ARTIFICIAL SINGLE GUIDE RNA AND USE THEREOF
20190382758 ยท 2019-12-19
Assignee
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
Y02P20/55
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C07C229/34
CHEMISTRY; METALLURGY
C40B50/06
CHEMISTRY; METALLURGY
C07C229/04
CHEMISTRY; METALLURGY
International classification
C12N15/11
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
Abstract
The invention provides an artificial sgRNA and a CRISPR/Cas9 system by combining the artificial sgRNA and Cas9. Activity of the sgRNA can be retained even when a nucleotide linker region for forming a single strand by linking the 3-terminal of crRNA and the 5-terminal of tracrRNA in sgRNA is substituted with an amino acid derivative linker, when the linker region existing between stem-loop 1 and stem-loop 2 of tracrRNA and/or the loop portion of stem-loop 2 are/is substituted with an amino acid derivative linker, or when an amino acid derivative linker is added/inserted into the vicinity of the 5-terminal and/or the 3-terminal of sgRNA. Stability in vivo can be improved by introducing one or more amino acid derivative linkers into the sgRNA.
Claims
1. A single guide RNA (1) represented by formula (A): ##STR00046## [in the formula (A), X.sup.a is an amino acid derivative linker represented by the following formula (I): ##STR00047## in the formula (I), X.sup.1 and X.sup.2 are each independently H.sub.2, O, S, or NH; Y.sup.1 and Y.sup.2 are each independently a single bond, CH.sub.2, NH, O, or S; L.sup.1 is an alkylene chain having n carbon atoms, and a hydrogen atom(s) on an alkylene carbon atom(s) may or may not be substituted with OH, OR.sup.a, NH.sub.2, NHR.sup.a, NR.sup.aR.sup.b, SH, or SR.sup.a, or L.sup.1 is a polyether chain obtained by substituting at least one carbon atom on the alkylene chain with an oxygen atom, provided that when Y.sup.1 is NH, O, or S, an atom bound to Y.sup.1 in L.sup.1 is carbon, an atom bound to OR.sup.1 in L.sup.1 is carbon, and oxygen atoms are not adjacent to each other; L.sup.2 is an alkylene chain having m carbon atoms, and a hydrogen atom(s) on an alkylene carbon atom(s) may or may not be substituted with OH, OR.sup.c, NH.sub.2, NHR.sup.c, NR.sup.cR.sup.d, SH, or SR.sup.c, or L.sup.2 is a polyether chain obtained by substituting at least one carbon atom on the alkylene chain with an oxygen atom, provided that when Y.sup.2 is NH, O, or S, an atom bound to Y.sup.2 in L.sup.2 is carbon, an atom bound to OR.sup.2 in L.sup.2 is carbon, and oxygen atoms are not adjacent to each other; R.sup.a, R.sup.b, R.sup.c, and R.sup.d are each independently a substituent or a protecting group; m is an integer in the range from 0 to 30; n is an integer in the range from 0 to 30; R.sup.1 and R.sup.2 may or may not be present, and when they are present, R.sup.1 and R.sup.2 are each independently a nucleotide residue or the structure (I), A is any atomic group, provided that the following formula (Ia) is an amino acid or a peptide, ##STR00048## said X.sup.a is bonded to the adjacent nucleotide residue via the OR.sup.1 or OR.sup.2, in the formula (A), X.sup.b and Y each independently show 1 to 5 optional nucleotide linkers, or an amino acid derivative linker represented by the formula (I), said X.sup.b and Y are each independently bonded to the adjacent nucleotide residue via the OR.sup.1 or OR.sup.2, in the formula (A), X.sup.c and X.sup.d may or may not be present, and when they are present, they are each independently an amino acid derivative linker represented by the formula (I), said X.sup.c and X.sup.d are each independently bonded to the adjacent nucleotide residue via the OR.sup.1 or OR.sup.2, and in the formula (A), (n).sub.20 is a nucleotide sequence consisting of 205 nucleotide residues each of which is independently A, G, C or U], or (2) represented by the formula (A), wherein 1 to several nucleotide residues are substituted, deleted, inserted or added in a region excluding (n).sub.20, which RNA forming a complex with Cas9 protein and having an activity of recognizing a double-stranded DNA containing a target nucleotide sequence complementary to the (n).sub.20.
2. The single guide RNA according to claim 1, wherein the amino acid constituting the amino acid or peptide of the formula (Ia) is at least one kind selected from the group consisting of glycine, -alanine, arginine, asparagine, aspartic acid, cysteine, cystine, glutamine, glutamic acid, histidine, isoleucine, leucine, lysine, hydroxylysine, methionine, phenylalanine, serine, threonine, tyrosine, valine, proline, 4-hydroxyproline, tryptophan, -alanine, 1-amino-2-carboxycyclopentane, aminobenzoic acid, aminopyridinecarboxylic acid, and amino acid represented by the following chemical formula (Ia2): ##STR00049## (in the formula (Ia2), R.sup.100 is any substituent, may or may not be present, and when it is present, it may be one or in plurality, and when it is in plurality, each may be the same or different), each of which optionally has a substituent or a protecting group.
3. The single guide RNA according to claim 1, wherein said X.sup.a is represented by the following formula (I-1)-(I-7): ##STR00050## wherein n and m are each independently an integer of 0-30.
4. The single guide RNA according to claim 3, wherein said X.sup.a is represented by the formula (I-4) or (I-7) wherein n=5 and m=4.
5. The single guide RNA according to claim 3, wherein said X.sup.a is represented by the formula (I-1) wherein n=5 and m=4, or represented by the formula (I-6) wherein n=4 and m=4.
6. The single guide RNA according to claim 1, wherein said X.sup.a is represented by the following formula (II): ##STR00051## (in the formula (II), X.sup.1 and X.sup.2 are each independently Hz, O, S, or NH; Y.sup.1 and Y.sup.2 are each independently a single bond, CH.sub.2, NH, O, or S; R.sup.3 is a hydrogen atom or substituent that is bound to C-3, C-4, C-5, or C-6 on a ring A; L.sup.1 is an alkylene chain composed of n atoms, and a hydrogen atom(s) on an alkylene carbon atom(s) may or may not be substituted with OH, OR.sup.a, NH.sub.2, NHR.sup.a, NR.sup.aR.sup.b, SH, or SR.sup.a, or L.sup.1 is a polyether chain obtained by substituting at least one carbon atom on the alkylene chain with an oxygen atom, provided that when Y.sup.1 is NH, O, or S, an atom bound to Y.sup.1 in L.sup.1 is carbon, an atom bound to OR.sup.1 in L.sup.1 is carbon, and oxygen atoms are not adjacent to each other; L.sup.2 is an alkylene chain composed of m atoms, and a hydrogen atom(s) on an alkylene carbon atom(s) may or may not be substituted with OH, OR.sup.c, NH.sub.2, NHR.sup.c, NR.sup.cR.sup.d, SH, or SR.sup.c, or L.sup.2 is a polyether chain obtained by substituting at least one carbon atom on the alkylene chain with an oxygen atom, provided that when Y.sup.2 is NH, O, or S, an atom bound to Y.sup.2 in L.sup.2 is carbon, an atom bound to OR.sup.2 in L.sup.2 is carbon, and oxygen atoms are not adjacent to each other; R.sup.a, R.sup.b, R.sup.c, and R.sup.d are each independently a substituent or a protecting group; l is 1 or 2; m is an integer in the range from 0 to 30; n is an integer in the range from 0 to 30; on the ring A, one carbon atom other than C-2 may be substituted with nitrogen, oxygen, or sulfur; the ring A may contain a carbon-carbon double bond or a carbon-nitrogen double bond, R.sup.1 and R.sup.2 may or may not be present, and when they are present, R.sup.1 and R.sup.2 are each independently a nucleotide residue or the structure (II), and said X.sup.a is bonded to the adjacent nucleotide residue via OR.sup.1 or OR.sup.2).
7. The single guide RNA according to claim 6, wherein said X.sup.a is represented by the following formula (II-1)-(II-9): ##STR00052## ##STR00053## wherein n and m are each independently an integer of 0-30 and q is an integer of 0-10.
8. The single guide RNA according to claim 7, wherein said X.sup.a is represented by the formula (II-8) wherein n=5 and m=4, n=7 and m=6, n=9 and m=8, or n=11 and m=10.
9. The single guide RNA according to claim 1, wherein said X.sup.a is represented by the following formula (III-1)-(III-3): ##STR00054## wherein n and m are each independently an integer of 0-30.
10. The single guide RNA according to claim 9, wherein in said each formula, n=5 and m=4.
11. The single guide RNA according to claim 1, wherein said X.sup.b and Y each independently show 1 to 5 optional nucleotide linkers.
12. The single guide RNA according to claim 11, wherein said X.sup.c and X.sup.d are absent.
13. The single guide RNA according to claim 11, wherein said X.sup.c and X.sup.d are each independently an amino acid derivative linker represented by the formula (I).
14. The single guide RNA according to claim 13, wherein said X.sup.c and X.sup.d are amino acid derivative linkers represented by the formula (II).
15. The single guide RNA according to claim 14, wherein said X.sup.c and X.sup.d are represented by the formula (II-8) wherein n=5 and m=4.
16. The single guide RNA according to claim 13, wherein said X.sup.c and X.sup.d are represented by any of the formulas (I-1), (I-4), (I-7) and (III-1)-(III-3), wherein n=5 and m=4, or the formula (I-6) wherein n=4 and m=4.
17. The single guide RNA according to claim 1, wherein said X.sup.b is an amino acid derivative linker represented by the formula (I).
18. The single guide RNA according to claim 17, wherein said X.sup.b is an amino acid derivative linker represented by the formula (II).
19. The single guide RNA according to claim 18, wherein said X.sup.b is represented by the formula (II-8) wherein n=5 and m=4.
20. The single guide RNA according to claim 17, wherein said X.sup.b is represented by any of the formulas (I-1), (I-4), (I-7) and (III-1)-(III-3) wherein n=5 and m=4, or represented by the formula (I-6) wherein n=4 and m=4.
21. The single guide RNA according to claim 17, wherein said Y shows 1 to 5 optional nucleotide linkers.
22. The single guide RNA according to claim 17, wherein said Y is an amino acid derivative linker represented by the formula (I).
23. The single guide RNA according to claim 22, wherein said Y is represented by the formula (I-4) wherein n=5 and m=4.
24. The single guide RNA according to claim 22, wherein said Y is an amino acid derivative linker represented by the formula (II).
25. The single guide RNA according to claim 24, wherein said Y is represented by the formula (II-8) wherein n=5 and m=4, n=7 and m=6, n=9 and m=8, or n=11 and m=10.
26. The single guide RNA according to claim 22, wherein said Y is represented by any of the formulas (I-1), (I-7) and (III-1)-(III-3) wherein n=5 and m=4 or represented by the formula (I-6) wherein n=4 and m=4.
27. The single guide RNA according to claim 7, wherein said X.sup.a is represented by the formula (II-8) wherein n=5 and m=4, and 1 to 3 base pairs of the stem adjacent to the X.sup.a are deleted.
28. The single guide RNA according to claim 19, wherein 1 to 4 base pairs of the stem adjacent to the X.sup.b are deleted.
29. The single guide RNA according to claim 28, wherein said X.sup.a is represented by the formula (II-8) wherein n=5 and m=4, and 1 to 3 base pairs of the stem adjacent to the X.sup.a are deleted.
30. A single guide RNA represented by the formula (A), wherein X.sup.a, X.sup.b and Y are 1 to 5 optional nucleotide linkers, X.sup.c and X.sup.d are absent, and loop portion (UA) of stem-loop 1 or loop portion (AGU) of stem-loop 3 is substituted with an amino acid derivative linker represented by the formula (II-8) wherein n=5 and m=4.
31. A CRISPR/Cas9 system comprising the single guide RNA according to claim 1 and Cas9 in combination.
32. The CRISPR/Cas9 system according to claim 31, wherein said Cas9 is derived from Streptococcus pyogenes.
33. The CRISPR/Cas9 system according to claim 31, wherein said Cas9 is in the form of a protein, an mRNA encoding same or an expression vector comprising a DNA encoding same.
34. A method for recognizing a double-stranded DNA, comprising contacting the CRISPR/Cas9 system according to claim 31 with a target double-stranded DNA.
35. The method according to claim 34, wherein the Cas9 protein has a double-stranded DNA cleavage activity.
36. The method according to claim 35, wherein said double-stranded DNA is cleaved in a cell.
37. The method according to claim 36, for knocking out a target gene.
38. The method according to claim 36, for modifying a base in the target gene, or inserting an exogenous gene in the gene.
39. A monomer for nucleic acid molecule synthesis represented by any of the following formulas (IV-1)-(IV-3): ##STR00055## (in each formula, R.sup.11 and R.sup.21 are each independently a hydrogen atom, a protecting group or a phosphoric acid protecting group, and n and m are each independently an integer of 0-30).
40. The monomer according to claim 39, wherein n=5 and m=4 in each of the formulas.
41. A method for producing a nucleic acid molecule comprising using the monomer according to claim 39.
42. A method for producing a nucleic acid molecule comprising using a monomer for nucleic acid molecule synthesis represented by any of the following formulas (IV-1)-(IV-3): ##STR00056## (in each formula, R.sup.11 and R.sup.21 are each independently a hydrogen atom, a protecting group or a phosphoric acid protecting group, and n and m are each independently an integer of 0-30), wherein said nucleic acid molecule is the single guide RNA according to claim 1.
43.-44. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
DESCRIPTION OF EMBODIMENTS
[0061] 1. Artificial sgRNA
[0062] The present invention provides a chemically-modified sgRNA which is the following single guide RNA (natural form sgRNA)
##STR00013##
comprising one or more amino acid derivative linkers at least in the internal sequence thereof (to be also referred to as the artificial sgRNA of the present invention in the present specification), which natural form sgRNA being obtained by chimerization (truncation and forming single strand) of crRNA and tracrRNA derived from Streptococcus pyogenes and shown by the following formula:
##STR00014##
(each n is independently A, G, C or U and (n).sub.20 is a guide region of crRNA).
[0063] The natural form sgRNA from which the artificial sgRNA of the present invention is derived (while sgRNA itself is inherently an artificial RNA, it is referred to as natural form sgRNA in the sense of sgRNA consisting only of natural form (i.e., non-modified) nucleotides in the present specification) contains, as mentioned above, a guide region ((n).sub.20) complementary to the target nucleotide sequence on the 5-terminal, crRNA-derived repeat region and tracrRNA-derived antirepeat region are linked at the downstream thereof via a tetraloop consisting of 4 nucleotides (GAAA), and forms a stem-loop structure. Furthermore, it contains three tracrRNA-derived stem-loop structures at the downstream of the antirepeat region, and has a linker region consisting of 5 nucleotides (UUAUC) between stem-loop 1 and stem-loop 2.
[0064] The length of the nucleotide sequence ((n).sub.20) in the guide region only needs to be sufficient for sgRNA to specifically bind to the target nucleotide sequence. For example, when a mutation is introduced into a particular site in the genomic DNA of a mammal, it is not less than 12 nucleotides, preferably not less than 15 nucleotides, more preferably not less than 17 nucleotides, according to the genome size thereof. While the upper limit of the length is not particularly limited, it is preferably not more than 25 nucleotides, more preferably not more than 22 nucleotides. More specifically, the nucleotide length of the guide region is 205 nucleotides, preferably 17-22 nucleotides, particularly preferably 20 nucleotides.
[0065] Specifically, the artificial sgRNA of the present invention is characterized in that at least the tetraloop portion of the natural form sgRNA is substituted by an amino acid derivative linker (X.sup.a). That is, the artificial sgRNA of the present invention is a single guide RNA represented by the following formula (A):
##STR00015##
[in the formula (A), X.sup.a is an amino acid derivative linker represented by the following formula (I):
##STR00016##
in the formula (I),
[0066] X.sup.1 and X.sup.2 are each independently H.sub.2, O, S or NH;
[0067] Y.sup.1 and Y.sup.2 are each independently a single bond, CH.sub.2, NH, O or S;
[0068] L.sup.1 is an alkylene chain having n carbon atoms, and a hydrogen atom(s) on an alkylene carbon atom(s) may or may not be substituted with OH, OR.sup.a, NH.sub.2, NHR.sup.a, NR.sup.aR.sup.b, SH, or SR.sup.a, or
[0069] L.sup.1 is a polyether chain obtained by substituting at least one carbon atom on the alkylene chain with an oxygen atom,
[0070] provided that when Y.sup.1 is NH, O or S, an atom bound to Y.sup.1 in L.sup.1 is carbon, an atom bound to OR.sup.1 in L.sup.1 is carbon, and oxygen atoms are not adjacent to each other;
[0071] L.sup.2 is an alkylene chain having m carbon atoms, and a hydrogen atom(s) on an alkylene carbon atom(s) may or may not be substituted with OH, OR.sup.c, NH.sub.2, NHR.sup.c, NR.sup.cR.sup.d, SH, or SR.sup.c, or
[0072] L.sup.2 is a polyether chain obtained by substituting at least one carbon atom on the alkylene chain with an oxygen atom,
[0073] provided that when Y.sup.2 is NH, O or S, an atom bound to Y.sup.2 in L.sup.2 is carbon, an atom bound to OR.sup.2 in L.sup.2 is carbon, and oxygen atoms are not adjacent to each other;
[0074] R.sup.a, R.sup.b, R.sup.c, and R.sup.d are each independently a substituent or a protecting group;
[0075] l is 1 or 2;
[0076] m is an integer in the range from 0 to 30;
[0077] n is an integer in the range from 0 to 30;
R.sup.1 and R.sup.2 may or may not be present, and when they are present,
R.sup.1 and R.sup.2 are each independently a nucleotide residue or the above-mentioned structure (I),
A is any atomic group, provided that the following formula (Ia) is an amino acid or a peptide,
##STR00017##
the aforementioned X.sup.a is bonded to the adjacent nucleotide residue via the aforementioned OR.sup.1 or OR.sup.2,
in the formula (A), X.sup.b and Y each independently show 1 to 5 optional nucleotide linkers, or an amino acid derivative linker represented by the above-mentioned formula (I),
the aforementioned X.sup.b and Y are each independently bonded to the adjacent nucleotide residue via the aforementioned OR.sup.1 or OR.sup.2,
in the formula (A), X.sup.c and X.sup.d may or may not be present, and when they are present, they are each independently an amino acid derivative linker represented by the aforementioned formula (I),
the aforementioned X.sup.c and X.sup.d are each independently bonded to the adjacent nucleotide residue via the aforementioned OR.sup.1 or OR.sup.2, and
in the formula (A), (n).sub.20 is a nucleotide sequence consisting of 205 nucleotide residues each of which is independently A, G, C or U], or
(2) a single guide RNA of the aforementioned formula (A), wherein 1 to several nucleotide residues are substituted, deleted, inserted or added in a region excluding (n).sub.20, which RNA forming a complex with Cas9 protein and having an activity of recognizing a double-stranded DNA containing a target nucleotide sequence complementary to the aforementioned (n).sub.20.
