Materials and methods for the treatment of latent viral infection
10507232 ยท 2019-12-17
Assignee
- University Of Florida Research Foundation, Incorporated (Gainesville, FL)
- Duke University (Durham, NC)
Inventors
- David C. Bloom (Gainesville, FL, US)
- Dane M. Phelan (Gainesville, FL, US)
- Bryan R. Cullen (Durham, NC)
- Matthew E. Kennedy (Chapel Hill, NC, US)
Cpc classification
A61K31/522
HUMAN NECESSITIES
C12N7/00
CHEMISTRY; METALLURGY
C12N2710/16611
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
A61K45/06
HUMAN NECESSITIES
A61K38/465
HUMAN NECESSITIES
A61K31/522
HUMAN NECESSITIES
A61K31/045
HUMAN NECESSITIES
A61K31/045
HUMAN NECESSITIES
A61K48/00
HUMAN NECESSITIES
C07K2319/80
CHEMISTRY; METALLURGY
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K31/7072
HUMAN NECESSITIES
International classification
C12N9/22
CHEMISTRY; METALLURGY
A61K31/7072
HUMAN NECESSITIES
A61K31/045
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
C12N7/00
CHEMISTRY; METALLURGY
Abstract
The subject invention pertains to materials and methods for the treatment of latent viral infections.
Claims
1. A method of treating a latent viral infection comprising the administration of a fusion protein comprising a TAL binding domain that binds a target gene of a latent virus and an effector domain to a subject having a latent viral infection, wherein (a) the target gene is selected from ICP27, ICP0, ICP4, UL5, UL7, UL30, LAT and/or UL25, (b) the effector domain is an endonuclease, and (c) the fusion protein modulates the target gene of the latent virus, wherein the viral infection is caused by an HSV-1 or HSV-2 virus.
2. A method of treating a latent viral infection comprising the administration of a vector encoding the fusion protein according to claim 1 to a subject having a latent viral infection.
3. The method of claim 1, wherein the target gene is ICP4 and the effector domain is Mme1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication, with color drawing(s), will be provided by the Office upon request and payment of the necessary fee.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
DETAILED DISCLOSURE OF THE INVENTION
(14) The terms nucleic acid, polynucleotide, and oligonucleotide (and grammatical variants thereof) are used interchangeably and refer to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form. For the purposes of the present disclosure, these polymers are not limited in length. Analogs and/or nucleotides that are modified in the base, sugar and/or phosphate moieties (e.g., phosphorothioate backbones) of natural nucleotides may be included in the polymers. Analogs will have the same base-pairing specificity as occurs in nature (an analog of G will base-pair with C).
(15) The terms polypeptide, peptide and protein (and grammatical variants thereof) are used interchangeably to refer to a polymer of amino acid residues. The term also applies to amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of corresponding naturally-occurring amino acids.
(16) Binding and grammatical variants thereof (e.g., bind, binds, bound, etc.) refers to a sequence-specific, non-covalent interaction between macromolecules (e.g., between a protein (e.g., a TAL) and a nucleic acid or an antibody with its cognate antigen/epitope).
(17) A binding protein (and grammatical variants thereof) is a protein that is able to bind non-covalently to another molecule. A binding protein can bind to, for example, a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein) and/or a protein molecule (a protein-binding protein). In the case of a protein-binding protein, it can bind to itself (to form homodimers, homotrimers, etc.) and/or it can bind to one or more molecules of a different protein or proteins. A binding protein can have more than one type of binding activity. For example, zinc finger proteins have DNA-binding, RNA-binding and protein-binding activity.
(18) A polypeptide having an activity on nucleic acids is defined as an effector domain(s) herein. Effector domains can be modified by being combined with a TAL as described herein in order to cause an effect at a target site within the genome of an organism that is bound by the TAL. Examples of such polypeptides include, and are not limited to, transcription activator (also referred to as transcription activator domain(s); TAD(S)) and repressor proteins, nucleases, topoisomerases, ligases, integrases, recombinases, resolvases, methylases, acetylases, demethylases, deacetylases, and any other polypeptide capable of modifying DNA or RNA. In certain preferred embodiments, the polypeptides combined with a TAL are nucleases such as Mmel, Colicin-E7 (CEA7_ECOLX), EndA, Endo I (END1_ECOLI), Human Endo G (NUCG HUMAN), Bovine Endo G (NUCG_BOVIN), R.HinPI I, l-Basl, I-Bmol, l-Hmul, l-Tev-l, l-Tevll, l-Tevlll, l-Twol, R.Mspl, R.Mval, NucA, NucM, Vvn, Vvn_CLS, Staphylococcal nuclease (NUC_STAAU), Staphylococcal nuclease (NUC_STAHY), Micrococcal nuclease (NUC_SHIFL), Endonuclease yncB, Endodeoxyribonuclease I (ENRN_BPT7), Metnase, Nb.BsrDI, BsrDI A, Nt.BspD6l (R.BspD6l large subunit), ss.BspD6l (R.BspD6l small subunit), R.PIel, Mlyl, Alwl, Mva1269l, Bsrl, Bsml, Nb.BtsCI, Nt.BtsCI, RlBtsl, R2.Btsl, BbvCI subunit 1, BbvCI subunit 2, BpulOI alpha subunit, BpulOI beta subunit, Bmrl, Bfil, l-Crel, hExol (EX01JHUMAN), Yeast Exol (EX01_YEAST), E. coli Exol, Human TREX2, Mouse TREX1, Human TREX1, Bovine TREX1, Rat TREX1, Human DNA2, Yeast DNA2 (DNA2_YEAST), VP16, RBBP8 and Type IIS nucleases like Fok-I. In certain preferred embodiments, the nuclease is Fok-I.
(19) Trans-activating domains (TAD(S)) include, and are not limited to, polypeptides containing a nine-amino-acid transactivation domain (9aaTAD) that defines a novel domain common to a large superfamily of eukaryotic transcription factors. Non-limiting examples of such eukaryotic transcription factors include p53 (also known as cellular tumor antigen p53, phosphoprotein p53, or tumor suppressor p53 which is encoded by the TP53 gene) or a fragment of p53 comprising amino acids 1-42, NFAT (Nuclear factor of activated T-cells), NF-B (nuclear factor kappa-light-chain-enhancer of activated B cells), E1A (adenovirus transcriptional activator) and VP16 (-TIF (also known as Trans Inducing Factor).
