Primers, Methods and Kits for Diagnosing and Predicting Therapy Response of Cancers by Cold-PCR Based Amplification of Mutation-Rich Regions of KRAS, EGFR and P53
20190382848 ยท 2019-12-19
Inventors
Cpc classification
C12Q2563/173
CHEMISTRY; METALLURGY
C12Q2563/173
CHEMISTRY; METALLURGY
International classification
Abstract
Nucleic acids primers for use in the detection of mutations in KRAS, EGFR and P53 associated with cancer, and in particular provides nucleic acids and methods employing reaction conditions suitable for use in COLD-PCR and high resolution melting HRM analysis of circulating tumour DNA, particularly from lung and colon cancers. The invention further relates to a combination of KRAS and APC mutations in diagnosing cancer.
Claims
1. A chemically synthesized nucleic acid of less than 50 nucleotides in length comprising any one of the following sequences: TABLE-US-00036 [SEQIDNO:1] AAAACAAGATTTACCTCTATTGTTGGA [SEQIDNO:2] AGGCCTGCTGAAAATGACTG [SEQIDNO:3] GTTAAAATTCCCGTCGCTATCA [SEQIDNO:4] GACCCCCACACAGCAAA [SEQIDNO:5] AAGTTAAAATTCCCGTCGCTATC [SEQIDNO:6] GCAGCATGTCAAGATCACAGA [SEQIDNO:7] TGCCTCCTTCTGCATGGTAT [SEQIDNO:8] AACCAGCCCTGTCGTCTCT [SEQIDNO:9] CAAGCAGTCACAGCACATGA [SEQIDNO:10] CTGAGCAGCGCTCATGGT [SEQIDNO:11] GTGCAGCTGTGGGTTGATTC [SEQIDNO:12] GGGGGTGTGGAATCAAC [SEQIDNO:13] ACTTGTGCCCTGACTTTCAA [SEQIDNO:14] CAGTTGCAAACCAGACCTCA [SEQIDNO:15] GGCCTCTGATTCCTCACTGAT [SEQIDNO:16] GGCTCCTGACCTGGAGTCTT [SEQIDNO:17] CTTGGGCCTGTGTTATCTCC [SEQIDNO:18] TCTTGCGGAGATTCTCTTCC [SEQIDNO:19] GCCTCTTGCTTCTCTTTTCCT [SEQIDNO:20] GCTTCTTGTCCTGCTTGCTT [SEQIDNO:21] CTACTGGGACGGAACAGCTT; or a sequence with greater than 80% homology to any one of the above sequences.
2. A method for detecting the presence of a mutation in the KRAS gene, and/or the p53 gene, and/or the EGFR gene in a sample obtained from a subject, the method comprising amplification of the region of interest using any two of the nucleic acids of claim 1, wherein: TABLE-US-00037 [SEQIDNO:1] AAAACAAGATTTACCTCTATTGTTGGA and [SEQIDNO:2] AGGCCTGCTGAAAATGACTG areusedtoamplifytheKRASlocus; [SEQIDNO:3] GTTAAAATTCCCGTCGCTATCA and [SEQIDNO:4] GACCCCCACACAGCAAA areusedtoamplifytheEGFRexon19locus; [SEQIDNO:5] AAGTTAAAATTCCCGTCGCTATC and [SEQIDNO:4] GACCCCCACACAGCAAA areusedtoamplifytheEGFRexon19locus; [SEQIDNO:6] GCAGCATGTCAAGATCACAGA and [SEQIDNO:7] TGCCTCCTTCTGCATGGTAT areusedtoamplifytheEGFRexon21locus; [SEQIDNO:8] AACCAGCCCTGTCGTCTCT and [SEQIDNO:9] CAAGCAGTCACAGCACATGA areusedtoamplifythep53exon5-1locus; [SEQIDNO:10] CTGAGCAGCGCTCATGGT and [SEQIDNO:11] GTGCAGCTGTGGGTTGATTC areusedtoamplifythep53exon5-2locus; [SEQIDNO:12] GGGGGTGTGGAATCAAC and [SEQIDNO:13] ACTTGTGCCCTGACTTTCAA areusedtoamplifythep53exon5-3locus; [SEQIDNO:14] CAGTTGCAAACCAGACCTCA and [SEQIDNO:15] GGCCTCTGATTCCTCACTGAT areusedtoamplifythep53exon6locus; [SEQIDNO:16] GGCTCCTGACCTGGAGTCTT and [SEQIDNO:17] CTTGGGCCTGTGTTATCTCC areusedtoamplifythep53exon7locus; [SEQIDNO:18] TCTTGCGGAGATTCTCTTCC and [SEQIDNO:19] GCCTCTTGCTTCTCTTTTCCT areusedtoamplifythep53exon8-1locus;and [SEQIDNO:20] GCTTCTTGTCCTGCTTGCTT and [SEQIDNO:21] CTACTGGGACGGAACAGCTT areusedtoamplifythep53exon8-2locus.
