Artificial cell membrane comprising supported lipid bilayer connected with probes having controllable mobility and method for analyzing interaction between molecules using the same
10509030 ยท 2019-12-17
Assignee
- Seoul National University R&Db Foundation (Seoul, KR)
- BIONANO HEALTH GUARD RESEARCH CENTER (Daejeon, KR)
Inventors
Cpc classification
C12Q2563/131
CHEMISTRY; METALLURGY
C12Q2563/131
CHEMISTRY; METALLURGY
C12Q2565/519
CHEMISTRY; METALLURGY
G01N33/554
PHYSICS
C12Q2565/519
CHEMISTRY; METALLURGY
G01N33/54373
PHYSICS
C12N5/0697
CHEMISTRY; METALLURGY
International classification
Abstract
Disclosed herein are an artificial cell membrane including a supported lipid bilayer (SLB) including a substrate and mobility-decreased metal particles bonded onto the substrate; an analysis device or kit including the artificial cell membrane and examining the interactions between molecules, in which one molecule is bonded to the surface of a mobility-decreased metal particle bonded to the artificial cell membrane and the other molecule is bonded to the surface of a mobility-increased metal particle bonded to a lipid at a low valency; a method of examining the interactions between molecules using the analysis device; a kit for quantitative or qualitative analysis of a target material including the artificial cell membrane by plasmonic scattering measurements; and a multiple analysis kit capable of detecting a plurality of target materials using a plurality of metal particles having different plasmonic scattering wavelengths and/or having mobility on a supported lipid bilayer. According to the artificial cell membrane including a supported lipid bilayer containing metal particles attached thereto, the fluidity of the metal particles on the lipid can be controlled by adjusting the number of ligands bonded to the metal particles. Therefore, target molecules for analyzing the interactions therebetween on two types of metal particles having different fluidity are introduced onto the artificial cell membrane, thereby monitoring the movements of the metal particles through plasmonic scattering so as to analyze the interactions between the target molecules. In this case, multiple analysis of simultaneously detecting and quantifying a plurality of target materials using the artificial cell membrane of the present invention, plasmonic scattering wavelengths, and a plurality of particles having different fluidity can be performed.
Claims
1. An artificial cell membrane, comprising: a substrate; and a supported lipid bilayer (SLB) disposed on the substrate, wherein the supported lipid bilayer, within which some or all lipids are capable of shifting position, comprises a plurality of molecules of a first lipid bound with a first ligand and a third lipid bound with a plurality of molecules of a third ligand which is the same as or different from the first ligand, a first metal particle comprising a second ligand specifically binding to the first ligand at a density of 100 to 100,000/m.sup.2, wherein the first metal particle is bound to at least two of the plurality of molecules of the first lipids through the binding between the first ligand and the second ligand, so as to decrease the mobility of the first metal particle in the supported lipid layer to 0 to 0.510.sup.8 cm.sup.2/s, and a second metal particle comprising a fourth ligand specifically binding to the third ligand, wherein the second metal particle binds to at least one of the plurality of molecules of the third lipids through the interaction between the third ligand and the fourth ligand, and has higher mobility than that of the first metal particle.
2. The artificial cell membrane according to claim 1, wherein the first metal particle is bound to the lipid by antigen-antibody interaction, ligand-receptor interaction, nucleic acid hybridization, chelation, covalent bonding, or electrostatic bonding between the first ligand and the second ligand.
3. The artificial cell membrane according to claim 1, wherein the first metal particle generates plasmonic scattering at an intrinsic wavelength depending on the size or shape thereof.
4. The artificial cell membrane according to claim 1, wherein the first lipid bound with the first ligand is included in an amount of 0.05 to 0.5 mol % with respect to the total amount of lipids in the supported lipid bilayer.
5. The artificial cell membrane according to claim 1, wherein the supported lipid bilayer further comprises a second lipid bound with polyethylene glycol in an amount of 1 to 10 mol % with respect to the total amount of lipids in the supported lipid bilayer.
6. An analysis device for examining the interaction between molecule A and molecule B using an artificial cell membrane, comprising: the artificial cell membrane of claim 1, molecule A, and molecule B, wherein the molecule A bound to the surface of the first metal particle in the artificial cell membrane; wherein the molecule B bound to the surface of the second metal particle in the artificial cell membrane, and wherein the second metal particle having higher mobility approaches the first metal particle and is then confined to the first metal particle by the interaction between the molecule A and the molecule B.
7. The analysis device according to claim 6, wherein the interaction between the molecule A and the molecule B is selected from the group consisting of antigen-antibody interaction, ligand-receptor interaction, nucleic acid hybridization, chelation, covalent bonding, and electrostatic bonding.
8. The analysis device according to claim 6, wherein the first metal particle is fixed on the supported lipid bilayer, and the second metal particle may carry out 2-dimensional free Brownian motion on the supported lipid bilayer in the absence of the interaction between the molecule A and the molecule B.
9. A method, comprising examining the interaction between the molecule A and the molecule B using the analysis device of claim 6.
10. The method of claim 9, wherein the position of the first metal particle and the change in scattering intensity or wavelength due to the first metal particle are monitored.
11. The method of claim 9, wherein the real-time movement trajectory or speed of the second metal particle, or the change in signal intensity or wavelength due to the second metal particle is monitored.
12. The method of claim 10, wherein the monitoring is accomplished by measuring the plasmonic scattering of the first metal particle.
13. The method of claim 11, wherein the monitoring is accomplished by measuring the plasmonic scattering of the second metal particle.
14. The method of claim 9, wherein the density of particles and the collision frequency between the first metal particles and the second metal particles are increased by additionally applying force in a predetermined direction.
15. An analysis kit for determining the binding between molecule A and molecule B by determining the distance between a first metal particle and a second metal particle from plasmonic scattering signals of the first metal particle bound with the molecule A and the second metal particle bound with the molecule B on an artificial cell membrane, comprising: an artificial cell membrane comprising a substrate, a supported lipid bilayer which is disposed on the substrate and within which some or all lipids are capable of shifting position, and a plurality of molecules of a first lipid bound with a first ligand and a plurality of molecules of a third lipid bound with a third ligand, which is the same as or different from the first ligand, as a part of the supported lipid bilayer; a first metal particle comprising a second ligand specifically binding to the first ligand, wherein the first metal particle is able to bind to at least one of the plurality of molecules of the first lipids through the interaction between the first ligand and the second ligand; and a second metal particle comprising a fourth ligand specifically binding to the third ligand, wherein the second metal particle is able to bind to at least one of the plurality of molecules of the third lipids through the interaction between the third ligand and the fourth ligand, and has higher mobility than that of the first metal particle.
16. A kit for qualitative or quantitative analysis of a target material capable of binding to molecule A and molecule B which is used to determine the binding between the molecule A and the molecule B by determining the distance between a first metal particle and a second metal particle from plasmonic scattering signals of the first metal particle bound with the molecule A and the second metal particle bound with the molecule B on an artificial cell membrane, comprising: an artificial cell membrane comprising a substrate, a supported lipid bilayer which is disposed on the substrate and within which some or all lipids are capable of shifting position, and a plurality of molecules of a first lipid bound with a first ligand and a plurality of molecules of a third lipid bound with a third ligand, which is the same as or different from the first ligand, as a part of the supported lipid bilayer; a first metal particle comprising a second ligand specifically binding to the first ligand, wherein the first metal particle is able to bind to at least one of the plurality of molecules of the first lipids through the interaction between the first ligand and the second ligand; the molecule A which is bound to the surface of the first metal particle and which is specifically bound to a portion of the target material; a second metal particle comprising a fourth ligand specifically binding to the third ligand, wherein the second metal particle is able to bind to at least one of the plurality of molecules of the third lipids through the interaction between the third ligand and the fourth ligand, and has higher mobility than that of the first metal particle; and the molecule B which is bound to the surface of the second metal particle in the artificial cell membrane and which is specifically bound to another portion of the target material on which the molecule A is not bound.