(20) Targeting Effector Molecules (TALENS and TALTADS). Transcription activator-like (TAL) binding domains are natively expressed by bacteria of the Xanthomonas genus and utilize a protein-DNA interaction mediated by a unique DNA-binding motif that is an array of highly conserved 34-amino acid repeats, where each of the repeats mediates binding to a single nucleotide base pair. The targeted base pair is determined by the identity of the 12.sup.th and 13.sup.th amino acid in each repeat. Owing to the relationship between the amino acid sequence of the TAL binding domain and the DNA target sequence, synthetic TAL effectors with permutated repeats have been developed with exquisite specificity towards target genes. TAL binding domains can be engineered to bind to a predetermined nucleotide sequence, Non-limiting examples of methods for engineering DNA-binding proteins are design and selection. A designed DNA binding protein is a protein not occurring in nature whose design/composition results principally from rational criteria. Methods of engineering TAL and other nucleic acid binding domains, such as zinc finger proteins, to bind a predetermined nucleic acid sequence are known in the art (see, for example, U.S. Pat. Nos. 6,140,081; 6,453,242; and 6,534,261; see also WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496 and U.S. Patent Application Publication No. 20110301073, each of which is hereby incorporated by reference in its entirety for such purposes).
(21) TAL binding domains (synthetic or engineered) effectors can include various effector domains (as discussed above). In the case where a TAL is associated with an nuclease, the TAL effector is referred to as a TALEN. Thus, the effector domain can be any of the nucleases (e.g., an endonuclease) discussed above. In certain embodiments, the nuclease/endonuclease attached to the TAL can be a nuclease/endonuclease that requires dimerization for activity (e.g., Fok-I) or can be an nuclease/endonuclease that does not require dimerization for activity. To utilize TALEN-mediated DNA cleavage with an endonuclease that requires dimerization for activity, a pair of TALENs are designed to bind at sequences flanking a chosen target site such that the endonuclease domains of each TALEN meet, dimerize, and catalyze cleavage at the desired target site. An exemplary endonuclease in this aspect of the invention is Fok-I. In other embodiments, engineered nucleases can be used to form a TALEN pair. In these embodiments, the nucleases have been modified to form obligate heterodimers with nuclease. Examples of such nucleases can be found in U.S. Patent Publication Nos. 2005/0064474, 2007/0218528, 2008/0131962 and 2011/0201055, each of which is hereby incorporated herein by reference in its entirety. Exemplary amino acid sequences that provide binding specificity to target genes within TAL are provided below (in single letter amino acid code). All the coordinates are chosen out of the GenBank genomic sequence of the HSV-1 strain 17syn+ and this sequence can be accessed on GenBank using the accession number NC_001806 (which is hereby incorporated by reference in its entirety). TAL binding domains can be assembled using the REAL TALEN Assembly Kit or the Voytas Golden Gate Assembly Kit. The target coordinates for each TAL fusion protein are shown in the HSV-1 genome. Since ICP0 and ICP4 each occur twice in the viral genome, the genes are coded on one DNA strand in one direction (+, sense) and in the other second gene is coded on the other DNA strand in an opposing direction (, antisense).
(22) TABLE-US-00001 RA-TALEN_ICP0_S1: AssembledUsing: REALAssemblyKit FunctionalDomain: FokI(wt) RVDSequence: NN-HD-NN-HD-NI-NI-NG-NG-NN-HD-NI-NG-HD-HD- NI-NN-NN(SEQIDNO:19) DNATargetSequence: 5-gcgcaattgcatccagg-3 (SEQIDNO:2) DNATargetCoordinates: 3459-3475(-),122896-122912(+) DNATargetGene: ICP0exon RA-TALEN_ICP0_S2: AssembledUsing: REALAssemblyKit FunctionalDomain: FokI(wt) RVDSequence: NN-HD-NI-NG-NN-HD-NI-HD-HD-NN-HD-NG-NG-HD- NG-NN-HD(SEQIDNO:20) DNATargetSequence: 5-gcatgcaccgcttctgc-3 (SEQIDNO:3) DNATargetCoordinates: 3426-3442(+),122929-122945(-) DNATargetGene: ICP0exon GG-TALEN_ICP4_S1: AssembledUsing: GoldenGateAssemblyKit FunctionalDomain: FokI(wt) RVDSequence: NN-NN-HD-HD-NH-HD-HD-NI-HD-HD-NH-NH-HD-HD- NH-NG-NH-NI-HD-NN(SEQIDNO:21) DNATargetSequence: 5-ggccgccaccggccgtgacg-3 (SEQIDNO:4) DNATargetCoordinates: 130605-130624(+),147609-147628(-) DNATargetGene: ICP4codingregion GG-TALEN_ICP4_S2: AssembledUsing: GoldenGateAssemblyKit FunctionalDomain: FokI(wt) RVDSequence: HD-NN-HD-HD-NH-HD-NH-HD-HD-HD-NH-HD-HD-NH- NH-HD-HD-HD-NI-NN(SEQIDNO:22) DNATargetSequence: 5-cgccgcgcccgccggcccag-3 (SEQIDNO:5) DNATargetCoordinates: 130640-130659(-),147574-147593(+) DNATargetGene: ICP4codingregion RA-TALE_ICP0: AssembledUsing: REALAssemblyKit FunctionalDomain: VP16 RVDSequence: NN-NN-NN-NI-HD-NN-HD-NN-HD-NN-NN-HD-HD-NI- NG(SEQIDNO:23) DNATargetSequence: 5-gggacgcgcggccat-3 (SEQIDNO:6) DNATargetCoordinates: 2023-2037(+),124334-124348(-) DNATargetGene: ICP0promoter RA-TALE_ICP4: AssembledUsing: REALAssemblyKit FunctionalDomain: VP16 RVDSequence: NN-NN-HD-NI-NN-NI-NG-NN-NN-HD-NN-HD-NN-NN- NI-NG-NN(SEQIDNO:24) DNATargetSequence: 5-ggcagatggcgcggatg-3 (SEQIDNO:7) DNATargetCoordinates: 131620-131636(-),146597-146613(+) DNATargetGene: ICP4promoter.
(23) A second possible effector domain for synthetic TAL effectors is a transcriptional activation domain, such as the strongly transactivating domain VP16 protein. These synthetic TAL effectors are referred to as TALTAD(s). TALTAD(s) are targeted to the 5 promoter regions of a particular target gene and the resulting fusion protein (e.g., TALE-VP16) acts to drive transcription from that gene. Such TAL effectors can be used in combination with anti-viral chemotherapeutic agents for the treatment of the viral infection. Non-limiting examples of anti-viral agents include trifluordine, docosanol, acyclovir, famciclovir, ganciclovir, penciclovir and valacyclovir.
(24) In certain embodiments of methods for targeted alteration of a sequence in a region of interest in viral nucleic acids, either episomal or incorporated into the genome, of the subject to be treated. Any of the methods described herein can be used for partial or complete inactivation of one or more viral target sequences in a cell. In addition these methods may be directed to mutate the target protein such that it may be expressed but is non-functional and could actively interfere with the activity of other non-mutated viral proteins present in that cell (dominant-negative mutation).