3. The method of claim 2 wherein the amplification is performed by PCR, optionally wherein the PCR is COLD-PCR.
4. The method of claim 3 wherein: where the target is KRAS and the nucleic acids are AAAACAAGATTTACCTCTATTGTTGGA [SEQ ID NO:1] and AGGCCTGCTGAAAATGACTG [SEQ ID NO: 2], the Tc of the COLD-PCR is 79 C., optionally wherein the denaturing time is 3 seconds; where the target is EGFR and the nucleic acids are GTTAAAATTCCCGTCGCTATCA [SEQ ID NO: 3] and GACCCCCACACAGCAAA [SEQ ID NO: 4], the Tc of the COLD-PCR is 78.5 C.; where the target is EGFR and the nucleic acids are AAGTTAAAATTCCCGTCGCTATC [SEQ ID NO: 5] and GACCCCCACACAGCAAA [SEQ ID NO: 4], the Tc of the COLD-PCR is 78.5 C.; where the target is EGFR and the nucleic acids are GCAGCATGTCAAGATCACAGA [SEQ ID NO: 6] and TGCCTCCTTCTGCATGGTAT [SEQ ID NO: 7] the Tc of the COLD-PCR is 86.5 C.; where the target is p53 and the nucleic acids are AACCAGCCCTGTCGTCTCT [SEQ ID NO: 8] and CAAGCAGTCACAGCACATGA [SEQ ID NO: 9] the Tc of the COLD-PCR is 86.7 C., optionally wherein the denaturing time is 10 seconds; where the target is p53 and the nucleic acids are CTGAGCAGCGCTCATGGT [SEQ ID NO: 10] and GTGCAGCTGTGGGTTGATTC [SEQ ID NO: 11] the Tc of the COLD-PCR is 89 C., optionally wherein the denaturing time is 10 seconds; where the target is p53 and the nucleic acids are GGGGGTGTGGAATCAAC [SEQ ID NO: 12] and ACTTGTGCCCTGACTTTCAA [SEQ ID NO: 13] the Tc of the COLD-PCR is 83 C., optionally wherein the denaturing time is 10 seconds; where the target is p53 and the nucleic acids are CAGTTGCAAACCAGACCTCA [SEQ ID NO: 14] and GGCCTCTGATTCCTCACTGAT [SEQ ID NO: 15] the Tc of the COLD-PCR is 87.5 C., optionally wherein the denaturing time is 3 seconds; where the target is p53 and the nucleic acids are GGCTCCTGACCTGGAGTCTT [SEQ ID NO: 16] and CTTGGGCCTGTGTTATCTCC [SEQ ID NO: 17] the Tc of the COLD-PCR is 83.5 C., optionally wherein the denaturing time is 10 seconds; where the target is p53 and the nucleic acids are TCTTGCGGAGATTCTCTTCC [SEQ ID NO: 18] and GCCTCTTGCTTCTCTTTTCCT [SEQ ID NO: 19] the Tc of the COLD-PCR is 81.8 C., optionally wherein the denaturing time is 20 seconds; where the target is p53 and the nucleic acids are GCTTCTTGTCCTGCTTGCTT [SEQ ID NO: 20] and CTACTGGGACGGAACAGCTT [SEQ ID NO: 21] the Tc of the COLD-PCR is 85.3 C., optionally wherein the denaturing time is 10 seconds;
5. The method of any of claims 2 and 3 wherein the reaction cycle is: a) TABLE-US-00038 Stage Temp Time Cycles Activation 95 C. 5 min 1 Pre-PCR 95 C. 10 sec 20 55 C. 30 sec 72 C. 10 sec COLD 79 C. 3 sec 40/45 55 C. 30 sec 72 C. 10 sec HRM 68-90 1 where the target is KRAS and the reaction is fast COLD-PCR; b) TABLE-US-00039 Stage Temp Time Cycles Activation 95 C. 5 min 1 Pre-PCR 95 C. 10 sec 20 60 C. 1 min COLD 95 C. 10 sec 40/45 70 C. 5 min 79.5 C. 3 sec 55 C. 30 sec 72 C. 10 sec HRM 68-90 1 where the target is KRAS and the reaction in full COLD-PCR; c) TABLE-US-00040 Stage Temp Time Cycles Activation 95 C. 5 min 1 Pre-PCR 95 C. 10 sec 20 55 C. 30 sec 72 C. 10 sec COLD 78.5 C. 3 sec 40/45 55 C. 30 sec 72 C. 10 sec HRM 68-90 1 where the target is EGFR exon 19 and the reaction is fast COLD-PCR; d) TABLE-US-00041 Stage Temp Time Cycles Activation 95 C. 5 min 1 Pre-PCR 95 C. 10 sec 20 60 C. 1 min COLD 95 C. 10 sec 40/45 70 C. 5 min 86 C. 3 sec 55 C. 30 sec 72 C. 10 sec HRM 68-90 1 where the target is EGFR exon 21 and the reaction is full COLD-PCR; e) TABLE-US-00042 Stage Temp Time Cycles Activation 95 C. 5 min 1 Pre-PCR 95 C. 10 sec 20 55 C. 30 sec 72 C. 10 sec COLD Tc C. 40/45 SEQ ID NO: 8 and 9 - 86.7 C. 10 sec SEQ ID NO: 10 and 11 - 89 C. 10 sec SEQ ID NO: 12 and 13 - 83 C. 10 sec SEQ ID NO: 14 and 15 - 87.5 C. 3 sec SEQ ID NO: 16 and 17 - 83.5 C. 10 sec SEQ ID NO: 18 and 19 - 81.8 C. 20 sec SEQ ID NO: 20 and 21 - 85.3 C. 10 sec 55 C. 30 sec 72 C. 10 sec HRM 68-90 1 Where the target is p53 and the reaction is fast COLD-PCR.
6. The method of any of claims 2-5 wherein the presence of the mutation is detected by high resolution melt curve analysis or sequencing or RT-PCR.
