen that siRNA encapsulation efficiency and loading efficiency were increased with increase of the content of cationic lipid compound in the liposome formulation. This indicated that the nucleic acid with negative charges loaded into the liposome was increased due to increase of the content of the cationic lipid compound. Therefore, the loading efficiency for nucleic acid medicaments was greatly increased by using the liposome formulation as described herein. As such, increased nucleic acid medicament was loaded into the unit lipid vesicles of the liposome formulation as described herein. At the same dosage, intake of cationic lipid compound was decreased due to increased loading amount, thereby reducing use of the lipid and toxicity.

    [0260] 2. Efficiency of the Liposome Formulation with siRNAs Encapsulated Therein

    [0261] The efficiency of the liposome formulation with siRNAs encapsulated therein as prepared in this example was detected according to the method as described in Example 3.

    [0262] 3. Experimental Results

    [0263] 3.1 Variation of mice body weight. As shown in FIG. 10, no significant variation of mice body weight was shown in each group before and after administration, indicating that the liposome formulation as described herein had no significant toxicity.

    [0264] 3.2 Variation of mRNA level of ApoB. As shown in FIG. 11, the liposome formation as described herein effectively inhibited expression of ApoB mRNA in liver.

    [0265] 3.3 Variation of total cholesterol content. As shown in FIG. 12, in comparison with control group, the total cholesterol level in serum of mice was decreased by using the liposome formulation as described herein.

    [0266] In sum, it can be seen that the liposome formulation of the present invention was able to deliver nucleic acid medicaments such as siRNA to target tissues or organs so as to facilitate the nucleic acid medicaments to play their role.

    EXAMPLE 7

    [0267] 1. Preparation of Liposome Formulation with siRNAs Encapsulated Therein

    [0268] 1.1 The cationic lipid compound consisted of lipid compound CL55 and cholesterol lipid compound CL68. Phospholipid was DSPC purchased from Shanghai Advanced Vehicle Technology L.T.D. Co. The PEGylated lipid was PEG-c-DMA.

    [0269] 1.2 The liposome formulation with siRNAs encapsulated therein was prepared according to the steps as described in Example 2. The ratios of the lipid-type lipid compound to the cholesterol lipid compound were listed in Table 9. Table 10 listed particle sizes and pKa values of the liposome formulations and the encapsulation efficiencies and loading efficiencies of the liposome formulations with siRNAs encapsulated therein.

    TABLE-US-00010 TABLE 9 Content of cationic Lipid-type lipd lipid compound:cholesterol cholesterol compound lipid Lipid lipid Formulation (%) compound compound compound F623 40 2:1 CL55 CL68 F624 60 2:1 CL55 CL68 F625 80 2:1 CL55 CL68 F626 90 2:1 CL55 CL68

    TABLE-US-00011 TABLE 10 siRNA siRNA Encapsulation Loading Formulation Particle Size (nm) pKa Value Efficiency Efficiency F623 68.93 6.95 58.3 46.3 F624 73.13 6.93 65.2 58.3 F625 76.64 6.53 69.5 63.2 F626 79.31 6.48 71.9 89.8

    [0270] From the above table 10, it can be seen that siRNA encapsulation efficiency and loading efficiency were increased with increase of the content of cationic lipid compound in the liposome formulation. This indicated that the nucleic acid with negative charges loaded into the liposome was increased due to increase of the content of the cationic lipid compound. Therefore, the loading efficiency for nucleic acid medicaments was greatly increased by using the liposome formulation as described herein. As such, increased nucleic acid medicament was loaded into the unit lipid vesicle of the liposome formulation. At the same dosage, intake of cationic lipid compound was decreased due to increased loading amount, thereby reducing use of the lipid and toxicity.

    [0271] 2. Efficiency of the Liposome Formulation with siRNA Encapsulated Therein

    [0272] The efficiency of the liposome formulation with siRNA encapsulated therein as prepared in this example was detected according to the method as described in Example 3.