(25) The term sequence (and grammatical variants thereof) refers to a nucleotide sequence of any length, which can be DNA or RNA. The nucleotide sequence can be linear, circular (e.g., episomal) or branched and can be either single-stranded or double stranded. An episome is a replicating nucleic acid, nucleoprotein complex or other structure comprising a nucleic acid that is not part of the chromosomal karyotype of a cell. Examples of episomes include plasmids and certain viral genomes.
(26) A target site or target sequence (and grammatical variants thereof) is a nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule will bind, provided sufficient conditions for binding exist. In various embodiments, the target sequences can be viral genes (also referred to as a target gene or target genes) that are associated with transcriptional activation of latent viruses within a cell. Non-limiting examples of such genes include ICP27, ICP0 and ICP4 for HSV-1 and HSV-2. Other target sequences include, and are not limited to, genes associated with replication of the viral genome (e.g., UL5, UL7, etc.), polymerases (e.g., UL30) and genes associated with processing and packaging of viral DNA (e.g., UL25) or producing viral RNAs during latency. Similar target sequences can be identified in other viruses causing latent infections from genomes found in databases such as EMBL or GenBank.
(27) An exogenous molecule is a molecule that is not normally present in a cell, but can be introduced into a cell by one or more genetic, biochemical or other methods. Normal presence in the cell is determined with respect to the particular developmental stage and environmental conditions of the cell. An exogenous molecule can be, among other things, a viral protein produced by a virus in either its latent state or while causing active infection.
(28) By contrast, an endogenous molecule is one that is normally present in a particular cell at a particular developmental stage under particular environmental conditions. For example, an endogenous nucleic acid can comprise a chromosome, the genome of a mitochondrion, chloroplast or other organelle, or a naturally-occurring episomal nucleic acid. Additional endogenous molecules can include proteins, for example, transcription factors and enzymes.
(29) A fusion molecule or fusion protein (and grammatical variants thereof) is a molecule in which two or more subunit molecules are linked, preferably covalently. The subunit molecules can be the same chemical type of molecule (e.g., two or more proteins) or can be different chemical types of molecules (e.g., a nucleic acid and a protein). Examples of the first type of fusion molecule include, but are not limited to, TALEN or TALTAD fusion proteins. Expression of a fusion protein in a cell can result from delivery of the fusion protein to the cell or by delivery of a polynucleotide encoding the fusion protein to a cell, wherein the polynucleotide is transcribed, and the transcript is translated, to generate the fusion protein. Methods for polynucleotide and polypeptide delivery to cells are presented elsewhere in this disclosure.
(30) Modulation of gene expression refers to a change in the activity of a gene. Modulation of expression can include, but is not limited to, gene activation and gene repression. Gene inactivation refers to any reduction in gene expression as compared to a cell that does not include TALEN, TALTAD or other TAL binding domain fused to an effector domain as described herein. Gene activation refers to any increase in gene expression as compared to a cell that does not include TALEN, TALTAD or other TAL binding domain fused to an effector domain as described herein. Thus, gene activation/inactivation may be partial or complete. Gene activation or inactivation can also be modulated by a RGN as described herein.
(31) A region of interest is any region of cellular chromatin, such as, for example, a gene or a non-coding sequence within or adjacent to a gene, in which it is desirable to bind a TAL binding domain fused to an effector domain as described herein (or a RGN). Binding can be for the purposes of targeted DNA cleavage and/or targeted delivery of an effector domain as described herein. A region of interest can be present in a chromosome, an episome, an organellar genome (e.g., mitochondrial, chloroplast), or an infecting viral genome, for example. A region of interest can be within the coding region of a gene, within transcribed non-coding regions such as, for example, leader sequences, trailer sequences or introns, or within non-transcribed regions, either upstream or downstream of the coding region (e.g., a promoter upstream of a coding region). A region of interest can be as small as a single nucleotide pair or up to 2,000 nucleotide pairs in length, or any integral value of nucleotide pairs.
(32) The terms operatively linked or operably linked can be used interchangeably with reference to a juxtaposition of two or more components (such as sequence elements), in which the components are arranged such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components. By way of illustration, a transcriptional regulatory sequence, such as a promoter, is operatively linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. With respect to fusion polypeptides, the term operatively linked can refer to the fact that each of the components performs the same function in linkage to the other component as it would if it were not so linked. For example, with respect to a fusion protein comprising a TAL binding domain fused to an effector domain polypeptide the individual elements of the fusion protein are in operative linkage if, in the fusion protein, the TAL binding domain is able to bind its target site and/or its binding site, while the effector domain able to mediate its effect on gene expression (e.g., up-regulation of gene expression by a transcription activation factor, cleavage of a nucleic acid sequence by a nuclease or methylation of a nucleic acid sequence or nucleotide).
(33) A functional fragment of a protein, polypeptide or nucleic acid is a protein, polypeptide or nucleic acid whose sequence is not identical to the full-length protein, polypeptide or nucleic acid, yet retains the same function as the full-length protein, polypeptide or nucleic acid. A functional fragment can possess more, fewer, or the same number of residues as the corresponding native molecule, and/or can contain one or more amino acid or nucleotide substitutions. Methods for determining the function of a nucleic acid (e.g., coding function, ability to hybridize to another nucleic acid) are well-known in the art. Similarly, methods for determining protein function are well-known. For example, the DNA-binding function of a polypeptide can be determined, for example, by filter-binding, electrophoretic mobility-shift, or immunoprecipitation assays. DNA cleavage can be assayed by gel electrophoresis or other methods known in the art.
(34) The CRISPR/Cas System
(35) The Type II CRISPR (exemplified by Cas9) is a well characterized system and carries out targeted DNA double-strand break in four sequential steps. First, two non-coding RNA, the pre-crRNA array and tracrRNA, are transcribed from the CRISPR locus. Second, tracrRNA hybridizes to the repeat regions of the pre-crRNA and mediates the processing of pre-crRNA into mature crRNAs containing individual spacer sequences. Third, the mature crRNA:tracrRNA complex directs Cas9 to the target DNA via Watson-Crick base-pairing between the spacer on the crRNA and the protospacer on the target DNA next to the protospacer adjacent motif (PAM), an additional requirement for target recognition. Finally, Cas9 mediates cleavage of target DNA to create a double-stranded break within the protospacer.
(36) In type II CRISPR/Cas systems, crRNAs are produced using a different mechanism where a trans-activating RNA (tracrRNA) complementary to repeat sequences in the pre-crRNA, triggers processing by a double strand-specific RNase III in the presence of the Cas9 protein. Cas9 is then able to cleave a target DNA that is complementary to the mature crRNA however cleavage by Cas 9 is dependent both upon base-pairing between the crRNA and the target DNA, and on the presence of a short motif in the crRNA referred to as the PAM sequence (protospacer adjacent motif) (see Qi et al. (2013) Cell 152:1173). In addition, the tracrRNA must also be present as it base pairs with the crRNA at its 3 end, and this association triggers Cas9 activity.