7. The method of any of claims 2-6 wherein the presence of a mutation is used to determine appropriate treatment.
8. The method of claim 7 wherein where a cancer is determined to be positive for one or more EGFR mutations, the appropriate treatment is considered to be Gefitinib, Erlotinib or Afatanib, and/or where a cancer is determined to be positive for one or more EGFR mutations, the appropriate treatment is not considered to be panitumumab and cetuximab.
9. The method of any of claims 2-8 wherein the method further comprises administration to the subject of a suitable therapeutic.
10. The method of any of claims 2-9 further comprising the determination of the presence or absence of a mutation in one or more of the APC BRAF, ALK, PIK3CA, DDR2, HER2, FGFR1, MAP2K1, MET, NRAS, NTRK1, PTEN, RET, ROS1 genes.
11. The method of any of claims 2-10 wherein the mutation is a point mutation, deletion mutation, or insertion mutation.
12. The method of any of claims 2-11 wherein the PCR is carried out on circulating tumour DNA, optionally wherein the circulating tumour DNA is extracted from plasma.
13. The method of any of claims 2-12 wherein the sample is a tumour biopsy sample.
14. The method of any of claims 2-13 wherein the presence of more than one mutation is assessed.
15. The method of any of claims 2-14 wherein the presence of one or more mutations in more than one gene is assessed.
16. A method for characterising a tumour of a subject comprising determining the presence or absence of a mutation in the KRAS locus, according to the method of any of claims 2-15, and further comprising the determination of the presence or absence of a mutation in the APC gene.
17. The method of 16 wherein a KRAS mutation in the absence of an APC mutation is considered to indicate a high likelihood of developing a self-limiting hyperplastic or borderline lesion; and the presence of both a mutation in the APC gene and the KRAS gene is considered to indicate a high likelihood of developing cancer.
18. The method of 16 and 17 wherein where the mutation in the APC gene is known to occur prior to the mutation in the KRAS gene, the subject is deemed likely to have or develop cancer.
19. A method of predicting the likelihood of a subject developing cancer, optionally colorectal cancer, wherein the subject is assessed for mutation in both the KRAS and APC gene over a period of time.
20. A method for determining a subject's suitability for treatment with an anti-EGFR therapy, comprising assessing the presence or absence of a mutation in the EGFR and/or KRAS gene according to any of claims 2-15.
21. The method of claim 20 wherein where the subject is found to have a mutation in the EGFR gene the subject is deemed suitable for EGFR therapy.
22. The method of any of claims 20 and 21 wherein where the subject is found to have a mutation in the KRAS gene, the subject is not deemed to be suitable for anti-EGFR therapy.
23. A method of treating a subject for cancer, wherein the method comprises determination of the presence or absence of a mutation in the KRAS, p53 and/or EGFR gene according to any of claims 2-15, and further comprising the administration of a therapeutic agent if a mutation is identified, wherein the choice of therapeutic agent is determined based on the determined mutation profile.
24. A method of diagnosing a subject with cancer, or a pre-cancerous lesion, comprising the determination of the presence or absence of a mutation in the KRAS, p53 and/or EGFR gene according to any of claims 2-15, wherein the presence of a mutation indicates that the subject is likely to have, or to develop, cancer.
25. The method of claim 24 wherein the subject is assessed for other mutations or symptoms or physical presence of cancer.
26. The method of any of claims 16-25 wherein the method is performed on a sample of circulating tumour DNA, optionally wherein the circulating tumour DNA is extracted from plasma.
27. The method of any of claims 16-25 wherein the method is performed on a sample of a tumour biopsy sample.
28. Gefitinib, Erlotinib or Afatanib for use in treating cancer wherein the subject has been determined to be suitable for treatment with Gefitinib, Erlotinib or Afatanib according to the method of claim 7 or 8.
29. Use of Gefitinib, Erlotinib or Afatanib for use in the manufacture of a medicament for use in treating cancer, wherein the subject has been determined to be suitable for treatment with Gefitinib, Erlotinib or Afatanib according to the method of claim 7 or 8.
30. A kit of parts comprising any one of the nucleic acids of claim 1.
31. The kit according to claim 30 wherein the kit comprises any two of the nucleic acids of claim 1, optionally wherein the any two comprises nucleic acids with: TABLE-US-00043 [SEQIDNO:1] AAAACAAGATTTACCTCTATTGTTGGA and [SEQIDNO:2 AGGCCTGCTGAAAATGACTG; [SEQIDNO:3] GTTAAAATTCCCGTCGCTATCA and [SEQIDNO:4] GACCCCCACACAGCAAA; [SEQIDNO:5] AAGTTAAAATTCCCGTCGCTATC and [SEQIDNO:4] GACCCCCACACAGCAAA; [SEQIDNO:6] GCAGCATGTCAAGATCACAGA and [SEQIDNO:7] TGCCTCCTTCTGCATGGTAT; [SEQIDNO:8] AACCAGCCCTGTCGTCTCT and [SEQIDNO:9] CAAGCAGTCACAGCACATGA; [SEQIDNO:10] CTGAGCAGCGCTCATGGT and [SEQIDNO:11] GTGCAGCTGTGGGTTGATTC; [SEQIDNO:12] GGGGGTGTGGAATCAAC and [SEQIDNO:13] ACTTGTGCCCTGACTTTCAA; [SEQIDNO:14] CAGTTGCAAACCAGACCTCA and [SEQIDNO:15] GGCCTCTGATTCCTCACTGAT; [SEQIDNO:16] GGCTCCTGACCTGGAGTCTT and [SEQIDNO:17] CTTGGGCCTGTGTTATCTCC; [SEQIDNO:18] TCTTGCGGAGATTCTCTTCC and [SEQIDNO:19] GCCTCTTGCTTCTCTTTTCCT; [SEQIDNO:20] GCTTCTTGTCCTGCTTGCTT and [SEQIDNO:21] CTACTGGGACGGAACAGCTT.
