Cancer Treatment
20240101628 ยท 2024-03-28
Assignee
Inventors
- Amin Hajitou (London, GB)
- Keittisak Suwan (London, GB)
- Mariam Albahrani (London, GB)
- Sajee Waramit (London, GB)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N2795/14143
CHEMISTRY; METALLURGY
C12N2320/32
CHEMISTRY; METALLURGY
C12N2999/007
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C12N2800/24
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
C12N2750/14152
CHEMISTRY; METALLURGY
C12N2795/14152
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12N2795/14144
CHEMISTRY; METALLURGY
A61K48/0066
HUMAN NECESSITIES
International classification
C12N7/00
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
Abstract
The present invention provides phagemid vectors and associated phagemid particles for cancer treatment, and in particular, to the use of novel phagemid particles and associated expression systems for the treatment, prevention, amelioration, or management of cancer. In particular, the invention relates to the use of phagemid particles and expression systems for the delivery of transgenes encoding cytokines, for the treatment, prevention, amelioration, or management of cancer. The invention also extends to the use of phagemid particles and expression systems for the delivery of transgenes, and for the combination of such treatment with the use of adoptively transferred T cells, for the treatment, prevention, amelioration, or management of cancer.
Claims
1-38. (canceled)
39. A recombinant phagemid particle comprising M13 phage coat proteins and a phagemid particle genome comprising a transgene expression cassette, wherein the transgene expression cassette comprises a promoter and a nucleic acid sequence encoding a protein, wherein the genome comprises no more than 50% of a bacteriophage genome and encodes neither a pIII capsid minor coat protein nor a pVIII capsid major coat protein.
40. The recombinant phagemid particle of claim 39, wherein the protein is a cytokine.
41. The recombinant phagemid particle of claim 40, wherein the cytokine is IL-4, IL-12, IL-15, TNF?, TRAIL, or IFN-?.
42. The recombinant phagemid particle of claim 40, wherein the cytokine is a hybrid cytokine comprising a non-endogenous signal peptide.
43. The recombinant phagemid particle of claim 42, wherein the non-endogenous signal peptide is an IL-2 signal peptide.
44. The recombinant phagemid particle of claim 43, wherein the hybrid cytokine is a hybrid TNF? comprising an IL-2 signal peptide.
45. The recombinant phagemid particle of claim 44, wherein the hybrid TNF? comprises an amino acid sequence substantially as set out in SEQ ID No: 22.
46. The recombinant phagemid particle of claim 44, wherein the hybrid TNF? is encoded by a nucleic acid sequence comprising SEQ ID No: 23.
47. The recombinant phagemid particle of claim 39, wherein the recombinant phagemid genome comprises a packaging signal.
48. The recombinant phagemid particle of claim 39, wherein the recombinant phagemid genome comprises an origin of replication.
49. The recombinant phagemid particle of claim 39, wherein the transgene expression cassette is a viral transgene expression cassette.
50. The recombinant phagemid particle of claim 39, wherein the phagemid particle genome comprises multiple transgene expression cassettes.
51. The recombinant phagemid particle of claim 39, wherein the transgene expression cassette comprises a mammalian viral transgene expression cassette.
52. The recombinant phagemid particle of claim 39, wherein the transgene expression cassette comprises nucleic acid encoding a polyA tail.
53. The recombinant phagemid particle of claim 39, wherein the transgene expression cassette comprises left and right Inverted Terminal Repeat sequences (ITRs) or left and/or right Long Terminal repeat sequences (LTRs).
54. The recombinant phagemid particle of claim 39, wherein the transgene expression cassette is a lentivirus transgene expression cassette, or an adeno-associated virus (AAV) transgene expression cassette.
55. The recombinant phagemid particle of claim 39, wherein the recombinant phagemid particle is combined with a cationic polymer to form a complex having a net positive charge.
56. The recombinant phagemid particle of claim 39, wherein the recombinant phagemid particle lacks at least 75% of the bacteriophage genome from which it is derived.
57. The recombinant phagemid particle of claim 39, wherein the recombinant phagemid particle lacks at least 95% of the bacteriophage genome from which it is derived.
58. The recombinant phagemid particle of claim 39, wherein the phagemid particle genome does not comprise any bacteriophage structural genes.