(37) Type II CRISPR/Cas systems can be delivered to target sites using guide RNA. These guide RNA are referred to as single-guide RNA (gRNA) that contain the hairpin normally formed by the annealing of the crRNA and the tracrRNA. In certain embodiments, Cas protein may be a functional derivative of a naturally occurring Cas protein. A functional derivative of a native sequence polypeptide is a compound having a qualitative biological property in common with a native sequence polypeptide. Functional derivatives include, but are not limited to, fragments of a native sequence and derivatives of a native sequence polypeptide and its fragments, provided that they have a biological activity in common with a corresponding native sequence polypeptide. A biological activity contemplated herein is the ability of the functional derivative to hydrolyze a DNA substrate into fragments. The term derivative encompasses both amino acid sequence variants of polypeptide, covalent modifications, and fusions thereof. Examples of guide sequences for HSV-1 are provided below:
(38) TABLE-US-00002 ICP4-G1 (SEQIDNO:8) GCGGTGGCCGGCCGCGACGCCACG; Target(gRNA+ PAM) (SEQIDNO:9) GCGGTGGCCGGCCGCGACGCCACGGGCCGCTT; ICP4-G2 (SEQIDNO:10) GCCGCGGCCGGAGGGACCCGCGGG; Target(gRNA+ PAM) (SEQIDNO:11) CCCGCGGCCGGAGGGACCCGCGGGCCCCGCTT; ICP4-G3 (SEQIDNO:12) GGGGGGCCCTGCCGCCGGCGCCGC; Target(gRNA+ PAM) (SEQIDNO:13) CGGGGGCCCTGCCGCCGGCGCCGCCCGGGATT; ICP0-G1 (SEQIDNO:14) GGGGTCAGGTACCGCGGGGCGAAC; Target(gRNA+ PAM) (SEQIDNO:15) AGGGTCAGGTACCGCGGGGCGAACCGCTGATT; ICP0-G2 (SEQIDNO:16) GGCGTCACGCCCACTATCAGGTAC; Target(gRNA+ PAM) (SEQIDNO:17) GGCGTCACGCCCACTATCAGGTACACCAGCTT.
(39) The term Cas polypeptide encompasses a full-length Cas polypeptide, an enzymatically active fragment of a Cas polypeptide, and enzymatically active derivatives of a Cas polypeptide or fragment thereof. Suitable derivatives of a Cas polypeptide or a fragment thereof include but are not limited to mutants, fusions, covalent modifications of Cas protein or a fragment thereof.
(40) Cas proteins and Cas polypeptides may be obtainable from a cell or synthesized chemically or by a combination of these two procedures. The cell may be a cell that naturally produces Cas protein, or a cell that naturally produces Cas protein and is genetically engineered to produce the endogenous Cas protein at a higher expression level or to produce a Cas protein from an exogenously introduced nucleic acid, which nucleic acid encodes a Cas that is same or different from the endogenous Cas. In some case, the cell does not naturally produce Cas protein and is genetically engineered to produce a Cas protein.
(41) The CRISPR/Cas system can also be used to inhibit gene expression. For example, a catalytically inactive Cas9 (i.e., a Cas9 lacking endonuclease activity) generates a DNA recognition complex that can specifically interfere with transcriptional elongation, RNA polymerase binding, or transcription factor binding when co-expressed with a guide RNA. This system, called CRISPR interference (CRISPRi), can efficiently repress expression of targeted genes. Additionally, Cas proteins have been developed which comprise mutations in their cleavage domains to render them incapable of inducing a DSB, and instead introduce a nick into the target DNA (Cas9 nicking enzyme).
(42) A polynucleotide can be introduced into a cell as part of a vector molecule having additional sequences such as, for example, replication origins, promoters and genes encoding antibiotic resistance or other marker genes. Marker genes include, but are not limited to, sequences encoding proteins that mediate antibiotic resistance (e.g., ampicillin resistance, neomycin resistance, G418 resistance, puromycin resistance), sequences encoding colored or fluorescent or luminescent proteins (e.g., green fluorescent protein, enhanced green fluorescent protein, red fluorescent protein, luciferase), and proteins which mediate enhanced cell growth and/or gene amplification (e.g., dihydrofolate reductase). Epitope tags include, for example, one or more copies of FLAG, His, myc, Tap, HA or any detectable amino acid sequence.
(43) The fusion proteins and CRISPR/Cas systems disclosed herein can be delivered in vivo or ex vivo by any suitable means. For example, any vector system may be used including, but not limited to, plasmid vectors, retroviral vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors; herpesvirus vectors and adeno-associated virus vectors, etc. (see, for example, U.S. Pat. Nos. 6,534,261; 6,607,882; 6,824,978; 6,933,113; 6,979,539; 7,013,219; and 7,163,824, each of which is hereby incorporated by reference herein in its entirety). Furthermore, it will be apparent that any of these vectors may comprise one or more of the sequences needed for treatment. Thus, when one or more fusion protein or CRISPR/Cas system are introduced into the cell, the fusion proteins and/or CRISPR/Cas system may be carried on the same vector or on different vectors. When multiple vectors are used, each vector may comprise a sequence encoding one or fusion protein or CRISPR/Cas system.
(44) Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids into cells (e.g., mammalian cells) and target tissues. Non-viral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. Methods of non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA.
(45) In situations in which transient expression is preferred, adenoviral based systems can be used. Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and high levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system. Adeno-associated virus (AAV) vectors are also used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures. Construction of recombinant AAV vectors are generally known to those skilled in the art.
(46) Recombinant adeno-associated virus vectors (rAAV) are a promising alternative gene delivery systems based on the defective and nonpathogenic parvovirus adeno-associated type 2 virus. All vectors are derived from a plasmid that retains only the AAV 145 bp inverted terminal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery due to integration into the genomes of the transduced cell are key features for this vector system. Other AAV serotypes, including AAV1, AAV3, AAV4, AAV5, AAV6, AAV8, AAV9 and AAVrh10, and all variants thereof, can also be used in accordance with the present invention.
(47) Gene therapy vectors can be delivered in vivo by administration to an individual subject, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion) or topical application.
(48) Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions available, as described below (see, e.g., Remington's Pharmaceutical Sciences, 17th ed., 1989).
(49) Viruses causing latent infections: The majority of viruses that cause latent infections are of the family Herpesviridae. These include, and are not limited to, herpes simplex virus (HSV)-1, HSV-2, varicella zoster virus (VZV), Epstein-Barr virus (EBV), CMV, human herpesvirus (HHV)-6, HHV-7 and Kaposi's sarcoma-associated herpesvirus (KSHV/HHV)-8. Other examples of viruses that cause latent infections include JC and BK virus (from the family Polyomaviridae), adenovirus (Adenoviridae) and parvovirus and adeno-associated virus (AAV; Parvoviridae). Thus, the subject disclosure seeks to provide methods of treating such viral infections comprising the administration of fusion proteins or CRISPR/Cas systems disclosed herein.
