RNAi FOR THE CONTROL OF FUNGI AND OOMYCETES BY INHIBITING SACCHAROPINE DEHYDROGENASE GENE

20190382770 · 2019-12-19

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to control of plant pathogens, particularly fungi or oomycetes, by inhibiting one or more biological functions, particularly by inhibiting saccharopine dehydrogenase gene(s) using RNA interference. The invention provides methods and compositions using RNA interference of plant pathogens target genes for such control. The invention is also directed to methods for making transgenic plants tolerant to said plant pathogens, and to transgenic plants and seeds generated thereof.

    Claims

    1. A dsRNA molecule comprising i) a first strand comprising a sequence substantially identical to at least 20 contiguous nucleotides of a fungus or oomycete saccharopine dehydrogenase gene and ii) a second strand comprising a sequence substantially complementary to the first strand.

    2. The dsRNA molecule according to claim 1, wherein the fungus or oomycete gene is: a) a polynucleotide comprising a sequence as set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43; b) a polynucleotide encoding a polypeptide having a sequence as set forth in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, or 44; c) a polynucleotide having at least 70% sequence identity to a polynucleotide having a sequence as set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43; or d) a polynucleotide encoding a polypeptide having at least 70% sequence identity to a polypeptide having a sequence as set forth in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, or 44.

    3. A composition comprising at least a dsRNA molecule according to claim 1.

    4. The composition according to claim 3, further comprising an agriculturally acceptable support, carrier, filler and/or surfactant.

    5. The composition according to claim 3, further comprising a phytopharmaceutical or plant growth promoting compound.

    6. A micro-organism producing a dsRNA molecule according to claim 1.

    7. A genetic construct comprising at least one DNA sequence as well as heterologous regulatory element(s) in the 5 and optionally in the 3 positions, wherein the DNA sequence(s) is able to form a dsRNA molecule according to claim 1.

    8. A cloning and/or expression vector, comprising at least one genetic construct according to claim 7.

    9. A transgenic plant cell capable of expressing at least a dsRNA molecule according to claim 1.

    10. A transgenic plant, seed or part thereof, comprising a transgenic plant cell according to claim 9.

    11. The transgenic plant cell according to claim 9, or transgenic plant, seed or part thereof, comprising said transgenic plant cell, wherein said plant is a soybean, oilseed, rice or potato plant.

    12. A method of making a transgenic plant cell capable of expressing a dsRNA that inhibits a fungus or oomycete saccharopine dehydrogenase gene, comprising transforming a plant cell with a genetic construct according to claim 7.

    13. A method of controlling a plant pathogen, comprising providing to said pathogen a dsRNA molecule according to claim 1, or a composition comprising said dsRNA molecule.

    14. A method for controlling a plant pathogen, comprising applying an effective quantity of a dsRNA molecule according to claim 1 or a composition comprising said dsRNA molecule to soil where plants grow or are capable of growing, to the leaves and/or the fruit of plants or to the seeds of plants.

    15. A method of controlling a plant pathogen, comprising providing a transformed plant cell according to claim 9 to a host plant of said plant pathogen.

    16. A method for inhibiting the expression of a plant pathogen gene, comprising: i) transforming plant cells with a genetic construct according to claim 7, ii) placing the transformed cells under conditions that allow the transcription of said construct, and iii) contacting the plant pathogen with the cells.

    17. The method according to claim 13, wherein said plant pathogen is Magnaporthe grisea, Phytophthora infestans Sclerotinia sclerotinium or Phakopsora pachyrhizi.

    18. The method according to claim 12, wherein said plant cell is soybean, oilseed, rice or potato.

    19. The method of claim 13, wherein the plant pathogen is a fungus or oomycete.

    20. The method of claim 14, wherein the plant pathogen is a fungus or oomycete.

    Description

    LEGEND OF THE FIGURES

    [0292] FIG. 1: Measurement of Phytophthora infestans growth inhibition in the presence of dsRNA targeting the saccharopine dehydrogenase messenger RNA.

    [0293] FIG. 2: Analysis of saccharopine dehydrogenase mRNA level by qRT PCR.

    SEQUENCE LISTING

    [0294] SEQ ID No 1: Saccharopine dehydrogenase (LYS1) from Aspergillus clavatus.

    [0295] SEQ ID No 2: Protein encoded by the above nucleic acid sequence.

    [0296] SEQ ID No 3: Saccharopine dehydrogenase (LYS1) from Aspergillus fumigatus.

    [0297] SEQ ID No 4: Protein encoded by the above nucleic acid sequence.

    [0298] SEQ ID No 5: Saccharopine dehydrogenase (LYS1) from Botrytis cinerea.