Description
[0225] For a better understanding of the invention, and to show how embodiments of the same may be carried into effect, reference will now be made, by way of example, to the accompanying Figures, in which:
[0226]
[0227]
[0228]
[0229]
[0230]
[0231]
[0232]
[0233]
[0234]
[0235]
[0236]
[0237]
[0238]
[0239]
[0240]
[0241]
[0242]
[0243]
[0244]
[0245]
[0246]
[0247]
[0248]
[0249]
[0250]
[0251]
[0252]
[0253]
[0254]
[0255]
[0256]
[0257]
[0258]
[0259]
[0260]
[0261]
[0262]
[0263]
[0264]
[0265]
[0266]
[0267]
[0268]
[0269]
[0270]
[0271]
[0272]
[0273]
[0274]
[0275]
[0276]
[0277]
[0278]
[0279]
[0280]
[0281]
[0282]
[0283]
[0284]
[0285]
BACKGROUND
[0286] The development of gene delivery technologies is instrumental to successful translation of basic research to the society. In the past decade, a number of viral and non-viral vectors have emerged as potential delivery vectors for industrial and therapeutic applications. An important property of vectors, in addition to being efficient at delivering genes, is that it must also be easily produced and commercially viable. In 2006, Hajitou et al. attempted to fulfil the need for such vectors by creating a hybrid between recombinant adeno-associated virus (rAAV) and filamentous bacteriophage (phage), called the adeno-associated Virus/Phage (AAVP) (Nature protocols 2, 523-531 (2007); Cell 125, 385-398 (2006)). The resulting AAVP vector possesses favourable characteristics of mammalian and prokaryotic viruses, but does not suffer from the disadvantages that those individual vectors normally carry. However, there are certain aspects of the AAVP vector that still leaves room for significant improvement. Above all, this includes the genetic design of the vector, which carries ramifications in its production and therapeutic properties. Ultimately, this leads to AAVP's relatively low gene transduction efficacy when compared to mammalian viruses.
[0287] The research described herein relates to the design of the most advanced version of phage gene delivery vectors and their superiority to the known and existing phage vector, AAVP, by using a so-called phagemid system, with the new phagemid vector being referred to as Phagemid/Adeno-associated Virion Phagemid (i.e. PAAV). Unlike the AAVP genome, which consists of a rAAV cassette inserted in to the filamentous phage genome, the PAAV genome does not contain any structural phage genesa prokaryotic helper virus is required to facilitate vector assembly (Mol Ther 3, 476-484; Pharmaceutical research 27, 400-420 (2010)). Separating the reproductive and therapeutic elements of the virus in to a therapeutic vector carrying the transgene and a separate helper virus carrying the structural genes substantially decreases the genome/vector size and thereby significantly increases transgene capacity, a useful advantage for gene therapy applications of the new system. Consequently, this results in the encapsidation of a eukaryotic virus genome into the capsid of a prokaryotic virus, resulting in a vector as hybrid between eukaryotic genome and prokaryotic capsid with enhanced production yield, gene transduction efficiency and flexibility of the vector system for other applications.
[0288] As described in the Examples below, the inventors have: [0289] 1. Designed and constructed a hybrid Phagemid-AAV Vector (PAAV) particle expression system; [0290] 2. Characterised and determined whether the phagemid/AAV vector (PAAV) is more efficient at gene transduction than the known AAVP system at various stages, including but not limited to: [0291] a. Binding to the cell surface, [0292] b. Internalisation of the vector from the cell surface, [0293] c. Recombinant transgene expression. [0294] 3. Determined whether the hybrid phagemid PAAV vector system is capable of producing rAAV from a mammalian producer cell-line. [0295] 4. Demonstrated that the system can be used in CAR-T therapy for cancer treatment. [0296] 5. Demonstrated that the system can be used to deliver the cytokines IL-12, TRAIL and hybrid TNF? to target cells for cancer treatment. [0297] 6. Designed and constructed a phagemid particle comprising a hybrid TNF? construct. [0298] 7. Demonstrated that a hybrid TNF? constructs show increased expression, secretion and cell killing efficiency when compared to full length TNF?.