32. The kit according to any of claims 30 and 31 wherein the kit further comprises one or more control samples, optionally wherein the control samples comprise the wild type and/or the mutant version of each PCR product generated by each pair of primers.
33. The kit according to any of claims 30-32 wherein the kit comprises standard curves generated by each mutant PCR product.
34. The kit according to any of claims 30 to 33 further comprising PCR reagents and/or detection reagents.
35. The kit according to any of claims 30-34 comprising any two of the nucleic acids of claim 1, optionally any 3, or any 4, or any 5, or any 6, or any 7, or any 8, or any 9, or any 10, or any 11, or any 12, or any 13, or any 14, or any 15, or any 16, or any 17, or any 18, or any 19, or any 20, or any 21 nucleic acids according to claim 1.
36. The kit according to any of claims 30-35 further comprising reaction wells, optionally a reaction plate, optionally a microtitre plate.
37. An anticancer agent for use in the treatment of a subject with cancer wherein the subject is assessed as being suitable for the treatment according to the method of claim 7 or 8.
Description
FIGURE LEGENDS
[0151] For all difference curve graphsThe curves on the graph (identified in the graph legends as variant 1, variant 2 etc) represent melting curves for individual tested samples containing different concentrations of mutant DNA in a mixture of mutant and wild-type DNA. The x-axis is for temperature; the y-axis is for the difference in melting profile as compared to a negative control (pure wild-type DNA; y=0). The deviation of a melting curve from the control suggests the presence of a mutation. The higher the concentration of mutant DNA, the higher the deviation from control is expected. Depending on the sensitivity of the method (subject of primer sequences and PCR-conditions), lower or higher percentage of mutations can be detected. For example, in the graph shown in
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168] The Tc=78.5 (condition 1) provided the highest enrichment, so this Tc was chosen for subsequent experiments.
[0169]
[0170]
[0171]
EXAMPLES
Example 1General Strategy for Primer Design
[0172] Overall, the following strategy was applied:
[0173] Custom primer sets were designed to encompass the region of interest taking into account some common rules (GC content 40%-60%, no self-complementarity, similar melting temperature, no secondary structures, etc.) and specific rules for COLD-PCR and HRM (product size <300, predicted difference in melting temperature for wild-type and mutant products).
[0174] The primer sets were tested to identify optimal conditions for effective discrimination between wild-type and mutant DNA. To do this, we experimentally identified the melting temperature (Tm) for the amplified sequences and used them as a starting point to find the critical temperature (Tc) for COLD-PCR which achieved the highest enrichment of mutant DNA (or analytic sensitivity, which we defined as a percentage of mutant DNA in a mixture of mutant/wild-type DNA).
[0175] The initial Tc was calculated as Tm1. To identify the best Tc, we prepared serial dilutions of mutant DNA with 1% lowest concentration, ran COLD-PCR using different Tc values and then analysed the deviation of obtained melting curves from the wild-type control. The conditions under which the deviation of 1% DNA from the wild-type was the highest was considered the one to follow up. E.g. if under condition 1 the deviation was 3 units and under condition 2 the deviation was 5, then the condition 2 was chosen to follow up.
[0176] The most effective primers/conditions, were then compared with those publicly available.
Example 2Development of Optimised KRAS Primers and Conditions
[0177] 4 sets of primers were designed according to Example 1.
TABLE-US-00011 Set1,162bp, [SEQIDNO:22] F-GGTCCTGCACCAGTAATATG; [SEQIDNO:23] R-GCCTGCTGAAAATGACTGAA Set2,170bp, [SEQIDNO:24] F-AGAATGGTCCTGCACCAGTAA; [SEQIDNO:25] R-AAGGCCTGCTGAAAATGACT Set3,119bp, [SEQIDNO:26] F-TTGTTGGATCATATTCGTCCAC; [SEQIDNO:2] R-AGGCCTGCTGAAAATGACTG Set4,138bp, [SEQIDNO:1] F-AAAACAAGATTTACCTCTATTGTTGGA; [SEQIDNO:2] R-AGGCCTGCTGAAAATGACTG (sameasforSet3)
[0178] Difference plots were generated using a Tc of Tm1. The results are shown in
[0179] Set1 primersThe sensitivity was found to be as little as 10% mutant DNA.
[0180] Set2 primersNo effective discrimination between wild-type and any dilution below 100% mutant DNA was found.
[0181] Set3 primersWith use of manual mutation allele calling, the analytic sensitivity was found to be as little as 1%.
[0182] Set4 primersThe analytic sensitivity was found to be as little as 0.1%.
[0183] As the highest analytic sensitivity was found for the primers Set4, we then chose these primers to develop further and identify the optimal conditions to achieve the maximal enrichment of mutant DNA.
[0184] We tested 5 conditions taking into account Tc and time for denature under the Tc.