    [0299] SEQ ID No 6: Protein encoded by the above nucleic acid sequence.

    [0300] SEQ ID No 7: Saccharopine dehydrogenase (LYS1) from Fusarium graminearum.

    [0301] SEQ ID No 8: Protein encoded by the above nucleic acid sequence.

    [0302] SEQ ID No 9: Saccharopine dehydrogenase (LYS1) from Fusarium oxysporum.

    [0303] SEQ ID No 10: Protein encoded by the above nucleic acid sequence.

    [0304] SEQ ID No 11: Saccharopine dehydrogenase (LYS1) from Fusarium verticilloides.

    [0305] SEQ ID No 12: Protein encoded by the above nucleic acid sequence.

    [0306] SEQ ID No 13: Saccharopine dehydrogenase (LYS1) from Fusarium verticilloides.

    [0307] SEQ ID No 14: Protein encoded by the above nucleic acid sequence.

    [0308] SEQ ID No 15: Saccharopine dehydrogenase (LYS1) from Mycosphaerella fijiensis.

    [0309] SEQ ID No 16: Polypeptide encoded by the above nucleic acid sequence.

    [0310] SEQ ID No 17: Saccharopine dehydrogenase (LYS1) from Magnaporthe grisea.

    [0311] SEQ ID No 18: Protein encoded by the above nucleic acid sequence.

    [0312] SEQ ID No 19: Saccharopine dehydrogenase (LYS1) from Monoliophthora perniciosa.

    [0313] SEQ ID No 20: Protein encoded by the above nucleic acid sequence.

    [0314] SEQ ID No 21: Saccharopine dehydrogenase (LYS1) from Puccinia graminis.

    [0315] SEQ ID No 22: Protein encoded by the above nucleic acid sequence.

    [0316] SEQ ID No 23: Saccharopine dehydrogenase (LYS1) from Phytophthora infestans.

    [0317] SEQ ID No 24: Protein encoded by the above nucleic acid sequence.

    [0318] SEQ ID No 25: Saccharopine dehydrogenase (LYS1) (from Phytophthora ramorum.

    [0319] SEQ ID No 26: Protein encoded by the above nucleic acid sequence.

    [0320] SEQ ID No 27: Saccharopine dehydrogenase (LYS1) from Phytophthora sojae.

    [0321] SEQ ID No 28: Protein encoded by the above nucleic acid sequence.

    [0322] SEQ ID No 29: Saccharopine dehydrogenase (LYS1) from Pyrenophora tritici-repentis.

    [0323] SEQ ID No 30: Protein encoded by the above nucleic acid sequence.

    [0324] SEQ ID No 31: Saccharopine dehydrogenase (LYS1) from Sclerotinia sclerotiorum.

    [0325] SEQ ID No 32: Protein encoded by the above nucleic acid sequence.

    [0326] SEQ ID No 33: Saccharopine dehydrogenase (LYS1) from Trichoderma reesei.

    [0327] SEQ ID No 34: Protein encoded by the above nucleic acid sequence.

    [0328] SEQ ID No 35: Saccharopine dehydrogenase (LYS1) from Ustilago maydis.

    [0329] SEQ ID No 36: Protein encoded by the above nucleic acid sequence.

    [0330] SEQ ID No 37: Saccharopine dehydrogenase (LYS1) from Verticillium albo-atrum.

    [0331] SEQ ID No 38: Protein encoded by the above nucleic acid sequence.

    [0332] SEQ ID No 39: Saccharopine dehydrogenase (LYS1) from Mycosphaerella graminicola.

    [0333] SEQ ID No 40: Protein encoded by the above nucleic acid sequence.

    [0334] SEQ ID No 41: Saccharopine dehydrogenase (LYS1) from Fusarium moniliform.

    [0335] SEQ ID No 42: Protein encoded by the above nucleic acid sequence.

    [0336] SEQ ID No 43: Saccharopine dehydrogenase (LYS1) from Claviceps purpurea.

    [0337] SEQ ID No 44:Protein encoded by the above nucleic acid sequence.

    [0338] SEQ ID No 45: Primer SACdh_Pi_T7_F

    [0339] SEQ ID No 46: Primer SACdh_Pi_T7_R

    [0340] SEQ ID No 47: Primer Actin forward

    [0341] SEQ ID No 48: Primer Actin reverse

    [0342] SEQ ID No 49: Primer -Tub forward

    [0343] SEQ ID No 50: Primer -Tub reverse

    [0344] SEQ ID No 51: Primer SACdh forward

    [0345] SEQ ID No 52: Primer SACdh reverse

    [0346] SEQ ID No 53: Primer pBINB33-1

    [0347] SEQ ID No 54: Primer pBINB33-2

    [0348] SEQ ID No 55: Primer SacdhPI R

    [0349] SEQ ID No 56: Primer SacdhPI F

    [0350] SEQ ID No 57: Primer LYS1 Pot 117-F

    [0351] SEQ ID No 58: Primer LYS1 Pot 117-R

    [0352] The various aspects of the invention will be understood more fully by means of the experimental examples below.