17. The kit according to claim 16, wherein the first metal particle is fixed on the supported lipid bilayer, and the second metal particle may carry out 2-dimensional free Brownian motion on the supported lipid bilayer in the absence of the interaction through the target material between the molecule A and the molecule B.
18. The kit according to claim 17, wherein the kit measures the changes in the intensity or wavelength of a plasmonic scattering signal or both at the position of the first metal particle where the second metal particle having higher mobility approaches the first metal particle due to the interactions between the molecule A and the target material and between the molecule B and the target material in the presence of the target material.
19. A multiple analysis kit for qualitative or quantitative analysis of target materials in the amount of i.sub.maxm.sub.max by the plasmonic scattering measurement, wherein i.sub.max and m.sub.max are maximum values of the following variables i and m, respectively, and are each independently an integer of 1 or more, but not i.sub.max=m.sub.max=1, comprising: an artificial cell membrane comprising a substrate, a supported lipid bilayer which is disposed on the substrate and within which some or all lipids are capable of shifting positions, and a plurality of molecules of a lipid I.sub.i bound with a plurality of molecules of a ligand I.sub.i and a lipid M.sub.m bound with a ligand M.sub.m, wherein the ligand I.sub.i and the ligand M.sub.m may be the same as or different from each other; a metal particle I.sub.i comprising a ligand I.sub.i specifically binding to the ligand I.sub.i, wherein the metal particle I.sub.i is bound to at least one of the plurality of molecules of the lipid I.sub.i through the interaction between the ligands I.sub.i and the ligand I.sub.i; a molecule A.sub.i which is bound to the surface of the metal particle I.sub.i and is specifically bound to a portion of the target material; a metal particle M.sub.m comprising a ligand M.sub.m specifically binding to the ligand M.sub.m, wherein the metal particle M.sub.m is bound to at least one of the plurality of molecules of the lipid M.sub.m through the interaction between the ligand M.sub.m and the ligand M.sub.m, and has higher mobility compared to that of the metal particle I.sub.i; and a molecule B.sub.m which is bound to the surface of the metal particle M.sub.m in the artificial cell membrane and which is specifically bound to another portion of the target material on which the molecule A is not bound, wherein the series of the metal particles I.sub.i have different plasmonic scattering wavelengths from one another, and the series of the metal particles M.sub.m have different plasmonic scattering wavelengths from one another.
Description
DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
BEST MODE FOR INVENTION
(40) According to an aspect, the present invention provides an artificial cell membrane, comprising: a substrate; and a supported lipid bilayer (SLB) disposed on the substrate, wherein the supported lipid bilayer, within which some or all lipids are capable of shifting position, comprises a first lipid bound with a first ligand, and a first metal particle comprising a second ligand specifically binding to the first ligand at a density of 100 to 100,000/m.sup.2 is bound to at least two of the first lipids through the binding between the first ligand and the second ligand, so as to decrease the mobility of the first metal particle in the supported lipid layer to 0 to 0.510.sup.8 cm.sup.2/s. The mobility of the first metal particle in the supported lipid layer may be decreased to 0 to 0.110.sup.8 cm.sup.2/s, and more preferably 0 to 0.0110.sup.8 cm.sup.2/s, which cannot be detected by a microscope. When the mobility thereof is 0, the lipids are completely stopped.
(41) As used herein, the term substrate, which is a support capable of supporting a lipid bilayer, may be a solid substrate having a predetermined shape. Preferably, the substrate may be a transparent solid substrate made of glass, gold, silver, platinum, or TiO.sub.2, or may be a transparent solid substrate made of an acrylic polymer, such as poly(methylmethacrylate) (PMMA), polyethylene (PE), polypropylene (PP), polystyrene (PS), polyethersulfone (PESX) polycycloolefin (PCO), polyurethane, or polycarbonate (PC). Further, as the substrate, a substrate coated with a coating agent that can be hydrated, such as cellulose, may also be used as long as the fluidity of the lipid bilayer introduced onto a coating film can be maintained.
(42) As used herein, the term supported lipid layer may be an in via-assembled lipid bilayer surrounding a quasi-cell structure, such as a natural cell membrane or a nucleus, may be a kind of model lipid bilayer made of synthetic or natural lipid, and may be anchored to a solid substrate to have improved stability. Therefore, the supported lipid layer may be used as a characterization tool that cannot be used in a bulk solution. The supported lipid layer, unlike a vesicle or cell membrane obtained by combining lipid bilayers in the form of a round closed cell, is a planar structure formed on a solid substrate. Therefore, only the upper surface of the lipid bilayer is exposed to a free solution. Such a configuration has advantages and disadvantages in relation to the study of lipid bilayers. The main advantage of the supported lipid bilayer is stability. The supported lipid bilayer (SLB) is not seriously damaged even when it is exposed to rapid flow or vibration. In the supported lipid bilayer (SLB), unlike a black lipid membrane (BLM), which is another model lipid bilayer, the presence of holes does not destroy the entire bilayer. Due to such stability, SLB experiments can be carried out for several weeks to several months, whereas BLM experiments are restricted to several hours. The SLB is also advantageous in that it cannot be used for freely floating specimens or can be used as a characterization tool for providing low resolution.
(43) The most obvious example of these advantages is that mechanical probing techniques requiring the direct physical interaction with specimens can be used. In order to image the phase separation of lipids, the formation of membrane-penetrating nanopores leading to single protein molecule adsorption, and the assembling of protein with sub-nanometer accuracy without dye labeling, atomic force microscopy (AFM) is used. Recently, in order to directly detect the mechanical properties of a single lipid bilayer, AFM is used in performing power spectroscopy on individual membrane proteins. Since the surface of a cell or vesicle is relatively soft and changes depending on time, the aforementioned study may be difficult or impossible without using SLB.
(44) Meanwhile, even in various modern fluorescence spectroscopies, a rigidly-supported planar surface is required. Evanescent field methods, such as total internal reflection fluorescence microscopy (TIRF) and surface plasmon resonance (SPR), can measure the bonding of an analyte and the optical properties of a bilayer with high sensitivity, but can be operated only when a specimen is supported on a substrate having an optical function. Examples of other methods applicable only to the supported bilayer include fluorescence interference contrast microscopy (FLIC) and reflection interference contrast microscopy (RICM).
(45) Generally, SLB is not directly in contact with the surface of a substrate, and is separated from the substrate through a very thin water layer. The size and properties of the water layer depend on the material of the substrate and the kind of lipid, but the thickness of the water layer is generally about 1 nm with respect to a zwitterionic lipid supported on silica, which is the most widely used experimental system. Since the water layer is very thin, extensive hydrodynamic coupling exists between the supported lipid bilayer and the substrate, and thus the supported lipid bilayer has a lower diffusion coefficient than a free lipid bilayer. A part of the lipids in SLB may be completely fixed. The fraction of the fixed lipids in SLB is 1% to 5%.