TABLE-US-00012 Condition Tc, C. Time of denature, sec 1 80 3 2 80 10 3 79.5 3 4 79.5 10 5 79 3
[0185] The results are shown in
[0186] Condition 5 was found to show the highest deviation of a melting curve for 1% mutant DNA from control (the deviation of 1% mutant DNA from wild-type was 6.5). i.e. these conditions provide the highest enrichment. Therefore, we chose this primer set (SEQ ID NO: 1 and 2), and condition 5 (79 C. and 3 seconds) were chosen for subsequent analyses.
[0187] Thus, primers comprising SEQ ID NO: 1 and 2, are useful in the detection of mutations in the KRAS locus, particularly when used in combination with the reaction conditions of a Tc of 79 C. and even more particularly, but not essentially, with a denaturing time of 3 seconds.
Example 3Comparison of Optimised KRAS Primers and Conditions to the Prior Art
[0188] The primers and conditions developed above were compared to primers and conditions from the prior art, namely from three papers: Mancini et al. 2010; DOI: 10.2353/jmoldx.2010.100018; Kristensen et al., 2010; DOI 10.1002/humu.21358; and Carotenuto et al. 2011; DOI: 10.3892/ijo.2011.1221. The protocols described within the papers were followed with minor adjustments required to use equipment available in our lab (ABI 7500 fast instrument).
[0189] Mancini et al. 2010The dilution of 1% mutant DNA was detected with manual alleles call at difference of 3.
[0190] Kristensen et al., 2010The dilution of 1% mutant DNA was detected with manual alleles call at difference of 2.
[0191] Carotenuto et al. 2011The dilution of 1% mutant DNA was not detected, and the lowest dilution was 6% which we were able to detect.
[0192] Thus, our primer set 4 (SEQ ID NO: 1 and 2) and respective conditions for fast COLD-PCR provide higher analytic sensitivity than competitors as we can detect 1% mutant DNA at difference 6.5 with automatic alleles call, while the best competitor can detect 1% mutant DNA at difference 3 with manual alleles call.
Example 4Comparison of Optimised KRAS Primers and Conditions to Prior Art Mutation Detection Kit
[0193] We carried out a comparison of our approach with a CE-IVD/US-IVD Cobas KRAS mutation detection kit (Roche). We carried out the analysis of DNA extracted from FFPE blocks of 80 patients with primary or metastatic lung cancer. Using the Cobas test, a total of 17 mutations was identified, while using our approach with primers of SEQ ID NO: 1 and 2, we found 2 more mutations (Table 1). These data testify that our approach is superior over a clinically approved Cobas KRAS mutation detection kit.
TABLE-US-00013 TABLE 1 A comparison of COLD-PCR approach and cobas KRAS mutation detection kit for identification of KRAS mutation in tumour tissues of patients with lung cancer. cobas KRAS mutation detection kit COLD-PCR Positive Negative Positive 17 2 Negative 0 61
Example 5the Optimised KRAS Primers and Conditions are Suitable for Use with ctDNA Giving Superior Mutation Detection than when Used with Tumour Samples
[0194] We also investigated whether our assays can detect mutations in low quality DNA, such as ctDNA extracted from plasma. If this is possible, it would provide a much more simple and low cost way to screen subjects for mutations than having to extract DNA from tumour biopsies.
[0195] To do so, we carried out the analysis of mutations in tumours and matched ctDNA specimens of 82 lung cancer patients.
[0196] First, we found a very good concordance between ctDNA and tumours (Table 2), with 18 out of 19 mutations in tumours found in ctDNA (94.7%). Also, we found more KRAS mutations in ctDNA than in matched tumours, thus suggesting that the analysis of ctDNA can be used as a sensitive and specific test for KRAS mutations in lung cancer patients.
TABLE-US-00014 TABLE 2 Breakdown and statistics of concordance between mutation detection in DNA obtained from tumours and blood-derived DNA Tumours, COLD-PCR/ HRM assay ctDNA Positive Negative Positive 18 7 Negative 1 56 Sensitivity (95% CI) 0.947 (0.774-0.999) Specificity (95% CI) 0.889 (0.801-0.954)
Example 6Development of Optimised EGFR Primers and Conditions
[0197] Ex19
[0198] 3 sets of primers were designed according to Example 1.
TABLE-US-00015 Set1,210bp; [SEQIDNO:27] F-GCTGGTAACATCCACCCAGA; [SEQIDNO:28] R-CCACACAGCAAAGCAGAAAC Set2,101bp; [SEQIDNO:3] F-GTTAAAATTCCCGTCGCTATCA; [SEQIDNO:4] R-GACCCCCACACAGCAAA Set3,103bp; [SEQIDNO:5] F-AAGTTAAAATTCCCGTCGCTATC; [SEQIDNO:4] R-GACCCCCACACAGCAAA
[0199] The Tc in both instances was Tm1.
[0200] Set1 primersThe analytic sensitivity was found to be as little as 6.3%. Also the curves are difficult to interpret.
[0201] Set2 primersThe analytic sensitivity was found to be as little as 1%.
[0202] The results for Set2 and Set3 primers were the same, so all subsequent experiments were carried out with Set2 primers. However, Set 3 primers are also considered to be useful primers of the invention.
[0203] We then tested 3 conditions taking into account Tc.
TABLE-US-00016 Condition Tc, C. 1 78.5 2 78.0 3 77.5
[0204] The results are shown in
[0205] The Tc=78.5 provided the highest enrichment, so this Tc was chosen for subsequent experiments.
[0206] Ex21 (L858R)
[0207] 2 sets of primers were designed according to Example 1.