[0078] In the formula (I), X.sup.1 and X.sup.2 are, for example, each independently H.sub.2, O, S or NH. In the formula (I), X.sup.1 is H.sub.2 means that X.sup.1 forms CH.sub.2 (a methylene group) together with a carbon atom to which X.sup.1 binds. The same applies to X.sup.2.
[0079] In the formula (I), Y.sup.1 and Y.sup.2 are each independently a single bond, CH.sub.2, NH, O or S.
[0080] In the formula (I), L.sup.1 is an alkylene chain having n carbon atoms. A hydrogen atom(s) on an alkylene carbon atom(s) may or may not be substituted with, for example, OH, OR.sup.a, NH.sub.2, NHR.sup.a, NR.sup.aR.sup.b, SH, or SR.sup.a. Alternatively, L.sup.1 may be a polyether chain obtained by substituting at least one carbon atom on the alkylene chain with an oxygen atom. The polyether chain is, for example, polyethylene glycol. When Y.sup.1 is NH, O or S, an atom bound to Y.sup.1 in L.sup.1 is carbon, an atom bound to OR.sup.1 in L.sup.1 is carbon, and oxygen atoms are not adjacent to each other. That is, for example, when Y.sup.1 is O, this oxygen atom and the oxygen atom in L.sup.1 are not adjacent to each other, and the oxygen atom in OR.sup.1 and the oxygen atom in L.sup.1 are not adjacent to each other.
[0081] In the formula (I), L.sup.2 is an alkylene chain having m carbon atoms. A hydrogen atom(s) on an alkylene carbon atom(s) may or may not be substituted with, for example, OH, OR.sup.c, NH.sub.2, NHR.sup.c, NR.sup.cR.sup.d, SH, or SR.sup.c. Alternatively, L.sup.2 may be a polyether chain obtained by substituting at least one carbon atom on the alkylene chain with an oxygen atom. When Y.sup.2 is NH, O or S, an atom bound to Y.sup.2 in L.sup.2 is carbon, an atom bound to OR.sup.2 in L.sup.2 is carbon, and oxygen atoms are not adjacent to each other. That is, for example, when Y.sup.2 is O, this oxygen atom and the oxygen atom in L.sup.2 are not adjacent to each other, and the oxygen atom in OR.sup.2 and the oxygen atom in L.sup.2 are not adjacent to each other.
[0082] n of L.sup.1 and m of L.sup.2 are not particularly limited, and the lower limit of each of them may be 0, for example, and the upper limit of the same is not particularly limited. n and m can be set as appropriate depending on, for example, a desired length of the linker region (Lx). For example, from the view point of manufacturing cost, yield, and the like, n and m are each preferably 0 to 30, more preferably 0 to 20, and still more preferably 0 to 15. n and m may be the same (n=m) or different. n+m is, for example, 0 to 30, preferably 0 to 20, and more preferably 0 to 15.
[0083] R.sup.a, R.sup.b, R.sup.c, and R.sup.d is, for example, each independently a substituent or a protecting group. Examples of the substituent include hydroxy, carboxy, sulfo, halogens, alkyl halides (haloalkyl e.g., CF.sub.3, CH.sub.2CF.sub.3, CH.sub.2CCl.sub.3), nitro, nitroso, cyano, alkyls (e.g., methyl, ethyl, isopropyl, tert-butyl), alkenyls (e.g., vinyl), alkynyls (e.g., ethynyl), cycloalkyls (e.g., cyclopropyl, adamantyl), cycloalkylalkyls (e.g., cyclohexylmethyl, adamantylmethyl), cycloalkenyls (e.g., cyclopropenyl), cyclylalkyl, hydroxyalkyl (e.g., hydroxymethyl, hydroxyethyl), alkoxyalkyl (e.g., methoxymethyl, ethoxymethyl, ethoxyethyl), aryls (e.g., phenyl, naphthyl), arylalkyls (e.g., benzyl, phenethyl), alkylaryl (e.g., p-methylphenyl), heteroaryls (e.g., pyridyl, furyl), heteroarylalkyls (e.g., pyridylmethyl), heterocyclyls (e.g., piperidyl), heterocyclylalkenyl, heterocyclylalkyls (e.g., morpholylmethyl), alkoxys (e.g., methoxy, ethoxy, propoxy, butoxy), halogenated alkoxys (e.g., OCF.sub.3), alkenyloxys (e.g., vinyloxy, allyloxy), aryloxys (e.g., phenyloxy), alkyloxycarbonyls (e.g., methoxycarbonyl, ethoxycarbonyl, tert-butoxycarbonyl), arylalkyloxys (e.g., benzyloxy), aminos [alkylaminos (e.g., methylamino, ethylamino, dimethylamino), acylaminos (e.g., acetylamino, benzoylamino), arylalkylaminos (e.g., benzylamino, tritylamino), hydroxyamino], aminoalkyl (e.g., aminomethyl), alkylaminoalkyls (e.g., diethylaminomethyl), carbamoyl, sulfamoyl, oxo, silyl, silyloxyalkyl and the like. These substituents are optionally substituted by one or more further substituents or further protecting groups. While the aforementioned further substituent is not particularly limited, for example, it may be a substituent exemplified above. The aforementioned further protecting group is not particularly limited and, for example, it may be a protecting group exemplified below. The same applies hereafter.
[0084] The aforementioned protecting group (or the aforementioned further protecting group) is, for example, a functional group that inactivates a highly-reactive functional group. Examples of the protecting group include known protecting groups. Regarding the protecting group, for example, the description in the literature (J. F. W. McOmie, Protecting Groups in Organic Chemistry, Plenum Press, London and New York, 1973) is incorporated herein by reference. The protecting group is not particularly limited, and examples thereof include a tert-butyldimethylsilyl group (TBDMS), a bis(2-acetoxyethyloxy)methyl group (ACE), a triisopropylsilyloxymethyl group (TOM), a 1-(2-cyanoethoxy)ethyl group (CEE), a 2-cyanoethoxymethyl group (CEM), a tolylsulfonylethoxymethyl group (TEM), and a dimethoxytrityl group (DMTr). When R.sup.3 is OR.sup.4, the protecting group is not particularly limited, and examples thereof include a TBDMS group, an ACE group, a TOM group, a CEE group, a CEM group, and a TEM group. Besides these, silyl-containing groups of the following formulas (P1) and (P2) can be mentioned. Of these, any of DMtr group and the aforementioned silyl-containing group is preferable.
##STR00018##
[0085] In the formula (I), each hydrogen atom may be, for example, independently substituted with a halogen such as Cl, Br, F, or I.
[0086] The aforementioned X.sup.a is bonded to the adjacent nucleotide residue via OR.sup.1 or OR.sup.2. Here, R.sup.1 and R.sup.2 may or may not be present. When R.sup.1 and R.sup.2 are present, R.sup.1 and R.sup.2 are each independently a nucleotide residue or the above-mentioned structure (I). When R.sup.1 and/or R.sup.2 have/has a structure of the aforementioned formula (I), X.sup.a is a structure in which not less than two amino acid derivative residues having the structure of the aforementioned formula (I) are linked. The structure of the aforementioned formula (I) may be contained in the number of, for example, 1, 2, 3 or 4. Thus, when a plurality of the aforementioned structures are contained, the structure of the aforementioned (I) may be, for example, directly linked or bonded via the aforementioned nucleotide residue.
[0087] The combination of the adjacent nucleotide residue and OR.sup.1 and OR.sup.2 is not particularly limited, and may be, for example, either of the following conditions.
Condition (1)
[0088] The 3-terminal of the adjacent nucleotide residue is linked to the structure of the aforementioned formula (I) via OR.sup.2 and the 5-terminal of the adjacent nucleotide residue is linked to the structure of the aforementioned formula (I) via OR.sup.1.
Condition (2)
[0089] The 3-terminal of the adjacent nucleotide residue is linked to the structure of the aforementioned formula (I) via OR.sup.1 and the 5-terminal of the adjacent nucleotide residue is linked to the structure of the aforementioned formula (I) via OR.sup.2.
[0090] In the aforementioned formula (I), atomic group A is not particularly limited as long as the following formula (Ia):
##STR00019##
is an amino acid or a peptide.
[0091] For example, the atomic group A in the aforementioned (I) or (Ia) may or may not contain, for example, at least one selected from the group consisting of chain atomic group, alicyclic atomic group and aromatic atomic group. While the aforementioned chain atomic group is not particularly limited, for example, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxyalkyl, aminoalkyl, silyl, silyloxyalkyl and the like can be mentioned. While the aforementioned alicyclic atomic group is not particularly limited, for example, cycloalkyl, cycloalkenyl, cycloalkylalkyl, cyclylalkyl and the like can be mentioned. While the aforementioned aromatic atomic group is not particularly limited, for example, aryl, arylalkyl, alkylaryl, condensed-ring aryl, condensed-ring arylalkyl, condensed-ring alkylaryl and the like can be mentioned. In the atomic group A in the aforementioned formula (I) or (Ia), each of the aforementioned atomic groups may or may not further have a substituent or a protecting group. When the aforementioned substituent or protecting group is in plurality, they may be the same or different. The aforementioned substituents are, for example, those exemplified for the aforementioned R.sup.a, R.sup.b, R.sup.c and R.sup.d, more specifically, for example, halogen, hydroxy, alkoxy, amino, carboxy, sulfo, nitro, carbamoyl, sulfamoyl, alkyl, alkenyl, alkynyl, haloalkyl, aryl, arylalkyl, alkylaryl, cycloalkyl, cycloalkenyl, cycloalkylalkyl, cyclylalkyl, hydroxyalkyl, alkoxyalkyl, aminoalkyl, silyl, silyloxyalkyl, pyrrolyl, imidazolyl, and the like. The aforementioned protecting groups are, for example, the same as those exemplified for the aforementioned R.sup.a, R.sup.b, R.sup.c and R.sup.d.
[0092] In the present invention, the amino acid refers to any organic compound containing at least one amino group and at least one carboxy group in a molecule. The peptide refers to an organic compound having a structure wherein not less than 2 molecules of amino acid are bonded via a peptide bond. The aforementioned peptide bond may be an acid amide structure or an acid imide structure. When plural amino groups are present in the amino acid molecule represented by the aforementioned formula (Ia), the amino group clearly shown in the aforementioned formula (Ia) may be any amino group. In addition, when plural carboxy groups are present in the amino acid molecule represented by the aforementioned formula (Ia), the carboxy group clearly shown in the aforementioned formula (Ia) may be any carboxy group.
[0093] In the aforementioned linker region (X.sup.a) of the artificial sgRNA of the present invention, the aforementioned amino acid may be natural amino acid or artificial amino acid. In the present invention, the natural amino acid refers to an amino acid having a naturally-occurring structure or an optical isomer thereof. The production method of the aforementioned natural amino acid is not particularly limited and, for example, it may be extracted from the nature, or may be synthesized. In the present invention, moreover, the artificial amino acid refers to an amino acid having a structure not occurring naturally. That is, the aforementioned artificial amino acid is an amino acid, i.e., a carboxylic acid derivative containing an amino group (organic compound containing at least one amino group and at least one carboxy group in a molecule) and having a structure not occurring naturally. The aforementioned artificial amino acid preferably does not contain, for example, a hetero ring. The aforementioned amino acid may be an amino acid constituting, for example, a protein. The aforementioned amino acid may be, for example, at least one kind selected from the group consisting of glycine, -alanine, arginine, asparagine, aspartic acid, cysteine, cystine, glutamine, glutamic acid, histidine, isoleucine, leucine, lysine, hydroxylysine, methionine, phenylalanine, serine, threonine, tyrosine, valine, proline, 4-hydroxyproline, tryptophan, -alanine, 1-amino-2-carboxycyclopentane, aminobenzoic acid, aminopyridinecarboxylic acid and amino acid represented by the following chemical formula (Ia2), and may or may not further have a substituent or a protecting group. Examples of the aforementioned substituent include the substituents exemplified for the aforementioned R.sup.a, R.sup.b, R.sup.c and R.sup.d. More specifically, for example, halogen, hydroxy, alkoxy, amino, carboxy, sulfo, nitro, carbamoyl, sulfamoyl, alkyl, alkenyl, alkynyl, haloalkyl, aryl, arylalkyl, alkylaryl, cycloalkyl, cycloalkenyl, cycloalkylalkyl, cyclylalkyl, hydroxyalkyl, alkoxyalkyl, aminoalkyl, silyl, silyloxyalkyl, pyrrolyl, imidazolyl, and the like can be mentioned. The aforementioned protecting group is the same as, for example, the protecting groups exemplified for the aforementioned R.sup.a, R.sup.b, R.sup.c and R.sup.d. When the amino acid or peptide of the aforementioned formula (Ia) contains isomers such as optical isomer, geometric isomer, stereoisomer and the like, any isomer can be used.
##STR00020##
[0094] In the aforementioned chemical formula (Ia2), R.sup.100 is any substituent, and may or may not be present. When it is present, it may be present singly or in plurality. When it is present in plurality, they may be the same or different from each other. Examples of the aforementioned any substituent for R.sup.100 include those exemplified as the aforementioned R.sup.a, R.sup.b, R.sup.c or R.sup.d. More specific examples thereof include halogen, hydroxy, alkoxy, amino, carboxy, sulfo, nitro, carbamoyl, sulfamoyl, alkyl, alkenyl, alkynyl, haloalkyl, aryl, arylalkyl, alkylaryl, cycloalkyl, cycloalkenyl, cycloalkylalkyl, cyclylalkyl, hydroxyalkyl, alkoxyalkyl, aminoalkyl, silyl, silyloxyalkyl, pyrrolyl, imidazolyl, and the like. In addition, the structure of the aforementioned chemical formula (Ia2) may be, for example, the following chemical formula (Ia3):
##STR00021##
[0095] When the structure of the aforementioned chemical formula (Ia) is the aforementioned chemical formula (Ia2), the structure of atomic group A in the aforementioned chemical formula (I) is represented by the following chemical formula (A2). R.sup.100 in the following chemical formula (A2) is the same as R.sup.100 in the aforementioned chemical formula (Ia2). In addition, when the structure of the aforementioned chemical formula (Ia) is the aforementioned chemical formula (Ia3), the structure of atomic group A in the aforementioned chemical formula (I) is represented by the following chemical formula (A2a):
##STR00022##
[0096] Examples of the structure of the aforementioned chemical formula (I) include the following chemical formulas (I-1)-(I-7). In the following chemical formulas (I-1)-(I-7), n and m are the same as in the aforementioned chemical formula (I).
##STR00023##
[0097] In the aforementioned chemical formulae (I-1) to (I-7), n and m are not particularly limited, and are as described above. Specific examples thereof include n=11 and m=12 or n=5 and m=4 (Gly in Example mentioned later) in the aforementioned chemical formula (I-1), n=5 and m=4 (GlyGly in Example mentioned later) in the aforementioned chemical formula (I-4), n=4 and m=4 (TP in Example mentioned later) in the aforementioned chemical formula (I-6), and n=5 and m=4 (K in Example mentioned later) in the aforementioned chemical formula (1-7). The structures are shown by the following chemical formulas (I-1a), (I-1b), (I-4a), (I-6a) and (I-7a). Of these, the formulas (I-1b), (I-6a) and (I-7a) are preferable.
##STR00024##
[0098] Alternatively, in the artificial sgRNA of the present invention, the aforementioned linker region (X.sup.a) is shown by the following formula (II):
##STR00025##
[0099] In the aforementioned formula (II), for example,
[0100] X.sup.1 and X.sup.2 are each independently H.sub.2, O, S or NH;
[0101] Y.sup.1 and Y.sup.2 are each independently a single bond, CH.sub.2, NH, O or S;
[0102] R.sup.3 is a hydrogen atom or substituent that is bound to C-3, C-4, C-5, or C-6 on a ring A;
[0103] L.sup.1 is an alkylene chain composed of n atoms, and a hydrogen atom(s) on an alkylene carbon atom(s) may or may not be substituted with OH, OR.sup.a, NH.sub.2, NHR.sup.a, NR.sup.aR.sup.b, SH, or SR.sup.a, or,
[0104] L.sup.1 is a polyether chain obtained by substituting at least one carbon atom on the alkylene chain with an oxygen atom,
[0105] provided that: when Y.sup.1 is NH, O or S, an atom bound to Y.sup.1 in L.sup.1 is carbon, an atom bound to OR.sup.1 in L.sup.1 is carbon, and oxygen atoms are not adjacent to each other;
[0106] L.sup.2 is an alkylene chain composed of m atoms, and a hydrogen atom(s) on an alkylene carbon atom(s) may or may not be substituted with OH, OR.sup.c, NH.sub.2, NHR.sup.c, NR.sup.cR.sup.d, SH, or SR.sup.c, or
[0107] L.sup.2 is a polyether chain obtained by substituting at least one carbon atom on the alkylene chain with an oxygen atom,
[0108] provided that: when Y.sup.2 is NH, O or S, an atom bound to Y.sup.2 in L.sup.2 is carbon, an atom bound to OR.sup.2 in L.sup.2 is carbon, and oxygen atoms are not adjacent to each other;
[0109] R.sup.a, R.sup.b, R.sup.c, and R.sup.d are each independently a substituent or a protecting group;
[0110] l is 1 or 2;
[0111] m is an integer of 0 to 30;
[0112] n is an integer of 0 to 30;
[0113] on the ring A, one carbon atom other than C-2 may be substituted with nitrogen, oxygen, or sulfur;
[0114] the ring A may contain a carbon-carbon double bond or a carbon-nitrogen double bond;
R.sup.1 and R.sup.2 may or may not be present, and when they are present,
R.sup.1 and R.sup.2 are each independently a nucleotide residue or the structure of the formula (II), and
the aforementioned X.sup.a is bonded to the adjacent nucleotide residue via the aforementioned OR.sup.1 or OR.sup.2.