[0299] Referring first to
Example 1Phagemid-AAV Vector (PAAV) Construction
[0300] Referring to
A) Phagemid/AAV Vector
[0301] Referring now to
[0302] Referring to
[0303] Referring to
[0304] Referring to
[0305] The phagemid is unable to package itself into particles as it lacks structural phage genes. As a result, it requires rescuing by a helper virus, as shown in
B) Helper Phage
[0306] Referring to
[0307] In order to give the phagemid targeting properties (or multifunctional properties as described in WO 2014/184528), the genome of the helper phage must be engineered to do so, as it provides the structural capsid proteins for phagemid particle assembly. For example, the helper genome may encode a pIII capsid minor coat protein that is configured to display a cell-targeting ligand for enabling delivery of the resultant PAAVP particle to a desired target cell (e.g. tumour). It can also encode at least one pVIII major coat protein that is configured to display a foreign peptide on the resultant PAAV particle. In one embodiment, therefore, it is desired to induce a 9-amino acid mutation in the pIII minor coat protein to confer specificity to tumour cells and angiogenic tumour-associated endothelial cells that express ?.sub.v?.sub.3 and ?.sub.v?.sub.5 integrin receptors. Thus, referring to
Example 2Phagemid-AAV Vector (PAAV) Production
[0308] The inventors have devised two different methods (Methods 1 and 2) for producing the Phagemid-AAV Vector (PAAV) particle, and these are illustrated in
Notes:
[0309] TG1: a strain of E. coli that carries the fertility factor (F? pilus). [0310] 2?YT: liquid broth used to culture TG1 E. coli. [0311] Kanamycin: antibiotic resistance selection marker present on the helper phage. [0312] Ampicillin: antibiotic resistance selection marker present on the phagemid vector. [0313] TYE top agar: solid media used to culture TG1 E. coli, adapted from 2?TY by the addition of 1.25% bacteriological agar.
Phagemid/AAV Vector (PAAV) Production Method 1: Infective Rescue
[0314] With reference to
[0322] The benefits of Method 1 are its very high yields.
Phagemid/AAV Vector (PAAV) Production Method 2: Stable Producer Cell-Line
[0323] With reference to
Part 1: Competent Producer Cell-Line Production
[0324] 1. Transform and plate TG1 competent E. coli (Zymo Research, USA) with ssDNA genome from helper phage M13KO7 in TYE top agar (50 ?g/mL Kanamycin) [0325] 1. Pick individual colonies and inoculate 5 mL 2?YT media (50 ?g/mL Kanamycin) supplemented with 1% glucose. [0326] 2. Incubate overnight in an orbital shaker at 37?, 250 rpm for 16-20 hours [0327] 3. Check for true positive transformants by extracting DNA from the 5 mL overnight cultures using a commercial extraction kit (QIAGEN, Netherlands) and run on 1% agarose gel (100 volts, 2.5 mA) against a DNA ladder. [0328] 4. Prepare chemically competent cells from the correct transformant identified in step 4 using a published protocol (adapted from that published by Krantz et al., UC Berkeley)
Part 2: PAAV Phagemid Particle Production
[0329] 1. Transform competent cell-line created in Part 1 with a Phagemid/AAV genome and plate on TYE top agar (100 ?g/mL Ampicillin+50 ?g/mL Kanamycin) [0330] 2. Pick a colony and inoculate 5 mL 2?YT (100 ?g/mL Ampicillin+50 ?g/mL Kanamycin) supplemented with 1% glucose. [0331] 3. Incubate in an orbital shaker at 37?, 250 rpm for 4 hours [0332] 4. Pour the infected starter culture from step 3 in to a 2 L flask with 2?YT (100 ?g/mL Ampicillin+25 ?g/mL Kanamycin) supplemented with 1% glucose to a final volume of 400-450 mL [0333] 5. Incubate overnight in an orbital shaker at 37?, 250 rpm for 16-20 hours [0334] 6. Purify phagemid particles from culture supernatant
PAAV Phagemid Particle Purification
[0335] 1. Transfer the warm overnight culture to centrifuge bottles and pellet the bacteria by centrifugation at 3300 G, 4? for 30 minutes. [0336] 2. Discard the pellet and transfer supernatant to a clean centrifuge bottle. [0337] 3. Add 30% volume of supernatant in each bottle with ice-cold 20% PEG-8000/2.5M NaCl and swirl to mix. [0338] 4. Incubate on ice for 4-24 hours [0339] 5. Precipitate phagemid particles by centrifugation at 10000 G, 4? for 30 minutes. Discard the supernatant. [0340] 6. Dry the phagemid particle pellet by centrifugation at 10000 G, 4? for 1 minute. [0341] 7. Remove remaining supernatant with PEG/NaCl [0342] 8. Resuspend the phagemid particle pellet in 0.5-2 mL PBS [0343] 9. Filter the resuspended phagemid particle preparation using a 0.45 micron filter. [0344] 10. Keep the preparation at 4?. The preparation is stable for up to 2 years 4?. A 25% glycerol stock can be stored indefinitely at ?80?.