TABLE-US-00017 Set1,180bp, [SEQIDNO:29] F-TTCCCATGATGATCTGTCCC, [SEQIDNO:30] R-TCTTTCTCTTCCGCACCCAG Set2,80bp, [SEQIDNO:6] F-GCAGCATGTCAAGATCACAGA, [SEQIDNO:7] R-TGCCTCCTTCTGCATGGTAT
[0208] As L858R is a Tm gaining mutation, full COLD-PCR was used. Results are shown in
[0209] Set1 primersThe sensitivity was found to be as little as 6.25% with manual allele calling.
[0210] Set2 primersThe sensitivity was found to be as little as 1.6%
[0211] We then tested 3 conditions taking into account Tc.
TABLE-US-00018 Condition Tc, C. 1 86.5 2 86.0 3 85.5
[0212] Results are shown in
Example 7Comparison of Optimised EGFR Primers and Conditions to Prior Art Mutation Detection Kit
[0213] We compared the performance of our assays versus Cobas EGFR tests (Roche) in a cohort of 95 lung cancer patients, using paraffin embedded tissue samples. Using the Cobas tests we have found 4 Ex19 deletions, while with the COLD-PCR assay we additionally identified 8 mutations (Table 3). Absolute concordance between the tests was found for Ex21 L858R mutations (Table 4).
TABLE-US-00019 TABLE 3 A comparison of COLD-PCR approach and cobas EGFR mutation detection kit for identification of EGFR Ex19 deletions in tumour tissues of patients with lung cancer cobas EGFR mutation detection kit (Ex19) COLD-PCR Positive Negative Positive 4 8 Negative 0 83
TABLE-US-00020 TABLE 4 A comparison of COLD-PCR approach and cobas EGFR mutation detection kit for identification of EGFR Ex19 deletions in tumour tissues of patients with lung cancer cobas EGFR mutation detection kit (Ex19) COLD-PCR Positive Negative Positive 3 0 Negative 0 92
[0214] Thus, our COLD-PCR assays outperforms or are equivalent to cobas EGFR mutation detection kit.
[0215] We also tested the performance of our COLD-PCR approach for ctDNA. Tables 5 and 6 provide the results of a comparison of mutation detection in ctDNA as compared with matched FFPE tumours for EGFR Ex19 and L858R (Ex21) mutations in lung cancer patients.
TABLE-US-00021 TABLE 5 A comparison of the performance of mutation detection in EGFR Ex19 in ctDNA and match FFPE DNA in lung cancer patients using COLD-PCR approach FFPE ctDNA Positive Negative Positive 6 3 Negative 2 38
TABLE-US-00022 TABLE 6 A comparison of the performance of L858R mutation detection in EGFR Ex21 in ctDNA and match FFPE DNA in lung cancer patients using COLD-PCR approach FFPE ctDNA Positive Negative Positive 2 0 Negative 1 92
[0216] Thus, both Ex19 deletions and L585R mutation in EGFR gene can effectively be detected in ctDNA using developed COLD-PCR approach. Again, we can see that some mutations discovered in ctDNA are not detected in FFPE.
Example 8Optimised Primers for Detection of Various p53 Mutations
[0217] Using the same methodology, we developed primers and conditions for COLD-PCR assessment of mutations. Taken into account, that in the case of TP53, no specific mutations are of interest, the whole sequence of exons 5 to 8 (account for 95% of all TP53 mutations) were analysed. Exon 5 was split into 3 fragments and exon 8 was split into 2 fragments due to their length. Currently, there is no clinically accepted commercial test for TP53 mutations, therefore we only compared the performance of mutations detection in ctDNA and FFPE.
[0218] A good concordance between ctDNA and FFPE for 92 lung cancer patients was seen for all exons, with most mutations detected in Exon 5 (table 7).
TABLE-US-00023 TABLE 7 A comparison of the performance of mutation detection in TP53 gene in ctDNA and match FFPE DNA in lung cancer patients using COLD-PCR approach TP53 FFPE exon ctDNA Positive Negative Ex 5 Positive 40 10 Negative 3 39 Ex 6 Positive 9 7 Negative 3 73 Ex 7 Positive 9 3 Negative 3 77 Ex 8 Positive 7 8 Negative 3 74
[0219] The optimised primers are shown below in Table 5
TABLE-US-00024 TABLE5 Critical temperature (Tc)forCOLD- Timeat Exon Sequence,5-3 PCR, C. Tc,sec 5-1 AACCAGCCCTGTCGTCTCT 86.7 10 [SEQIDNO:8] CAAGCAGTCACAGCACATGA [SEQIDNO:9] 5-2 CTGAGCAGCGCTCATGGT 89.0 10 [SEQIDNO:10] GTGCAGCTGTGGGTTGATTC [SEQIDNO:11] 5-3 GGGGGTGTGGAATCAAC 83.0 10 [SEQIDNO:12] ACTTGTGCCCTGACTTTCAA [SEQIDNO:13] 6 CAGTTGCAAACCAGACCTCA 87.5 3 [SEQIDNO:14] GGCCTCTGATTCCTCACTGAT [SEQIDNO:15] 7 GGCTCCTGACCTGGAGTCTT 83.5 10 [SEQIDNO:16] CTTGGGCCTGTGTTATCTCC [SEQIDNO:17] 8-1 TCTTGCGGAGATTCTCTTCC 81.8 20 [SEQIDNO:18] GCCTCTTGCTTCTCTTTTCCT [SEQIDNO:19] 8-2 GCTTCTTGTCCTGCTTGCTT 85.3 10 [SEQIDNO:20] CTACTGGGACGGAACAGCTT [SEQIDNO:21]
Example 9Detailed Protocol for the Detection of Mutations in the KRAS Codon 12/13 Locus
[0220] The below is a detailed protocol for the detection of the mutations in the KRAS codon 12/13 locus. It will be appreciated that not every step needs to be followed precisely, not even included, and the precise amounts of and types of reagent may vary without affecting the outcome, all of which the skilled person will be well aware.