[0115] In the formula (II), X.sup.1 and X.sup.2 are each independently, for example, H.sub.2, O, S or NH. In the formula (I), X.sup.1 is H.sub.2 means that X.sup.1 forms CH.sub.2 (a methylene group) together with a carbon atom to which X.sup.1 binds. The same applies to X.sup.2.
[0116] In the formula (II), Y.sup.1 and Y.sup.2 are each independently a single bond, CH.sub.2, NH, O or S.
[0117] In the aforementioned formula (II), L.sup.1 is an alkylene chain composed of n atoms. A hydrogen atom(s) on an alkylene carbon atom(s) may or may not be substituted with, for example, OH, OR.sup.a, NH.sub.2, NHR.sup.a, NR.sup.aR.sup.b, SH, or SR.sup.a. Alternatively, L.sup.1 may be a polyether chain obtained by substituting at least one carbon atom on the alkylene chain with an oxygen atom. The polyether chain is, for example, polyethylene glycol. When Y.sup.1 is NH, O or S, an atom bound to Y.sup.1 in L.sup.1 is carbon, an atom bound to OR.sup.1 in L.sup.1 is carbon, and oxygen atoms are not adjacent to each other. That is, for example, when Y.sup.1 is O, this oxygen atom and the oxygen atom in L.sup.1 are not adjacent to each other, and the oxygen atom in OR.sup.1 and the oxygen atom in L.sup.1 are not adjacent to each other.
[0118] In the formula (II), L.sup.2 is an alkylene chain composed of m atoms. A hydrogen atom(s) on an alkylene carbon atom(s) may or may not be substituted with, for example, OH, OR.sup.c, NH.sub.2, NHR.sup.c, NR.sup.cR.sup.d, SH, or SR.sup.c. Alternatively, L.sup.2 may be a polyether chain obtained by substituting at least one carbon atom on the alkylene chain with an oxygen atom. When Y.sup.2 is NH, O or S, an atom bound to Y.sup.2 in L.sup.2 is carbon, an atom bound to OR.sup.2 in L.sup.2 is carbon, and oxygen atoms are not adjacent to each other. That is, for example, when Y.sup.2 is O, this oxygen atom and the oxygen atom in L.sup.2 are not adjacent to each other, and the oxygen atom in OR.sup.2 and the oxygen atom in L.sup.2 are not adjacent to each other.
[0119] n of L.sup.1 and m of L.sup.2 are not particularly limited, and the lower limit of each of them may be 0, for example, and the upper limit of the same is not particularly limited. n and m can be set as appropriate depending on, for example, a desired length of the aforementioned non-nucleotide structure. For example, from the view point of manufacturing cost, yield, and the like, n and m are each preferably 0 to 30, more preferably 0 to 20, and still more preferably 0 to 15. n and m may be the same (n=m) or different. n+m is, for example, 0 to 30, preferably 0 to 20, and more preferably 0 to 15.
[0120] R.sup.a, R.sup.b, R.sup.c, and R.sup.d is, for example, each independently a substituent or a protecting group. The substituent and the protecting group are, for example, the same as described above.
[0121] In the aforementioned formula (II), a hydrogen atoms each independently may be substituted with, for example, a halogen such as Cl, Br, F, or I.
[0122] The aforementioned X.sup.a is bonded to the adjacent nucleotide residue via OR.sup.1 or OR.sup.2. R.sup.1 and R.sup.2 may or may not be present. When R.sup.1 and R.sup.2 are present, R.sup.1 and R.sup.2 are each independently a nucleotide residue or the structure represented by the formula (II). When R.sup.1 and/or R.sup.2 is the structure represented by the formula (II), the structure of the linker region (X.sup.a) is such that, for example, two or more of the amino acid derivative residues having the above-mentioned structure of the formula (II) are linked to each other. The number of the structures of the formula (II) may be, for example, 1, 2, 3, or 4. When the linker region (Lx) includes a plurality of the structures, the structures of the formula (II) may be linked, for example, either directly or via the nucleotide residue(s).
[0123] The combination of the adjacent nucleotide residue and OR.sup.1 and OR.sup.2 is not particularly limited, and may be, for example, either of the following conditions.
Condition (1)
[0124] The 3-terminal of the adjacent nucleotide residue is linked to the structure of the aforementioned formula (II) via OR.sup.2 and the 5-terminal of the adjacent nucleotide residue is linked to the structure of the aforementioned formula (II) via OR.sup.1.
Condition (2)
[0125] The 3-terminal of the adjacent nucleotide residue is linked to the structure of the aforementioned formula (II) via OR.sup.1 and the 5-terminal of the adjacent nucleotide residue is linked to the structure of the aforementioned formula (II) via OR.sup.2.
[0126] In the aforementioned formula (II), l in the ring A is 1 or 2. When l=1, the ring A is a 5-membered ring, which is, for example, the pyrrolidine skeleton. The pyrrolidine skeleton is, for example, a proline skeleton, a prolinol skeleton, or the like, and specific examples include divalent structures of the proline skeleton and the prolinol skeleton. When l=2, the ring A is a 6-membered ring, which is, for example, the piperidine skeleton. On the ring A, one carbon atom other than C-2 may be substituted with nitrogen, oxygen, or sulfur. Furthermore, the ring A may contain a carbon-carbon double bond or a carbon-nitrogen double bond. The ring A may be, for example, in either L-form or D-form.
[0127] In the formula (II), R.sup.3 is a hydrogen atom or substituent that is bound to C-3, C-4, C-5, or C-6 on the ring A. When R.sup.3 is the substituent, there may be one substituent R.sup.3, two or more substituents R.sup.3, or no substituent R.sup.3, and when there are a plurality of substituents R.sup.3, they may be the same or different.
[0128] The substituent R.sup.3 is, for example, a halogen, OH, OR.sup.4, NH.sub.2, NHR.sup.4, NR.sup.4R.sup.5, SH, SR.sup.4, an oxo group (O), or the like.
[0129] R.sup.4 and R.sup.5 are each a substituent or a protecting group, and they may be the same or different. Examples of the substituent include halogens, alkyls, alkenyls, alkynyls, haloalkyls, aryls, heteroaryls, arylalkyls, cycloalkyls, cycloalkenyls, cycloalkylalkyls, cyclylalkyls, hydroxyalkyls, alkoxyalkyls, aminoalkyls, heterocyclylalkenyls, heterocyclylalkyls, heteroarylalkyls, silyls, and silyloxyalkyls. The same applies hereinafter. The substituent R.sup.3 may be any of the above-listed substituents.
[0130] The protecting group is, for example, a functional group that inactivates a highly-reactive functional group. Examples of the protecting group include known protecting groups. Regarding the protecting group, for example, the description in the literature (J. F. W. McOmie, Protecting Groups in Organic Chemistry, Plenum Press, London and New York, 1973) is incorporated herein by reference. The protecting group is not particularly limited, and examples thereof include a tert-butyldimethylsilyl group (TBDMS), a bis(2-acetoxyethyloxy)methyl group (ACE), a triisopropylsilyloxymethyl group (TOM), a 1-(2-cyanoethoxy)ethyl group (CEE), a 2-cyanoethoxymethyl group (CEM), a tolylsulfonylethoxymethyl group (TEM), and a dimethoxytrityl group (DMTr). When R.sup.3 is OR.sup.4, the protecting group is not particularly limited, and examples thereof include a TBDMS group, an ACE group, a TOM group, a CEE group, a CEM group, and a TEM group. Other examples of the protecting group include silyl-containing groups represented by the formula to be shown in the paragraph [0275]. The same applies hereinafter.
[0131] Examples of the structure of the formula (II) include the structures of the following formulae (II-1) to (II-9). In the following formulae, n and m are the same as in the formula (II). In the following formulae, q is an integer from 0 to 10.
##STR00026## ##STR00027##
[0132] In the formulae (II-1) to (II-9), n, m, and q are not particularly limited, and are as described above. Specific examples are as follows: in the formula (II-1), n=8; in the formula (II-2), n=3; in the formula (II-3), n=4 or 8; in the formula (II-4), n=7 or 8; in the formula (II-5), n=3 and m=4; in the formula (II-6), n=8 and m=4; in the formula (II-7), n=8 and m=4; in the formula (II-8), n=5 and m=4 (P in Example described later), n=7 and m=6 (P13 in Example described later), n=9 and m=8 (P14 in Example described later), or n=11 and m=10 (P15 in Example described later); and in the formula (II-9), q=1 and m=4. The following formula (II-4a) shows an example of the formula (II-4) (n=8), and the following formula (II-8a) shows an example of the formula (II-8) (n=5, m=4).
##STR00028##
[0133] In the present invention, the term alkyl encompasses, for example, straight-chain and branched alkyl groups. The number of carbon atoms in the alkyl is not particularly limited, and is, for example, 1 to 30, preferably 1 to 6 or 1 to 4. Examples of the alkyl group include: methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, isohexyl, n-heptyl, n-octyl, n-nonyl, and n-decyl. Among them, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, isohexyl, and the like are preferable.
[0134] In the present invention, the term alkenyl encompasses, for example, straight-chain and branched alkenyls. Examples of the alkenyl include the above-described alkyls having one or more double bonds. The number of carbon atoms in the alkenyl is not particularly limited, and is, for example, the same as that in the alkyl, preferably 2 to 8. Examples of the alkenyl include vinyl, 1-propenyl, 2-propenyl, 1-butenyl, 2-butenyl, 3-butenyl, 1,3-butadienyl, and 3-methyl-2-butenyl.
[0135] In the present invention, the term alkynyl encompasses, for example, straight-chain and branched alkynyls. Examples of the alkynyl include the above-described alkyls having one or more triple bonds. The number of carbon atoms in the alkynyl is not particularly limited, and is, for example, the same as that in the alkyl, preferably 2 to 8. Examples of the alkynyl include ethynyl, propynyl, and butynyl. The alkynyl may further include, for example, one or more double bonds.
[0136] In the present invention, the term aryl encompasses, for example, monocyclic aromatic hydrocarbon groups and polycyclic aromatic hydrocarbon groups. Examples of the monocyclic aromatic hydrocarbon group include phenyl. Examples of the polycyclic aromatic hydrocarbon group include 1-naphthyl, 2-naphthyl, 1-anthryl, 2-anthryl, 9-anthryl, 1-phenanthryl, 2-phenanthryl, 3-phenanthryl, 4-phenanthryl, and 9-phenanthryl. Among them, for example, phenyl, naphthyls such as 1-naphthyl and 2-naphthyl, and the like are preferable.
[0137] In the present invention, the term heteroaryl encompasses, for example, monocyclic aromatic heterocyclic groups and condensed aromatic heterocyclic groups. Examples of the heteroaryl include furyls (e.g., 2-furyl, 3-furyl), thienyls (e.g., 2-thienyl, 3-thienyl), pyrrolyls (e.g., 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl), imidazolyls (e.g., 1-imidazolyl, 2-imidazolyl, 4-imidazolyl), pyrazolyls (e.g., 1-pyrazolyl, 3-pyrazolyl, 4-pyrazolyl), triazolyls (e.g., 1,2,4-triazol-1-yl, 1,2,4-triazol-3-yl, 1,2,4-triazol-4-yl), tetrazolyls (e.g., 1-tetrazolyl, 2-tetrazolyl, 5-tetrazolyl), oxazolyls (e.g., 2-oxazolyl, 4-oxazolyl, 5-oxazolyl), isoxazolyls (e.g., 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl), thiazolyls (e.g., 2-thiazolyl, 4-thiazolyl, 5-thiazolyl), thiadiazolyls, isothiazolyls (e.g., 3-isothiazolyl, 4-isothiazolyl, 5-isothiazolyl), pyridyls (e.g., 2-pyridyl, 3-pyridyl, 4-pyridyl), pyridazinyls (e.g., 3-pyridazinyl, 4-pyridazinyl), pyrimidinyls (e.g., 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl), furazanyls (e.g., 3-furazanyl), pyrazinyls (e.g., 2-pyrazinyl), oxadiazolyls (e.g., 1,3,4-oxadiazol-2-yl), benzofuryls (e.g., 2-benzo[b]furyl, 3-benzo[b]furyl, 4-benzo[b]furyl, 5-benzo[b]furyl, 6-benzo[b]furyl, 7-benzo[b]furyl), benzothienyls (e.g., 2-benzo[b]thienyl, 3-benzo[b]thienyl, 4-benzo[b]thienyl, 5-benzo[b]thienyl, 6-benzo[b]thienyl, 7-benzo[b]thienyl), benzimidazolyls (e.g., 1-benzimidazolyl, 2-benzimidazolyl, 4-benzimidazolyl, 5-benzimidazolyl), dibenzofuryls, benzoxazolyls, benzothiazolyls, quinoxalyls (e.g., 2-quinoxalinyl, 5-quinoxalinyl, 6-quinoxalinyl), cinnolinyls (e.g., 3-cinnolinyl, 4-cinnolinyl, 5-cinnolinyl, 6-cinnolinyl, 7-cinnolinyl, 8-cinnolinyl), quinazolyls (e.g., 2-quinazolinyl, 4-quinazolinyl, 5-quinazolinyl, 6-quinazolinyl, 7-quinazolinyl, 8-quinazolinyl), quinolyls (e.g., 2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 6-quinolyl, 7-quinolyl, 8-quinolyl), phthalazinyls (e.g., 1-phthalazinyl, 5-phthalazinyl, 6-phthalazinyl), isoquinolyls (e.g., 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, 6-isoquinolyl, 7-isoquinolyl, 8-isoquinolyl), puryls, pteridinyls (e.g., 2-pteridinyl, 4-pteridinyl, 6-pteridinyl, 7-pteridinyl), carbazolyls, phenanthridinyls, acridinyls (e.g., 1-acridinyl, 2-acridinyl, 3-acridinyl, 4-acridinyl, 9-acridinyl), indolyls (e.g., 1-indolyl, 2-indolyl, 3-indolyl, 4-indolyl, 5-indolyl, 6-indolyl, 7-indolyl), isoindolyls, phenazinyls (e.g., 1-phenazinyl, 2-phenazinyl), and phenothiazinyls (e.g., 1-phenothiazinyl, 2-phenothiazinyl, 3-phenothiazinyl, 4-phenothiazinyl).
[0138] In the present invention, the term cycloalkyl refers to cyclic saturated hydrocarbon groups, for example, and the number of carbon atoms in the cycloalkyl is, for example, 3 to 15. Examples of the cycloalkyl include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, bridged cyclic hydrocarbon groups, and spiro hydrocarbon groups. Among them, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, bridged cyclic hydrocarbons, and the like are preferable.
[0139] In the present invention, examples of the bridged cyclic hydrocarbon groups include bicyclo[2.1.0]pentyl, bicyclo[2.2.1]heptyl, bicyclo[2.2.2]octyl, and bicyclo[3.2.1]octyl, tricyclo[2.2.1.0]heptyl, bicyclo[3.3.1]nonane, 1-adamantyl, and 2-adamantyl.
[0140] In the present invention, examples of the spiro hydrocarbon groups include spiro[3.4]octyl.
[0141] In the present invention, the term cycloalkenyl encompasses unsaturated cyclic aliphatic hydrocarbon groups, for example, and the number of carbon atoms in the cycloalkenyl is, for example, 3 to 7. Examples of the cycloalkenyl group include cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, and cycloheptenyl. Among them, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, and the like are preferable. The term cycloalkenyl also encompasses, for example, bridged cyclic hydrocarbon groups and spiro hydrocarbon groups having an unsaturated bond in their rings.
[0142] In the present invention, examples of the arylalkyl include benzyl, 2-phenethyl, and naphthalenylmethyl. Examples of the cycloalkylalkyl and cyclylalkyl include cyclohexylmethyl and adamantylmethyl. Examples of the hydroxyalkyl include hydroxymethyl and 2-hydroxyethyl.
[0143] In the present invention, the alkoxy encompasses groups composed of any of the above-described alkyls and oxygen (alkyl-O groups), for example, and examples thereof include methoxy, ethoxy, n-propoxy, isopropoxy, and n-butoxy. Examples of the alkoxyalkyl include methoxymethyl. Examples of the aminoalkyl include 2-aminoethyl.
[0144] In the present invention, examples of the heterocyclyl include 1-pyrrolinyl, 2-pyrrolinyl, 3-pyrrolinyl, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, pyrrolidinone, 1-imidazoliny, 2-imidazoliny, 4-imidazoliny, 1-imidazolidinyl, 2-imidazolidinyl, 4-imidazolidinyl, imidazolidinone, 1-pyrazolinyl, 3-pyrazolinyl, 4-pyrazolinyl, 1-pyrazolidinyl, 3-pyrazolidinyl, 4-pyrazolidinyl, piperidinone, piperidino, 2-piperidinyl, 3-piperidinyl, 4-piperidinyl, 1-piperazinyl, 2-piperazinyl, piperazinone, 2-morpholinyl, 3-morpholinyl, morpholino, tetrahydropyranyl, and tetrahydrofuranyl.
[0145] In the present invention, examples of the heterocyclylalkyl include piperidinylmethyl and piperazinylmethyl. Examples of the heterocyclylalkenyl include 2-piperidinyl ethenyl. Examples of the heteroarylalkyl include pyridylmethyl and quinolin-3-ylmethyl.
[0146] In the present invention, the term silyl encompasses groups represented by the formula R.sub.3Si, where R independently can be selected from the above-described alkyls, aryls, and cycloalkyls. Examples of the silyl include a trimethylsilyl group and a tert-butyldimethylsilyl group. Examples of the silyloxy include a trimethylsilyloxy group. Examples of the silyloxyalkyl include trimethylsilyloxymethyl.
[0147] In the present invention, examples of the alkylene include methylene, ethylene, and propylene.