    [0353] All the methods or operations described below are given by way of example and correspond to a choice, made among the various methods available for achieving the same result. This choice has no effect on the quality of the result, and, consequently, any appropriate method can be used by those skilled in the art to achieve the same result. In particular, and unless otherwise specified in the examples, all the recombinant DNA techniques employed are carried out according to the standard protocols described in Sambrook and Russel (2001, Molecular cloning: A laboratory manual, Third edition, Cold Spring Harbor Laboratory Press, NY) in Ausubel et al. (1994, Current Protocols in Molecular Biology, Current protocols, USA, Volumes 1 and 2), and in Brown (1998, Molecular Biology LabFax, Second edition, Academic Press, UK). Standard materials and methods for plant molecular biology are described in Croy R. D. D. (1993, Plant Molecular Biology LabFax, BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications (UK)). Standard materials and methods for PCR (Polymerase Chain Reaction) are also described in Dieffenbach and Dveksler (1995, PCR Primer: A laboratory manual, Cold Spring Harbor Laboratory Press, NY) and in McPherson et al. (2000, PCRBasics: From background to bench, First edition, Springer Verlag, Germany).

    REF BIBLIO

    [0354] Bevan, 1984, Nucl Acids Res 12: 8711-8721 [0355] Bhattacharjee, J. K., 1985, Crit. Rev. Microbiol. 12, 131-151 [0356] Bhattacharjee, J. K., 1992, in Handbook of Evolution of Metabolic Function, Mortlock, R. P., ed., CRC Press, Boca Raton, Fla., pp. 47-80 [0357] Born T. L. and Blanchard J. S., 1999, Curr. Opin. Chem. Biol., 3:607-613 [0358] Broquist, H. P., 1971, Methods Enzymol. 17, 112-129 [0359] Chuang and Meyerowitz, 2000, PNAS, 97: 4985-4990 [0360] Ehmann et al., 1999, biochemistry, 38, 6171-6177 [0361] Escobar et al., 2001, Proc. Natl. Acad. Sci. USA., 98(23): 13437-13442 [0362] Fire et al. 1998, Nature 391: 806-811 [0363] Garrad, R. C. and Bhattacharjee, J. K., 1992, J. Bacteriol. 174, 7379-7384 [0364] Gielen et al, 1984, EMBO Journal 3, 835-846 [0365] Hamilton and Baulcome, 1999, Science 286: 950-952 [0366] Hamilton et al., 1998, Plant J, 15: 737-746 [0367] Hammond et al., 2000, Nature 404: 293-296 [0368] Hannon, 2002, Nature, 418 (6894): 244-51 [0369] Herrera-Estrella et al, 1983 Nature, 303, 209-213 [0370] Hofgen and Willmitzer, 1990, Plant Science 66, 221-230 [0371] Houmard et al., 2007, Plant Biotechnology Journal 5, 605-614 [0372] Montgomery et al., 1998, PNAS 95: 15502-15507 [0373] Pandolfini et al., 2003, Biotechnol., 25; 3(1): 7 [0374] Pietrzak et al, 1986 Nucleic Acids Res. 14, 5858 [0375] Thompson et al., Nucleic Acids Research 22 (1994), 4673-4680 [0376] Umbargar, H. E., 1978, Annu. Rev. Biochem. 47, 533-606 [0377] Randall, T. A., 2005, MPMI, 18, 229-243 [0378] Rocha-Sosa et al., 1989, EMBO J. 8, 23-29 [0379] Ruiz Ferrer and Voinnet, Annu. Rev. Plant Biol. 2009. 60:485-510 [0380] Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, third edition, ISBN978-087969577-4 [0381] Silu et al. Physiol. Mol. Plant Pathol., 53 239-251, 1998 [0382] Strkel C., Ph. D. thesis Host induced gene silencingstrategies for the improvement of resistance against Cercospora beticola in sugar beet (B. vulgaris L) and against Fusarium graminearum in wheat (T. aestivum L.) and maize (Z. mays L.), defended in June 2011, XP002668931, retrieved from internet (2012 Feb. 7) on http://ediss.subni-hamburg.de/vol|teste/2011/5286/pdf/Dissertation.pdf [0383] Tang et al., 2003 Gene Dev., 17(1): 49-63 [0384] Villalba et al. Fungal Genetics and Biology 45, 68-75, 2008 [0385] Vogel, H. J., 1965, in Handbook of Evolving Genes and Proteins, Bryson, V., ed., Academic Press, New York, pp. 25-40 [0386] Waterhouse et al., 1998, PNAS 95: 13959-13964, [0387] Wesley et al. The Plant Journal (2001); 27(6), 581-590 [0388] Xiao et al., 2003, Plant Mol Biol., 52(5): 957-66 [0389] Xu et al., 2006, Cell Bio chemistry and Biophysics, vol 46, 43-64 [0390] Zamore et al., 2000, Cell, 101: 25-33,