[0221] Equipment
[0222] PCR-workstation
[0223] QIAGEN RotorGene real-time PCR instrument
[0224] Dedicated PCR pipettes
[0225] Materials
[0226] Type-it HRM PCR Kit (QIAGEN)
[0227] PCR-grade water (supplied with the kit or equivalent)
[0228] RotorGene 0.1 uL PCR strips
[0229] Control DNA
[0230] Notes: [0231] All pre-PCR steps must be carried out in a PCR-workstation [0232] Use dedicated PCR pipettes and sterile filter tips [0233] Equilibrate concentrations of the DNA before use, so all the samples were at same concentration; variation 5% is acceptable.
[0234] Procedure 1 (COLD-PCR): [0235] Prepare spreadsheet with samples allocated in PCR instrument rotor. [0236] Completely thaw oligonucleotides for COLD-PCR and reagents at RT before use; shake or mix them well and spin down. [0237] Calculate the amount of reagents required for the number of reactions (including control DNA)+5%. For every sample, including control DNA, set up at least 2 technical replicates. [0238] Prepare master mix (MM) in a 1.5-2.0 mL sterile tube:
TABLE-US-00025 Amount per 1 sample, Reagent ul Final concentration Type-it HRM mix, 2x 12.5 1x Primer Fwd, 10 uM 1.75 700 nM Primer Rev, 10 uM 1.75 700 nM Water 8 DNA 1
Primers Sequence:
[0239]
TABLE-US-00026 [SEQIDNO:1] Fwd: 5-AAAACAAGATTTACCTCTATTGTTGGA-3 [SEQIDNO:2] Rev: 5-AGGCCTGCTGAAAATGACTG-3 [0240] Aliquot 24 uL of MM into PCR-tubes [0241] Put 1 uL DNA for each sample into the tubes according to the sample allocations. [0242] Close the tubes with caps and place them into rotor of the RotorGene; close the RotorGene lid. [0243] Turn on RotorGene and attached laptop; set up program for fast or full COLD-PCR using the following profile:
[0244] Fast COLD-PCR
TABLE-US-00027 Stage Temp Time Cycles Activation 95 C. 5 min 1 Pre-PCR 95 C. 10 sec 20 55 C. 30 sec 72 C. 10 sec COLD 79 C. 3 sec 40/45 55 C. 30 sec 72 C. 10 sec HRM 68-90 1
[0245] Full COLD-PCR
TABLE-US-00028 Stage Temp Time Cycles Activation 95 C. 5 min 1 Pre-PCR 95 C. 10 sec 20 60 C. 1 min COLD 95 C. 10 sec 40/45 70 C. 5 min 79.5 C. 3 sec 55 C. 30 sec 72 C. 10 sec HRM 68-90 1 [0246] Run the program [0247] Analyze the results using RotorGene software; mutations will be detected automatically, bust manual adjustment may require.
Example 10Detailed Protocol for the Detection of Mutations in the EGFR Exon 19 and Exon 21
[0248] The below is a detailed protocol for the detection of the mutations in the EGFR exon 19 and exon 21. It will be appreciated that not every step need to be followed precisely, not even included, and the precise amounts of and types of reagent may vary without affecting the outcome, all of which the skilled person will be well aware.
[0249] Equipment
[0250] PCR-workstation
[0251] QIAGEN RotorGene real-time PCR instrument
[0252] Dedicated PCR pipettes
[0253] Materials
[0254] Type-it HRM PCR Kit (QIAGEN)
[0255] PCR-grade water (supplied with the kit or equivalent)
[0256] RotorGene 0.1 uL PCR strips
[0257] Control DNA
[0258] Notes: [0259] All pre-PCR steps must be carried out in a PCR-workstation [0260] Use dedicated PCR pipettes and sterile filter tips [0261] Equilibrate concentrations of the DNA before use, so all the samples were at same concentration; variation 5% is acceptable. [0262] Set up Ex19 and Ex21 reactions separately, no multiplexing [0263] Ex21 L858R mutation is a temperature gaining, this must be taken into account during interpretation of the results
[0264] Sequences of Oligos:
TABLE-US-00029 EGFREx19 Fwd: 5-GTTAAAATTCCCGTCGCTATCA Rev: 5-GACCCCCACACAGCAAA EGFREx21 Fwd: 5-GCAGCATGTCAAGATCACAGA Rev: 5-TGCCTCCTTCTGCATGGTAT
[0265] Procedure 1 (COLD-PCR): [0266] Prepare spreadsheet with samples allocated in PCR instrument rotor. [0267] Completely thaw oligonucleotides for COLD-PCR and reagents at RT before use; shake or mix them well and spin down. [0268] Calculate the amount of reagents required for the number of reactions (including control DNA)+5%. For every sample, including control DNA, set up at least 2 technical replicates. [0269] Prepare master mix (MM) in a 1.5-2.0 mL sterile tube:
TABLE-US-00030 Amount per 1 sample, Reagent ul Final concentration Type-it HRM mix, 2x 12.5 1x Primer Fwd, 10 uM 1.75 700 nM Primer Rev, 10 uM 1.75 700 nM Water 8 DNA 1 [0270] Aliquot 24 uL of MM into PCR-tubes [0271] Put 1 uL DNA for each sample into the tubes according to the sample allocations. [0272] Close the tubes with caps and place them into rotor of the RotorGene; close the RotorGene lid. [0273] Turn on RotorGene and attached laptop; set up program for fast or full COLD-PCR using the following profiles:
[0274] Ex19 Fast COLD-PCR
TABLE-US-00031 Stage Temp Time Cycles Activation 95 C. 5 min 1 Pre-PCR 95 C. 10 sec 20 55 C. 30 sec 72 C. 10 sec COLD 78.5 C. 3 sec 40/45 55 C. 30 sec 72 C. 10 sec HRM 68-90 1
[0275] Ex21 Full COLD-PCR
TABLE-US-00032 Stage Temp Time Cycles Activation 95 C. 5 min 1 Pre-PCR 95 C. 10 sec 20 60 C. 1 min COLD 95 C. 10 sec 40/45 70 C. 5 min 86 C. 3 sec 55 C. 30 sec 72 C. 10 sec HRM 68-90 1 [0276] Run the program
[0277] Analyse the results using RotorGene software; mutations will be detected automatically, but manual adjustment may be required.