[0148] In the present invention, the above-described various groups may be substituted. Examples of the substituent include hydroxy, carboxy, sulfo, halogens, alkyl halides (haloalkyl e.g., CF.sub.3, CH.sub.2CF.sub.3, CH.sub.2CCl.sub.3), nitro, nitroso, cyano, alkyls (e.g., methyl, ethyl, isopropyl, tert-butyl), alkenyls (e.g., vinyl), alkynyls (e.g., ethynyl), cycloalkyls (e.g., cyclopropyl, adamantyl), cycloalkylalkyls (e.g., cyclohexylmethyl, adamantylmethyl), cycloalkenyls (e.g., cyclopropenyl), cyclylalkyl, hydroxyalkyl (e.g., hydroxymethyl, hydroxyethyl), alkoxyalkyl (e.g., methoxymethyl, ethoxymethyl, ethoxyethyl), aryls (e.g., phenyl, naphthyl), arylalkyls (e.g., benzyl, phenethyl), alkylaryl (e.g., p-methylphenyl), heteroaryls (e.g., pyridyl, furyl), heteroarylalkyls (e.g., pyridylmethyl), heterocyclyls (e.g., piperidyl), heterocyclylalkenyl, heterocyclylalkyls (e.g., morpholylmethyl), alkoxys (e.g., methoxy, ethoxy, propoxy, butoxy), halogenated alkoxys (e.g., OCF.sub.3), alkenyloxys (e.g., vinyloxy, allyloxy), aryloxys (e.g., phenyloxy), alkyloxycarbonyls (e.g., methoxycarbonyl, ethoxycarbonyl, tert-butoxycarbonyl), arylalkyloxys (e.g., benzyloxy), aminos [alkylaminos (e.g., methylamino, ethylamino, dimethylamino), acylaminos (e.g., acetylamino, benzoylamino), arylalkylaminos (e.g., benzylamino, tritylamino), hydroxyamino], aminoalkyl (e.g., aminomethyl), alkylaminoalkyls (e.g., diethylaminomethyl), carbamoyl, sulfamoyl, oxo, silyl, silyloxyalkyl and the like.
[0149] Alternatively, in the artificial sgRNA of the present invention, the aforementioned linker region (X.sup.a) is shown by any of the following formulas (III-1)-(III-3). In each formula, n and m are the same as in the aforementioned chemical formula (I)
##STR00029##
[0150] In the aforementioned chemical formulas (III-1) to (III-3), n and m are not particularly limited, and are as described above. Specific examples thereof include n=5 and m=4 (F in Example described later) in the aforementioned chemical formula (III-1), n=5 and m=4 (L in Example described later) in the aforementioned chemical the formula (III-2), and n=5 and m=4 (E in Example described later) in the aforementioned chemical the formula (III-3). The structures thereof are shown by the following chemical formulas (III-1a), (III-2a) and (III-3a).
[0151] The structures thereof are shown by the following chemical formulas (III-1a), (III-2a) and (III-3a).
##STR00030##
[0152] In the artificial sgRNA of the present invention, (1) loop portion (GAAA) of stem-loop 2 and/or (2) linker region (UUAUC) of the natural form sgRNA can be substituted with the amino acid derivative linker (X.sup.b, Y) of the aforementioned formula (I) in addition to the aforementioned amino acid derivative linker (X.sup.a). Alternatively/in addition thereto, the amino acid derivative linker (X.sup.c, X.sup.d) of the aforementioned formula (I) can be added to and/or inserted into the vicinity of (3) 5-terminal and/or (4) 3-terminal of the natural form sgRNA.
##STR00031##
[0153] The amino acid derivative linkers X.sup.b, Y, X.sup.c and X.sup.d may be each independently, any amino acid derivative represented by the aforementioned formula (I). For example, as the aforementioned X.sup.b, a proline derivative linker represented by the aforementioned formula (II) is preferable, and a proline derivative linker (P) represented by the aforementioned formula (II-8) wherein n=5 and m=4 is more preferable.
[0154] Alternatively, as the aforementioned X.sup.b, a glycine derivative linker (Gly) represented by the aforementioned formula (I-1) wherein n=5 and m=4, a glycylglycine derivative linker (GlyGly) represented by the aforementioned formula (I-4) wherein n=5 and m=4, a terephthalic acid derivative linker (TP) represented by the aforementioned formula (I-6) wherein n=4 and m=4, a lysine derivative linker (K) represented by the aforementioned formula (I-7) wherein n=5 and m=4, a phenylalanine derivative linker (F) represented by (III-1) wherein n=5 and m=4, a leucine derivative linker (L) represented by the aforementioned formula (III-2) wherein n=5 and m=4, and a glutamic acid derivative linker (E) represented by the aforementioned formula (III-3) wherein n=5 and m=4 are also preferable.
[0155] As the aforementioned Y, a glycylglycine derivative linker represented by the aforementioned formula (I-4) and a proline derivative linker represented by the aforementioned formula (II) are preferable, and a glycylglycine derivative linker (GlyGly) represented by the aforementioned formula (I-4) wherein n=5 and m=4 and a proline derivative linker represented by the aforementioned formula (II-8) wherein n=5 and m=4(P), n=7 and m=6(P13), n=9 and m=8(P14), or n=11 and m=10(P15) are more preferable.
[0156] Alternatively, as the aforementioned Y, a glycine derivative linker (Gly) represented by the aforementioned formula (I-1) wherein n=5 and m=4, a terephthalic acid derivative linker (TP) represented by the aforementioned formula (I-6) wherein n=4 and m=4, a lysine derivative linker (K) represented by the aforementioned formula (I-7) wherein n=5 and m=4, a phenylalanine derivative linker (F) represented by (III-1) wherein n=5 and m=4, a leucine derivative linker (L) represented by the aforementioned formula (III-2) wherein n=5 and m=4, and a glutamic acid derivative linker (E) represented by the aforementioned formula (III-3) wherein n=5 and m=4 are also preferable.
[0157] As the aforementioned X.sup.c and X.sup.d, for example, a proline derivative linker represented by the aforementioned formula (II) is preferable, and a proline derivative linker (P) represented by the aforementioned formula (II-8) wherein n=5 and m=4 is more preferable.
[0158] Alternatively, as the aforementioned X.sup.c and X.sup.d, a glycine derivative linker (Gly) represented by the aforementioned formula (I-1) wherein n=5 and m=4, a glycylglycine derivative linker (GlyGly) represented by the aforementioned formula (I-4) wherein n=5 and m=4, a terephthalic acid derivative linker (TP) represented by the aforementioned formula (I-6) wherein n=4 and m=4, a lysine derivative linker (K) represented by the aforementioned formula (I-7) wherein n=5 and m=4, a phenylalanine derivative linker (F) represented by (III-1) wherein n=5 and m=4, a leucine derivative linker (L) represented by the aforementioned formula (III-2) wherein n=5 and m=4, and a glutamic acid derivative linker (E) represented by the aforementioned formula (III-3) wherein n=5 and m=4 are also preferable.
[0159] In one preferable embodiment, the artificial sgRNA of the present invention may be obtained by substituting only the tetraloop portion of the natural form sgRNA with the aforementioned amino acid derivative linker (X.sup.a). That is, in the following formula (A), X.sup.b and Y show a nucleotide linker consisting of 1 to 5 optional nucleotide residues and X.sup.c and X.sup.d are absent:
##STR00032##
[0160] X.sup.b and Y may respectively remain as the loop portion (GAAA) and the linker region (UUAUC) of the stem-loop 2 of the natural form sgRNA, or may also be replaced with other nucleotide linker as long as the structures of the stem-loop 2 and the linker region in the natural form sgRNA are retained. For example, it has been reported that an equivalent or higher DSB activity can be obtained even when the aforementioned Y is substituted from UUAUC to U alone.
[0161] In another preferable embodiment of the artificial sgRNA of the present invention, the loop portion (GAAA) of stem-loop 2 in addition to the tetraloop portion in the natural form sgRNA are substituted with the aforementioned amino acid derivative linker, preferably, a proline derivative linker represented by the aforementioned formula (II), more preferably, proline derivative linker (P) represented by the aforementioned formula (II-8) wherein n=5 and m=4.
[0162] Alternatively, an artificial sgRNA wherein the loop portion (GAAA) of stem-loop 2 is substituted with a glycine derivative linker (Gly) represented by the aforementioned formula (I-1) wherein n=5 and m=4, a glycylglycine derivative linker (GlyGly) represented by the aforementioned formula (I-4) wherein n=5 and m=4, a terephthalic acid derivative linker (TP) represented by the aforementioned formula (I-6) wherein n=4 and m=4, a lysine derivative linker (K) represented by the aforementioned formula (I-7) wherein n=5 and m=4, a phenylalanine derivative linker (F) represented by (III-1) wherein n=5 and m=4, a leucine derivative linker (L) represented by the aforementioned formula (III-2) wherein n=5 and m=4, and a glutamic acid derivative linker (E) represented by the aforementioned formula (III-3) wherein n=5 and m=4 is also preferable.
[0163] The artificial sgRNA of the present invention in which the loop portion (GAAA) of the stem-loop 2 in addition to the tetraloop portion of the natural form sgRNA are substituted with the aforementioned amino acid derivative linker is considered to be more superior due to the in vivo stability improving effect. It is also particularly useful as a tool for in vivo genome editing since it retains a DNA cleavage activity equal to or higher than that of the natural form sgRNA in cells.
[0164] In still another preferable embodiment of the artificial sgRNA of the present invention, the linker region (UUAUC) as well as the tetraloop portion and the loop portion (GAAA) of stem-loop 2 in the natural form sgRNA are substituted with the aforementioned amino acid derivative linker, preferably, a glycylglycine derivative linker represented by the aforementioned formula (I-4) and a proline derivative linker represented by the aforementioned formula (II), more preferably, a glycylglycine derivative linker (GlyGly) represented by the aforementioned formula (I-4) wherein n=5 and M=4 and a proline derivative linker represented by the aforementioned formula (II-8) wherein n=5 and m=4(P), n=7 and m=6(P13), n=9 and m=8(P14), or n=11 and m=10(P15).
[0165] Alternatively, an artificial sgRNA in which the linker region (UUAUC) is substituted with a glycine derivative linker (Gly) represented by the aforementioned formula (I-1) wherein n=5 and m=4, a glycylglycine derivative linker (GlyGly) represented by the aforementioned formula (I-4) wherein n=5 and m=4, a terephthalic acid derivative linker (TP) represented by the aforementioned formula (I-6) wherein n=4 and m=4, a lysine derivative linker (K) represented by the aforementioned formula (I-7) wherein n=5 and m=4, a phenylalanine derivative linker (F) represented by (III-1) wherein n=5 and m=4, a leucine derivative linker (L) represented by the aforementioned formula (III-2) wherein n=5 and m=4, and a glutamic acid derivative linker (E) represented by the aforementioned formula (III-3) wherein n=5 and m=4 is also preferable.
[0166] However, in consideration of the intracellular DNA cleavage activity when combined with Cas9, the artificial sgRNA of the present invention may be preferably free of simultaneous substitution of X.sup.a, X.sup.b and Y in the aforementioned formula (A) with an amino acid derivative linker in some cases.
[0167] In still another preferable embodiment of the artificial sgRNA of the present invention, the aforementioned amino acid derivative linker, preferably, a proline derivative linker represented by the aforementioned formula (II), more preferably, proline derivative linker (P) represented by the aforementioned formula (II-8) wherein n=5 and m=4 is added to and inserted into the vicinity of the 5-terminal and 3-terminal in addition to the tetraloop portion in the natural form sgRNA.
[0168] Alternatively, an artificial sgRNA wherein a glycine derivative linker (Gly) represented by the aforementioned formula (I-1) wherein n=5 and m=4, a glycylglycine derivative linker (GlyGly) represented by the aforementioned formula (I-4) wherein n=5 and m=4, a terephthalic acid derivative linker (TP) represented by the aforementioned formula (I-6) wherein n=4 and m=4, a lysine derivative linker (K) represented by the aforementioned formula (I-7) wherein n=5 and m=4, a phenylalanine derivative linker (F) represented by (III-1) wherein n=5 and m=4, a leucine derivative linker (L) represented by the aforementioned formula (III-2) wherein n=5 and m=4, and a glutamic acid derivative linker (E) represented by the aforementioned formula (III-3) wherein n=5 and m=4 are respectively added to and inserted into the vicinity of the 5-terminal and 3-terminal is also preferable.
[0169] The artificial sgRNA of the present invention in which the aforementioned amino acid derivative linker, preferably, a proline derivative linker represented by the aforementioned formula (II), more preferably, proline derivative linker (P) represented by the aforementioned formula (II-8) wherein n=5 and m=4, is added to and inserted into each of the vicinity of the 5-terminal and 3-terminal in addition to the tetraloop portion in the natural form sgRNA is considered to be more superior due to the improvement of stability in vivo and the effect reducing side effect due to the enhanced innate immune response. It is also particularly useful as a tool for in vivo genome editing since it retains a DNA cleavage activity equal to or higher than that of the natural form sgRNA in cells.
[0170] As mentioned above, any of the above-mentioned artificial sgRNA into which two or more amino acid derivative linkers are introduced can have, when combined with Cas9 and similar to artificial sgRNA into which an amino acid derivative linker is introduced into X.sup.a alone, a target double-stranded DNA cleavage activity within the cell which is equal to or higher than that of the natural form sgRNA. Introduction of two or more amino acid derivative linkers further improves nuclease resistance of sgRNA and can improve stability in vivo. The effect of improving the stability in vivo can be confirmed, for example, by conducting a resistance test to serum and/or nuclease in vitro.
[0171] The artificial sgRNA of the present invention also includes not only the nucleotide sequence shown by the aforementioned formula (A) but also said nucleotide sequence wherein 1 to several (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) nucleotide residues are substituted, deleted, inserted or added, and showing, when combined with Cas9, a target double-stranded DNA recognizing ability (binding activity) equivalent to or higher than that of the natural form sgRNA. For example, a report has documented that replacement of Watson-Crick base pairs (UUUU/AAAA) between the repeat region and the antirepeat region with CCCC/GGGG, or substitution of Watson-Crick base pairs (ACUU/UGAA) in stem-loop 2 with CGCC/GCGG or insertion of 2 base pairs (ACUUGA/UGAACU) did not result in a significant decrease in the DSB activity when combined with Cas9, and truncation of the linker region (UUAUC) to U alone significantly increased DSB activity. Therefore, the action effect of the artificial sgRNA of the present invention can be exerted even when a mutation maintaining the characteristic hairpin structure of sgRNA is introduced into the nucleotide sequence of the aforementioned formula (A).
[0172] According to the study of the present inventors, a truncated sgRNA lacking the 3-terminal and further the stem-loop 2 and linker region of tracrRNA, without introducing the amino acid derivative linker of the present invention into the natural form sgRNA, showed a significantly decreased DSB activity when combined with Cas9. On the other hand, as shown in the below-mentioned Experimental Example 3, not only the tetraloop of the natural form sgRNA but also 1-3 base pairs of the stem adjacent thereto and/or not only the loop portion of the stem-loop 2 but also 1-4 base pairs of the stem adjacent thereto are substituted with the aforementioned amino acid derivative linker, preferably, a proline derivative linker represented by the aforementioned formula (II), more preferably, proline derivative linker (P) represented by the aforementioned formula (II-8) wherein n=5 and m=4, whereby even a truncated sgRNA can maintain sufficient DSB activity even though inferior to the natural form sgRNA.
[0173] In addition, good DSB activity can be maintained when combined with Cas9 by substituting the loop portion of stem-loop 1 or stem-loop 3 in tracrRNA with the aforementioned amino acid derivative linker, preferably, a proline derivative linker represented by the aforementioned formula (II), more preferably, proline derivative linker (P) represented by the aforementioned formula (II-8) wherein n=5 and m=4, without modifying the tetraloop, stem-loop 2 or linker region in tracrRNA or both terminals of sgRNA.
[0174] Therefore, the present invention also provides the following artificial sgRNA.
(a) sgRNA represented by the aforementioned formula (A),
(i) wherein X.sup.a is represented by the aforementioned formula
(II-8) wherein n=5 and m=4, and 1 to 3 base pairs of the stem adjacent to X.sup.a are deleted, and/or
(ii) wherein X.sup.b is represented by the aforementioned formula (II-8) wherein n=5 and m=4, and 1 to 4 base pairs of the stem adjacent to X.sup.b are deleted;
(b) sgRNA represented by the aforementioned formula (A), wherein X.sup.a, X.sup.b and Y are 1 to 5 optional nucleotide linkers, X.sup.c and X.sup.d are absent, and loop portion (UA) of stem-loop 1 or loop portion (AGU) of stem-loop 3 is substituted with an amino acid derivative linker represented by the aforementioned formula (II-8) wherein n=5 and m=4.
[0175] The nucleotide residue constituting the artificial sgRNA of the present invention includes, as its components, a sugar, a base, and a phosphate. The nucleotide residue may be, for example, a ribonucleotide residue or a deoxyribonucleotide residue, as described above. The ribonucleotide residue has, for example, a ribose residue as the sugar; and adenine (A), guanine (G), cytosine (C), or uracil (U) as the base. The deoxyribose residue has, for example, a deoxyribose residue as the sugar; and adenine (A), guanine (G), cytosine (C), or thymine (T) as the base.
[0176] The aforementioned nucleotide residue may be, for example, an unmodified nucleotide residue or a modified nucleotide residue. The components of the unmodified nucleotide residue are, for example, the same or substantially the same as the components of a naturally-occurring nucleotide residue. Preferably, the components are the same or substantially the same as the components of a nucleotide residue occurring naturally in a human body.
[0177] The modified nucleotide residue is, for example, a nucleotide residue obtained by modifying the unmodified nucleotide residue. The modified nucleotide residue may be such that, for example, any of the components of the unmodified nucleotide residue is modified. In the present invention, modification means, for example, substitution, addition, and/or deletion of any of the components; and substitution, addition, and/or deletion of an atom(s) and/or a functional group(s) in the component(s). It also can be referred to as modification. Examples of the modified nucleotide residue include naturally-occurring nucleotide residues and artificially-modified nucleotide residues. Regarding the naturally-derived modified nucleotide residues, for example, Limbach et al. (1994, Summary: the modified nucleosides of RNA, Nucleic Acids Res. 22: pp. 2183 to 2196) can be referred to. The modified nucleotide residue may be, for example, a residue of an alternative of the nucleotide residue.
[0178] Examples of the modification of the nucleotide residue include modification of a ribose-phosphate backbone (hereinafter referred to as a ribophosphate backbone).