    EXAMPLES

    Example 1: In Vitro Cultivation of Magnaporthe grisea

    [0391] Assays were carried out using the Magnaporthe grisea wild-type strain P1.2 originated from the collection of the phytopathology laboratory of the CIRAD (Centre de coopration internationale en recherche agronomique pour le dveloppement) in Montpellier. Conditions for culturing, the composition of the rice-agar medium, maintenance, and sporulation as well as protoplasts preparations are described by Silu et al. (1998).

    Example 2: Magnaporthe grisea Transfection with dsRNA Targeting Saccharopine Dehydrogenase and Measurement of Growth Inhibition

    [0392] The Magnaporthe grisea saccharopine dehydrogenase (SACdh) gene sequence Lys-1 (MGG_01359.6: 1426 bp) was obtained from the Broad Institute (http://www.broadinstitute.org/). A region of about 325 bp was selected for dsRNA, comprising the nucleotides 301 through 626, was synthesized by the Geneart company and cloned into the plasmid.

    [0393] For transfection, ds RNA of saccharopine dehydrogenase from Magnaporthe grisea was produced using the MEGAscript RNAi Kit (Ambion) according to the manufacturers' instructions. Different amounts (200 g to 2 g of ds RNA) were treated with transfection agent Lipofectamin RNAi max (Invitrogen) following manufactures' instructions. Lipofectamin-ds RNA complexes were added to 2.510.sup.6 Magnaporthe grisea protoplast in a microtiterplate with TB3 media (Villalba et al., 2008), and growth was monitored for 5-7 days at a OD of 600 nm using a Infinite M1000 (Tecan) microplate reader.

    [0394] Growth of Magnaporthe grisea protoplasts treated with ds RNA of saccharopine dehydrogenase comparing to untreated control. was monitored at several time points and showed a significant difference in growth.

    Example 3: In Vitro Cultivation Phytophthora infestans and Zoospores Preparation

    [0395] Phytophthora infestans strain PT78 was cultivated in vitro in 9 cm petri dishes on pea agar medium (125 g/l boiled and crushed peas, 20 g/l agar agar, carbenicillin 100 mg/l) at 21 C. in the dark. Every 15 days, new medium was inoculated with four 5 mm cubic plugs of mycelium.

    [0396] To release the zoospores, 12 ml of ice cold water were put on a 10 days old culture and the culture was placed at 4 C. for 2 hours. The supernatant was then collected without disturbing the mycelium and filtered through a 100 m sieve to remove hyphal fragments. The zoospores were placed on ice and counted with a haemocytometer.

    Example 4: Phytophthora infestans Transfection with dsRNA Targeting Saccharopine Dehydrogenase and Measurement of Growth Inhibition

    [0397] The Phytophthora infestans saccharopine dehydrogenase gene sequence Lys-1 (PITG_03530: 3020 bp) was obtained from the P. infestans database of the Broad Institute. A region about 500 bp offering the best siRNA according to the BLOCKit RNAi designer software (Invitrogen) and comprising the nucleotides 2251 through 2750, was synthesized by the Geneart company and cloned into the plasmid 0920357_SacDH_Pi_pMA.

    [0398] Synthesis of dsRNA was carried out using the Megascript RNAi kit (Ambion) following the manufacturer's protocol and using as a template a PCR product amplified from the plasmid 0920357_SacDH_Pi_pMA. The forward primer used was SACdh_Pi_T7_F: 5 TAATACGACTCACTATAGGGTTGCAGGAGAGCGCAGAAAGC (SEQ: ID NO: 45) and the reverse primer was SACdh_Pi_T7_R: TAATACGACTCACTATAGGGTCAGTTGGAGTCCGCGTGGTGT (SEQ. ID NO: 46).

    [0399] dsRNA were then precipitated with 100% ethanol and sodium acetate 3M, pH5.2, washed 2 times with 70% ethanol and the pellets were resuspended in RNase free water.