    [0273] 3. Experimental Results

    [0274] 3.1 Variation of mice body weight. As shown in FIG. 13, no significant variation of mice body weight was shown in each group before and after administration, indicating that the liposome formulation as described herein had no significant toxicity.

    [0275] 3.2 Variation of mRNA level of ApoB. As shown in FIG. 14, the liposome formation as described herein effectively inhibited expression of ApoB mRNA in liver.

    [0276] 3.3 Variation of total cholesterol content. As shown in FIG. 15, in comparison with control group, the total cholesterol level in serum of mice was decreased by using the liposome formulation as described herein.

    [0277] In sum, it can be seen that the liposome formulation of the present invention was able to deliver nucleic acid medicaments such as siRNA to target tissues or organs so as to facilitate the nucleic acid medicaments to play their role.

    EXAMPLE 8

    [0278] 1. Preparation of Liposome Formulation with siRNAs Encapsulated Therein

    [0279] 1.1 The cationic lipid compound consisted of lipid compound CL56 and cholesterol lipid compound CL68. Phospholipid was DSPC purchased from Shanghai Advanced Vehicle Technology L.T.D. Co. The PEGylated lipid was PEG-c-DMA.

    [0280] 1.2 The liposome formulation with siRNAs encapsulated therein was prepared according to the steps as described in Example 2. The ratios of the lipid-type lipid compound to the cholesterol lipid compound were listed in Table 11. Table 12 listed particle sizes and pKa values of the liposome formulations and the encapsulation efficiencies and loading efficiencies of the liposome formulations with siRNAs encapsulated therein.

    TABLE-US-00012 TABLE 11 Content of cationic Lipid-type lipd lipid compound:Cholesterol Cholesterol Formu- compound lipid Lipid lipid lation (%) compound compound compound F627 40 2:1 CL56 CL68 F628 60 2:1 CL56 CL68 F629 80 2:1 CL56 CL68 F630 90 2:1 CL56 CL68

    TABLE-US-00013 TABLE 12 siRNA siRNA Encapsulation Loading Formulation Particle Size (nm) pKa Value Efficiency Efficiency F627 88.12 7.11 48.2 49.3 F628 86.53 7.23 45.3 60.3 F629 66.64 6.59 59.2 75.2 F630 99.19 6.68 68.3 86.7

    [0281] From the above table 12, it can be seen that siRNA encapsulation efficiency and loading efficiency were increased with increase of the content of cationic lipid compound in the liposome formulation. This indicated that the nucleic acid with negative charges loaded into the liposome was increased due to increase of the content of the cationic lipid compound. Therefore, the loading efficiency for nucleic acid medicaments was greatly increased by using the liposome formulation as described herein. As such, increased nucleic acid medicament was loaded into the unit lipid vesicle of the liposome formulation. At the same dosage, intake of cationic lipid compound was decreased due to increased loading amount, thereby reducing use of the lipid and toxicity.

    [0282] 2. Efficiency of the Liposome Formulation with siRNA Encapsulated Therein

    [0283] The efficiency of the liposome formulation with siRNA encapsulated therein was detected according to the method as described in Example 3.

    [0284] 3. Experimental Results

    [0285] 3.1 Variation of mice body weight. As shown in FIG. 16, no significant variation of mice body weight was shown in each group before and after administration, indicating that the liposome formulation as described herein had no significant toxicity.

    [0286] 3.2 Variation of mRNA level of ApoB. As shown in FIG. 17, the liposome formation as described herein effectively inhibited expression of ApoB mRNA in liver.

    [0287] 3.3 Variation of total cholesterol content. As shown in FIG. 18, in comparison with control group, the total cholesterol level in serum of mice was decreased by using the liposome formulation as described herein.

    [0288] In sum, it can be seen that the liposome formulation of the present invention was able to deliver nucleic acid medicaments such as siRNA to target tissues or organs so as to facilitate the nucleic acid medicaments to play their role.