(46) Generally, the artificial cell membrane may be a lipid membrane-containing system for imitating the in vivo cell membrane system in a test tube, the system being artificially fabricated in order to study the cell membrane-related phenomena occurring on the surface of cells in vivo, such as cell membrane proteins, membrane-penetrating proteins, and interactions related thereto. Examples of the model systems providing the artificial cell membrane include a black lipid membrane (BLM), a supported lipid bilayer (SLB), a tethered bilayer lipid membrane (tBLM), a vesicle, a micelle, a bicelle, and a nanodisc. In particular, SLB is a useful means for identifying biophysical cell membrane phenomena. SLB can control mobility and activity due to the change of chemical composition as well as environmental variables, such as pH and temperature.
(47) Each of the first ligand and the second ligand may be selected from antigens, antibodies, ligands, receptors, chelates, DNA, RNA, aptamers, chemical molecules specifically binding to each other, and combinations thereof, but is not limited thereto. For example, when the first ligand is an antibody, the second ligand may be an antigen specific to the antibody. Further, the second ligand may be bonded with the first ligand by a sandwich immune reaction for forming an antibody-antigen-antibody complex by combining all antibodies additionally bonded to the antigen with the antibody. As another example, the first ligand and the second ligand may be DNA fragments having sequences complementary to each other, and in this case, the first ligand and the second ligand may be bonded to each other by the hybridization of these DNA fragments.
(48) In an exemplary embodiment of the present invention, biotin, as the first ligand, is attached to other binding sites containing no streptavidin by using biotin as the first ligand and using a conjugate of biotin and streptavidin (receptor of biotin) as the second ligand.
(49) The first metal particle may be bonded to a lipid by specific antigen-antibody bonding, ligand-receptor bonding, DNA hybridization, chelation, covalent bonding, electrostatic bonding, or chemical reaction bonding, between the first ligand on the lipid and the second ligand on the surface of a metal particle. In this case, the first metal particle may include the plurality of second ligands, and one metal particle may be bonded to a plurality of lipid particles depending on density. In this case, the movement of an individual lipid molecule on a lipid membrane is free. However, in the case where the plurality of lipid molecules are bonded to one metal particle, the movement thereof is relatively restricted because the plurality of lipid molecules bonded to one metal particle should be moved organically on a 2-dimensional plane in order to move the metal particle.
(50) According to an exemplary embodiment of the present invention, as valency per unit particle increases, the movement of particles is remarkably retarded. As a result, the movement of particles is almost not captured, as the particles are fixed, when the valency reaches 486 (refer to
(51) The method of monitoring the movement of the first metal particle is not particularly limited, but preferably, may be performed by measuring plasmonic scattering.
(52) Preferably, the second ligand includes a thiol group, and may be covalently bonded to the first metal particle through the thiol group.
(53) The artificial cell membrane of the present invention is characterized in that metal particles are bonded thereto as probes. Since the metal particles are stable compared to particles, such as vesicles composed of a polymer or a lipid bilayer, they are not decomposed even under conditions of relatively low or high salt concentration or pH so as to maintain their forms and physical properties. Further, preferably, since the metal particles include plasmonic metal particles and exhibit plasmonic scattering, the metal particles themselves can be detected without additional probes, and do not cause flickering or extinction so as to perform stable monitoring for a long period of time. Moreover, since the metal particles can directly form strong covalent bonds together with a functional group, such as a thiol group, ligands can be provided to the surface thereof using this function group.
(54) Preferably, the first lipid bound with the first ligand may be included in an amount of 0.05 mol % to 0.5 mol % with respect to the total amount of lipids in the supported lipid bilayer. The first ligand is a site at which particles are disposed by bonding with the second ligand. When the ratio of the amount of the first lipid bound with the first ligand to the total amount of lipids is less than 0.05 md/%, the frequency of the first ligands on the surface of lipid becomes low, that is, the distance between the first ligands increases, and thus one particle is bonded to the plurality of first ligands, so it is difficult for particles to be fixed on the lipid bilayer. When the ratio thereof is more than 0.5 mol %, the density of the first ligands becomes excessively high, the aggregation of first particles including the second ligands specifically binding to the first ligands is caused so as to inhibit the movement of the particles or make the analysis thereof difficult.
(55) Preferably, the supported lipid bilayer may further include a second lipid bound with polyethylene glycol (PEG) in an amount of 1 mol % to 10 mol % with respect to the total amount of lipids. In this case, the average molecular weight of polyethylene glycol is preferably 500 to 2000, but is not limited thereto. For example, when PEG having a relatively low molecular weight of 2000 or less is used, even though the content of the second lipid bound with PEG is increased to a level of 10 mol %, which is a somewhat higher content than the content used to stabilize a lipid bilayer, a screening effect is not caused, the lipid layer is physically stabilized to increase the lifespan and stability of the lipid bilayer, and the nonspecific bonding between nanoparticles and between nanoparticles and the lipid bilayer is efficiently reduced to increase fluidity. However, when the molecular weight of PEG exceeds the above range or the content of the second lipid exceeds the above range, the approach of nanoparticles to a lipid membrane and/or the bonding between the first ligand and the second ligand may be inhibited by causing a screening effect, so it is preferable that the molecular weight of PEG used and the content of the second lipid bound with PEG are combined and selected appropriately.
(56) According to another aspect, the present invention provides an analysis device for examining the interaction between molecule A and molecule B using an artificial cell membrane, comprising: the artificial cell membrane, in which a supported lipid bilayer further comprises a third lipid bound with a third ligand which is the same as or different from the first ligand; the molecule A bound to the surface of the first metal particle in the artificial cell membrane; a second metal particle comprising a fourth ligand specifically binding to the third ligand, wherein the second metal particle binds to at least one of the third lipids through the interaction between the third ligand and the fourth ligand, and has higher mobility compared to that of the first metal particle; and the molecule B bound to the surface of the second metal particle in the artificial cell membrane, wherein the second metal particle having higher mobility approaches the first metal particle and is then confined to the first metal particle by the interaction between the molecule A and the molecule B.
(57) The fourth ligand may be the same as or different from the second ligand.
(58) Each of the molecule A and the molecule B may be selected from DNA, RNA, antigens, antibodies, ligands, chelates, receptors, aptamers, polymers, organic compounds, metal ions, and polypeptides.
(59) Therefore, the interaction between the molecule A and the molecule B to be examined by the analysis device of the present invention may be antigen-antibody bonding, ligand-receptor bonding, protein-protein bonding, nucleic acid hybridization, chelation, covalent bonding, or electrostatic bonding. The nucleic acid hybridization may include the hybridizations of DNA, RNA, PNA, and combinations thereof without limitation.
(60) The first metal particles are fixed on the supported lipid bilayer through the bonding with a plurality of lipids, and the second metal particles can perform 2-dimensional free Brownian motion on the supported lipid bilayer in the absence of the interaction between the molecule A and the molecule B.
(61) Therefore, when the stimulus due to the interaction between the molecule A on the first metal particle and the molecule B on the second metal particle, that is, the attractive force or repulsive force between the first metal particle and the second metal particles, is generated, the first metal particle may be fixed, and the second metal particle may be moved toward the first metal particle by attractive force or may be moved away from the first metal particle by repulsive force. Therefore, the interaction between the molecule A and the molecule B may be examined by observing the movement of the second metal particle relative to the fixed first metal particle.
(62) According to still another aspect, the present invention provides a method of examining the interaction between the molecule A and the molecule B using the analysis device.