    [0400] The transfection mixes were prepared in a 48 well plate by adding sequentially V8 medium (5% of V8 juice (Campbell Foods Belgium), pH5), the appropriate amount of dsRNA and 10 l of lipofectamine RNAi max (Invitrogen) in a final volume of 200 l. The transfection mixture was incubated during 15 min at room temperature.

    [0401] Zoospores were diluted in V8 medium to a concentration of 510.sup.4 zoospores/ml. Then, 800 L of the zoospores solution were added in each well of the plate. The final concentration of zoospores was 410.sup.5 zoospores/ml.

    [0402] Three controls were added on each plate: V8 medium, V8 medium+zoospores, V8 medium+zoospores+lipofectamine. The plates were incubated at 21 C., in the dark.

    [0403] The growth of the fungus was followed by measuring the absorbance at 620 nm in a plate reader (Infinite 1000, Tecan) over 8 days The percentage of growth inhibition was calculated using the following formula: 100(OD.sub.dsRNA100/OD.sub.control lipofectamine). The growth of the fungi was reduced in the presence of dsRNA directed against saccharopine dehydrogenase in a concentration dependant manner (100 nM and 200 nM respectively) as shown in FIG. 1

    Example 5: Quantitative PCR Analysis of P. infestans Saccharopine Dehydrogenase Messenger RNA

    [0404] To yield sufficient RNA for cDNA synthesis and real-time RT-PCR, several wells of the 48 wells plate were pooled for one concentration of dsRNA tested: 10 wells for 72 h time point, 6 wells for 96 h time point, 3 wells for 120 h time point.

    [0405] After 72 h, 96 h and 120 h of treatment with the dsRNA, the mycelia were collected. The samples were centrifuged to remove the medium. The samples were frozen in liquid nitrogen and then lyophilized overnight.

    [0406] Before RNA extraction, the mycelium was grinded. Total RNA was extracted using the RNeasy Plant mini kit (Qiagen) following the manufacturer's protocol. DNA contamination of the RNA samples was removed by DNase digestion (DNA free, Ambion). Integrity of the RNA was tested on the 2100 Bioanalyzer (RNA 6000 nano kit, Agilent) following the protocol supplied by the manufacturer. The cDNA were synthesized from 2 g of total RNA by oligo dT priming using the kit Thermoscript RT-PCR system (Invitrogen) following the manufacturer's protocol. The cDNA were precipitated with 100% EtOH and sodium acetate 3M, pH5.2, washed 2 times with 70% EtOH and the pellets were resuspended in 10 L of RNase free water. The cDNA were diluted a hundred fold for the qPCR test. Primer pairs were designed for each gene sequence by using the Primer Express 3 software (Applied Biosystems). Real time RT-PCR was performed on a 7900 Real Time PCR system (Applied Biosystems) with Power SYBR green PCR master mix (Applied Biosystems) following the manufacturer's protocol. Q-PCR was performed as follows: 95 C. for 10 min, 45 cycles at 95 C. for 15 s and 60 C. 1 min, followed by a dissociation stage at 95 C. for 15 s, 60 C. for 1 min and 95 C. for 15 s.

    [0407] The actin and 3-tubuline genes were used as endogenous controls. The relative expression of genes was calculated with the 2Ct method. The FIG. 2 shows a significant reduction of the level of the saccharopine dehydrogenase messenger RNA and this reduction correlates with growth inhibition.

    TABLE-US-00001 TABLE1 SequenceofqPCRprimers: Primername Forwardprimersequence Reverseprimersequence actin CGACTCTGGTGACGGTGTGT GCGTGAGGAAGAGCGTAACC (SEQIDNO:47) (SEQIDNO:48) -Tub CCGCCCAGACAATTTCGT CCTTGGCCCAGTTGTTACCA (SEQIDNO:49) (SEQIDNO:50) SACdh TGGGTGGTTTCCAAGGTCTTC AAAGGCACCAAGCCACTGAA (SEQIDNO51) (SEQIDNO:52)

    Example 6: Construction of Transformation Vectors Containing the Phytophthora infestans Saccharopine Dehydrogenase Gene

    a) Preparation of the Plant Expression Vector IR 47-71

    [0408] The plasmid pBinAR is a derivative of the binary vector plasmid pBin19 (Bevan, 1984) which was constructed as follows: A fragment of a length of 529 bp which comprised the nucleotides 6909-7437 of the 35S promoter of the cauliflower mosaic virus was isolated as EcoR \IKpn I fragment from the plasmid pDH51 (Pietrzak et al, 1986) and ligated between the EcoR I and Kpn I restriction sites of the polylinker of pUC18. In this manner, the plasmid pUC18-35S was formed. Using the restriction endonucleases Hind III and Pvu II, a fragment of a length of 192 bb which included the