Example 3Use of Phagemid-AAV Vector (PAAV) for Gene Therapy Techniques
[0345] Examples 1 and 2 describe the components of the invention (i.e. phagemid genome shown in
[0346] As an example, the PAAV particles described herein carry the GFP transgene, as it is readily detectable in known assays to show successful delivery to a target cell. In therapy, any transgene may be selected and engineered into the phagemid genome shown in
Example 4Use of Phagemid-AAV Vector (PAAV) for In Vitro AAV Production
[0347] In addition to gene therapy, the PAAV particles described herein can be used in novel methods for producing adeno-associated virus (AAV). Phage-guided AAV production utilizes the ability of the phagemid particles to package large amounts of dsDNA. A typical AAV production system consists of three major elements: rAAV, rep-cap and adenohelper genes, which function together to production recombinant AAV particles. The inventors have devised two different strategies.
[0348] With reference to Figure ii, the first strategy employed is to produce three different phagemid vectors that carry the rAAV-producing elements. These are the Phagemid-AAV Vector (PAAV) (see
[0349] In another embodiment, the inventors have genetically engineered a so-called unified construct that contains all of the required elements inside a single vector genome, as shown in
[0350] When introduced into the same mammalian producer cell (see
[0351] Below is described a protocol for PAAV phagemid-guided production of adeno-associated virus (AAV).
Notes:
[0352] DMEM: Dulbecco's Modified Eagle Medium. [0353] FBS: Foetal Bovine Serum, a growth supplement. [0354] Complete media: DMEM+10% FBS. [0355] EDTA: Ethyl-diamine tetra-acetic acid, an ion chelator used to dissociate cells by sequestering calcium ions required for tight junction formation. [0356] GlutaMax: a growth supplement, analogue of L-Glutamine.
Protocol for Phagemid-Guided AAV Production:
[0357] 1. Seed and grow HEK293 cells in complete media (DMEM supplemented with 10% FBS, 20 mM GlutaMax, Penicillin/Streptomycin and Non-Essential Amino Acids) in a 15 cm tissue culture plate for a minimum of 48 hours until 80% confluence is achieved. [0358] 2. Mix Phagemid/AAV, rep-cap phagemid and adeno-helper phagemid to achieve a 1:1:1 transducing unit ratio under 5 mL total volume OR Aliquot a unified vector (single vector containing all three elements in a single particle) to achieve 1 million transducing units per cell. [0359] 3. Add an equal volume of serum-free DMEM (supplemented with 20 mM GlutaMax) to the transduction mixture made in step 3. [0360] 4. Invert to mix. Incubate at room temperature for 15 minutes. [0361] 5. Wash the HEK293 cells plated in step 1 with PBS, repeat 3 times. [0362] 6. Add the transduction mixture and swirl gently to distribute the mixture evenly. [0363] 7. Incubate at 37?, 5% CO2 in a cell culture incubator for 72 hours [0364] a. After 6 hours of incubation with the transduction mixture, supplement with an equal volume of complete media (DMEM supplemented with 10% FBS, 20 mM GlutaMax, Penicillin/Streptomycin and Non-Essential Amino Acids). [0365] b. After 24 hours, replace media with complete media (DMEM supplemented with 10% FBS, 20 mM GlutaMax, Penicillin/Streptomycin and Non-Essential Amino Acids).