(63) As described above, in the analysis device, the first metal particle is fixed on the plane of the supported lipid bilayer, and the second metal particle performs free Brownian motion as long as additional stimuli are not applied.
(64) Therefore, the position of the first metal particle and the change in scattering intensity or wavelength due to the first metal particle may be monitored.
(65) Further, the real-time movement trajectory or speed of the second metal particle, or the change in signal intensity or wavelength due to the second metal particle may be monitored.
(66) Preferably, the monitoring is performed by measuring the plasmonic scattering of the first metal particle and/or the second metal particle. Nanoparticles causing plasmonic scattering can enhance scattering signal through plasmonic coupling when the distance therebetween decreases, and scattering wavelengths are shifted to long wavelengths when the distance therebetween further decreases within a predetermined distance, that is, a plasmonic coupling distance. Therefore, when particles are far away from each other, the distance between the particles can be measured from the trajectory of the particles, and when the particles are closer to each other within a predetermined distance, the distance between the particles can be estimated from the intensity and wavelength of the measured scattering signal.
(67) In an exemplary embodiment of the present invention, gold nanoparticles labeled with complementary sequence DNA are used, and two or more DNAs are bonded to one gold nanoparticle, and thus the plurality of gold nanoparticles are closer to each other by the hybridization of DNAs. As a result, the number of the gold nanoparticles bonded to each other increases, and thus the gold nanoparticles are grown in order of dimers, trimers, and tetramers, so that scattering intensity increases stepwise, and scattering signals are continued for a long time. In contrast, the increase of signals is observed by transient non-specific interactions, but the corresponding signals are not continued even for several seconds. Therefore, it is ascertained that the increase of signals by non-specific interactions and the increase of signals by specific interactions are distinguished from each other (refer to
(68) This method is characterized in that the density of particles and the collision frequency of particles are increased by applying an additional force in a predetermined direction, thereby improving analytic sensitivity and shortening detection time. In this case, the applied force may be a magnetic field, an electric field, or a fluid flow, but is not limited thereto.
(69) According to still another aspect, the present invention provides analysis kit for determining the binding between molecule A and molecule B by determining the distance between a first metal particle and a second metal particle from plasmonic scattering signals of the first metal particle bound with the molecule A and the second metal particle bound with the molecule B on an artificial cell membrane, comprising: an artificial cell membrane comprising a substrate, a supported lipid bilayer which is disposed on the substrate and within which some or all lipids are capable of shifting position, and a first lipid bound with a first ligand and a third lipid bound with a third ligand, which is the same as or different from the first ligand, as a part of the supported lipid bilayer, a first metal particle comprising a second ligand specifically binding to the first ligand, wherein the first metal particle is able to bind to at least one of the first lipids through the interaction between the first ligand and the second ligand, and a second metal particle comprising a fourth ligand specifically binding to the third ligand, wherein the second metal particle is able to bind to at least one of the third lipids through the interaction between the third ligand and the fourth ligand.
(70) As described above, in order to examine the interaction between two molecules, it is preferable for the convenience of detection that an analysis device, which is configured such that the metal particle bonded with one molecule of the two molecules to be analyzed is fixed on the artificial cell membrane and the other molecule is bonded to the metal particle having relatively high mobility, is used. However, according to current optical detection techniques, since the particles freely moving on a lipid bilayer can be monitored, the individual particle can also be monitored even though these particles are able to move freely on the lipid bilayer because both molecule A and molecule B are bonded to the metal particle having high mobility. Therefore, this system can also be used as an analysis kit for examining the interaction between the molecule A and the molecule B. This analysis kit can also be applied to a commonly-known plasmonic scattering detecting system.
(71) According to still another aspect, the present invention provides a kit for qualitative or quantitative analysis of a target material capable of binding to molecule A and molecule B which is used to determine the binding between the molecule A and the molecule B by determining the distance between a first metal particle and a second metal particle from plasmonic scattering signals of the first metal particle bound with the molecule A and the second metal particle bound with the molecule B on an artificial cell membrane, comprising: an artificial cell membrane comprising a substrate, a supported lipid bilayer which is disposed on the substrate and within which some or all lipids are capable of shifting position, and a first lipid bound with a first ligand and a third lipid bound with a third ligand, which is the same as or different from the first ligand, as a part of the supported lipid bilayer, a first metal particle comprising a second ligand specifically binding to the first ligand, wherein the first metal particle is able to bind to at least one of the first lipids through the interaction between the first ligand and the second ligand; the molecule A which is bound to the surface of the first metal particle and which is specifically bound to a portion of the target material; a second metal particle comprising a fourth ligand specifically binding to the third ligand, wherein the second metal particle is able to bind to at least one of the third lipids through the interaction between the third ligand and the fourth ligand; and the molecule B which is bound to the surface of the second metal particle in the artificial cell membrane and which is specifically bound to another portion of the target material on which the molecule A is not bound.
(72) As described above, each of the target material, the molecule A, the molecule B, the first ligand and the second ligand may be selected from antigens, antibodies, ligands, receptors, chelates, DNA, RNA, aptamers, chemical molecules specifically binding to each other, and combinations thereof.
(73) Although not limited thereto, when the valency is adjusted such that the first metal particle is fixed on the supported lipid bilayer and the second metal particle can conduct 2-dimensional free Brownian motion on the supported lipid bilayer through the target material at the time of absence of the interaction between the molecule A and the molecule B, the relative movement of the second metal particle to the fixed first metal particle can be tracked so as to facilitate monitoring.
(74) In this case, the interactions between the molecule A and the target material and between the molecule B and the target material in the presence of the target material can be examined by measuring the changes in the intensity and/or wavelength of a plasmonic scattering signal at the position of the first metal particle, the changes being caused by the bonding between the molecule A and the target material and between the molecule B and the target material when the second metal particle having high mobility approaches the first metal particle.
(75) According to still another aspect, the present invention provides a multiple analysis kit for qualitative or quantitative analysis of target materials in the amount of i.sub.maxm.sub.max by the plasmonic scattering measurement (i.sub.max and m.sub.max are maximum values of the following variables i and m, respectively, and are each independently an integer of 1 or more, but not i.sub.max=m.sub.max=1), comprising: an artificial cell membrane comprising a substrate, a supported lipid bilayer which is disposed on the substrate and within which some or all lipids are capable of shifting positions, and a lipid I.sub.i bound with a ligand I.sub.i and a lipid M.sub.m bound with a ligand M.sub.m (herein, the ligand I.sub.i and the ligand M.sub.m may be the same as or different from each other); a metal particle I.sub.i comprising a ligand I.sub.i specifically binding to the ligand I.sub.i, wherein the metal particle I.sub.i is bound to at least one of the lipids I.sub.i through the interaction between the ligands I.sub.i and the ligand I.sub.i; a molecule A.sub.i which is bound to the surface of the metal particle I.sub.i and is specifically bound to a portion of the target material; a metal particle M.sub.m comprising a ligand M.sub.m specifically binding to the lipid M.sub.m, wherein the metal particle M.sub.m is bound to at least one of the lipids M.sub.m though the interaction between the ligand M.sub.m and the ligand M.sub.m; and a molecule B.sub.m which is bound to the surface of the metal particle M.sub.m in the artificial cell membrane and which is specifically bound to another portion of the target material on which the molecule A is not bound, wherein the series of the metal particles I.sub.i have different plasmonic scattering wavelengths from one another, and the series of the metal particles M.sub.m have different plasmonic scattering wavelengths from one another.