    polyadenylation signal (3 terminus) of the Octopin Synthase gene (gene 3) of the T-DNA of the Ti plasmid pTiACH (Gielen et al, 1984) (nucleotides 11 749-11 939) was isolated from the plasmid pAGV40 (Herrera-Estrella et al, 1983). Following addition of Sph I linkers to the Pvu II restriction site, the fragment was ligated between the Sph I and Hind III restriction sites of pUC18-35S. This gave the plasmid pA7. Here, the entire polylinker comprising the 35S promoter and Ocs terminator was removed using EcoR I and Hind III and ligated into the appropriately cleaved vector pBin19. This gave the plant expression vector pBinAR (Hofgen and VVilimitzer, 1990).

    [0409] The promoter of the patatin gene B33 from Solanum tuberosum (Rocha-Sosa et al., 1989) was, as Dra I fragment (nucleotides-1512-+14), ligated into the Ssf I-cleaved vector pUC19 whose ends had been blunted using T4-DNA polymerase. This gave the plasmid pUC19-B33. From this plasmid, the B33 promoter was removed using EcoR I and Sma I and ligated into the appropriately restricted vector pBinAR. This gave the plant expression vector pBinB33. To facilitate further cloning steps, the MCS (Multiple Cloning Site) was extended. To this end, two complementary oligonucleotides were synthesized, heated at 95 C. for 5 minutes, slowly cooled to room temperature to allow good fixation (annealing) and cloned into the Sal I and Kpn I restriction sites of pBinB33. The oligonucleotides used for this purpose had the following sequence:

    pB1NB33-1: 5-TCG ACA GGC CTG GAT CCT TAA TTA AAC TAG TCT CGA GGA GCT CGG TAC-3 (SEQ ID NO: 53) pB1 NB33-2: 5-CGA GCT CCT CGA GAC TAG TTT AAT TAA GGA TCC AGG CCT G-3
    (SEQ ID NO: 54) The plasmid obtained was named IR 47-71.
    b) Preparation of the Plant Expression Vectors pEPA248 and pEPA262 Comprising a Nucleic Acid Sequences for the Phytophthora infestans Saccharopine Dehydrogenase Gene.

    [0410] The saccharopine dehydrogenase sequence (PITG_03530: 3020 bp) was obtained from the P. infestans ORF Prot V1 database. A region about 500 bp offering the best siRNA according to the BLOCKit RNAi designer software (Invitrogen), was synthesized by the Geneart company.

    [0411] A 300 bp fragment was amplified by PCR from this sequence DNA with the primers SacdhPI R (5-agaggtaccaagcttgcgtagctgg-3) and SacdhPI F (5-tatctcgagtctagacaacgccattggttac-3). The amplified fragment was cloned into pCRII-Topo (Invitrogen) to obtain the plasmid pEPA250. According to Wesley et al. (2001), the sequence of interest was cloned in pHannibal vector to give plasmid pEPA241. Then the dsRNA expression cassette was sub-cloned into different binary (plant expression) vectors pART27 (Gleave A P, PMB 20, (1992), 1203-1207) and IR 47 to produce the plant expression vectors pEPA248 and pEPA262, respectively.

    [0412] Vector pEPA248 and pEPA262 were introduced into respectively GV3101 and C58C1RIF (pGV2260) agrobacteria cells by electroporation (Rocha-Sosa et al. (1989)), in order to further transform potato plants.

    Example 7: Construction of Transformation Vectors Targeting the Sclerotinia scharotiorum Saccharopine Dehydrogenase Gene LysI

    [0413] The 351 bp of a region of the S. sclerotiorum Lysi coding sequence (saccharopine dehydrogenase SS1G_06166.1) was synthesized by the Geneart company (pEPA293), and flanked by internal (XbaI, HindIII) and external (XhoI, KpnI) restriction sites designed to perform a two-step cloning into the pHannibal vector (Wesley et al., 2001). The intermediate plasmid harbored two inverted copies of the LysI gene fragment spaced by the pHannibal PdK intron and regulated by the cauliflower mosaic virus (CaMV) 35S promoter and the OCS terminator.

    [0414] The entire DNA cassette was then excised with NotI and inserted into the pART27 binary vector (Gleave, 1992), giving the final plasmid pEPA307 with a plant selection cassette based on kanamycin resistance (nptII gene regulated by the Nos promoter and terminator).

    [0415] The same NotI cassette was also inserted in a binary vector (pFC031) with a plant selection marker based on an HPPD inhibitors resistance, to be used in Soybean transformation. The final plasmid can then transform plants with a T-DNA comprising in between the Right and Left borders, our cassette of interest and an HPPD gene regulated by a CsVMV promoter, a chloroplast transit peptide sequence and a 3Nos terminator.