rAAV Purification: [0366] 1. Add 0.5M EDTA solution to the medium in the tissue culture plate to a final concentration of 0.010M, incubate for 5 minutes at room temperature. [0367] 2. Collect the cells and media by aspiration and trituration and transfer to a 50 mL centrifuge tube. [0368] 3. Pellet the cells by centrifugation at 1500 RPM, 5 minutes, Room temperature. [0369] a. Optional: collect the supernatant for further AAV purification. [0370] 4. Resuspend the cell pellet in 2-5 mL serum-free DMEM. [0371] 5. Lyse the cells in the suspension by subjecting to 4 freeze-thaw cycles in an ethanol-dry ice bath and a water bath set to 37?. [0372] 6. Centrifuge the cell lysate at 10000 G, 10 minutes at Room temperature. [0373] a. Aliquot the supernatant for quantification/further purification/concentration. [0374] b. Discard the pellet (debris).
Example 5Use of Phagemid-AAV Vector (PAAV) for In Situ AAV Production
[0375] Referring to
[0376] Firstly, an optimal dose (or multiple doses) of the three phagemid vectors or the unified vector are introduced in vivo through intravenous/thecal/peritoneal or intramuscular/subcutaneous (or any of the aforementioned routes of administration). The diseased tissue is a tumour displaying the relevant integrins and so the targeting moiety on the phagemid PAAV particles is the RGD4C sequence. The tumour should start to produce rAAV containing the viral transgene encoded in the hybrid phagemid particle and not wild-type AAV. These AAV therapeutic particles should autoinfect nearby sites, as they naturally have high affinity to mammalian tissue, and eradicate the tumour over a given time.
Example 6Engineering Pseudovirions for Large-Scale Targeted Gene Transfer and Recombinant Adeno-Associated Virus Production
Transmission Electron Microscopy
[0377] In characterising the particles, the inventors imaged PAAV particles to show that vector size is substantially reduced when using the phagemid-based vector system. Using Transmission Electron Microscopy, the inventors imaged and measured the length of PAAV of the invention and known AAVP particles on mesh copper TEM grids after negative staining with uranyl acetate (see
[0378] The difference in vector size forms the basis of the theory that PAAV may be more efficient as a gene delivery vector than the AAVP, not only in terms of production yield, but also in subsequent infection processes when entering and expressing genes in mammalian cells. As such, the inventors probed vector efficiency at various stages of infection, including binding, internalisation, and gene expression in 293AAV (a derivative of Human Embryonic Kidney 293) and U87 glioblastoma cell lines.
Vector Internalisation
[0379] Following binding, vectors undergo receptor-mediated endocytosis by the target cell. To investigate potential differences in vector internalisation, the inventors assayed the number of internalised vectors in target cells at two time-points (2 hours, 2H; 4 hours, 4H) using flow cytometry (see
Green Fluorescent Protein Expression Following AAVP and PAAV-Mediated Gene Transfer
[0380] To investigate whether the differences in vector internalisation translates to increased gene expression, the inventors performed a GFP-expression assay using RGD and NT PAAV.GFP and AAVP.GFP vectors (see
[0381] When Dex is added however, gene expression increases dramatically for RGD.AAVP and RGD.PAAV vectors. In 293AAV cells, GFP expression in RGD.AAVP.GFP treated cells increased to 25% while RGD. PAAV.GFP treated cells experience a substantial increase to 50% (all p<0.01); addition of Dex resulted in an increase in gene expression of 7.9-fold for RGD.AAVP and 6.5-fold for RGD. PAAVP (
Phagemid-Guided Recombinant Adeno-Associated Virus Production
[0382] To assess whether PAAV and phagemid-derived vectors could be used to produce rAAV in a commercial producer cell-line, the inventors transduced 293AAV cells with three targeted vectors, which are normally plasmids that require transfection for gene transfer. They were able to harvest rAAV particles from the cell lysate and quantify the rAAV gene copy number (GC) per mL over three time-points after phagemid-guided transduction (
Example 7Construction and Uses of RGD4C-Phagemid
[0383] The tripeptide, RGD, is found in proteins of the extracellular matrix, including fibronectin. The integrins act as receptors for fibronectin by binding to the RGD motif located in fibronectin in the site of cell attachment to ?.sub.v?.sub.3 integrin, and so the inventors induced a 9-amino acid mutation in the pIII minor coat protein of the recombinant phagemid particle in order to confer its specificity to tumour cells and angiogenic tumour-associated endothelial cells that express ?.sub.v?.sub.3 and ?.sub.v?.sub.5 integrins. Thus, the genome of the second vector comprises the RGD4C targeting peptide (CDCRGDCFCSEQ ID No: 7).