[0179] In the ribophosphate backbone, for example, a ribose residue may be modified. In the ribose residue, for example, the 2-position carbon can be modified. Specifically, a hydroxyl group bound to the 2-position carbon can be, for example, substituted with hydrogen, fluoro, or the like. By substituting the hydroxyl group bound to the 2-position carbon with hydrogen, it is possible to substitute the ribose residue with deoxyribose residue. The ribose residue can be substituted with its stereoisomer, for example, and may be, for example, substituted with an arabinose residue.
[0180] The ribophosphate backbone may be substituted with, for example, a non-ribophosphate backbone having a non-ribose residue and/or a non-phosphate. The non-ribophosphate backbone may be, for example, the ribophosphate backbone modified so as to be uncharged, or the like. Examples of an alternative obtained by substituting the ribophosphate backbone with the non-ribophosphate backbone in the nucleotide residue include morpholino, cyclobutyl, and pyrrolidine. Other examples of the alternative include artificial nucleic acid monomer residues. Specific examples thereof include PNA (Peptide Nucleic Acid), LNA (Locked Nucleic Acid), and ENAs (2-O,4-C-Ethylenebridged Nucleic Acids). Among them, PNA is preferable.
[0181] In the ribophosphate backbone, for example, a phosphate group can be modified. In the ribophosphate backbone, a phosphate group in the closest proximity to the sugar residue is called an -phosphate group. The -phosphate group is charged negatively, and the electric charges are distributed evenly over two oxygen atoms that are not linked to the sugar residue. Among the four oxygen atoms in the -phosphate group, the two oxygen atoms not linked to the sugar residue in the phosphodiester linkage between the nucleotide residues hereinafter are referred to as non-linking oxygens. On the other hand, two oxygen atoms that are linked to the sugar residue in the phosphodiester linkage between the nucleotide residues hereinafter are referred to as linking oxygens. The -phosphate group preferably is modified so as to be uncharged, or, for example, so as to render the charge distribution between the non-linking atoms asymmetric.
[0182] In the phosphate group, for example, the non-linking oxygen(s) may be substituted. The oxygen(s) can be substituted with any atom selected from S (sulfur), Se (selenium), B (boron), C (carbon), H (hydrogen), N (nitrogen), and OR (R is an alkyl group or an aryl group, for example,), for example, and substitution with S is preferable. It is preferable that both the non-linking oxygens are substituted, for example, and it is more preferable that both the non-linking oxygens are substituted with S. Examples of the thus-modified phosphate group include phosphorothioates, phosphorodithioates, phosphoroselenates, borano phosphates, borano phosphates, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates, and phosphotriesters. In particular, phosphorodithioate in which both of the two non-linking oxygens are substituted with S is preferable.
[0183] In the phosphate group, for example, the linking oxygen(s) may be substituted. The oxygen(s) may be substituted with, for example, any atom selected from S (sulfur), C (carbon), and N (nitrogen). Examples of the thus-modified phosphate group include: bridged phosphoroamidates resulting from the substitution with N; bridged phosphorothioates resulting from the substitution S; and bridged methylenephosphonates resulting from the substitution C. Preferably, substitution of the linking oxygen(s) is performed, for example, in at least one of the 5 end nucleotide residue and the 3 end nucleotide residue of the artificial sgRNA of the present invention. When the substitution is performed on the 5 side, substitution with C is preferable. When the substitution is performed on the 3 side, substitution with N is preferable.
[0184] The phosphate group may be, for example, substituted with the phosphate-free linker. The linker may contain siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, methyleneoxymethylimino, or the like. Preferably, the linker may contain a methylene carbonyl amino group and a methylenemethylimino group.
[0185] In the artificial sgRNA of the present invention, for example, at least one of a nucleotide residue at the 3 end and a nucleotide residue at the 5 end may be modified. The nucleotide residue at either one of the 3 end and the 5 end may be modified or, for example, the nucleotide residues at both the 3 end and the 5 end may be modified. The modification may be as described above, for example, and it is preferable to modify a phosphate group(s) at the end(s). The entire phosphate group may be, for example, modified, or one or more atoms in the phosphate group may be modified. In the former case, for example, the entire phosphate group may be substituted or deleted.
[0186] Modification of the nucleotide residue(s) at the end(s) may be, for example, addition of any other molecule, or the like. Examples of the other molecule include functional molecules such as labeling substances as described above and protecting groups. Examples of the protecting groups include S (sulfur), Si (silicon), B (boron), and ester-containing groups.
[0187] The other molecule may be, for example, added to the phosphate group of the nucleotide residue, or may be added to the phosphate group or the sugar residue via a spacer. The terminal atom of the spacer can be, for example, added to or substituted for either one of the linking oxygens of the phosphate group, or O, N, S or C of the sugar residue. The binding site in the sugar residue preferably is, for example, C at the 3-position, C at the 5-position, or any atom bound thereto. The spacer also can be added to, for example, or substituted for a terminal atom of the nucleotide alternative such as PNA.
[0188] The spacer is not particularly limited, and examples thereof include (CH.sub.2).sub.n, (CH.sub.2).sub.nN, (CH.sub.2).sub.nS, O(CH.sub.2CH.sub.2O).sub.nCH.sub.2CH.sub.2OH, abasic sugars, amide, carboxy, amine, oxyamine, oxyimine, thioether, disulfide, thiourea, sulfonamide, and morpholino, and also biotin reagents and fluorescein reagents. In the above formulae, n is a positive integer, and n=3 or 6 is preferable.
[0189] Other examples of the molecule to be added to the end include dyes, intercalating agents (e.g., acridines), crosslinking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic carriers (e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O (hexadecyl)glycerol, a geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, a heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholic acid, dimethoxytrityl, or phenoxazine), peptide complexes (e.g., Antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG].sub.2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), and synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole complexes, Eu.sup.3+ complexes of tetraazamacrocycles).
[0190] In the artificial sgRNA of the present invention, for example, the 5 end may be modified with a phosphate group or a phosphate group analog. Examples of the phosphate group include:
5-monophosphate ((HO).sub.2(O)PO-5); 5-diphosphate (HO).sub.2(O)POP(HO)(O)O-5); 5-triphosphate(HO).sub.2(O)PO(HO)(O)POP(HO)(O)O-5);
5-guanosine cap (7-methylated or non-methylated, 7m-G-O-5-(HO)(O)PO(HO)(O)POP(HO)(O)O-5);
5-adenosine cap (Appp);
any modified or unmodified nucleotide cap structure (NO-5-(HO)(O)PO(HO)(O)POP(HO)(O)O-5);
5-monothiophosphate (phosphorothioate: (HO).sub.2(S) PO-5);
5-monodithiophosphate (phosphorodithioate: (HO)(HS)(S)PO-5);
5-phosphorothiolate ((HO).sub.2(O)PS-5);
sulfur substituted monophosphate, diphosphate, and
triphosphates (e.g., 5--thiotriphosphate, 5--thiotriphosphate, and the like);
5-phosphoramidates ((HO).sub.2(O)PNH-5, (HO)(NH.sub.2)(O)PO-5); 5-alkylphosphonates (e.g., RP(OH)(O)O-5, (OH).sub.2(O)P-5-CH.sub.2,
where R is alkyl (e.g., methyl, ethyl, isopropyl, propyl, or the like)); and 5-alkyletherphosphonates (e.g., RP(OH)(O)O-5, where R is alkylether (e.g., methoxymethyl, ethoxymethyl, or the like)).
[0191] In the nucleotide residue, the base is not particularly limited. The base may be, for example, a natural base or a non-natural base. The base may be, for example, a naturally-derived base or a synthetic base. As the base, for example, a common (universal) base, a modified analog thereof, and the like can be used.
[0192] Examples of the base include: purine bases such as adenine and guanine; and pyrimidine bases such as cytosine, uracil, and thymine. Other examples of the base include inosine, thymine, xanthine, hypoxanthine, nubularine, isoguanisine, and tubercidine. Examples of the base also include: alkyl derivatives such as 2-aminoadenine, 6-methylated purine, and 2-propylated purine; 5-halouracil and 5-halocytosine; 5-propynyl uracil and 5-propynyl cytosine; 6-azo uracil, 6-azo cytosine, and 6-azo thymine; 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5-(2-aminopropyl)uracil, 5-amino allyl uracil; 8-halogenated, aminated, thiolated, thioalkylated, hydroxylated, and other 8-substituted purines; 5-trifluoromethylated and other 5-substituted pyrimidines; 7-methylguanine; 5-substituted pyrimidines; 6-azapyrimidines; N-2, N-6, and O-6 substituted purines (including 2-aminopropyladenine); 5-propynyluracil and 5-propynylcytosine; dihydrouracil; 3-deaza-5-azacytosine; 2-aminopurine; 5-alkyluracil; 7-alkylguanine; 5-alkylcytosine; 7-deazaadenine; N6,N6-dimethyladenine; 2,6-diaminopurine; 5-amino-allyl-uracil; N3-methyluracil; substituted 1,2,4-triazoles; 2-pyridinone; 5-nitroindole; 3-nitropyrrole; 5-methoxyuracil; uracil-5-oxyacetic acid; 5-methoxycarbonylmethyluracil; 5-methyl-2-thiouracil; 5-methoxycarbonylmethyl-2-thiouracil; 5-methylaminomethyl-2-thiouracil; 3-(3-amino-3-carboxypropyl)uracil; 3-methylcytosine; 5-methylcytosine; N4-acetylcytosine; 2-thiocytosine; N6-methyladenine; N6-isopentyladenine; 2-methylthio-N6-isopentenyladenine; N-methylguanine; and O-alkylated bases. Examples of the purines and pyrimidines include those disclosed in U.S. Pat. No. 3,687,808, Concise Encyclopedia of Polymer Science and Engineering, pp. 858 to 859, edited by Kroschwitz J. I, John Wiley & Sons, 1990, and Englisch et al, Angewandte Chemie, International Edition, 1991, vol. 30, p. 613.
[0193] Other examples of the modified nucleotide residue include those having no base, i.e., those having an abasic ribophosphate backbone. Furthermore, as the modified nucleotide residue, those described in U.S. Provisional Application 60/465,665 (filing date: Apr. 25, 2003) and International Application No. PCT/US04/07070 (filing date: Mar. 8, 2004) can be used, for example, and these documents are incorporated herein by reference.
[0194] The artificial sgRNA of the present invention can be, for example, a modified form in which any functional molecule is added via a non-nucleotide residue such as an amino acid derivative linker by the method described in WO 2013/180038.
2. Synthesis Method of Artificial sgRNA of the Present Invention
[0195] The method for synthesizing the artificial sgRNA of the present invention is not particularly limited, and a conventionally known method can be employed. Examples thereof include a phosphoramidite method and an H-phosphonate method. The chemical synthesis methods can be carried out, for example, using a commercially available automated nucleic acid synthesizer. In the chemical synthesis methods, an amidite generally is used. The amidite is not particularly limited. Examples of commercially available amidites include RNA Phosphoramidites (2-O-TBDMSi, trade name, Samchully Pharm. Co., Ltd.), ACE amidite, TOM amidite, CEE amidite, CEM amidite, and TEM amidite. In the synthesis of the artificial sgRNA of the present invention, for example, it is preferable to use the monomer of the present invention to be described below for the synthesis of the linker region(s) represented by the formula (I).
3. Monomer of the Present Invention
[0196] The monomer according to the present invention is a monomer for nucleic acid synthesis, having the structure of the following formula (IV):
##STR00033##
wherein X.sup.1, X.sup.2, Y.sup.1, L.sup.1, L.sup.2 and A are as defined for the aforementioned formula (I), and R.sup.11 and R.sup.21 are each independently a hydrogen atom, a protecting group or a phosphoric acid protecting group.
[0197] In R.sup.11 and R.sup.21, for example, the protecting group is as described above regarding the formula (I). Specifically, for example, the protecting group can be selected from Group I. Group I includes, for example, a dimethoxytrityl (DMTr) group, a TBDMS group, an ACE group, a TOM group, a CEE group, a CEM group, a TEM group, and silyl-containing groups (group I) represented by the following formula (P1) or (P2). In particular, it is preferable that the protecting group is the DMtr group or any of the silyl-containing groups.
##STR00034##
[0198] The phosphate-protecting group can be represented, for example, by the following formula:
P(OR.sup.6)(NR.sup.7R.sup.8).
[0199] In the formula, R.sup.6 is a hydrogen atom or any substituent. The substituent R.sup.6 preferably is a hydrocarbon group and, for example, the hydrocarbon group may or may not be substituted with an electron-withdrawing group. Examples of the substituent R.sup.6 include halogens, haloalkyls, heteroaryls, hydroxyalkyls, alkoxyalkyls, aminoalkyls, silyls, silyloxyalkyls, heterocyclylalkenyls, heterocyclylalkyls, heteroarylalkyls, and hydrocarbons such as alkyls, alkenyls, alkynyls, aryls, arylalkyls, cycloalkyls, cycloalkenyls, cycloalkylalkyls, and cyclylalkyls. Furthermore, the substituent R.sup.6 may or may not be substituted with an electron-withdrawing group. Specific examples of the substituent R.sup.6 include a -cyanoethyl group, a nitrophenylethyl group, and a methyl group.
[0200] R.sup.7 and R.sup.8 are each a hydrogen atom or any substituent, and they may be the same or different. The substituents R.sup.7 and R.sup.8 preferably are each a hydrocarbon group, and the hydrocarbon group may or may not be substituted with any substituent. Examples of the hydrocarbon group are the same as those listed in the above description regarding R.sup.6, and the hydrocarbon group preferably is a methyl group, an ethyl group, or an isopropyl group. In this case, specific examples of NR.sup.7R.sup.8 include a diisopropylamino group, a diethylamino group, and an ethylmethylamino group. Alternatively, the substituents R.sup.7 and R.sup.8 together (i.e., NR.sup.7R.sup.8 as a whole) may form a nitrogen-containing ring (e.g., a piperidyl group, a morpholino group, or the like) with a nitrogen atom(s) to which they bind.
[0201] As specific example of the above-mentioned phosphate-protecting group, for example, P(OCH.sub.2CH.sub.2CN)(N(i-Pr).sub.2), P(OCH.sub.3)(N(i-Pr).sub.2) and the like (group II) can be mentioned. In the above formulae, i-Pr indicates isopropyl.
[0202] In the formula (IV), for example, one of R.sup.11 and R.sup.21 is a hydrogen atom or a protecting group, and the other is a hydrogen atom or a phosphate-protecting group. For example, it is preferable that, when R.sup.11 is a protecting group, R.sup.21 is a hydrogen atom or a phosphate-protecting group. Specifically, it is preferable that, when R.sup.11 is selected from Group I, R.sup.21 is a hydrogen atom or is selected from Group II. Also, it is preferable that, for example, when R.sup.11 is a phosphate-protecting group, R.sup.21 is a hydrogen atom or a protecting group. Specifically, it is preferable that, when R.sup.11 is selected from Group II, R.sup.21 is a hydrogen atom or is selected from Group I.
[0203] As the monomer of the present invention, specifically, for example, the monomer described in WO 2013/103146 and the like, and the monomers represented by the following formulas (IV-1)-(IV-3) can be mentioned.
##STR00035##
(in each formula, R.sup.11 and R.sup.21 are as defined for the aforementioned formula (IV), and n and m are each independently an integer of 0-30.)
[0204] The monomer of the present invention can be synthesized, for example, the method described in WO 2013/103146 and the like, or the method described in the below-mentioned Examples.
4. CRISPR/Cas9 System
[0205] The present invention also provides a CRISPR/Cas9 system combining the above-mentioned artificial sgRNA of the present invention and Cas9.
[0206] Cas9 used in the present invention is not particularly limited as long as it forms a complex with the artificial sgRNA of the present invention and can recognize and bind to the target nucleotide sequence in the target double-stranded DNA and the proto-spacer adjacent motif (PAM) adjacent thereto. Streptococcus pyogenes-derived Cas9 (SpCas9; PAM sequence NGG (N is A, G, T or C, hereinafter the same)), as long as a complex with the artificial sgRNA of the present invention can be formed, Streptococcus thermophiles-derived Cas9 (StCas9; PAM sequence NNAGAAW), Neisseria meningitidis-derived Cas9 (MmCas9; PAM sequence NNNNGATT) and the like can be preferably used. SpCas9 which is less restricted by PAM is particularly preferable (it is substantially 2 bases and can theoretically be targeted almost anywhere on the genome). As Cas9 used in the present invention, in addition to wild-type Cas9 capable of cleaving both strands of double-stranded DNA, one having nickase activity resulted from inactivation of the cleavage ability of one chain (nCas9) can also be used. For example, in the case of SpCas9, a D10A mutant in which the 10th Asp residue is converted to Ala residue and lacking the cleavage ability of a strand opposite to the strand forming a complementary strand with sgRNA, and a H840A mutant in which the 840th His residue is converted to Ala residue and lacking the cleavage ability of the strand forming a complementary strand with sgRNA can be mentioned, though not limited thereto. Furthermore, depending on the use object, a double mutant lacking cleavage ability of both strands (dCas9) can also be used. Specific examples of the embodiments using dCas9 and nCas9 include, but are not limited to, fusing a transcriptional regulatory factor or a chromatin modulator with dCas9/nCas9 to control the transcription of a target gene and visualizing the target locus by fusing a fluorescent protein (live imaging) and the like.
[0207] In addition, Cpf1 can also be used instead of Cas9. Examples of the Cpf1 include, but are not limited to, Francisella novicida-derived Cpf1 (FnCpf1; PAM sequence NTT), Acidaminococcus sp.-derived Cpf1 (AsCpf1; PAM sequence NTTT), Lachnospiraceae bacterium-derived Cpf1 (LbCpf1; PAM sequence NTTT) and the like. In the case of Cpf1, it is also possible to use mutants lacking cleavage activity of one or both strands. For example, in the case of FnCpf1, a mutant (dCpf1) in which the 917th Asp residue is converted to Ala residue (D917A) or the 1006th Glu residue is converted to Ala residue (E1006A), and lacking the cleavage ability of the both strands can be used.