(50) The terms treat, treating, treatment and various grammatical variants thereof refer to reducing the frequency of reactivation events for treated subjects/patients. In some embodiments, it may be possible to eliminate the recurrence of reactivation episodes entirely.
(51) Thus, a further aspect of the invention relates to the treatment of latent viral infections using TALEN(s) or TALTAD(s). Thus, in this aspect of the invention, TALEN(s) are administered to a subject having a latent viral infection in an amount effective to either bind and mutagenize/inactivate (or cause the degradation) of latent viral episomes or integrated viral genomes within a cell) or TALTAD(s) are administered to a subject having a latent viral infection in an amount effective drive the viral episome or integrated viral genome from a dormant state into one of productive replication. Where TALTAD(s) are administered to drive expression of the viral episome or integrated viral genome into productive replication, the subject is also treated with an antiviral drug, such as acyclovir, that blocks viral replication at the stage of viral DNA synthesis. Latent viral infections suitable for treatment in accordance with this disclosure include, but are not limited to, herpes simplex virus (HSV)-1, HSV-2, varicella zoster virus (VZV), Epstein-Barr virus (EBV), CMV, human herpesvirus (HHV)-6, HHV-7, Kaposi's sarcoma-associated herpesvirus (KSHV/HHV)-8, JC and BK virus (from the family Polyomaviridae), adenovirus (Adenoviridae), parvovirus and adeno-associated virus (AAV; Parvoviridae).
(52) Yet another aspect of the invention provides methods for treatment of latent viral infections comprising the administration of a Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas system to cleave latent viral episomes in vivo or in vitro. There are two distinct elements to the (CRISPR)/Cas system. These are: (1) a guide RNA (gRNA) and (2) an endonuclease (e.g., a Cas nuclease such as Cas9). The gRNA/Cas9 complex base-pairs with a target sequence in episomal or genomic DNA. Thus, Cas9 is directed to bind and cleave specific DNA sequences using a short gRNA. In certain embodiments, the guide sequences can bind to any desired nucleic acid sequence found in the genome of a virus causing latent infection. For HSV viruses, preferred genes include
(53) AAV is a small ssDNA virus that has been extensively employed as a gene therapy vector, owing to advantages including its broad cellular tropism, prolonged transduction in dividing and non-dividing cells, and lack of pathogenicity or affinity for insertional mutagenesis. We are able to generate AAV viral vector stocks with titers of 10.sup.13 infectious units per mL, and we have established a facile and non-invasive AAV delivery protocol enacted via topical delivery at the peripheral epithelium. Through this method, transduction can be achieved in 98% of all sensory neurons in the dorsal root ganglia of mice, or >80% of trigeminal ganglia neurons of rabbits, demonstrating that AAV vectors can strongly transduce within the latent HSV reservoir in either model. Similarly to HSV, AAV uses fast axonal transport to travel with precision from the epithelia to the ganglia, and thus it is expected that this delivery scheme will sidestep both the neutralization of vector by the humoral immune response as well as the need for high vector doses, both of which are limiting problems for AAV-mediated gene therapy efforts against other conditions.
(54) Efficient delivery of a transgene to the sensory neurons from the periphery involves the preparation of the peripheral tissue surface and delivery of the AAV vector in such a way that gives the AAV vector access to the nerve termini that are present just under the surface of the epithelium, mucosal or ocular surface. The specific preparation is directed by the type of epithelial surface where the vector is to be applied. For mucosal epithelial surfaces (including but not limited to oral, ocular, anal and genital) the surface is mildly abraded or scratched. This can be accomplished, for example, with either with: 1) a sharp needle (bevel-side facing up) in a cross-hatched pattern with a minimum of 3 cross hatches in each direction, or 2) an emery board or other sand-paper-like surface. For mucosal epithelial surfaces this treatment only penetrates several cell layers to expose the nerve termini. For cornified epithelial surfaces (including but not limited to the skin of the lips, face, buttocks, and non-mucosal genital surfaces), the cornified layers are removed first by abrasion (e.g., with an emery board or sand-paper), and the exposed epithelial surfaces are subsequently scratched or abraded to expose the underlying nerve termini. Following these treatments, the AAV vector is applied and allowed to adsorb for a period of time (e.g., for 20-40 minutes). An alternative method of delivering the AAV vector to the nerve termini is to inject a small volume (0.01-0.05 mL) of the concentrated vector stock intradermally under the skin, mucosal epithelium or cornea (intrastromal inoculation). The vector is then able to enter sensory neurons and mediate its effect.