(76) In an exemplary embodiment of the present invention, gold/silver nanoparticles having different colors, that is, red, green, and blue colors, are prepared, and DNAs having a capture sequence and a complementary sequence and bonded onto a lipid bilayer are provided to the surface of the gold/silver nanoparticles at a predetermined rate to control the valency with the lipid bilayer, thereby providing six types of different metal particles, that is, metal particles fixed on the lipid bilayer and metal particles moving freely on the lipid bilayer. In addition, complementary sequence DNAs that can be bonded to some of nine types of miRNAa, which are used as target materials, are provided to the surface of the gold/silver nanoparticles (refer to
(77) According to still another aspect, the present invention provides a method of concentrating particles into a specific area of a fluid channel, comprising: preparing a supported lipid bilayer in the fluid channel, wherein the supported lipid bilayer comprises a first lipid bound with a first ligand, and some or all lipids are capable of shifting positions in the supported lipid bilayer, applying a first particle comprising a second ligand specifically binding to the first ligand onto the supported lipid bilayer, and transferring the first particles into the specific area of the fluid channel by applying a fluid flow in the fluid channel.
(78) If necessary, as the first particles, particles bound with genes or proteins may be used.
(79) When a fluid flow is applied to the fluid channel including the supported lipid layer including particles bonded onto a lipid through ligand binding, the particles can perform free Brownian motion on the supported lipid bilayer, and thus the particles move along the flow direction of fluid to be concentrated at a specific portion. Conventionally, as the method of concentrating the particles disposed on the lipid bilayer, methods of applying a stimulus, such as an electric field, have been used. However, when an electric field is applied, as exposure time increases, proteins or genes bonded to particles may be denatured, or the lipid bilayer itself may be destroyed, and thus experimental conditions, such as pH, temperature, and air bubble generation, may be changed. However, when the flow of fluid according to the present invention is used, the above disadvantages can be overcome.
(80) In an exemplary embodiment of the present invention, a flow channel is provided on a substrate, and holes are formed in both sides of an upper slide glass so as to allow fluid to flow in a predetermined direction. The lipid bilayer bound with gold or silver nanoparticles according to the present invention is formed in the flow channel, and the movement of the metal nanoparticles is monitored while adjusting the flow rate of fluid. The metal nanoparticles are freely moved and diffused before the flow of fluid is applied, but these metal nanoparticles start to move in the same direction as the flow of fluid while the flow of fluid is applied, and the movement of the metal nanoparticles is accelerated with the increase in the flow of fluid. Further, as the metal nanoparticles move in one direction, the density of the metal nanoparticles in the specific area increases, and scattering wavelengths are shifted by plasmonic coupling (refer to
MODE FOR INVENTION
(81) Hereinafter, the present invention will be described in more detail with reference to the following Examples. These Examples are set forth to illustrate the present invention, and the scope of the present invention is not limited thereto.
Example 1: Materials
(82) 1,2-Dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(cap biotinyl) sodium salt (biotinylated DOPE), and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-1000] ammonium salt (PEG-DOPE) were purchased from Avanti Polar Lipids (Alabaster, Ala., USA). Cy3-modified streptavidin (STV) was purchased from Molecular Probes (Eugene, Oreg. USA). Carboxymethyl polyethylene glycol (M.W. 5000) was purchased from Laysan Bio Inc. (Arab, Ala., USA). Bovine serum albumin (BSA), sodium dodecyl sulfate (SDS), and dithiothreitol (DTT) were purchased from Sigma-Aldrich (St. Louis, Mo., USA). A 0.15 M phosphate-buffered saline (PBS) solution was prepared by dissolving NaH.sub.2PO.sub.4, Na.sub.2HPO.sub.4, and NaCl (Sigma-Aldrich, St. Louis, Mo., USA) in deionized water (DI water), yielding a 10 mM phosphate buffer solution with 150 mM NaCl (pH 7.4). Further, 0.025 M PBS was prepared to contain 25 mM NaCl with the same reagents. Nanopure water with the minimum resistance (>18 M/cm) was used in all of the experiments. For vesicle preparation (vesicle extrusion), polycarbonate (PC) filters (Whatman, Fisher Scientific) with a pore diameter of 100 nm were used. Organic solvents such as chloroform, acetone, and ethanol were purchased from Duksan Pure Chemicals Co. Ltd. (Gyeonggi-do, South Korea). Sulfuric acid and hydrogen peroxide were purchased from Daejung Chemicals & Metals Co. Ltd. (Gyeonggi-do, South Korea). 50 nm gold nanoparticles and oligonucleotides were purchased from BBI Life Sciences (Cardiff, UK) and Integrated DNA Technology (Coralville, Iowa, USA), respectively. The target capture sequence for I-PNP (immobile PNP) is
(83) TABLE-US-00001 (SEQIDNO:1) 5-HS-(CH.sub.2).sub.6-PEG.sub.6-CTTTGAGCACATCCTTATCAATATT-3
and the SLB tethering sequence for I-PNP is
(84) TABLE-US-00002 (SEQIDNO:2) 5-HS-(CH.sub.2).sub.6-PEG.sub.6-CTTTGAGCACTGTTAGCGTGTGTGGAATTTTA AT-biotin-3'.
The target capture sequence for M-PNP (mobile PNP) is
(85) TABLE-US-00003 (SEQIDNO:3) 5-TAACAATAATCCCTCCACGAGTTTC-PEG.sub.6-(CH.sub.2).sub.3-SH-3
and the SLB tethering sequence for M-PNP (mobile PNP) is
(86) TABLE-US-00004 (SEQIDNO:4) 5-biotin-TAATTTTAAGGTGTGTGCGATTGTCACGAGTTTC-PEG.sub.6- (CH.sub.2).sub.3-SH-3.
The target sequence
(87) TABLE-US-00005 (SEQIDNO:5) 5-GAGGGATTATTGTTAAATATTGATAAGGAT-3.
The underlined parts of target capture sequences hybridize with the target DNA sequence. As the single base pair-mismatched DNA sequence, a target DNA sequence in which A is replaced by T was used. The non-complementary DNS sequence was
(88) TABLE-US-00006 (SEQIDNO:6) 5-CTGATTACTATTGCATCTTCCGTTACAACT-3.
Example 2: Preparation of Small Unilamellar Vesicle (SUV)
(89) A supported lipid bilayer (SLB) was formed on a cover glass by the diffusion of SIV containing 97.4 mol % of DOPC, 0.1 mol % of biotinylated DOPE, and 2.5 mol % of PEG-DOPE. A SUV solution was prepared by dissolving an appropriate amount of a lipid in chloroform. A lipid solution was evaporated in a 50 ml round-bottom flask using a rotary evaporator. A lipid film was completely dried under a stream of N.sub.2. The dried mixture was resuspended in DI water and subjected to three repetitive free-thaw cycles. The total lipid concentration was 2 mg/ml. The solution was extruded more than 21 times through a PC membrane with a pore diameter of 100 nm at 25 C. The resulting SUV solution was kept at 4 C. until use.
