Recombinant Escherichia coli for high efficiency production of fructosylated chondroitin and method for making thereof
10508279 ยท 2019-12-17
Assignee
Inventors
- Jing Wu (Wuxi, CN)
- Quan Zhang (Wuxi, CN)
- Liming LIU (Wuxi, CN)
- Xiulai CHEN (Wuxi, CN)
- Jia LIU (Wuxi, CN)
- Qiuling LUO (Wuxi, CN)
Cpc classification
C12P19/24
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C12P19/26
CHEMISTRY; METALLURGY
International classification
C12P19/26
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
Abstract
The present invention relates to the field of biotechnology engineering. It provides a recombinant Escherichia coli that can produce fructosylated chondroitin with high yields and the method for constructing the recombinant strain. The present invention discloses a method for constructing an expression plasmid pETM6R1-RBS-glmM-GGGS-glmS that contains a glmM and a glmS gene under regulation of ribosome binding sites. The recombinant plasmid was transformed into E. coli K4 to obtain a recombinant E. coli strain ZQ33 that can produce fructosylated chondroitin up to 3.99 g.Math.L.sup.1 by fed-batch fermentation in a 5-L fermentor, which was increased by 108.90% compared to that of the wild type strain.
Claims
1. A recombinant E. coli that can produce fructosylated chondroitin with high efficiency, wherein said recombinant E. coli overexpresses phosphoglucosamine mutase and aminotransferase.
2. The recombinant E. coli of claim 1, wherein the amino acid sequence of said phosphoglucosamine mutase is set forth in SEQ ID NO:1, and the amino acid sequence of said aminotransferase is set forth in SEQ ID NO:2.
3. The recombinant E. coli of claim 1, wherein said recombinant E. coli contains an phosphoglucosamine mutase gene (glmM) and an aminotransferase gene (glmS) connected to an expression vector through RBS1, wherein the nucleotide sequence of said RBS1 is set forth in SEQ ID NO: 5.
4. The recombinant E. coli of claim 3, wherein said glmM is fused and co-expressed with said glmS.
5. The recombinant E. coli of claim 3, wherein said RBS1, said glmM, a linker GGGS and said glmS are fused together sequentially, which is inserted into said expression vector whose nucleotide sequence is set forth in SEQ ID NO:7, and wherein the nucleotide sequence of said GGGS linker is set forth in SEQ ID NO:6.
6. The recombinant E. coli of claim 1, wherein the host strain of said recombinant E. coli. is E. coli K4 ATCC23502.
7. A method for constructing a recombinant E. coli of claim 1, comprises the following steps: 1) obtaining the gene of phosphoglucosamine mutase whose amino acid sequence is set forth in SEQ ID NO:1, and the gene of aminotransferase whose amino acid sequence is set forth in SEQ ID NO:2; 2) obtaining the gene of RBS1 whose nucleotide sequence is set forth in SEQ ID NO:5, and the DNA sequence of a linker GGGS whose nucleotide sequence is set forth in SEQ ID NO:6; 3) obtaining the expression vector pETM6R1 whose nucleotide sequence is set forth in SEQ ID NO:7; 4) fusing said RBS1, said phosphoglucosamine mutase gene, said linker GGGS and said aminotransferase gene together sequentially, and inserting the fused gene into said expression vector pETM6R1 to obtain a recombinant plasmid pETM6R1-RBS1-glmM-GGGS-glmS; 5) introducing said recombinant plasmid pETM6R1-RBS1-glmM-GGGS-glmS into E. coli K4 ATCC23502 to obtain said recombinant E. coli that produces high yield fructosylated chondroitin.
8. A method of producing fructosylated chondroitin by batch fermentation, comprising cultivating the recombinant E. coli of claim 1 in said batch fermentation, wherein fermentation medium used in said batch fermentation contains 10 g.Math.L.sup.1 glycerol, 1 g.Math.L.sup.1 soy peptone, 2 g.Math.L.sup.1 KH.sub.2PO.sub.4, 10 g.Math.L.sup.1 K.sub.2HPO.sub.4, 0.1 g.Math.L.sup.1 MgCl.sub.2, 1 g.Math.L.sup.1 (NH.sub.4).sub.2SO.sub.4, and 0.5 g.Math.L.sup.1 sodium citrate; and feeding medium of said batch fermentation contains 400 g.Math.L.sup.1 glycerol, 40 g.Math.L.sup.1 soy peptone; and wherein said batch fermentation is performed at 37 C. using a fed-batch fermentation strategy.
9. The method of claim 8, wherein said batch fermentation is performed in a 5-L bioreactor with an inoculation ratio of 5-15%; inducer of 0.05-0.15 mmol IPTG is added to induce the expression of exogenous genes at 5-10 hr after inoculation; and the inducing temperature is 35-38 C.
10. The method of claim 8, wherein said batch fermentation is performed in a 5-L bioreactor with a feeding medium under a pH-stat control strategy, wherein feeding starts when there is a sudden increase of dissolved oxygen and pH exceeds 7.0 during the fermentation, and the feeding stops when the pH falls below 7.0.