[0384] Referring to
[0385] Referring to
[0386]
[0387]
[0388]
[0389]
[0390]
Example 8Luciferase Expression of RGD4C-Phagemid
Protocol:
[0391] HEK cells were plated in a 48-well plate in complete media (DMEM, 10% FBS, 1% glutamine, 1% penicillin/streptomycin) and incubated for at least 48 hours until 70-80% confluence was reached. Cells were then washed with PBS and transduced with hybrid phage/phagemid vectors suspended in serum-free media (DMEM) for 12 hours before the media was supplemented with complete media. Luciferase expression was measured by adding 10 uL of culture media to 50 uL of prepared Quanti-luc (InvivoGen, USA) reagent. The emission of photos was measured using a plate reader equipped with a luminometer (promega, USA).
[0392]
Example 9Binding of RGD.PAAV Vector to 293 AAV Cells
Protocol:
[0393] 293AAV cells were seeded on 24-well plates in complete media (DMEM+10% FBS, 1% Glutamine, 1% Penicillin/Streptomycin), and were left to reach 70-90% confluence for a minimum of 48 hours. The cells were washed twice with 500 uL PBS and placed on ice before being transduced with 200000 TU/cell (transducing units/cell) of PAAV vectors suspended in 200 uL of serum-free DMEM. After 1 hour of incubation on ice, the media was recovered from the wells and the amount of phagemid particles were titrated on TG1 E. coli and quantified by colony-counting.
[0394] Referring to
Example 10Transduction of Tumour Cells by PAAV to Express Either MUC1 or PSMA Antigen on their Cell Surface, Such that they can be Targeted by Specific CAR T Cells
[0395] The conventional treatment for cancer currently consists of one or more of the following three options: surgery, chemotherapy and radiotherapy. Although the disease can sometimes be cured by these interventions, in many cases the cancer cells are not completely eliminated, and so the recurrence rate is high. To make matters worse, chemotherapy and radiotherapy are associated with unpleasant side effects. As a result, there is a great interest in the development of alternative approaches for cancer treatment. One of the most promising of these new therapeutic techniques is cancer immunotherapy, which aims to harness the power and specificity of patients' own immune system to eliminate cancer cells. Cancer immunotherapy is an evolving avenue of treatment. Two main strategies involve active immunotherapy targeting tumour-associated antigens (TAAs) and passive immunotherapies that enhance existing anti-tumour responses.
[0396] Examples of cancers include paediatric brain tumours, such as medulloblastoma and Diffuse Intrinsic Pontine Glioma (DIPG). Medulloblastoma is the most common brain tumour and originates in the cerebellum with a five years survival rate following the current therapeutic strategy that consists of surgical resection, radiotherapy, and chemotherapy (Rudin et al., 2009). However, the survivors often have long term endocrinological and neurocognitive side effects. Therefore, development of novel therapeutic approaches that are non-invasive, tumour specific, safer, cost-effective and efficient is urgently needed to avoid the long-term side-effects from current treatment. On the other hand, diffuse intrinsic pontine glioma (DIPG) is the most aggressive brain tumour that arises exclusively in children with poor survival of only 6-10% beyond two years. Due to its diffuse nature, there is no effective therapeutic strategy for this type of cancer (Jansen et al., 2012, Mueller and Chang, 2009).
[0397] Due to the immune system's unique properties and its central and universal role in the organism, immunotherapy possesses the great potential to treat cancer and offers long-term protection while potentially providing fewer side effects than other treatments. One particular approach, adoptive cell therapy (ACT), involves the transfer of immune cells that have anti-tumour activity. These cells can be T cells that already exist in a tumour, known as tumour-infiltrating lymphocytes (TIL), some of which will be specific for TAAs. These cells can be isolated from excised tumour tissue, cultivated, activated and expanded ex vivo, then re-infused into patients. Other types of cells that are useful for ACT include genetically engineered T cells that express either a modified T cell receptor (TCR) or a chimeric antigen receptor (CAR). These artificial receptors specifically direct the T cells to target antigens expressed by tumour cells (Blankenstein T, et al. The determinants of tumour immunogenicity. Nat Rev Cancer. 2012; 12(4):307-13; Sharpe M and Mount N. Genetically modified T cells in cancer therapy: opportunities and challenges. Dis Model Mech. 2015; 8(4):337-50.).