(55) The following non-limiting embodiments are also provided:
(56) 1. A non-naturally occurring fusion protein comprising a TAL binding domain that binds to a target gene of a latent virus and an effector domain, wherein said fusion protein modulates the target gene of the latent virus;
(57) 2. The fusion protein of embodiment 1, wherein the TAL binding domain binds to viral polymerase genes, viral genes associated with processing and packaging of viral DNA and/or genes associated the replication of the viral genome;
(58) 3. The fusion protein of embodiment 1 or 2, wherein the target gene is an HSV-1 or HSV-2 gene;
(59) 4. The fusion protein of embodiment 3, wherein said target gene is selected from ICP27, ICP0, ICP4, UL-5, UL7, UL30 and/or UL25;
(60) 5. The fusion protein of embodiments 1-4, wherein said effector domain is a transcription activator, repressor protein, nuclease, endonuclease, topoisomerase, ligase, integrase, recombinase, resolvase, methylase, acetylase, demethylase or deacetylase;
(61) 6. The fusion protein of embodiment 5, wherein said effector domain is selected from Mmel, Colicin-E7 (CEA7_ECOLX), EndA, Endo I (END1_ECOLI), Human Endo G (NUCG HUMAN), Bovine Endo G (NUCG_BOVIN), R.HinPI I, l-Basl, I-Bmol, l-Hmul, l-Tev-l, l-Tevll, l-Tevlll, l-Twol, R.Mspl, R.Mval, NucA, NucM, Vvn, Vvn_CLS, Staphylococcal nuclease (NUC_STAAU), Staphylococcal nuclease (NUC_STAHY), Micrococcal nuclease (NUC_SHIFL), Endonuclease yncB, Endodeoxyribonuclease I (ENRN_BPT7), Metnase, Nb.BsrDI, BsrDI A, Nt.BspD6l (R.BspD6l large subunit), ss.BspD6l (R.BspD6l small subunit), R.PIel, Mlyl, Alwl, Mva1269l, Bsrl, Bsml, Nb.BtsCI, Nt.BtsCI, RlBtsl, R2.Btsl, BbvCI subunit 1, BbvCI subunit 2, BpulOI alpha subunit, BpulOI beta subunit, Bmrl, Bfil, 1-Crel, hExol (EX01JHUMAN), Yeast Exol (EX01_YEAST), E. coli Exol, Human TREX2, Mouse TREX1, Human TREX1, Bovine TREX1, Rat TREX1, Human DNA2, Yeast DNA2 (DNA2_YEAST), VP16, RBBP8, p53 or a fragment comprising amino acids 1-42, NFAT, NF-B, or E1A;
(62) 7. A fusion protein of embodiments 1-6, wherein said TAL binding domain comprises:
(63) TABLE-US-00003 (SEQIDNO:19) NN-HD-NN-HD-NI-NI-NG-NG-NN-HD-NI-NG-HD-HD-NI-NN- NN; (SEQIDNO:20) NN-HD-NI-NG-NN-HD-NI-HD-HD-NN-HD-NG-NG-HD-NG-NN- HD; (SEQIDNO:21) NN-NN-HD-HD-NH-HD-HD-NI-HD-HD-NH-NH-HD-HD-NH-NG- NH-NI-HD-NN; (SEQIDN:22) HD-NN-HD-HD-NH-HD-NH-HD-HD-HD-NH-HD-HD-NH-NH-HD- HD-HD-NI-NN; (SEQIDNO:23) NN-NN-NN-NI-HD-NN-HD-NN-HD-NN-NN-HD-HD-NI-NG; (SEQIDNO:24) NN-NN-HD-NI-NN-NI-NG-NN-NN-HD-NN-HD-NN-NN-NI-NG- NN; (SEQIDNO:25) NNHDNNHDNININGNGNNHANINGHDHDNINN NN; (SEQIDNO:26) NNHDNINGNNHDNIHDHDNNHDNGNGHDNGNN HD; (SEQIDNO:27) NNNNHDHDNNHDHDNIHDHDNNNNHDHDNNNG NNNIHDNN; (SEQIDNO:28) HDNNHDHDNNHDNNHDHDHDNNHDHDNNNNHD HDHDNINN; (SEQIDNO:29) NNNNNGHDNINNHDNINNNNNININNHDHDHD NGNGHDNG; or (SEQIDNO:30) NNNNHDHDNINGNNNINNHDHDNNHDHDNN.
(64) 8. A polynucleotide encoding one or more fusion protein of embodiments 1-7;
(65) 9. A pharmaceutical composition comprising a fusion protein of embodiments 1-7 and a pharmaceutically acceptable carrier and, optionally an anti-viral agent;
(66) 10. The pharmaceutical composition of embodiment 9, wherein said composition comprises an anti-viral agent;
(67) 11. A targeted nuclease comprising a guide RNA sequence bound to an endonuclease;
(68) 12. The targeted nuclease of embodiment 11, wherein said endonuclease is a bacterial CAS endonuclease;
(69) 13. The targeted nuclease of embodiment 11, wherein said endonuclease is a CAS9 endonuclease;
(70) 14. The targeted nuclease of embodiment 13, wherein said CAS9 endonuclease is a Neisseria meningitidis Cas9 endonuclease;
(71) 15. The targeted nuclease of embodiments 11-14, wherein said gRNA sequence targets viral polymerase genes, viral genes associated with processing and packaging of viral DNA and/or genes associated the replication of the viral genome or producing viral RNAs during latency;
(72) 16. The targeted nuclease of embodiment 15, wherein the target gene is an HSV-1 or HSV-2 gene;
(73) 17. The targeted nuclease of embodiment 16, wherein said target gene is selected from ICP27, ICP0, ICP4, UL-5, UL7, UL30 and/or UL25;
(74) 18. The targeted nuclease of embodiment 11, wherein said gRNA sequence is selected from:
(75) TABLE-US-00004 ICP4-G1 (SEQIDNO:8) GCGGTGGCCGGCCGCGACGCCACG; Target(gRNA+ PAM) (SEQIDNO:9) GCGGTGGCCGGCCGCGACGCCACGGGCCGCTT; ICP4-G2 (SEQIDNO:10) GCCGCGGCCGGAGGGACCCGCGGG; Target(gRNA+ PAM) (SEQIDNO:11) CCCGCGGCCGGAGGGACCCGCGGGCCCCGCTT; ICP4-G3 (SEQIDNO:12) GGGGGGCCCTGCCGCCGGCGCCGC; Target(gRNA+ PAM) (SEQIDNO:13) CGGGGGCCCTGCCGCCGGCGCCGCCCGGGATT; ICP0-G1 (SEQIDNO:14) GGGGTCAGGTACCGCGGGGCGAAC; Target(gRNA+ PAM) (SEQIDNO:15) AGGGTCAGGTACCGCGGGGCGAACCGCTGATT; ICP0-G2 (SEQIDNO:16) GGCGTCACGCCCACTATCAGGTAC; Target(gRNA+ PAM) (SEQIDNO:17) GGCGTCACGCCCACTATCAGGTACACCAGCTT.