    Example 8: Construction of Transformation Vectors Targeting the Phakopsora pachirizi Saccharopine Dehydrogenase Gene Lys1

    [0416] The 364 bp of a region of a Phakopsora pachirizi LysI E.S.T. (saccharopine dehydrogenase PHAPC_EH247326.1) was synthesized by the Geneart company (pCED42), and flanked by internal (XbaI, HindIII) and external (XhoI, KpnI), restriction sites designed to perform a two-step cloning into the pHannibal vector (Wesley et al., 2001). The intermediate plasmid harbored two inverted copies of the Lys1 gene fragment spaced by the pHannibal PdK intron and regulated by the cauliflower mosaic virus (CaMV) 35S promoter and the OCS terminator.

    [0417] The entire DNA cassette was then excised with NotI and inserted into the pART27 binary vector (Gleave, 1992), giving the final plasmid pCED45 with a plant selection cassette based on kanamycin resistance (nptII gene regulated by the Nos promoter and terminator).

    [0418] The same NotI cassette was also inserted in a binary vector (pFCO31) with a plant selection marker based on an HPPD inhibitors resistance, to be used in Soybean transformation. The final plasmid (pCED87) can then transform plants with a T-DNA comprising inbetween the Right and Left borders, our cassette of interest and an HPPD gene regulated by a CsVMV promoter, a chloroplast transit peptide sequence and a 3Nos terminator.

    Example 9: Transformation of Potato Plants with Plant Expression Vectors Comprising Nucleic Acid Molecules Coding for Hairpin Saccharopine Dehydrogenase Construct pEPA262

    [0419] Potato plants were transformed via Agrobacterium using the plant expression vector pEPA262, which comprises a coding nucleic acid sequence for saccharopine dehydrogenase under the control of the promoter of the patatin gene B33 from Solanum tuberosum as described by Rocha-Sosa et al. (1989). The transgenic potato plants transformed with the plasmid pEPA262, were named 537 ES. Molecular analysis of the events of 537 ES was performed using standard PCR methods (Sambrook et al.) to detect the presence of the nucleic acid sequence for saccharopine dehydrogenase using the following primers SacDH PI F: 5-TATCTCGAGTCTAGACAACGCCATTGGTTAC-3 (SEQ ID NO: 56) and SacDH PI R: 5-AGAGGTACCAAGCTTGCGTAGCTGG-3. (SEQ ID NO: 55) Further selection was accomplished either by Northern blotting or by expression analysis of the nucleic acid sequence for saccharopine dehydrogenase via RT-Q PCR leading to a selection of different events. The oligonucleotides used for this purpose had the following sequence: LYS1_Pot 117-F: 5-TCA ATA GAA GCG AAC GCG TAA A-3 (SEQ ID NO: 57) and LYS1_Pot 117-R: 5-GTT CGG GAT CTG CTC GAT GT-3 (SEQ. ID NO: 58).

    Example 10: Agrobacterium-Mediated Transformation of Arabidopsis thaliana

    [0420] The pART27 derived plasmids was introduced into Agrobacterium tumefaciens strain LBA4404 (Invitrogen Electromax) by electroporation. The obtained bacterial strains were then used for the floral dip infiltration of the A. thaliana Col-0 or Wassileskija plants as described by Clough & Bent (PlantJ 1998).

    Example 11: Agrobacterium-Mediated Transformation of Glycine max

    [0421] The pFCO31 derived plasmids were introduced into Agrobacterium tumefaciens strain LBA4404 (Invitrogen Electromax) by electroporation. The obtained bacterial strains were then used for Soybean transformation as described below.