Description
BRIEF DESCRIPTION OF FIGURES
(1)
(2)
(3)
(4)
EXAMPLES
(5) The following examples are intended for illustration purpose only, and not intended to limit the scope of the invention.
(6) Materials and Methods:
(7) Information of related nucleotide sequences:
(8) (1) SEQ ID NO:1 is the amino acid sequence of phosphoglucosamine mutase from Escherichia coli.
(9) (2) SEQ ID NO:2 is the amino acid sequence of aminotransferase from Escherichia coli.
(10) (3) SEQ ID NO:3 is the nucleotide sequence of a regulatory DNA fragment RBS1-glmM-GGGS-glmS.
(11) (4) SEQ ID NO:4 is the nucleotide sequence of inducible promoter pTrc.
(12) (5) SEQ ID NO:5 is the nucleotide sequence of RBS1.
(13) (6) SEQ ID NO:6 is the nucleotide sequence of GGGS.
(14) (7) SEQ ID NO:7 is the nucleotide sequence of vector of pETM6R1.
(15) The glucuronic acid of the fructosylated chondroitin was determined by the modified carbazole assay. The concentration of fructosylated chondroitin was 2.88 times of that of the glucuronic acid.
Example 1: Construction of the Fusion Fragment RBS1-glmM-GGGS-glmS
(16) The phosphoglucosamine mutase glmM gene and the aminotransferase glmS gene were cloned from Escherichia coli K4 (ATCC23502). The E. coli K4 was inoculated into 25 mL Luria-Bertani (LB) liquid medium and cultured at 37 C., 200 rpm, for 12 hr. The bacterial cells were then harvested and the genomic DNA of the E. coli cells was extracted using a bacterial genomic DNA extraction kit.
(17) Based on published genomic sequence database, primer pairs RH-glmM-S1/RH-glmM-A (SEQ ID NO:8/SEQ ID NO:9) and RH-glmS-S/RH-glmS-A (SEQ ID NO:10/SEQ ID NO:11) were designed for amplification of the glmM and the glmS gene, respectively. Using the extracted genomic DNA as template, the E. coli. glmM and the glmS gene were amplified by standard PCR.
(18) The fusion fragment RBS1-glmM-GGGS-glmS was obtained via the standard fusion PCR amplification system using the glmM-S1/RH-glmS-A primer pair and the obtained glmM and glmS gene sequence as templates.
(19) The nucleotide sequences of primers RH-glmM-S1 and RH-glmM-A, RH-glmS-S and RH-glmS-A were shown as follows (from 5 to 3):
(20) TABLE-US-00001 RH-glmM-S1: AAGAGGGCGCGGCAGAGAAGGAGGAGGTAAGAAAT GAGTAATCGTAAATATTTCGGT RH-glmM-A: CGCCAACAATTCCACACATAGAACCACCACCAACGGCTTTTACTG CATCG RH-glmS-S: CGATGCAGTAAAAGCCGTTGGTGGTGGTTCTATGTGTGGAATTGTT GGCG RH-glmS-A:
AGTTACTCAACCGTAACCGATTTTG
(21) The fusion fragment RBS1-glmM-GGGS-glmS was purified using agarose gel electrophoresis and the purified product was ligated into the pMD19 T vector. The ligation system (total 10 L) contained: 5 L ligase solution, 4 L the fusion fragment, 1 L The pMD19 T vector. The ligation reaction was performed at 16 C. overnight. The ligated product was transformed into JM109 competent cells. Single colonies were picked up and positive transformants were confirmed by PCR amplification and DNA sequencing analysis. The successfully constructed recombinant plasmid was named as pMD19-RBS1-glmM-GGGS-glmS.
Example 2: Construction of the Fusion Fragment RBS2-glmM-GGGS-glmS
(22) Fusion fragment RBS2-glmM-GGGS-glmS and RBS3-glmM-GGGS-glmS were obtained by the same method of Example 1, with the primer RH-glmM-S 1 substituted by RH-glmM-S2 (SEQ ID NO:12) and RH-glmM-S3 (SEQ ID NO:13), respectively.
(23) The nucleotide sequences of primers RH-glmM-S2 and RH-glmM-S3 were shown as follows (from 5 to 3):
(24) TABLE-US-00002 RH-glmM-S2(SEQIDNO:12): TATTTAAACTATCACGACATAAGGAGGTC AGGGATGAGTAATCGTAAATATTTCGGT RH-glmM-S3(SEQIDNO:13):
CGACATAACGTTAGAAAAGAATAAGG TAGTTTCATGAGTAATCGTAAATATTTCGGT
Example 3: Construction of the Expression Plasmid pETM6R1
(25) Promoter pTrc was cloned from vector pTrcHisA by standard PCR amplification using primer pair pTrcHisA-S/pTrcHisA-A (SEQ ID NO:14/SEQ ID NO:15).