[0208] Cas9 to be used in the CRISPR/Cas9 system of the present invention may be in the form of a protein or mRNA encoding the protein. Alternatively, it may be in the form of an expression vector containing a DNA encoding Cas9. When the CRISPR/Cas9 system is performed as an enzyme reaction of a cell-free system, Cas 9 is provided in the form of a protein. On the other hand, when modification of a target gene in a cell is aimed, Cas9 can be introduced into a cell in any form of a protein, an mRNA encoding the protein, and an expression vector containing a DNA encoding the same.
[0209] DNA encoding Cas9 can be cloned, for example, by amplifying same by RT-PCR method using total RNA or mRNA fraction prepared from the cell producing the protein as a template. A mutant Cas9 can be obtained by introducing a mutation into a DNA encoding the cloned Cas9 by using a site-specific mutagenesis method known per se, so as to convert the amino acid residue at the site important for the DNA cleavage activity (e.g., in the case of Cas9, the 10th Asp residue and the 840th His residue can be mentioned, though not limited thereto) with other amino acid. Alternatively, the DNA encoding Cas9 can also be constructed as DNA having codon usage suitable for expression in a host cell to be used, in combination with chemical synthesis or PCR method or Gibson Assembly method. For example, CDS sequences optimized for expression of SpCas9 in eukaryotic cells are well known.
[0210] DNA encoding the obtained Cas9 can be inserted into the downstream of the promoter of a suitable expression vector according to the host. An expression vector can be introduced by a known method (e.g., lysozyme method, competent method, PEG method, CaCl.sub.2 coprecipitation method, electroporation method, microinjection method, particle gun method, lipofection method, Agrobacterium method and the like) according to the kind of the host.
[0211] The artificial sgRNA of the present invention and Cas9 can be introduced into a host cell preferably by a nucleofection method.
[0212] The sgRNA introduced (and expressed) in the cell forms a complex with the Cas9 protein and binds to the target sequence to induce DSB in the target gene. The DSB is repaired by non-homologous end joining (NHEJ), but the target gene is destroyed (knockout) by a frameshift mutation due to accidental insertion or deletion (indel) of base(s) occurring at that time. In addition, co-transfection of a donor DNA having a sequence homologous to the target at both ends results in homologous recombination repair, thus enabling base modification and gene insertion (knockin).
[0213] The present invention is explained in detail in the following by referring to Examples and the like, which are not to be construed as limitative.
EXAMPLE
(Example 1) Synthesis of sgRNAs
[0214] sgRNAs shown in Table 1 were synthesized based on a phosphoramidite method and using a nucleic acid synthesizer (The ABI Expedite 8909 Nucleic Acid Synthesis System, Applied Biosystems). As RNA amidite, EMM amidite (WO 2013/027843) was used in the aforementioned synthesis (hereinafter the same). Deprotection of the aforementioned amidite was performed according to a conventional method, and sgRNA was purified by HPLC. In the following sequences, the underlined part is a guide region complementary to the target nucleotide sequence, proline diamide amidite was introduced into P, lysine diamide amidite was introduced into K, and glycylglycine diamide amidite was introduced into X.
TABLE-US-00001 TABLE1 ID Sequence(5-3) SG-0001 GUAGUUGGAGCUGUUGGCGUGUUUUAGAGCUAGAA AUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU SG-0002 GUAGUUGGAGCUGUUGGCGUGUUUUAGAGCUA-P- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU SG-0012 GUAGUUGGAGCUGUUGGCGUGUUUUAGAGCUA-K- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU SG-0013 GUAGUUGGAGCUGUUGGCGUGUUUUAGAGCUA-X- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU SG-0014 GUAGUUGGAGCUGUUGGCGUGUUUUAGAGCUA-P- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU-P-AAGUGGCACCGAGUCGGUGCUUU SG-0015 GUAGUUGGAGCUGUUGGCGUGUUUUAGAGCUA-P- UAGCAAGUUAAAAUAAGGCUAGUCCG-X-AACUU-P-AAGUGGCACCGAGUCGGUGGUUU SG-0016 P-GUAGUUGGAGCUGUUGGCGUGUUUUAGAGCUA-P- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-P-U SG-0017 AAGCGUCCCCGCGCGGUGAAGUUUUAGAGCUAGAAAU AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU SG-0018 AAGCGUCCCCGCGCGGUGAAGUUUUAGAGCUA-P- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU SG-0019 AAGCGUCCCCGCGCGGUGAAGUUUUAGAGCUA-K- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU SG-0020 AAGCGUCCCCGCGCGGUGAAGUUUUAGAGCUA-X- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU SG-0021 AAGCGUCCCCGCGCGGUGAAGUUUUAGAGCUA-P- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU-P-AAGUGGCACCGAGUCGGUGCUUU SG-0022 AAGCGUCCCCGCGCGGUGAAGUUUUAGAGCUA-P- UAGCAAGUUAAAAUAAGGCUAGUCCG-X-AACUU-P-AAGUGGCACCGAGUCGGUGCUUU SG-0023 P-AAGCGUCCCCGCGCGGUGAAGUUUUAGAGCUA-P- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-P-U
(Experimental Example 1) Evaluation of In Vitro Cleavage Activity of sgRNA Targeting KRAS Gene
[0215] Plasmid DNA (pCMV6-Entry-KRAS (G12V), OriGene Technologies) incorporating a sequence (NCBI Reference Sequence NP_0049762) having a G12V mutation in human KRAS gene (GenBank accession No. NM_004985.3) was reacted with restriction enzyme Tth111I (TaKaRa) according to the attached protocol. After completion of the reaction, the DNA of interest was purified according to a conventional method and dissolved in TE buffer (10 mM Tris-HCl, pH 8, 1 mM EDTA) to a final concentration of 100 ng/L to give a substrate DNA.
[0216] The above-mentioned substrate DNA was mixed with sgRNA and Cas9 as follows using the reagent attached to Cas9 Nuclease, S. pyogenes (New England Biolabs);
[0217] 100 ng substrate DNA+10 ng sgRNA+0.3 pmol Cas9 (total amount 10 L)
This was incubated at 37 C. for 30 min, and further incubated at 70 C. for 10 min to inactivate Cas9. Thereafter, electrophoresis was performed and, after ethidium bromide staining, the band intensity was measured using gel imaging system PXi4 (SYNGENE).
[0218] Based on the measurement results, the cleavage efficiency was calculated by the following equation.
Cleavage Efficiency=sum of cleaved band intensities/(sum of the cleaved and uncleaved band intensities)
[0219] The results are shown in
(Experimental Example 2) Evaluation of In Vitro Cleavage Activity of sgRNA Targeting BCL-2 Gene
[0220] Plasmid DNA (pCAGGS-hbcl-2, Iwahashi et. al., Nature, vol 390, pp 414-417, 1997) incorporating human BCL-2 gene (GenBank accession No. NM_000633) was reacted with restriction enzyme HindIII (TaKaRa) according to the attached protocol. After completion of the reaction, the DNA of interest was purified according to a conventional method and dissolved in TE buffer (10 mM Tris-HCl, pH 8, 1 mM EDTA) to a final concentration of 100 ng/L to give a substrate DNA.
[0221] The above-mentioned substrate DNA was mixed with sgRNA and Cas9 as follows using the reagent attached to Cas9 Nuclease, S. pyogenes (New England Biolabs);
[0222] 100 ng substrate DNA+10 ng sgRNA+0.3 pmol Cas9 (total amount 10 L)
This was incubated at 37 C. for 30 min, and further incubated at 70 C. for 10 min to inactivate Cas9. Thereafter, electrophoresis was performed and, after ethidium bromide staining, the band intensity was measured using gel imaging system PXi4 (SYNGENE).
[0223] Based on the measurement results, the cleavage efficiency was calculated by the following equation.
Cleavage Efficiency=sum of cleaved band intensities/(sum of the cleaved and uncleaved band intensities)
[0224] The results are shown in
(Example 2) Synthesis of Phenylalanine Amidite: Compound (5)
[0225] According to the following scheme, compound (5) was synthesized.
##STR00036##
[[1] Synthesis of Compound (1)]
[0226] To a solution (100 mL) of Fmoc-phenylalanine (3.0 g, 7.7 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (1.78 g, 9.3 mmol) and 1-hydroxybenzotriazole monohydrate (HOBt) (2.51 g, 18.6 mmol) in acetonitrile was added 4-amino-1-butanol (0.83 g, 9.3 mmol) and the mixture was stirred at room temperature overnight. After completion of the reaction, the solvent was evaporated under reduced pressure. To the residue was added dichloromethane, and the mixture was washed twice with saturated aqueous sodium hydrogen carbonate solution and once with saturated aqueous sodium chloride solution. The washed organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give a crude product (4.1 g) of the object compound (1).
[[2] Synthesis of Compound (2)]
[0227] Compound (1) (4.1 g, 8.9 mmol) was azeotropically distilled with pyridine and vacuum dried. The compound was dissolved in pyridine (80 mL), 4,4-dimethoxytrityl chloride (4.54 g, 13.4 mmol) was added and the mixture was stirred at room temperature overnight. After completion of the reaction, methanol was added and the mixture was stirred for 30 min and the solvent was evaporated under reduced pressure. To the residue was added ethyl acetate, and the mixture was washed twice with saturated aqueous sodium hydrogen carbonate solution and once with saturated aqueous sodium chloride solution. The washed organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give a crude product (9.8 g) of the object compound (2).
[[3] Synthesis of Compound (3)]
[0228] To compound (2) (9.8 g, 12.9 mmol) were added N,N-dimethylformamide (50 mL) and piperidine (8.9 mL) at room temperature, and the mixture was stirred at room temperature overnight. After completion of the reaction, the solvent was evaporated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (dichloromethane:methanol=20:1, containing 0.05% pyridine) to give the object compound (3) (3.1 g, yield after three-steps 74%).
[[4] Synthesis of Compound (4)]
[0229] Compound (3) (3.1 g, 5.8 mmol) was azeotropically distilled with pyridine and vacuum dried. Under an argon atmosphere, 6-hydroxyhexanoic acid (0.91 g, 6.9 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (1.32 g, 6.9 mmol), 1-hydroxybenzotriazole monohydrate (HOBt) (1.87 g, 13.8 mmol) and dichloromethane (40 mL) were added at room temperature, and the mixture was stirred for 10 min. After stirring, triethylamine (2.1 g, 20.7 mmol) was added, and the mixture was stirred at room temperature overnight. To the obtained residue was added dichloromethane, and the mixture was washed twice with saturated aqueous sodium bicarbonate solution and with saturated aqueous sodium chloride solution. The washed organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained crude product was purified by silica gel column chromatography (hexane:ethyl acetate=1:2, containing 0.05% pyridine) to give the object compound (4) (2.0 g, yield 53%). The instrument analytical value of compound (4) is shown below.
Compound (4):
[0230] .sup.1H-NMR (500 MHz, CDCl.sub.3) : 7.41-7.39 (2H, m), 7.30-7.16 (12H, m), 6.84-6.80 (4H, m), 6.26 (1H, d, J=7.4 Hz), 5.71-5.69 (1H, m), 4.57-4.52 (1H, m), 3.79 (6H, s), 3.64-3.58 (2H, m), 3.18-3.15 (1H, m), 3.09-2.93 (5H, m), 2.19-2.16 (2H, m), 1.64-1.58 (2H, m), 1.56-1.50 (2H, m), 1.46-1.39 (4H, m), 1.36-1.30 (2H, m).
[[5] Synthesis of Compound (5)]
[0231] Compound (4) (2.0 g, 3.1 mmol) was azeotropically distilled with pyridine, and vacuum dried. Then, acetonitrile (4 mL) and diisopropylammoniumtetrazolide (0.63 g, 3.7 mmol) were added, 2-cyanoethyl-N,N,N,N-tetraisopropylphosphordiamidite (1.1 g, 3.7 mmol) was further added, and the mixture was stirred at 40 C. for 2 hr. After completion of the reaction, the solvent was evaporated under reduced pressure, ethyl acetate was added, and the mixture was washed twice with saturated aqueous sodium hydrogen carbonate solution and once with saturated aqueous sodium chloride solution. The washed organic layer was dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained crude product was purified by silica gel column chromatography (hexane:ethyl acetate=1:1, containing 0.1% triethylamine) to give the object compound (5) (2.4 g, purity 97.5%, yield 92%).
[0232] The instrument analytical value of compound (5) is shown below.
Compound (5):
[0233] .sup.1H-NMR (500 MHz, CDCl.sub.3) : 7.41-7.40 (2H, m), 7.33-7.16 (12H, m), 6.86-6.80 (4H, m), 6.28 (1H, d, J=7.7 Hz), 5.77 (1H, t, J=6.0 Hz), 4.58-4.54 (1H, m), 3.87-3.80 (1H, m), 3.79-3.74 (1H, m), 3.78 (6H, s), 3.67-3.53 (4H, m), 3.21-3.15 (1H, m), 3.10-2.94 (5H, m), 2.62 (2H, t, J=6.4 Hz), 2.18-2.12 (2H, m), 1.64-1.55 (4H, m), 1.46-1.39 (4H, m), 1.36-1.31 (2H, m), 1.17 (12H, m).
[0234] .sup.31P-NMR (202 MHz, CDCl.sub.3) : 147.95, 147.91
[0235] ESI-Mass: 871.49 [M+H.sub.2O+H].sup.+
(Example 3) Synthesis of Leucine Amidite: Compound (10)
[0236] According to the following scheme, compound (10) was synthesized.
##STR00037##
[[1] Synthesis of Compound (6)]
[0237] To a solution (90 mL) of Fmoc-leucine (3.0 g, 8.5 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (1.95 g, 10.2 mmol) and 1-hydroxybenzotriazole monohydrate (HOBt) (2.75 g, 20.4 mmol) in acetonitrile was added 4-amino-1-butanol (0.91 g, 10.2 mmol) and the mixture was stirred at room temperature overnight. After completion of the reaction, the solvent was evaporated under reduced pressure. To the residue was added dichloromethane, and the mixture was washed twice with saturated aqueous sodium hydrogen carbonate solution, and once with saturated aqueous sodium chloride solution. The washed organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give a crude product (4.42 g) of the object compound (6).
[[2] Synthesis of Compound (7)]
[0238] Compound (6) (4.42 g, 10.4 mmol) was azeotropically distilled with pyridine, and vacuum dried. The compound was dissolved in pyridine (80 mL), 4,4-dimethoxytrityl chloride (5.29 g, 15.6 mmol) was added and the mixture was stirred at room temperature overnight. After completion of the reaction, methanol was added and the mixture was stirred for 30 min, and the solvent was evaporated under reduced pressure. To the residue was added ethyl acetate, and the mixture was washed twice with saturated aqueous sodium hydrogen carbonate solution, and once with saturated aqueous sodium chloride solution. The washed organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give a crude product (9.51 g) of the object compound (7).
[[3] Synthesis of Compound (8)]
[0239] To compound (7) (9.51 g, 13.1 mmol) were added N,N-dimethylformamide (40 mL) and piperidine (9.0 mL) at room temperature, and the mixture was stirred at room temperature overnight. After completion of the reaction, the solvent was evaporated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (dichloromethane:methanol=30:1, containing 0.05% pyridine and chloromethane:methanol=40:1, containing 0.05% pyridine) to give the object compound (8) (3.89 g, yield after three-steps 91%).
[[4] Synthesis of Compound (9)]
[0240] Compound (8) (3.89 g, 7.7 mmol) was azeotropically distilled with pyridine, and vacuum dried. Under an argon atmosphere, 6-hydroxyhexanoic acid (1.22 g, 9.2 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (1.77 g, 9.2 mmol), 1-hydroxybenzotriazole monohydrate (HOBt) (2.50 g, 18.5 mmol) and dichloromethane (50 mL) were added at room temperature, and the mixture was stirred for 10 min. After stirring, triethylamine (2.81 g, 27.7 mmol) was added and the mixture was stirred at room temperature overnight. To the obtained residue was added dichloromethane, and the mixture was washed twice with saturated aqueous sodium bicarbonate solution and with saturated aqueous sodium chloride solution. The washed organic layer was dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained crude product was purified by silica gel column chromatography (hexane:ethyl acetate=1:4, containing 0.05% pyridine) to give the object compound (9) (3.80 g, yield 80%). The instrument analytical value of compound (9) is shown below.
Compound (9):
[0241] .sup.1H-NMR (500 MHz, CDCl.sub.3) : 7.42-7.41 (2H, m), 7.31-7.27 (6H, m), 7.21-7.18 (1H, m), 6.83-6.80 (4H, m), 6.21 (1H, t, J=5.7 Hz), 6.05 (1H, d, J=8.3 Hz), 4.41-4.36 (1H, m), 3.78 (6H, s), 3.64-3.59 (2H, m), 3.31-3.15 (2H, m), 3.06 (2H, t, J=6.0 Hz), 2.20 (2H, t, J=7.4 Hz), 1.78 (1H, t, J=5.5 Hz), 1.68-1.47 (10H, m), 1.40-1.34 (2H, m), 0.93-0.91 (6H, m).
[[5] Synthesis of Compound (10)]
[0242] Compound (9) (3.80 g, 6.1 mmol) was azeotropically distilled with pyridine, and vacuum dried. Then, acetonitrile (7.6 mL) and diisopropylammoniumtetrazolide (1.26 g, 7.4 mmol) were added, 2-cyanoethyl-N,N,N,N-tetraisopropylphosphordiamidite (2.22 g, 7.4 mmol) was further added, and the mixture was stirred at 40 C. for 2 hr. After completion of the reaction, the solvent was evaporated under reduced pressure, ethyl acetate was added and the mixture was washed twice with saturated aqueous sodium hydrogen carbonate solution and once with saturated aqueous sodium chloride solution. The washed organic layer was dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained crude product was purified by silica gel column chromatography (hexane:ethyl acetate=1:1, containing 0.1% triethylamine) to give the object compound (10) (4.80 g, purity 97.5%, yield 95.4%). The instrument analytical value of compound (10) is shown below.