    [0422] Soybean seeds are sterilized for 24 h with Chlorine gas (Cl2). Seeds are then placed in Petri dishes and soaked in sterile deionized water for 20 hours prior to inoculation, in the dark, at room temperature. An overnight culture grown at 28 C. and 200 rpm agitation of Agrobacterium tumefaciens in 200 ml of YEP (5 g/L Yeast extract, 10 g/L Peptone, 5 g/L NaCl2. pH to 7.0) containing the appropriate antibiotic is centrifugated at 4000 rpm, 4 C., 15 min. The pellet is resuspended in 40 to 50 mL of infection medium to a final OD600 nm between 0.6 and 1 and stored on ice. Soaked seeds are dissected, under sterile conditions, using a #15 scalpel blade to separate the cotyledons and remove the primary leaves attached to them. Each cotyledon is kept as explant for inoculation. About 100 explants are prepared and subsequently inoculated together, for 30 minutes in the Agrobacterium inoculum, with occasional agitation. Cocultivation is performed in classical Petri dishes containing 4 papers filter (Whatman grade 1) and 4 mL of Cocultivation medium ( 1/10B5 major salts, 1/10B5 minor salts, 2.8 mg/L Ferrous, 3.8 mg/L NaEDTA, 30 g/L Sucrose, 3.9 g/L MES (pH 5.4). Filter sterilized 1B5 vitamins, GA3 (0.25 mg/L), BAP (1.67 mg/L), Cysteine (400 mg/L), Dithiothrietol (154.2 mg/L), and 200 M acetosyringone). Explants are placed on co-cultivation plates (9 per plate), adaxial (flat) side down and sealed with a single vertical string of tape (Leucopore) and further incubated for 5 days, at 24C, in a 18:6 photoperiod. At the end of cocultivation, the explants are placed (6 per plate) on the Shoot Initiation Medium (1B5 major salts, 1B5 minor salts, 28 mg/L Ferrous, 38 mg/L NaEDTA, 30 g/L Sucrose, 0.56 g/L MES, and 8 g/L agar (pH 5.6). Filter sterilized 1B5 vitamins, BAP (1.67 mg/L), Timentin (50 mg/L), Cefotaxime (50 mg/L), Vancomycin (50 mg/L) and Tembotrione (0.1 mg/L)), inclined at 45, with the cotyledonary node area imbedded in the medium and upwards. The Shoot Initiation step lasts 1 month (24 C. 16/8 photoperiod). After one more month, explants with green shoots are transferred on Shoot Elongation Medium (1MS/B5 medium amended with 1 mg/l zeatin riboside (ZR), 0.1 mg/l IAA, 0.5 mg/l GA3, 3% sucrose, 100 mg/l pyroglutamic acid, 50 mg/l asparagine, 0.56 g/L MES, pH 5.6, solidified with 0.8% agar, ticarcillin (50 mg/l), cefotaxime (50 mg/l) and vancomycin (50 mg/L)), with fresh transfer every 2 weeks. Plantlets that are more than 2 cm high are transferred on Rooting medium. Plantlets are cut and placed on rooting medium ( MS major salts, minor salts and vitamins B5, 15 g/L Sucrose, 1 mg/L IBA 8 g/L Noble agar, pH 5.7). in an 180 mL vertical plastic container.

    [0423] Once the roots are well formed and the apex is strong, plants are placed into soil in the greenhouse and covered with a green plastic box for acclimatization for 5 days on a 36 C. heating bed. After 10 days of acclimatization, the plants are transferred into big pots, without heating bed.

    Example 12: Asian Soybean Rust (Phakopsora pachyrhizi) Assay

    [0424] Soybean plants expressing dsRNA directed against Phakopsora pachirizi Lys1 were grown in the greenhouse in 7.5 cm pots (28.5 C., 50% humidity, 1 4 h light). In an incubator, plants were sprayed with a conidia suspension (50 ml at 10-1510.sup.4 spores/ml obtained from artificially infected soybean plants serving as a source of inoculum, for one tray of dimensions 55345 cm containing 15 pots). Suspension includes Tween20 at 0.033%. To ensure even inoculation multidirectional spraying is necessary. Plants are then incubated for 4 days at ca. 25 C. (daytime) and ca. 20 C. (night) with very high humidity (90% to saturation). After this period plants are transferred back to normal growing conditions. Asian soybean rust development is evaluated at regular intervals to follow kinetics of disease development and severity of symptoms. All experiments with Asian soybean rust are performed in L2 safety level culture chambers or incubators according to HCB requirements.

    Example 13: Sclerotinia sclerotiorum Assay

    [0425] Development of the Wild-type S. sclerotiorum isolate 1980 as well as the pac 1 mutant (Rollins, 2003) fungus was studied on a whole plant assay. S. sclerotiorum was stored at 4 C. on potato dextrose agar (PDA, potato 200 g/I, glucose 20 g/I, agar 18 g/l). The fungus was cultured in a Petri dish containing PDA by placing a mycelial plug in the centre and was maintained under static conditions at 21 C. for 4 days. 4 weeks old Arabidopsis wild-type and transgenic plants were inoculated with 12-mm diameter agar-mycelium plugs excised from the actively growing margin of the fungal colony in the centre of the plant. Inoculated plants were kept in a growth chamber at 21 C. with 100% relative humidity under a 12-h light photoperiod with a light intensity of 34 mmol m-2 s-1 using fluorescent white lights and were monitored every 12 h to observe fungal development. Disease symptoms were monitored by number of infected leaves as well as lengths and widths of lesions.