(76) 19. A vector encoding a fusion protein or a targeted nuclease according to any one of embodiments 1-7 or 11-18;
(77) 20. The vector of embodiment 19, wherein said vector is an AAV vector;
(78) 21. The vector of embodiment 20, wherein said AAV vector comprises a promoter operably linked to a gene encoding a fusion protein or targeted nuclease of embodiments 1-7 or 9-17;
(79) 22. The vector of embodiment 21, wherein said promoter is a chicken beta-actin/CMV IE (CBA) promoter;
(80) 23. The vector of any one of embodiments 19-22, wherein said promoter comprises the sequence:
(81) TABLE-US-00005 (SEQIDNO:18) 5tcgaggtgagccccacgttctgcttcactctccccatctcccccccct ccccacccccaattttgtatttatttattttttaattattttgtgcagcg atgggggcggggggggggggggggcgcgcgccaggcggggcggggcgggg cgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcaga gcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcgg ccctataaaaagcgaagcgcgcggcgggcg3;
(82) 24. A method of treating a latent viral infection comprising the administration of a vector, fusion protein or targeted nuclease as set forth in any of embodiments 1-7 or 11-23 to a subject having a latent viral infection;
(83) 25. The method of embodiment 24, wherein said method comprises the administration of a vector encoding said fusion protein or targeted nuclease to a subject;
(84) 26. The method of embodiment 25, wherein said vector is an AAV vector;
(85) 27. The method of embodiments 24-25, wherein a fusion protein according to embodiments 1-7 is administered to a subject;
(86) 28. The method of embodiment 24, wherein said method comprises the administration of a fusion protein or targeted nuclease as set forth in any of embodiments 1-7 or 11-18 to a subject;
(87) 29. The method of embodiment 24, wherein said fusion protein is a TALEN;
(88) 30. The method of embodiment 24, wherein said fusion protein is a TALTAD;
(89) 31. The method of embodiment 30, wherein said TALTAD comprises a TAL binding domain and an effector domain that is a transcription activator;
(90) 32. The method of embodiment 31, wherein said transcription activator is VP16;
(91) 33. The method of embodiments 31-32, wherein said method further comprises the administration of an anti-viral agent to said subject;
(92) 34. The method of embodiment 33, wherein said anti-viral agent is trifluordine, docosanol, acyclovir, ganciclovir, famciclovir, penciclovir, valacyclovir or a combination thereof;
(93) 35. The method of any one of embodiments 24-34, wherein said fusion protein or targeted nuclease is administered topically;
(94) 36. The method of any of embodiments 24-35, wherein said vector encodes a comprising a TAL binding domain that binds to a target gene selected from viral polymerase genes, viral genes associated with processing and packaging of viral DNA and/or genes associated the replication of the viral genome;
(95) 37. The method of embodiment 36, wherein the target gene is an HSV-1 or HSV-2 gene;
(96) 38. The method of embodiment 37, wherein said target gene is selected from ICP27, ICP0, ICP4, UL-5, UL7, UL30 and/or UL25;
(97) 39. The method of embodiment 36, wherein said TAL binding domain comprises:
(98) TABLE-US-00006 (SEQIDNO:19) NN-HD-NN-HD-NI-NI-NG-NG-NN-HD-NI-NG-HD-HD-NI-NN- NN; (SEQIDNO:20) NN-HD-NI-NG-NN-HD-NI-HD-HD-NN-HD-NG-NG-HD-NG-NN- HD; (SEQIDNO:21) NN-NN-HD-HD-NH-HD-HD-NI-HD-HD-NH-NH-HD-HD-NH-NG- NH-NI-HD-NN; (SEQIDN:22) HD-NN-HD-HD-NH-HD-NH-HD-HD-HD-NH-HD-HD-NH-NH-HD- HD-HD-NI-NN; (SEQIDNO:23) NN-NN-NN-NI-HD-NN-HD-NN-HD-NN-NN-HD-HD-NI-NG; (SEQIDNO:24) NN-NN-HD-NI-NN-NI-NG-NN-NN-HD-NN-HD-NN-NN-NI-NG- NN; (SEQIDNO:25) NNHDNNHDNININGNGNNHANINGHDHDNINN NN; (SEQIDNO:26) NNHDNINGNNHDNIHDHDNNHDNGNGHDNGNN HD; (SEQIDNO:27) NNNNHDHDNNHDHDNIHDHDNNNNHDHDNNNG NNNIHDNN; (SEQIDNO:28) HDNNHDHDNNHDNNHDHDHDNNHDHDNNNNHD HDHDNINN; (SEQIDNO:29) NNNNNGHDNINNHDNINNNNNININNHDHDHD NGNGHDNG; or (SEQIDNO:30) NNNNHDHDNINGNNNINNHDHDNNHDHDNN.
(99) 40. The method of embodiment 24, wherein said vector encodes a targeted nuclease that targets viral polymerase genes, viral genes associated with processing and packaging of viral DNA and/or genes associated the replication of the viral genome;
(100) 41. The method of embodiment 40, wherein said target gene is an HSV-1 or HSV-2 gene;
(101) 42. The method of embodiment 41, wherein said target gene is selected from ICP27, ICP0, ICP4, UL-5, UL7, UL30 and/or UL25;
(102) 43. The method of embodiment 42, wherein said gRNA sequence is selected from:
(103) TABLE-US-00007 ICP4-G1 (SEQIDNO:8) GCGGTGGCCGGCCGCGACGCCACG; Target(gRNA+ PAM) (SEQIDNO:9) GCGGTGGCCGGCCGCGACGCCACGGGCCGCTT; ICP4-G2 (SEQIDNO:10) GCCGCGGCCGGAGGGACCCGCGGG; Target(gRNA+ PAM) (SEQIDNO:11) CCCGCGGCCGGAGGGACCCGCGGGCCCCGCTT; ICP4-G3 (SEQIDNO:12) GGGGGGCCCTGCCGCCGGCGCCGC; Target(gRNA+ PAM) (SEQIDNO:13) CGGGGGCCCTGCCGCCGGCGCCGCCCGGGATT; ICP0-G1 (SEQIDNO:14) GGGGTCAGGTACCGCGGGGCGAAC; Target(gRNA+ PAM) (SEQIDNO:15) AGGGTCAGGTACCGCGGGGCGAACCGCTGATT; ICP0-G2 (SEQIDNO:16) GGCGTCACGCCCACTATCAGGTAC; Target(gRNA+ PAM) (SEQIDNO:17) GGCGTCACGCCCACTATCAGGTACACCAGCTT.
(104) All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification. Following are examples which illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.
Example 1
TALEN/TALTAD Activity
(105) Our initial validation experiments have focused on cell culture models of HSV-1 infection. To demonstrate that the TALENs are active in live cells, we generated indicator constructs containing the HSV-1 target sites embedded between a fragment of the HIV-1 rev gene and the green fluorescent protein (gfp) gene. The HSV-1 fragment is inserted in frame such that gfp is properly translated from the construct, but such that cleavage should disrupt gfp expression by either destabilizing the indicator plasmid or by generating a frame-shift mutation. As shown in
(106) To extend these data, we also measure expression of the Rev-GFP protein by Western blot analysis. As shown in
(107) We also investigated the ability of ICP0-specific TALENs to inhibit lytic HSV-1 replication in cell culture. 293T cells were transfected with one of the ICP0-specific TALEN pairs and the cells were then infected with 0.01 pfu per cell of HSV-1. Transfection efficiency was 80%, and we noted a close to 80% inhibition in HSV-1 DNA replication in the transfected cells, with an accompanying significant drop in virus replication (
(108) While our initial TALEN constructs certainly demonstrate proof-of-concept that these can effectively target the HSV genome in vitro, latent genomes in vivo are packaged into nucleosomes, much of which becomes associated with heterochromatin. As other DNA-binding proteins are less effective in acting on heterochromatized template compared to euchromatized template, we expect TALENs to exhibit greater activity on regions of viral DNA associated with lower levels of heterochromatic histone marks. To this end we have successfully profiled latent HSV-1 genomes from sensory ganglia of infected mice and identified key lytic gene regions that are significantly under-enriched in the heterochromatin mark trimethylated H3K27 (H3K27me3). A few such regions occur in the coding region of the major transactivator ICP4 (
(109) To confirm that the TALE-VP16 fusions are functional, we generated indicator constructs bearing either the HSV-1 ICP0 promoter or the HSV-1 ICP4 promoter linked to the firefly luciferase (Fluc) indicator gene, and then co-transfected these indicators in duplicate with either the ICP0-specific or ICP4-specific TALE-VP16, or alternatively VP16 without fusion to a TAL effector. As shown in
Example 2
CRISPR/Cas Systems are Effective Against Viral Episomes
(110) To demonstrate that CRISPR/Cas systems can be effective against viral DNA episomes we employed the prototypic Streptococcus Pyogenes Cas9. SPCas9 cleavage is highly specific and comparable to that shown earlier with TALENs in
(111) In
(112) The inhibitory effect of the observed fragmentation of circular viral DNA episomes is potentially further enhanced by the high likelihood of simultaneous mutagenesis of essential viral genes resulting from error prone dsDNA break repair. Because a single Cas9 protein can bind to several specific DNA targets, depending on the presence of appropriate gRNAs, one could also potentially cleave the HSV-1 genome at two or more places simultaneously to generate lethal viral deletion mutants. Moreover, the CRISPR/Cas system uses endonucleases that are active as single polypeptides, rather than as heterodimeric proteins as for the TALENs. As a result, sequences encoding a single Cas9 protein and one or more gRNA cassettes can be packaged into a viral vector, such as an Adeno associated virus (AAV) based vector or a vector based on an attenuated HSV-1 derivative, and subsequently used to transduce cells in vivo leading to the cleavage of one or several specific viral DNA targets in these cells, depending on the identity on the guide RNAs co-expressed by the vector.