Example 3: Functionalization of Gold Plasmonic Nanoprobes Using DNA and Quantification of Biotin Valency
(90) Thiolated oligonucleotides were reduced by incubation with 100 mM PB (pH 8.0) for 2 h and separated by NAP-5 columns (GE Healthcare, Buckinghamshire, UK). For DNA functionalization, freshly reduced 4 M oligonucleotides were mixed with 50 M AuNPs of 50 nm and incubated at room temperature overnight. For I-PNP, the molar ratio of the SLB tethering sequence to the target capture sequence was 200:600 (mole fraction of SLB tethering sequence: 0.25). For M-PNP the molar ratio was 1:799 (mole fraction of SLB tethering sequence: 0.00125). The solution was then adjusted to yield 10 mM of phosphate buffer and 0.1% (wt/vol) SDS. The adjusted solution was further incubated in an orbital shaker for 30 min and six aliquots of 2 M NaCl were added by 0.05 M increments to obtain a final NaCl concentration of 0.3 M. After each addition of 2 M NaCl, the solution was heated at 55 C. for 10 min and incubated for 30 min at room temperature. The DNA-AuNP mixture was allowed to stand overnight at room temperature and the solution was then centrifuged (4500 rpm, 10 min). The supernatant was eliminated and the precipitate was redispersed in DI water (this procedure was repeated three times). The DNA-functionalized AuNP solution was kept at 4 C. until use. For quantification of the number of SLB tethering sequences per AuNP, the Cy3-labeled oligonucleotide-modified AuNPs were dissolved with a 30 mM KCN solution. Further, measurement of fluorescence emission intensity of Cy3 was performed on an Acton spectrometer (Spectra Pro, MA, USA) with a Xe lamp (500 W) as an excitation source.
Example 4: Preparation of SLB and Gold Plasmonic Nanoparticles Tethered to SLB
(91) Preparation of SLB and Au PNPs tethered to the SLB was conducted in a glass flow chamber. The glass flow chamber consists of top and bottom glass substrates which are separated from each other by a 100 m-thick thermoplastic spacer. Inlet and outlet holes were drilled on both ends of the top glass substrate. The top slide glass was pre-treated with 10 mg/ml BSA in 0.15 M BPS for 1 h to make it inert to SLB deposition. The bottom cover glass was cleaned by sonicating for 10 min in chloroform, acetone, and ethanol. After sonication, the cover glass was washed with DI water and dried by a stream of N.sub.2. Next, the bottom cover glass was pre-treated with 1 M NaOH for 1 h and then completely washed with DI water. The glass substrates were assembled with a sandwiched thermoplastic spacer by heating at 120 C. on a digital hot plate. The prepared SUV solution was mixed 1:1 v/v with 0.15 M PBS and introduced into the glass flow chamber through the inlet port. Approximately 70 l of the SUV solution was required to fill the flow channel. After 45 min of incubation at 25 C., excess and unfused SUVs were washed out with 200 l of DI water two times. 1 nM STV in a 0.15 M PBS solution was reacted with biotinylated SLB for 1 h after replacing DI water in the flow channel with PBS. Unreacted STV was washed out with 0.15 M PBS, and then the flow channel was filled with 0.025 M PBS. Next, 2 M of I-PNP and 15 M of M-PNP probes were introduced and reacted for 10 min. Unbound PNPs were removed and unreacted STV binding sites were quenched by washing with 0.025 M PBS containing 1 M of free biotins. After 15 min, the buffer was exchanged to 0.15 M PBS. Typically, this procedure resulted in SLB-tethered I-PNP and M-PNP at a ratio of 1:3.
(92) 4.1. Control and Quantification of Biotin Valency Per Gold Nanoparticle
(93) First, the present inventors controlled the diffusion of the lipid-tethered plasmonic nanoparticles (PNPs) by changing the biotin valency of PNPs. From this, it was ascertained that the number of ligands per particle has a significant effect on the lateral mobility of nanoparticles on a lipid membrane. The present inventors adjusted the valency of the biotin molecules on AuNPs during the DNA functionalization step by varying the molar ratios between the target capture DNA sequence and the SLB tethering DNA sequence. This stoichiometric control method yielded highly reproducible results. The number of SLB tethering sequences per PNP was estimated by measuring the fluorescence emission intensity of Cy3 molecules that were modified to SLB tethering sequences after dissolving AuNPs with a KCN solution. The average biotin valency increased linearly from 0.57 to 128 as the added amount of SLB tethering DNA linker increased (refer to
(94) TABLE-US-00007 TABLE 1 Mole fraction of SLB tethering sequence Average biotin (total concentration: 4 M) valency of PNPs 0.00125 0.569 0.08 (~1 for tethered PNP) 0.0025 4.660 0.564 0.0125 28.297 1.850 0.0625 127.78 1.351 0.3125 486.46 8.008
(95) 4.2. Effects of Biotin Valency on Diffusion Kinetics of PNP Probes on SLB
(96) The lateral motions of SLB-tethered PNP probes were observed with a single-nanoparticle resolution using the dark-field microscopy, and their individual trajectories were analyzed by an image analysis program (ImageJ software; detailed experiments and analysis methods will be described later). The mean square displacement (MSD) values as a function of time of the SLB-tethered PNP probes with different biotin valencies are shown in
(97) 4.3 Optical Stability Test of Gold Nanoparticles
(98) The resonant light scattering of metal nanoparticles has a different physical origin than the fluorescence of organic dyes. The radiative damping of localized surface plasmon creates scattered photons, and this process is free of blinking and photobleaching. In order to evaluate photostability of PNPs, the 50 nm AuNPs on the SLB were continuously exposed to dark-field microscopy illumination for 30 min and the scattering intensity was recorded every 6 s (
(99) 4.4. Single-Nanoparticle-Resolution In Situ Imaging and Analysis of Nanoparticles Tethered on SLB
(100) PNPs are dynamically tethered to a fluidic SLB, and the dynamic behavior of PNP was adjusted by controlling the valency of particles. Then, the in situ DNA hybridization-induced particle duster growth dynamics were analyzed with single-particle-level resolution, and the quantitative analysis on this platform was performed using real-time plasmonic coupling between interacting PNPs (
Example 5: Preparation of Patterned SLB
(101) For DNA assay, SLB of 120120 m.sup.2 was formed in a pattered gold film on a glass substrate. A gold pattern was formed by conventional photolithography and a conventional lift-off process. The SLB could be selectively deposited onto the glass surface exposed by the introduction of an SUV solution because the surface of gold is inert to the formation of SLB. After the formation of SLB, the surface of gold was passivated with 2 mg/ml BSA and 10 m carboxymethyl polyethylene glycol dissolved in PBS in order to suppress the nonspecific binding of PNPs and target DNA. Then, PNPs were tethered for the use of DNA assay experiments.
Example 6: Dark-Field Microscopy-Based in Situ Observation of PNP Probes and Optical Analysis Thereof
(102) The movement and plasmonic coupling of SLB-tethered PNP probes were observed by the dark-field microscopy (Axiovert 200M, Carl Zeiss, Gttingen, Germany) provided with a 40 objective lens (NA 0.6). All of the image analysis procedures were conducted with ImageJ software (http://rsb.info.nih.gov/ij/). For tracking and trajectory analysis of individual SLB-tethered PNP probes, the MOSAIC plugin was used (http://www.mosaic.ethz.ch/Downloads/ParticleTracker). The scattering intensity and RGB color spectra were measured by basic intensity measurement and RGB color intensity splitting functions of ImageJ software, respectively. Cy3-modified STV was observed by epifluorescence microscopy (TE-2000, Nikon, Tokyo, Japan) provided with a 60 lens (NA 1.49) under 532 nm laser excitation.