Compound (10):
[0243] .sup.1H-NMR (500 MHz, CDCl.sub.3) : 7.42-7.40 (2H, m), 7.31-7.26 (6H, m), 7.21-7.18 (1H, m), 6.83-6.81 (4H, m), 6.29 (1H, t, J=5.6 Hz), 6.09 (1H, d, J=8.5 Hz), 4.42-4.37 (1H, m), 3.87-3.74 (2H, m), 3.78 (6H, s), 3.68-3.51 (4H, m), 3.29-3.23 (1H, m), 3.19-3.14 (1H, m), 3.06 (2H, t, J=5.7 Hz), 2.62 (2H, t, J=6.2 Hz), 2.19 (2H, t, J=8.0 Hz), 1.69-1.50 (8H, m), 1.40-1.35 (2H, m), 1.30-1.21 (2H, m), 1.17 (12H, m), 0.94-0.91 (6H, m).
[0244] .sup.31P-NMR (202 MHz, CDCl.sub.3) : 147.95
[0245] ESI-Mass: 841.47 [M+Na].sup.+
(Example 4) Synthesis of Glutamic Acid Amidite: Compound (15)
[0246] According to the following scheme, compound (15) was synthesized.
##STR00038##
[[1] Synthesis of Compound (11)]
[0247] To a solution (25 ml) of 6-hydroxyhexanoic acid (1.00 g, 7.6 mmol) and dimethylaminopyridine (DMAP) (92 mg, 0.8 mmol) in pyridine was added 4,4-dimethoxytrityl chloride (2.6 g, 7.6 mmol) and the mixture was stirred at room temperature for 5 hr. After confirming the disappearance of the starting materials by TLC, methanol was added and the mixture was stirred for 30 min. The solvent was evaporated under reduced pressure, dichloromethane was added and the mixture was washed three times with saturated aqueous sodium hydrogen carbonate solution and once with saturated brine. The organic layer was dried over sodium sulfate, concentrated under reduced pressure, triturated with hexane, and dried under reduced pressure to give an oily crude product. To the oily crude product was added dichloromethane (32 mL), 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) (2.48 g, 13.0 mmol) and N-hydroxysuccinimide (1.49 g, 13.0 mmol) were added and the mixture was stirred at room temperature overnight. After completion of the reaction, the solvent was evaporated under reduced pressure, ethyl acetate was added, and the mixture was washed three times with saturated sodium hydrogen carbonate solution and once with saturated brine. The organic layer was dried over sodium sulfate, and the solvent was evaporated under reduced pressure to give a crude product (3.40 g) of the object compound (11).
[[2] Synthesis of Compound (12)]
[0248] To a solution (40 mL) of Boc-glutamic acid (OMe) (2.0 g, 7.7 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (1.76 g, 9.2 mmol) and 1-hydroxybenzotriazole monohydrate (HOBt) (2.48 g, 18.4 mmol) in acetonitrile was added 4-amino-1-butanol (0.82 g, 9.2 mmol) and the mixture was stirred at room temperature overnight. After completion of the reaction, the solvent was evaporated under reduced pressure. To the residue was added dichloromethane, and the mixture was washed twice with saturated aqueous sodium hydrogen carbonate solution, and once with saturated aqueous sodium chloride solution. The washed organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give a crude product (2.30 g) of the object compound (12).
[[3] Synthesis of Compound (13)]
[0249] Compound (12) (2.30 g, 6.9 mmol) was dissolved in 1,4-dioxane (23 ml) by adding the solvent thereto, and hydrochloric acid (2.3 ml) was added at 0 C. The mixture was warmed to room temperature and stirred for 30 min. After completion of the reaction, the solvent was evaporated under reduced pressure, the residue was triturated with isopropylether and dried under reduced pressure to give a crude product (2.06 g) of the object compound (13).
[[4] Synthesis of Compound (14)]
[0250] To a solution (9 ml) of compound (13) (0.93 g, 4.0 mmol) in DMF were added triethylamine (0.61 g, 6.0 mmol) and a solution (9 ml) of compound (11) (2.34 g, 4.4 mmol) in DMF and the mixture was stirred at room temperature overnight. After completion of the reaction, the solvent was evaporated under reduced pressure, to the residue was added dichloromethane and the mixture was washed 3 times with saturated brine. The washed organic layer was dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained crude product was purified by silica gel column chromatography (ethyl acetate, containing 0.05% pyridine). This reaction was performed twice to give the object compound (14) (0.85 g). The instrument analytical value of compound (14) is shown below.
Compound (14):
[0251] .sup.1H-NMR (500 MHz, CDCl.sub.3) : 7.43-7.41 (2H, m), 7.32-7.26 (6H, m), 7.21-7.18 (1H, m), 6.87-6.85 (1H, m), 6.83-6.80 (4H, m), 6.51 (1H, d, J=7.3 Hz), 4.43-4.38 (1H, m), 3.79 (6H, s), 3.67 (3H, s), 3.63 (2H, d, J=6.1 Hz), 3.28-3.25 (2H, m), 3.02 (2H, t, J=6.6 Hz), 2.54-2.48 (1H, m), 2.38-2.32 (1H, m), 2.20-2.17 (2H, m), 2.14-2.07 (1H, m), 1.96-1.89 (1H, m), 1.64-1.53 (8H, m), 1.40-1.34 (2H, m)
[[5] Synthesis of Compound (15)]
[0252] Compound (14) (0.85 g, 1.3 mmol) was azeotropically distilled with pyridine, and vacuum dried. Then, acetonitrile (2.5 mL) and diisopropylammoniumtetrazolide (0.27 g, 1.6 mmol) were added, 2-cyanoethyl-N,N,N,N-tetraisopropylphosphordiamidite (0.47 g, 1.6 mmol) was further added and the mixture was stirred at room temperature for 2 hr. After completion of the reaction, the solvent was evaporated under reduced pressure, ethyl acetate was added, and the mixture was washed twice with saturated aqueous sodium hydrogen carbonate solution and once with saturated aqueous sodium chloride solution. The washed organic layer was dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained crude product was purified by silica gel column chromatography (hexane:ethyl acetate=1:2, containing 0.1% triethylamine) to give the object compound (15) (0.95 g, purity 92.%, yield 86.4%). The instrument analytical value of compound (15) is shown below.
Compound (15):
[0253] .sup.1H-NMR (500 MHz, CDCl.sub.3) : 7.43-7.41 (2H, m), 7.32-7.26 (6H, m), 7.21-7.17 (1H, m), 6.83-6.80 (4H, m), 6.63-6.60 (1H, m), 6.47 (1H, d, J=7.4 Hz), 4.44-4.40 (1H, m), 3.88-3.82 (1H, m), 3.80-3.75 (1H, m), 3.78 (6H, s), 3.71-3.67 (1H, m), 3.66 (3H, s), 3.64-3.55 (3H, m), 3.31-3.21 (2H, m), 3.03 (2H, t, J=6.4 Hz), 2.64 (2H, t, J=6.4 Hz), 2.53-2.47 (1H, m), 2.38-2.32 (1H, m), 2.18 (2H, t, J=7.5 Hz), 2.14-2.07 (1H, m), 1.96-1.89 (1H, m), 1.64-1.56 (8H, m), 1.41-1.34 (2H, m), 1.19-1.16 (12H, m).
[0254] .sup.31P-NMR (202 MHz, CDCl.sub.3) : 147.89
[0255] ESI-Mass: 867.49 [M+H.sub.2O+H].sup.+
(Example 5) Synthesis of Proline Amidites: Compounds (5a-c)
[0256] According to the following scheme, compounds (5a-c) were synthesized.
##STR00039##
[[1] Synthesis of Compound (1a)]
[0257] Fmoc-L-proline (3.0 g, 8.9 mmol) was dissolved in dehydrated N,N-dimethylformamide (50 mL). 6-Amino-1-hexanol (1.3 g, 1.2 eq), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (2.0 g, 1.2 eq) and 1-hydroxybenzotriazole (3.3 g, 2.4 eq) were added and the mixture was stirred under an argon atmosphere at room temperature overnight. After completion of the reaction, the solvent was evaporated under reduced pressure from the reaction mixture. To the obtained residue was added dichloromethane, and the mixture was washed with saturated aqueous sodium bicarbonate solution and with saturated brine. The organic phase was dried over sodium sulfate, and the solvent was evaporated. The obtained residue was subjected to silica gel column chromatography (eluent: dichloromethane-methanol (20:1)) to give the object substance (2.9 g, yield 75%).
[0258] .sup.1H-NMR (CDCl.sub.3): 7.76-7.83 (m, 2H), 7.50-7.63 (m, 2H), 7.38-7.43 (m, 2H), 7.27-7.34 (m, 2H), 4.54-4.35 (m, 2H), 4.13-4.35 (m, 2H), 3.54-3.63 (m, 2H), 3.35-3.54 (m, 2H), 3.17-3.28 (m, 2H), 1.82-2.07 (m, 3H), 1.21-1.59 (m, 9H)
[[2] Synthesis of Compound (2a)]
[0259] Compound 1a (2.9 g, 6.6 mmol) was azeotropically dried using dehydrated pyridine. The residue was dissolved in dehydrated pyridine (40 mL). 4,4-Dimethoxytritylchloride (DMTrCl) (2.7 g, 1.2 eq.) was added at 0 C. and the mixture was stirred at room temperature overnight. After confirming the disappearance of the starting materials by TLC, methanol was added and the mixture was stirred for 30 min. The solvent was evaporated under reduced pressure. To the obtained residue was added dichloromethane, and the mixture was washed with saturated aqueous sodium bicarbonate solution and with saturated brine. The organic phase was dried over sodium sulfate and the solvent was evaporated. The residue was dried under reduced pressure to give an oily substance (5.0 g).
[[3] Synthesis of Compound (3a)]
[0260] Compound 2a (5.0 g, 6.6 mmol) was dissolved in dehydrated N,N-dimethylformamide (40 mL). Piperidine (6.5 mL) was added, and the mixture was stirred under an argon atmosphere at room temperature overnight. After completion of the reaction, the solvent was evaporated under reduced pressure from the reaction mixture. The obtained residue was subjected to silica gel column chromatography (eluent: dichloromethane-methanol (20:1), 0.05% pyridine) to give the object substance (2.6 g, yield 76%, two-step).
[0261] .sup.1H-NMR (CDCl.sub.3): 7.44-7.49 (m, 2H), 7.28-7.38 (m, 6H), 7.20-7.26 (m, 1H), 6.83-6.88 (m, 4H), 3.83 (s, 6H), 3.70 (dd, 1H, J=9.2 Hz, 5.2 Hz), 3.20 (q, 2H, J=6.9 Hz), 3.03 (t, 2H, J=6.6 Hz), 2.97-3.00 (m, 1H), 2.86-2.93 (m, 1H), 2.10-2.21 (m, 1H), 1.58-1.97 (m, 5H), 1.25-1.57 (m, 6H)
[[4] Synthesis of Compound (4a)]
[0262] Compound 3a (2.5 g, 4.8 mmol) was dissolved in N,N-dimethylformamide (15 mL). 8-Hydroxyoctanoic acid (0.93 g, 1.2 eq) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (1.1 g, 1.2 eq) and 1-hydroxybenzotriazole (1.8 g, 2.4 eq) were dissolved in N,N-dimethylformamide (15 mL). To this mixture was added the solution of compound 3a in N,N-dimethylformamide at 0 C., and the mixture was stirred under an argon atmosphere at room temperature overnight. After completion of the reaction, the solvent was evaporated under reduced pressure from the reaction mixture. To the obtained residue was added dichloromethane, and the mixture was washed with saturated aqueous sodium bicarbonate and saturated brine. The organic phase was dried over sodium sulfate and the solvent was evaporated. The obtained residue was subjected to silica gel column chromatography (eluent: dichloromethane-methanol (40:1), 0.05% pyridine) to give the object substance (2.1 g, yield 71%).
[0263] .sup.1H-NMR (CDCl.sub.3): 7.42-7.46 (m, 2H), 7.26-7.36 (m, 6H), 7.16-7.24 (m, 1H), 6.81-6.86 (m, 4H), 3.79 (s, 6H), 3.58-3.66 (m, 2H), 3.49-3.56 (m, 1H), 3.37-3.44 (m, 1H), 3.10-3.27 (m, 1H), 3.01 (2H, t, J=6.6 Hz), 2.29-2.35 (m, 2H), 1.42-1.71 (m, 10H), 1.21-1.41 (m, 12H)
[[5] Synthesis of Compound (5a)]
[0264] To a solution (8 mL) of azeotropically dried compound 4a (2.0 g, 2.6 mmol) in acetonitrile was added diisopropylammoniumtetrazolide (DIPAT) (0.64 g, 1.2 eq.). A solution (2 mL) of 2-cyanoethoxy-N,N,N,N-tetraisopropylphosphordiamidite (1.1 g, 1.2 eq.) in acetonitrile was added and the mixture was stirred at room temperature for 2 hr. Dichloromethane was added, and the mixture was washed with saturated aqueous sodium bicarbonate solution and with saturated brine. The organic phase was dried over sodium sulfate and the solvent was evaporated. The residue was subjected to column chromatography (eluent: n-hexane-ethyl acetate (1:1), 0.1% triethylamine) using amino silica to give the object substance (2.1 g, yield 81%).
[0265] .sup.31P-NMR (CDCl.sub.3): =147.821
[0266] ESI-Mass m/z: 877.55 [M+H.sub.2O+H].sup.+, 960.66 [M+TEA+H].sup.+
[[6] Synthesis of Compound (1b)]
[0267] Fmoc-L-proline (3.0 g, 8.9 mmol) was dissolved in dehydrated N,N-dimethylformamide (60 mL). 8-Amino-1-octanol (1.5 g, 1.2 eq), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (2.0 g, 1.2 eq) and 1-hydroxybenzotriazole (3.3 g, 2.4 eq) were added, and the mixture was stirred under an argon atmosphere at room temperature overnight. After completion of the reaction, the solvent was evaporated under reduced pressure from the reaction mixture. To the obtained residue was added dichloromethane, and the mixture was washed with saturated aqueous sodium bicarbonate solution and with saturated brine. The organic phase was dried over sodium sulfate and the solvent was evaporated. The obtained residue was subjected to silica gel column chromatography (eluent: dichloromethane-methanol (20:1)) to give the object substance (3.0 g, yield 73%).
[0268] .sup.1H-NMR (CDCl.sub.3): 7.76-7.83 (m, 2H), 7.50-7.64 (m, 2H), 7.39-7.45 (m, 2H), 7.30-7.36 (m, 2H), 4.58-4.37 (m, 2H), 4.16-4.37 (m, 2H), 3.57-3.65 (m, 2H), 3.38-3.57 (m, 2H), 3.10-3.30 (m, 2H), 1.82-2.07 (m, 3H), 1.21-1.59 (m, 13H)
[[7] Synthesis of Compound (2b)]
[0269] Using dehydrated pyridine, compound 1b (3.0 g, 6.5 mmol) was azeotropically dried. The residue was dissolved in dehydrated pyridine (40 mL). 4,4-Dimethoxytritylchloride (DMTrCl) (2.6 g, 1.2 eq.) was added at 0 C. and the mixture was stirred at room temperature overnight. After confirming the disappearance of the starting materials by TLC, methanol was added and the mixture was stirred for 30 min. The solvent was evaporated under reduced pressure. To the obtained residue was added dichloromethane, and the mixture was washed with saturated aqueous sodium bicarbonate solution and with saturated brine. The organic phase was dried over sodium sulfate and the solvent was evaporated. The residue was dried under reduced pressure to give an oily substance (5.0 g).
[[8] Synthesis of Compound (3b)]
[0270] Compound 2b (5.0 g, 6.5 mmol) was dissolved in dehydrated N,N-dimethylformamide (40 mL). Piperidine (6.4 mL) was added, and the mixture was stirred under an argon atmosphere at room temperature overnight. After completion of the reaction, the solvent was evaporated under reduced pressure from the reaction mixture. The obtained residue was subjected to silica gel column chromatography (eluent: dichloromethane-methanol (15:1), 0.05% pyridine) to give the object substance (2.9 g, yield 83%, two-step).
[0271] .sup.1H-NMR (CDCl.sub.3): 7.43-7.47 (m, 2H), 7.26-7.37 (m, 6H), 7.18-7.23 (m, 1H), 6.81-6.86 (m, 4H), 3.80 (s, 6H), 3.71 (dd, 1H, J=9.2 Hz, 5.2 Hz), 3.21 (q, 2H, J=6.9 Hz), 2.97-3.06 (m, 3H), 2.85-2.91 (m, 1H), 2.09-2.18 (m, 1H), 1.87-1.96 (m, 1H), 1.66-1.74 (m, 2H), 1.57-1.65 (m, 2H), 1.44-1.52 (m, 2H), 1.22-1.38 (m, 8H)
[[9] Synthesis of Compound (4b)]
[0272] Compound 3b (2.8 g, 5.1 mmol) was dissolved in dehydrated dichloromethane (40 mL). 10-hydroxydecanoic acid (1.2 g, 1.2 eq), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (1.2 g, 1.2 eq), 1-hydroxybenzotriazole (1.9 g, 2.4 eq) and triethylamine (2.6 mL) were added, and the mixture was stirred under an argon atmosphere at room temperature overnight. After completion of the reaction, the solvent was evaporated under reduced pressure from the reaction mixture. To the obtained residue was added dichloromethane, and the mixture was washed with saturated aqueous sodium bicarbonate solution and with saturated brine. The organic phase was dried over sodium sulfate and the solvent was evaporated. The obtained residue was subjected to silica gel column chromatography (eluent: dichloromethane-methanol (20:1), 0.05% pyridine) to give the object substance (2.5 g, yield 70%).
[0273] .sup.1H-NMR (CDCl.sub.3): 7.41-7.45 (m, 2H), 7.25-7.35 (m, 6H), 7.16-7.21 (m, 1H), 6.79-6.85 (m, 4H), 3.79 (s, 6H), 3.58-3.65 (m, 2H), 3.48-3.54 (m, 1H), 3.36-3.43 (m, 1H), 3.11-3.22 (m, 1H), 3.01 (2H, t, J 6.6 Hz), 2.26-2.32 (m, 2H), 1.50-1.68 (m, 8H), 1.39-1.49 (m, 2H) 1.19-1.38 (m, 20H)
[[10] Synthesis of Compound (5b)]
[0274] To a solution (8 mL) of azeotropically dried compound 4b (2.4 g, 3.4 mmol) in acetonitrile was added diisopropylammoniumtetrazolide (DIPAT) (0.69 g, 1.2 eq.). A solution (2 mL) of 2-cyanoethoxy-N,N,N,N-tetraisopropylphosphordiamidite (1.2 g, 1.2 eq.) in acetonitrile was added and the mixture was stirred at room temperature for 2 hr. Dichloromethane was added and the mixture was washed with saturated aqueous sodium bicarbonate solution and with saturated brine. The organic phase was dried over sodium sulfate and the solvent was evaporated. The residue was subjected to column chromatography (eluent: n-hexane-ethyl acetate (1:1), 0.1% triethylamine) using amino silica to give the object substance (2.4 g, yield 80%).