(113) The SPCas9 gene is too large to package in an AAV vector, so we have selected Type II CRISPR/Cas9 system from Neisseria meningitidis (NMCas9; SEQ ID NO: 1), which is a minimal but complete RNA guided nuclease (RGN), for more intensive analysis in the context of AAV-based vectors. This highly specific and effective dsDNA endonuclease can be employed to destroy HSV-1 episomes and/or mutationally inactivate HSV-1 open reading frames both in culture and in vivo, initially in mice but later potentially in human patients.
(114) To further minimize total RGN size for AAV packaging, we have optimized the NMCas9 nuclease and the gRNA expression cassettes by using small but effective promoters (
(115) To facilitate delivery of the NMCas9 payload to cells in vivo, we have designed and constructed the AAV vector that is schematically represented in
Example 3
ICP4 Targeted TALEN Activity
(116) CTRL TALEN, assembled using the Joung Lab Real Assembly TALEN kit, contains an RVD-array targeted to CMV sequences not present in the virus or cell genomes. The RA-TALEN ICP0 pair, assembled using the Joung Lab Real Assembly TALEN kit, contain RVD arrays targeted to the first exon of the ICP0 protein (see X in ICP0 gene,
(117) TABLE-US-00008 RA-TALENICP0(left): (SEQIDNO:25) NNHDNNHDNININGNGNNHANINGHDHDNINNNN; RA-TALENICP0(right): (SEQIDNO:26) NNHDNINGNNHDNIHDHDNNHDNGNGHDNGNNHD.
(118) The GG-TALEN ICP4_nt1nn pair, assembled using the Voytas Lab Golden Gate Assembly TALEN kit and Yamamoto Lab TALEN Accessory Pack (acquired via Addgene), contain RVD arrays targeted to a coding region of the ICP4 protein corresponding to a functional domain essential for ICP4s ability to transactivate other HSV genes (see right X in ICP4 gene,
(119) TABLE-US-00009 GG-TALENICP4_nt1nn(left): (SEQIDNO:27) NNNNHDHDNNHDHDNIHDHDNNNNHDHDNNNGNN NIHDNN; GG-TALENICP4_nt1nn(right): (SEQIDNO:28) HDNNHDHDNNHDNNHDHDHDNNHDHDNNNNHDHD HDNINN.
(120) The GG-TALEN ICP4_nb2nn pair, assembled using the Voytas Lab Golden Gate Assembly TALEN kit and Yamamoto Lab TALEN Accessory Pack (acquired via Addgene), contain RVD arrays targeted to a coding region of the ICP4 protein corresponding to a functional domain essential for ICP4s DNA-binding ability (see left X in ICP4 gene,
(121) TABLE-US-00010 GG-TALENICP4_nb2nn(left): (SEQIDNO:29) NNNNNGHDNINNHDNINNNNNININNHDHDHD NGNGHDNG; GG-TALENICP4_nb2nn(right): (SEQIDNO:30) NNNNHDHDNINGNNNINNHDHDNNHDHDNN.
(122) Cleavage Efficiency of a Panel of ICP4-targeted TALENs. 293T cells were seeded in triplicate into a 96-well plate containing a transfection solution composed of Lipofectamine 2000 and a mixture of plasmid DNA composed of a pair of TALEN expression vectors, a reporter containing a TALEN target sequence inserted into the firefly luciferase gene, and a reporter containing the renilla luciferase gene (to allow for normalization between wells with respect to transfection efficiency). 24 hours after transfection, luciferase signal was assayed using the Promega Dual-Glo Luciferase Assay System according to the manufacturer's protocol. In cases where the sequence in the firefly luciferase gene is recognized by the TALEN pair in a given reaction (column identified as 2) for each TALEN pair, successful cleavage and subsequent repair of the firefly luciferase gene results in increased relative luciferase signal (y-axis, arbitrary units) compared to wells transfected with a given reporter alone (column identified as 1) for each TALEN pair. Each ICP4-targeted TALEN pair was also mixed in a reaction containing an ICP0 target in the firefly luciferase gene to assay for off-target amplication of luciferase (column identified as 4) for each TALEN pair compared to background levels of the ICP0 target reporter (column identified as 3) for each TALEN pair. TALEN pairs used in subsequent assays are labeled; other data sets are for ICP4-targeted TALEN pairs with alternative RVD composition.
(123) Antiviral Action of HSV1-Targeted TALENs. 293T cells seeded into a 24-well plate were transfected in triplicate using a plasmid mixture containing 233 ng left-binding TALEN expression vector, 233 ng right-binding TALEN expression vector, and about 33 ng pIRES-EGFP-puro (enabling visualization of transfection efficiency and puromycin selection of transfected cells) via the TransIT-293 transfection reagent according to the manufacturer's protocol. Fluorescence microscopy 24 hours after transfection revealed a lower estimate of near 30% transfection efficiency. 48 hours after transfection, cells were infected with HSV-1 strain 17syn+ at an MOI of 1.12 hours after infection, cells and medium were harvested from each well, subjected to two freeze/thaw cycles, and concentration of shown (see
(124) It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and the scope of the appended claims. In addition, any elements or limitations of any invention or embodiment thereof disclosed herein can be combined with any and/or all other elements or limitations (individually or in any combination) or any other invention or embodiment thereof disclosed herein, and all such combinations are contemplated with the scope of the invention without limitation thereto.