(103) 6.1. High-Resolution Imaging Assay of Interacting Particles
(104) Another important aspect of high-resolution imaging assay is a stable and reliable observation method of interacting particles. In order to facilitate this, two types of DNA-modified plasmonic nanoparticles (DNA-PNPs) with significant difference in lateral mobility were designed, prepared and tethered to the SLB surface, highly mobile and nearly immobile PNP (M-PNP and I-PNP) probes, respectively (refer to
(105) As M-PNP and I-PNP probes were tethered to biotinylated lipids in the SLB via streptavidin linkers, the local position and movement of the PNP-conjugated lipids could be readily tracked with a resonant light scattering signal in the dark-field microscopy. In the absence of particle-linking target DNA, M-PNP probes can approach a fixed I-PNP site and these probes could be temporarily overlapped in the dark-field microscopy. Consequently, the scattering intensity of an I-PNP site was initially constant but fluctuated as an M-PNP came within the optical diffraction limit (refer to
(106) 6.2. Analysis of Duster Growth Kinetics
(107) The duster growth kinetics from monomer to tetramer were fitted to the three-step first-order consecutive reactions by assuming M-PNPs are present in excess compared to I-PNPs:
(108) ##STR00001##
(109) The differential forms for the rates of change of each species are as follows.
(110)
(111) Solving these differential equations yields solutions to describe time-dependent concentrations of each species:
(112)
(113) Where an initial I-PNP monomer concentration [M].sub.0 is 150, which is the number of particles analyzed here. The rate constant values of k.sub.1, k.sub.2, and k.sub.3 were evaluated by fitting kinetic data using these equations.
(114) The highly parallel in situ observations of multiple interactions were realized by the simultaneous analysis of individual plasmonic coupling of PNP probes over a large surface area (typically 30,000 m.sup.2;
(115) Finally, the present inventors drew the optical calibration standards for the number of reacted particles in the dusters, and based on this standard curve, they performed target DNA detection and evaluated detection sensitivity of the PNP-tethered SLB platform. The calibration standard plots were obtained by analyzing 30 individual clusters simultaneously, and the number of particles in the dusters was confirmed by resolving and recording particle addition events in full. In order to avoid simultaneous addition of multiple PNP probes within a single frame acquisition, the frame rate was elevated by 5.3 frames per second in this case. The present inventors plotted the averaged scattering intensities and found a linear relationship with the number of clustered particles (R.sup.2 value is 0.999,
(116) 6.3. Target DNA Detection Limit Using Interaction with Complementary DNA-Modified PNPs Tethered to SLB
(117) The gold nanoparticle cluster formed by the interaction of target DNA and complementary sequence thereof can be used as a biosensor for detecting DNA in the case of quantifying the degree of cluster formation, because the intensity of scattering signals of the gold nanoparticle duster is dearly increased and this gold nanoparticle duster can be observed at a single-nanoparticle level. Therefore, since the gold nanoparticle cluster is formed depending on the concentration of target DNA, the detectable concentration range of target DNA was determined by analyzing the brightness of dark-field microscope images. The DNA detection was performed on a 120120 m.sup.2 SLB pattern embedded in a gold film (
(118) Through the optimization procedures of the assay, the present inventors intended to decrease the detection limit and increase the sensitivity. Thus, it was found that ultralow-concentration target DNA of 47, 95, 950, and 9500 strands was quantified, and as a result, target DNA having a very small number of 95, 950, and 9500 strands can also be dearly discriminated from single-base-pair-mismatched DNA. Specifically, for this purpose, the volume of sample was reduced to 1 L to 3.5 L by using a small sticker chamber having a radius of 1 mm to block the random diffusion of target materials, so as to exhibit the effect of concentrating the sample (
(119) Moreover, the repetitive conversion of target DNA hybridization-induced plasmonic nanoparticle duster into monomers and dimmers through the assembly and disassembly procedures of the duster over time was confirmed from the trend of scattering intensity change over time (
(120) Meanwhile,
(121) Such high sensitivity means that M-PNPs mobile on the SLB and I-PNPs immobile on the SLB are moved and reacted on the two-dimensional plane, and thus collision probability increases so as to cause a rapid reaction. In reality, it was observed that a very slow and inefficient reaction was caused when the M-PNPs were dispersed in a solution without being introduced into a supported lipid bilayer (SLB) and were reacted with the I-PNPs fixed on the SLB.
(122) 6.4. Adjustment of Distribution of Nanoparticles Tethered to SLB by External Stimuli and Induction of Plasmonic Coupling
(123) When the biotin valency of metal nanoparticles tethered on SLB is appropriately adjusted, the metal nanoparticles have fluidity on the SLB. The fluidic metal nanoparticles conduct a free two-dimensional diffusion movement, and can be adjusted such that they are moved on the SLB in a desired direction by external stimuli (for example, electric field and fluid flow). In this case, the moving speed of the metal nanoparticles can also be adjusted by changing electric field intensity or flow rate. As shown in
(124) Specifically, in order to adjust the movement of the metal nanoparticles introduced in the SLM platform, a flow channel is provided on a glass substrate. Holes are formed in both sides of an upper slide glass to introduce a buffer solution for forming a fluid flow. When the fluid flow is introduced in the flow channel in this way, the metal nanoparticles move in a specific direction during the free two-dimensional diffusion movement while gradually changing the mute of movement. As flow rate increased, such a movement tendency was observed dearly (
(125) When the SLB pattern is fabricated to a large size of several square millimeters (mm.sup.2), a larger number of metal nanoparticles can be accumulated in one place. In order to accumulate a larger number of metal nanoparticles, a trapezoidal pattern was fabricated, and metal nanoparticles were concentrated at a flow rate of 6 ml/h for about 30 min. It was found that the concentrated metal nanoparticles have specific plasmonic scattering colors at ends of the trapezoidal pattern. In this case, the metal nanoparticles maintain an equilibrium by fluid flow force, Van der Waals interactions between DNA-modified nanoparticles, steric repulsion between DNA molecules, and electrostatic repulsion. In order to reduce the distance between metal nanoparticles, in this study, the concentration of NaCl contained in the fluid was increased. It was found that, with the increase in the concentration of NaCl, the electrostatic repulsion between the metal nanoparticles is decreased, and thus the distance between the metal nanoparticles becomes closer so as to induce plasmonic coupling. The scattering spectra at this time were measured and analyzed (
(126) 6.5. Development of Biomimetic Artificial Membrane Platform
(127) The cell membrane, which is a structure separating the inside and outside of a cell, is a thin phospholipid bilayer composed of phospholipid and protein molecules. The cell membrane has selective permeability, and functions to maintain cell functions and cell tissues through various proteins. Like this, various biological phenomena for maintaining the homeostasis and essential functions of cells occur in the cell membrane. Therefore, biological and cytological understandings of the cell membrane are very important.
(128) From this viewpoint, the behaviors of cells can be observed by using the SLB platform disclosed in Example 6.4., which is an electrically or hydrodynamically adjustable artificial cell membrane structure. A marker material, such as metal nanoparticles, including a biomaterial is introduced into the SLB, which is an artificial membrane, by using a chemical or biological method, and the optical properties of the marker material are detected, thereby monitoring the behavior of cells. The biomaterial introduced into the SLB can induce signal transfer intracellularly or can induce a phenotype modulation reaction extracellularly. Such observation can help to identify new biological mechanisms not yet disclosed in that it is similar to a biological reaction occurring in the real cell membrane.