[0275] .sup.31P-NMR (CDCl.sub.3): =147.810
[0276] ESI-Mass m/z: 937.56 [M+Na].sup.+, 1016.70 [M+TEA+H].sup.+
[[11] Synthesis of Compound (1c)]
[0277] Fmoc-L-proline (3.0 g, 8.9 mmol) was dissolved in a mixed solvent of dehydrated acetonitrile (75 mL) and dehydrated N,N-dimethylformamide (15 mL). 10-Amino-1-decanol (1.8 g, 1.2 eq), N,N-dicyclohexylcarbodiimide (2.2 g, 1.2 eq) and 1-hydroxybenzotriazole (3.3 g, 2.4 eq) were added, and the mixture was stirred under an argon atmosphere at room temperature overnight. After completion of the reaction, the precipitate was filtered, and the solvent was evaporated under reduced pressure from the filtrate. To the obtained residue was added dichloromethane, and the mixture was washed with saturated aqueous sodium bicarbonate solution and with saturated brine. The organic phase was dried over sodium sulfate and the solvent was evaporated. The residue was triturated with diisopropylether and dried under reduced pressure to give a solid substance (4.0 g, yield 93%).
[0278] .sup.1H-NMR (CDCl.sub.3): 7.72-7.78 (m, 2H), 7.50-7.62 (m, 2H), 7.35-7.42 (m, 2H), 7.26-7.33 (m, 2H), 4.54-4.33 (m, 2H), 4.12-4.33 (m, 2H), 3.57-3.62 (m, 2H), 3.34-3.54 (m, 2H), 3.06-3.26 (m, 2H), 1.80-2.04 (m, 3H), 1.13-1.47 (m, 17H)
[[12] Synthesis of Compound (2c)]
[0279] Using dehydrated pyridine, compound 1c (3.9 g, 8.0 mmol) was azeotropically dried. The residue was dissolved in dehydrated pyridine (50 mL). 4,4-Dimethoxytritylchloride (DMTrCl) (3.2 g, 1.2 eq.) was added at 0 C. and the mixture was stirred at room temperature overnight. After confirming the disappearance of the starting materials by TLC, methanol was added and the mixture was stirred for 30 min. The solvent was evaporated under reduced pressure. To the obtained residue was added dichloromethane, and the mixture was washed with saturated aqueous sodium bicarbonate solution and with saturated brine. The organic phase was dried over sodium sulfate and the solvent was evaporated. The residue was dried under reduced pressure to give an oily substance (6.2 g).
[[13] Synthesis of Compound (3c)]
[0280] Compound 2c (6.2 g, 7.8 mmol) was dissolved in dehydrated N,N-dimethylformamide (50 mL). Piperidine (7.7 mL) was added, and the mixture was stirred under an argon atmosphere at room temperature overnight. After completion of the reaction, the solvent was evaporated under reduced pressure from the reaction mixture. The obtained residue was subjected to silica gel column chromatography (eluent: dichloromethane-methanol (15:1), 0.05% pyridine) to give the object substance (3.4 g, yield 76%, two-step).
[0281] .sup.1H-NMR (CDCl.sub.3): 7.38-7.42 (m, 2H), 7.21-7.31 (m, 6H), 7.13-7.18 (m, 1H), 6.75-6.80 (m, 4H), 3.79 (s, 6H), 3.72 (dd, 1H, J=9.2 Hz, 5.7 Hz), 3.21 (q, 2H, J=6.9 Hz), 2.98-3.03 (m, 3H), 2.80-2.88 (m, 1H), 2.05-2.15 (m, 1H), 1.83-1.91 (m, 1H), 1.66-1.74 (m, 2H), 1.52-1.59 (m, 2H), 1.38-1.48 (m, 2H), 1.16-1.34 (m, 12H)
[[14] Synthesis of Compound (4c)]
[0282] Compound 3c (2.4 g, 4.2 mmol) was dissolved in N,N-dimethylformamide (20 mL). 12-Hydroxydodecanoic acid (1.1 g, 1.2 eq), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (0.96 g, 1.2 eq) and 1-hydroxybenzotriazole (1.5 g, 2.4 eq) were dissolved in N,N-dimethylformamide (20 mL). To this mixture was added the solution of compound 3c in N,N-dimethylformamide at 0 C., and the mixture was stirred under an argon atmosphere at room temperature overnight. After completion of the reaction, the solvent was evaporated under reduced pressure from the reaction mixture. To the obtained residue was added dichloromethane, and the mixture was washed with saturated aqueous sodium bicarbonate solution and with saturated brine. The organic phase was dried over sodium sulfate and the solvent was evaporated. The obtained residue was subjected to silica gel column chromatography (eluent: n-hexane-ethyl acetate (1:3), 0.05% pyridine) to give the object substance (2.1 g, yield 66%).
[0283] .sup.1H-NMR (CDCl.sub.3): 7.41-7.45 (m, 2H), 7.25-7.34 (m, 6H), 7.17-7.22 (m, 1H), 6.79-6.83 (m, 4H), 3.79 (s, 6H), 3.58-3.67 (m, 2H), 3.47-3.56 (m, 1H), 3.35-3.44 (m, 1H), 3.09-3.29 (m, 1H), 3.02 (2H, t, J=6.6 Hz), 2.25-2.35 (m, 2H), 1.53-1.65 (m, 9H), 1.18-1.39 (m, 29H)
[[15] Synthesis of Compound (5c)]
[0284] To a solution (8 mL) of azeotropically dried compound 4c (2.0 g, 2.6 mmol) in acetonitrile was added diisopropylammoniumtetrazolide (DIPAT) (0.53 g, 1.2 eq.). A solution (2 mL) of 2-cyanoethoxy-N,N,N,N-tetraisopropylphosphordiamidite (0.94 g, 1.2 eq.) in acetonitrile was added and the mixture was stirred at room temperature for 2 hr. Dichloromethane was added, and the mixture was washed with saturated aqueous sodium bicarbonate solution and with saturated brine. The organic phase was dried over sodium sulfate and the solvent was evaporated. The residue was subjected to column chromatography (eluent: n-hexane-ethyl acetate (1:1), 0.1% triethylamine) using amino silica to give the object substance (1.9 g, yield 76%).
[0285] .sup.31P-NMR (CDCl3): =147.821
[0286] ESI-Mass m/z: 989.67 [M+H.sub.2O+H].sup.+, 1072.78 [M+TEA+H].sup.+
(Example 6) Synthesis of sgRNA
[0287] Using compounds 5, 10, 15, 5a, 5b and 5c synthesized in Examples 2-5, proline diamide amidite, lysine diamide amidite, glycine diamide amidite, terephthalic acid diamide amidite and glycylglycine diamide amidite known per se, sgRNAs shown in Table 2-1-Table 4 were synthesized in the same manner as in Example 1. In the following sequences, the underlined part is a guide region complementary to the target nucleotide sequence and the amino acid derivative linkers are shown by abbreviations as shown in Table 5.
TABLE-US-00002 TABLE2-1
TABLE-US-00003 TABLE2-2
TABLE-US-00004 TABLE2-3
In Tables, del means that the sequence is deleted.
TABLE-US-00005 TABLE3-1
TABLE-US-00006 TABLE3-2
TABLE-US-00007 TABLE4
TABLE-US-00008 TABLE 5 amino acid amidite general Example abbr. amino acid formula n m compound X glycylglycine (GlyGly) I-4 5 4 X7 terephthalic acid (TP) I-6 4 4 X8 glycine (Gly) I-1 5 4 X10 phenylalanine (P) IV-1 5 4 compound 5 X11 leucine (L) IV-2 5 4 compound 10 X12 glutamic acid (E) IV-3 5 4 compound 15 P proline (P) II-8 5 4 P13 proline (P) II-8 7 6 compound 5a P14 proline (P) II-8 9 8 compound 5b P15 proline (P) II-8 11 10 compound 5c K lysin (K) I-7 5 4
(Experimental Example 3) Evaluation of In Vitro Cleavage Activity of sgRNA Targeting KRAS Gene2
[0288] Plasmid DNA (pCMV6-Entry-KRAS (G12V), OriGene Technologies) incorporating a sequence (NCBI Reference Sequence NP_0049762) having a G12V mutation in human KRAS gene (GenBank accession No. NM_004985.3) was reacted with restriction enzyme Tth111I (TaKaRa) according to the attached protocol. After completion of the reaction, the DNA of interest was purified according to a conventional method and dissolved in TE buffer (10 mM Tris-HCl, pH 8, 1 mM EDTA) to a final concentration of 100 ng/L to give a substrate DNA.
[0289] The above-mentioned substrate DNA was mixed with sgRNA and Cas9 as follows using the reagent attached to Cas9 Nuclease, S. pyogenes (New England Biolabs);
[0290] 100 ng substrate DNA+0.5 ng sgRNA+0.3 pmol Cas9 (total amount 10 L)
This was incubated at 37 C. for 15 min, and further incubated at 70 C. for 10 min to inactivate Cas9. Thereafter, electrophoresis was performed and, after ethidium bromide staining, the band intensity was measured using gel imaging system PXi4 (SYNGENE).
[0291] Based on the measurement results, the cleavage efficiency was calculated by the following equation.
Cleavage Efficiency=sum of cleaved band intensities/(sum of the cleaved and uncleaved band intensities)
[0292] The results are shown in
[0293] Many of the artificial sgRNAs of this Example showed cleavage efficiency equal to or higher than that of the natural form sgRNA in Reference Example, and it was clarified that substitution of each site with an amino acid derivative is effective.
(Experimental Example 4)) Evaluation of In Vitro Cleavage Activity of sgRNA Targeting BCL-2 Gene2
[0294] Plasmid DNA (pCAGGSHB2) incorporating human BCL-2 gene (GenBank accession No. NM_000633) was reacted with restriction enzyme HindIII (TaKaRa) according to the attached protocol. After completion of the reaction, the DNA of interest was purified according to a conventional method and dissolved in TE buffer (10 mM Tris-HCl, pH 8, 1 mM EDTA) to a final concentration of 100 ng/L to give a substrate DNA.
[0295] The above-mentioned substrate DNA was mixed with sgRNA and Cas9 as follows using the reagent attached to Cas9 Nuclease, S. pyogenes (New England Biolabs);
[0296] 100 ng substrate DNA+10 ng sgRNA+0.3 pmol Cas9 (total amount 10 L)
This was incubated at 37 C. for 30 min, and further incubated at 70 C. for 10 min to inactivate Cas9. Thereafter, electrophoresis was performed and, after ethidium bromide staining, the band intensity was measured using gel imaging system PXi4 (SYNGENE).
[0297] Based on the measurement results, the cleavage efficiency was calculated by the following equation.
Cleavage Efficiency=sum of cleaved band intensities/(sum of the cleaved and uncleaved band intensities)
[0298] The results are shown in
[0299] The artificial sgRNAs of this Example showed cleavage efficiency equal to or higher than that of the natural form sgRNA in Reference Example, and it was clarified that substitution of each site with an amino acid derivative is effective.
(Experimental Example 5) Evaluation of In Vitro Cleavage Activity of sgRNA Targeting BRAF Gene
[0300] Plasmid DNA (pCMV6-Entry-BRAF (V600E), OriGene
[0301] Technologies) incorporating a sequence having a V600E mutation in human BRAF gene (GenBank accession No. NM_004333) was reacted with restriction enzyme Tth111I (TaKaRa) according to the attached protocol. After completion of the reaction, the DNA of interest was purified according to a conventional method and dissolved in TE buffer (10 mM Tris-HCl, pH 8, 1 mM EDTA) to a final concentration of 100 ng/L to give a substrate DNA.
[0302] The above-mentioned substrate DNA was mixed with sgRNA and Cas9 as follows using the reagent attached to Cas9 Nuclease, S. pyogenes (New England Biolabs);
[0303] 100 ng substrate DNA+0.5 ng sgRNA+0.3 pmol Cas9 (total amount 10 L)
This was incubated at 37 C. for 15 min, and further incubated at 70 C. for 10 min to inactivate Cas9. Thereafter, electrophoresis was performed and, after ethidium bromide staining, the band intensity was measured using gel imagint system PXi4 (SYNGENE).
[0304] Based on the measurement results, the cleavage efficiency was calculated by the following equation.
Cleavage Efficiency=sum of cleaved band intensities/(sum of the cleaved and uncleaved band intensities)
[0305] The results are shown in
[0306] The artificial sgRNAs of this Example showed cleavage efficiency equal to or higher than that of the natural form sgRNA in Reference Example, and it was clarified that substitution of each site with an amino acid derivative is effective.
(Experimental Example 6) Evaluation of Intracellular Cleavage Activity of sgRNA Targeting BCL-2 Gene
[0307] Jurkat cells (210.sup.5 cells) were collected in a microtube, washed with PBS, and suspended in a test substance solution (10 L) obtained by adding 6 g GeneArt Platinum Cas9 Nuclease (Thermo Fisher Scientific) and 1.2 g sgRNA to ReSuspension buffer R attached to Neon 10 L tip (Thermo Fisher Scientific). The cell suspension was sucked into Neon 10 L tip and transfected using electroporator Neon (Thermo Fisher Scientific) under the conditions of Pulse Voltage 1700V, Pulse Width 20 ms, Pulse Number once. The obtained cells were seeded in RPMI1640 Medium (Thermo Fisher Scientific) (500 L) containing 10% Fetal Bovine Serum (MP Biomedicals) in a 24-well Dish (Thermo Fisher Scientific). After culturing at 37 C. under 5% CO.sub.2 for 48 hr, the cells were recovered, washed with PBS and genomic DNA was purified using GeneArt (registered trade mark) Genomic Cleavage Detection Kit (Thermo Fisher Scientific). Using a part of the obtained genomic DNA as a template and primer sets for human BCL-2 gene amplification: 5-ATCAAGTGTTCCGCGTGATTGAAGA-3/5-CTCACATCACCAAGTGCACCTACCC-3, PCR was performed according to the protocol attached to GeneArt (registered trade mark) Genomic Cleavage Detection Kit. Using the obtained PCR product and according to the protocol attached to GeneArt (registered trade mark) Genomic Cleavage Detection Kit, chromosome in-del detection reaction was performed. Thereafter, agarose gel electrophoresis was performed, the gel was stained with ethidium bromide, and the band intensity on the gel was measured using gel imagint system PXi4 (SYNGENE).
[0308] Based on the measurement results, the cleavage efficiency was calculated by the following equation.
Cleavage Efficiency=1[(1fraction cleaved).sup.1/2]
Fraction Cleaved=sum of cleaved band intensities/(sum of the cleaved and parental band intensities)
[0309] The results thereof are shown in
[0310] Some of the artificial sgRNAs of this Example showed cleavage efficiency equal to or higher than that of the natural form sgRNA in Reference Example also in the cells.
(Experimental Example 7) Evaluation of Intracellular Cleavage Activity of sgRNA Targeting BRAF Gene
[0311] A-375 cells (5.610.sup.4 cells) were collected in a microtube, washed with PBS, and suspended in a test substance solution (10 L) obtained by adding 6 g GeneArt Platinum Cas9 Nuclease (Thermo Fisher Scientific) and 1.2 g sgRNA to ReSuspension buffer R attached to Neon 10 L tip (Thermo Fisher Scientific). The cell suspension was sucked into Neon 10 L tip and transfected using electroporator Neon (Thermo Fisher Scientific) under the conditions of Pulse Voltage 1400V, Pulse Width 20 ms, Pulse Number twice. The obtained cells were seeded in Dulbecco's Modified Eagle's Medium (High Glucose) (Sigma Aldrich) (500 L) containing 10% Fetal Bovine Serum (MP Biomedicals) in a 24-well Dish (Thermo Fisher Scientific). After culturing at 37 C. under 5% CO.sub.2 for 48 hr, the cells were washed with PBS and genomic DNA was purified using GeneArt (registered trade mark) Genomic Cleavage Detection Kit (Thermo Fisher Scientific). Using a part of the obtained genomic DNA as a template and primer sets for human BRAF gene amplification: 5-CGCCCAGGAGTGCCAAGAGAATATC-3/5-CAGCAGCATCTCAGGGCCAAAAAT-3, PCR was performed according to the protocol attached to GeneArt (registered trade mark) Genomic Cleavage Detection Kit. Using the obtained PCR product and according to the protocol attached to GeneArt (registered trade mark) Genomic Cleavage Detection Kit, chromosome in-del detection reaction was performed. Thereafter, agarose gel electrophoresis was performed, the gel was stained with ethidium bromide, and the band intensity on the gel was measured using gel imagint system PXi4 (SYNGENE).
[0312] Based on the measurement results, the cleavage efficiency was calculated by the following equation.
Cleavage Efficiency=1[(1fraction cleaved).sup.1/2]
Fraction Cleaved=sum of cleaved band intensities/(sum of the cleaved and parental band intensities)
[0313] The results thereof are shown in
[0314] Some of the artificial sgRNAs of this Example showed cleavage efficiency equal to or higher than that of the natural form sgRNA in Reference Example also in the cells.
[0315] While the present invention has been explained above by referring to embodiments, the present invention is not limited by the above-mentioned embodiments. The constitution and detail of the present invention can be modified variously as long as those skilled in the art can understand within the scope of the present invention.
[0316] The contents disclosed in any publication cited herein, including patents and patent applications, are hereby incorporated in their entireties by reference, to the extent that they have been disclosed herein.
[0317] This application is based on a patent application No. 2016-016743 filed in Japan (filing date: Jan. 30, 2016), the contents of which are incorporated in full herein.
INDUSTRIAL APPLICABILITY
[0318] The artificial sgRNA of the present invention can be synthesized easily at a low cost and can improve the in vivo stability when combined with Cas9 while maintaining DSB activity equal to or higher than that of natural form sgRNA. Therefore, it is useful for improving genome editing efficiency, particularly genome editing efficiency in vivo.