(26) The nucleotide sequences of primer pair pTrcHisA-S and pTrcHisA-A were shown as follows (from 5 to 3):
(27) TABLE-US-00003 pTrcHisA-S(SEQIDNO:14): C ATCGAGATCGATCTCGATCCCGCGAAATT AATACGACTCACTATATTGACAATTAATCATCCGG pTrcHisA-A(SEQIDNO:15):
GGTAATTTTTAATAATAAAGTTAATCG
(28) The pTrc gene fragment and pETM6 vector were digested by restriction enzymes AvrII and XbaI, respectively. The digested fragments were purified by agarose gel electrophoresis and the purified fragments were used for ligation. The ligation products was transformed into JM109 competent cells and positive recombinant plasmid was verified by sequencing. The recombinant vector was designated as pETM6R1.
Example 4: Construction of the Recombinant Plasmid pETM6R1-RBS1-glmM-GGGS-glmS
(29) The E. coli JM109 strain that carried recombinant plasmid pMD19-RBS1-glmM-GGGS-glmS was incubated in 25 mL LB media at 37 C., 200 rpm for 12 hours, and the plasmid DNA was extracted by a plasmid DNA extraction kit. In Example 1, XbaI and XhoI restriction site were introduced into the RH-glmM-S1 and the RH-glmS-A primer, respectively. The recombinant plasmid pMD19-RBS1-glmM-GGGS-glmS and pETM6R1 were digested with XbaI and XhoI. The digested fragments were purified and ligated together. Then, the obtained ligation product was transformed into JM109 competent cells. The positive recombinant cells were verified by sequencing, and the recombinant plasmid was designated as pETM6R1-RBS1-glmM-GGGS-glmS. Finally, extracted recombinant plasmid was transformed into E. coli K4, and the positive recombinant E. coli K4 carrying pETM6R1-RBS1-glmM-GGGS-glmS was designated as ZQ33.
Example 5: Construction of the Recombinant Plasmid pETM6R1-RBS2-glmM-GGGS-glmS, pETM6R1-RBS3-glmM-GGGS-glmS
(30) Using the same method as described in Example 4, fusion fragment RBS2-glmM-GGGS-glmS and RBS3-glmM-GGGS-glmS were insert into pETM6R1 to obtain plasmid pETM6R1-RBS2-glmM-GGGS-glmS and pETM6R1-RBS3-glmM-GGGS-glmS, respectively. The recombinant plasmids were transformed into E. coli K4 and the recombinant strains carrying plasmid pETM6R1-RBS2-glmM-GGGS-glmS and pETM6R1-RBS3-glmM-GGGS-glmS were designated as ZQ31 and ZQ32, respectively.
Example 6: Fermentation of the Recombinant Strains in a Shake Flask
(31) Recombinant strains ZQ31, ZQ32 and ZQ33 were fermented, respectively. Single colonies of the recombinant strains were grown in a LB media with 10 mg.Math.mL.sup.1 ampicillin at 37 C., 200 rpm for 10 hr. The seed cultures were transferred to a shake flask with a 1% inoculation volume. The cultivation in shake flask was performed on a rotary shaker at 200 rpm at 37 C. The inducer isopropyl -D-1-thiogalactopyranoside (IPTG, 0.04 mmol) was added to induce the expression of exogenous glmM and glmS gene after 5 hr incubation at 37 C. Fermentation samples were periodically withdrawn to determine the fructosylated chondroitin production. The sample was centrifuged at 10,000 rpm for 15 min, the fermentation supernatant was transferred to another tube, and 3 volumes ethanol was added to precipitate fructosylated chondroitin at 4 C. for 10 hr. The precipitate was collected by centrifugation (10,000 rpm for 10 min) and dissolved in ultra-pure water. The suspension was used for determination of the yield of fructosylated chondroitin.
(32)
Example 7: Fed-Batch Fermentation of the Recombinant Strain ZQ33 in a 5-L Fermentor
(33) Recombinant strain ZQ33 was selected for Fed-batch fermentation, which was performed in a 5-L bioreactor by a pH-stat control mode. The initial volume was 2.5 L and the inoculation ratio was 10%. The temperature was maintained at 37 C. and the pH was controlled at 7.0 by aqueous ammonia. The medium for cultivation contained 10 g.Math.L.sup.1 glycerol, 1 g.Math.L.sup.1 soy peptone, 2 g.Math.L.sup.1 KH.sub.2PO.sub.4, 10 g.Math.L.sup.1 K.sub.2HPO.sub.4, 0.1 g.Math.L.sup.1 MgCl.sub.2, 1 g.Math.L.sup.1 (NH.sub.4).sub.2SO.sub.4, and 0.5 g.Math.L.sup.1 sodium citrate. The feeding medium contained 400 g.Math.L-1 glycerol, and 40 g.Math.L-1 soy peptone. The fed-batch fermentation strategy uses fermentation pH as a feeding indicator. When glycerol was consumed during the fermentation and dissolved oxygen level showed a sharp increase, which leads to the pH increase to over 7 and triggers the start of feeding. When the culture pH drops to below 7, the feeding process stops. This feeding strategy continues until the end of the fermentation. IPTG was added to induce the expression of exogenous genes after 5 hr of fermentation. The yield of fructosylated chondroitin was measured every 4 hr as described in Example 6.
(34) While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention, which is defined by the appended claims. All figures, tables, appendices, patents, patent applications and publications, referred to above, are hereby incorporated by reference.