Example 11Detailed Protocol for the Detection of Mutations in Various Regions of p53
[0278] The below is a detailed protocol for the detection of the mutations in various regions of p53. It will be appreciated that not every step need to be followed precisely, not even included, and the precise amounts of and types of reagent may vary without affecting the outcome, all of which the skilled person will be well aware.
[0279] SOP Mutation detection in exons 5-8 of TP53 gene
[0280] Equipment
[0281] PCR-workstation
[0282] QIAGEN RotorGene real-time PCR instrument
[0283] Dedicated PCR pipettes
[0284] Materials
[0285] Type-it HRM PCR Kit (QIAGEN)
[0286] PCR-grade water (supplied with the kit or equivalent)
[0287] RotorGene 0.1 uL PCR strips
[0288] Control DNA
[0289] Notes: [0290] All pre-PCR steps must be carried out in a PCR-workstation [0291] Use dedicated PCR pipettes and sterile filter tips [0292] Equilibrate concentrations of the DNA before use, so all the samples were at same concentration; variation 5% is acceptable.
[0293] Sequences of Primers:
TABLE-US-00033 Critical temperature (Tc)forCOLD- Timeat Exon Sequence,5-3 PCR, C. Tc,sec 5-1 AACCAGCCCTGTCGTCTCT 86.7 10 [SEQIDNO:8] CAAGCAGTCACAGCACATGA [SEQIDNO:9] 5-2 CTGAGCAGCGCTCATGGT 89.0 10 [SEQIDNO:10] GTGCAGCTGTGGGTTGATTC [SEQIDNO:11] 5-3 GGGGGTGTGGAATCAAC 83.0 10 [SEQIDNO:12] ACTTGTGCCCTGACTTTCAA [SEQIDNO:13] 6 CAGTTGCAAACCAGACCTCA 87.5 3 [SEQIDNO:14] GGCCTCTGATTCCTCACTGAT [SEQIDNO:15] 7 GGCTCCTGACCTGGAGTCTT 83.5 10 [SEQIDNO:15] CTTGGGCCTGTGTTATCTCC [SEQIDNO:17] 8-1 TCTTGCGGAGATTCTCTTCC 81.8 20 [SEQIDNO:18] GCCTCTTGCTTCTCTTTTCCT [SEQIDNO:19] 8-2 GCTTCTTGTCCTGCTTGCTT 85.3 10 [SEQIDNO:20] CTACTGGGACGGAACAGCTT [SEQIDNO:21]
[0294] Procedure (COLD-PCR): [0295] Prepare spreadsheet with samples allocated in PCR instrument rotor. [0296] Completely thaw oligonucleotides for COLD-PCR and reagents at RT before use; shake or mix them well and spin down. [0297] Calculate the amount of reagents required for the number of reactions (including control DNA)+5%. For every sample, including control DNA, set up at least 2 technical replicates. [0298] Prepare master mix (MM) in a 1.5-2.0 mL sterile tube:
TABLE-US-00034 Amount per 1 sample, Reagent ul Final concentration Type-it HRM mix, 2x 12.5 1x Primer Fwd, 10 uM 1.75 700 nM Primer Rev, 10 uM 1.75 700 nM Water 8 DNA 1 [0299] Aliquot 24 uL of MM into PCR-tubes [0300] Put 1 uL DNA for each sample into the tubes according to the sample allocations. [0301] Close the tubes with caps and place them into rotor of the RotorGene; close the RotorGene lid. [0302] Turn on RotorGene and attached laptop; set up program for fast COLD-PCR using the following profile:
[0303] Fast COLD-PCR
TABLE-US-00035 Stage Temp Time Cycles Activation 95 C. 5 min 1 Pre-PCR 95 C. 10 sec 20 55 C. 30 sec 72 C. 10 sec COLD Tc C.* 3-20 sec* 40/45 55 C. 30 sec 72 C. 10 sec HRM 68-90 1 *see table above for details [0304] Run the program [0305] Analyse the results using RotorGene software; mutations will be detected automatically, but manual adjustment may be required.