(129) Metal nanoparticles having optical properties, such as plasmon resonance, may be hybridized depending on the distance between the metal nanoparticle and adjacent metal particles. Due to such characteristics, these metal nanoparticles exhibit different colors depending on the distance between the metal nanoparticle and adjacent metal particles and the clustering degree of the metal nanoparticles at the time of observation with a dark-field microscope. Further, the metal nanoparticles can be observed at a high signal-to-noise ratio (S/N ratio) for a period of time due to strong plasmonic scattering. Cell responses can be observed by introducing cell monitoring probes generating multiply-detectable surface-enhanced Raman scattering signals as well as plasmonic scattering signals into a cell membrane.
(130) Therefore, the metal nanoparticles including biomaterials are introduced into the surface of SLM, cells are cultured, and the movement of the metal nanoparticles due to the cells can then be optically analyzed. Accordingly, cell signal transfer mechanisms can be more precisely analyzed in that the behavior of cells can be observed in real time and the interactions between cells and biomaterials can be monitored at the nanoscale in real time (
Example 7: Multiple Detection Using Three-Color (Red/Green/Blue (RGB)) Nanoprobes
(131) Noble metal nanoparticles, such as silver nanoparticles and gold nanoparticles, are characterized in that they exhibit a variety of colors depending on the shape and/or size thereof because they cause plasmonic resonance. Due to these characteristics, nanoparticles emitting red, blue, or green light can be provided by changing the composition, shape, and/or size thereof since these nanoparticles exhibit different colors from one another, they can be distinguished from one another by a dark-field microscope. Therefore, the applicability of these different three-color nanoparticles to the multiple detection of miRNA was found by enabling the distinction between different combinations. Meanwhile, since miRNA, which is a short RNA strand controlling the in vivo function, is known to be incorrectly expressed in patients having diseases such as cancers, it may serve as a biomarker for diagnosing diseases such as cancers. Examples of incorrectly expressed miRNA found in various cancers are shown in Table 2 below.
(132) TABLE-US-00008 TABLE 2 Lung Breast Colon Pancreas Prostate Stomach miR-21 + + + + + + miR-25 + + + miR- + + + 125b miR-141 + + + + miR- + + + 146a miR-155 + + + miR-191 + + + + + miR-205 + miR-221 + + + + + indicates the presence of incorrectly expressed miRNA found in various cancers.
(133) 7.1. Preparation of Three-Color (RGB) Nanoparticles
(134) Red nanoparticles were prepared by coating gold nanorods having a size of 15 nm15 nm45 nm with a silver shell to a thickness of about 5 nm. As green nanoparticles, spherical gold nanoparticles having a diameter of 50 nm were used. Blue nanoparticles were prepared by coating spherical gold nanoparticles having a diameter of 20 nm with a silver shell to a thickness of about 10 nm. The color and shape of each of the prepared nanoparticles were observed by using a dark-field microscope and an electron microscope, and the results thereof were shown in
(135) 7.2. Multiple Detection of Micro-RNA Through Combination of Three-Color Nanoprobes
(136) DNA was introduced into each of the nanoparticles obtained from Example 7.1. in the same manner as in Example 3, and these nanoparticles were functionalized so as to synthesize three-color nanoprobes. The mobility of the three-color nanoprobes was adjusted in the same manner as in Example 4, thereby introducing a total of six types of nanoprobes of I-PNPs (hereinafter, expressed as IR, IG, and IB) and M-PNPs (hereinafter, expressed as MR, MG, and MB) onto SLB. As described in Example 6.1., metal nanoparticles causing plasmonic resonance scattering approach one another according to the hybridization of complementary sequence DNA bonded to the metal nanoparticles to form a cluster of two or more metal nanoparticles, and thus plasmonic scattering intensity as well as plasmonic color is changed (
(137) An example of miRNA detection by complementary sequence recognition is shown in
(138) TABLE-US-00009 TABLE3 Firsttargetmaterial miR21 UAGCUUAUGAGACUGAUGUUGA (SEQIDNO:7) MoleculeA.sub.1 21_ProbeA TGACTACAACT-PEG-A.sub.10-3thiol (SEQIDNO:8) MoleculeB.sub.1 21_ProbeB 5thiol-A.sub.10-PEG-ATCGAATAGT (SEQIDNO:9) Secondtargetmaterial miR25 CAUUGCAUUGUCUCGGUCUGA (SEQIDNO:10) MoleculeA.sub.2 25_ProbeA CAAGTGCAATG-PEG-A.sub.10-3thiol (SEQIDNO:11) MoleculeB.sub.2 25_ProbeB 5thiol-A.sub.10-PEG-TCAGACCGAGA (SEQIDNO:12) Thirdtargetmaterial miR125b UCCCUGAGACCCUAACUUGUGA (SEQIDNO:13) MoleculeA.sub.3 125b_ProbeA GGTCTCAGGGA-PEG-A.sub.10-3thiol (SEQIDNO:14) MoleculeB.sub.3 125b_ProbeB 5thiol-A.sub.10-PEG-TCACAAGTTAG (SEQIDNO:15) Fourthtargetmaterial miR141 UAACACUGUCUGGUAAAGAUGG (SEQIDNO:16) MoleculeA.sub.4 141_ProbeA AGACAGTGTTA-PEG-A.sub.10-3thiol (SEQIDNO:17) MoleculeB.sub.4 141_ProbeB 5thiol-A.sub.10-PEG-CCATCTTTACC (SEQIDNO:18) Fifthtargetmaterial miR146a UGAGAACUGAAUUCCAUGGGUU (SEQIDNO:19) MoleculeA.sub.5 146a_ProbeA TTCAGTTCTCA-PEG-A.sub.10-3thiol (SEQIDNO:20) MoleculeB.sub.5 146a_ProbeB 5thiol-A.sub.10-PEG-AACCCATGGAA (SEQIDNO:21) Sixthtargetmaterial miR155 UUAAUGCUAAUCGGUGAUAGGGG (SEQIDNO:22) MoleculeA.sub.6 155_ProbeA ATTAGCATTAA-PEG-A.sub.10-3thiol (SEQIDNO:23) MoleculeB.sub.6 155_ProbeB 5thiol-A.sub.10-PEG-CCCCTATCACG (SEQIDNO:24) Seventhtargetmaterial miR191 CAACGGAAUCCCAAAAGCAGCU (SEQIDNO:25) MoleculeA.sub.7 191_ProbeA GGATTCCGTTG-PEG-A.sub.10-3thiol (SEQIDNO:26) MoleculeB.sub.7 191_ProbeB 5thiol-A.sub.10-PEG-AGCTGCTTTTG (SEQIDNO:27) Eighthtargetmaterial miR205 UCCUUCAUUCCACCGGACUCUG (SEQIDNO:28) MoleculeA.sub.8 205_ProbeA GGAATGAAGGA-PEG-A.sub.10-3thiol (SEQIDNO:29) MoleculeB.sub.8 205_ProbeB 5thiol-A.sub.10-PEG-CAGACTCCGGT (SEQIDNO:30) Ninthtargetmaterial miR221 AGCUACAUUGUCUGCUGGGUUC (SEQIDNO:31) MoleculeA.sub.9 221_ProbeA GACAATGTAGCT-PEG-A.sub.10-3thiol (SEQIDNO:32) MoleculeB.sub.9 221_ProbeB 5thiol-A.sub.10-PEG-GAAACCCAGCA (SEQIDNO:33)