[0398] CAR proteins are expressed on the surface of T cells, and contain extracellular binding domains which bind strongly to specific tumour antigens, a hinge region linking between extracellular domains and transmembrane domains, a transmembrane domain, and intracellular signalling domains (also called co-stimulatory domains) such as CD28 and OX40 (a tumour necrosis factor receptor). Co-stimulatory signals mediated by those domains enable efficiency and prolong the anti-tumour activity of the T cells (Sharpe M and Mount N. Genetically modified T cells in cancer therapy: opportunities and challenges. Dis Model Mech. 2015; 8(4):337-50; Till B G, et al. CD20-specific adoptive immunotherapy for lymphoma using a chimeric antigen receptor with both CD28 and 4-1BB domains: pilot clinical trial results. Blood. 2012; 119(17):3940-50; Koehler H, et al. CD28 co-stimulation overcomes transforming growth factor-beta-mediated repression of proliferation of redirected human CD4+ and CD8+ T cells in an antitumor cell attack. Cancer Res. 2007; 67(5):2265-73). CART cells can be designed to recognise broad types of antigen, which may be expressed on tumour's cell surface. Potential target antigens include proteins, carbohydrates, and glycolipids. CAR T cells do not need the antigen to be processed and presented by MHC, unlike conventional T cells and transgenic TCR T cells. Therefore, the same CAR-based strategy can be applied in all patients expressing the same tumour antigen regardless of the patient's MHC haplotype (Sharpe M and Mount N. Genetically modified T cells in cancer therapy: opportunities and challenges. Dis Model Mech. 2015; 8(4):337-50, Haji-Fatahaliha M, et al. CAR-modified T-cell therapy for cancer: an updated review. Artif Cells Nanomed Biotechnol. 2015:1-11).
[0399] Despite having many advantages, CAR T cell therapy has some limitations. For instance, the tumour may not express a suitable target antigen. This may occur for a variety of reasons such as the neo-antigens being unknown, expressed at inappropriate levels, expressed only on a sub-population of tumour cells, also expressed on non-tumour tissues, not expressed in a manner that is suitable for the targeting of CAR T cells to the tissue, or if expression of the antigen by the tumour is likely to be reduced or lost during treatment.
[0400] For example, it has been reported that some CAR T cell therapies have unwanted toxicity in both animal models and in clinical trials. The problem can occur when the antigen recognised by the CAR T cell is not merely expressed on tumour cells but also presented on normal cells leading to damage of healthy tissue (Palmer D C, et al. Effective tumour treatment targeting a melanoma/melanocyte-associated antigen triggers severe ocular autoimmunity (Proc Natl Acad Sci USA. 2008; 105(23):8061-6; Morgan R A, et al. Case report of a serious adverse event following the administration of T cells transduced with a chimeric antigen receptor recognizing ERBB2. Mol Ther. 2010; 18(4):843-51; Lamers C H J, et al. Treatment of Metastatic Renal Cell Carcinoma With Autologous T-Lymphocytes Genetically Retargeted Against Carbonic Anhydrase IX: First Clinical Experience. Journal of Clinical Oncology. 2006; 24(13):e20-e2; Grupp S A, et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. N Engl J Med. 2013; 368(16):1509-18.). Therefore, the availability and selection of the target antigen are challenging. Ideally, the antigen presented exclusively by the tumour cells or alternatively by normal cells that is not essential for survival (Rosenberg S A, Restifo N P. Adoptive cell transfer as personalized immunotherapy for human cancer. Science. 2015; 348(6230:62-8). At present, many CAR T cells have successfully been developed against various tumour antigens, such as mucin 1 (MUC1) for the treatment of prostate cancer and breast cancer (Sanchez C, et al. Combining T-cell immunotherapy and anti-androgen therapy for prostate cancer. Prostate Cancer Prostatic Dis. 2013; 16(2):123-31, Si; Wilkie S, et al. Retargeting of Human T Cells to Tumor-Associated MUC1: The Evolution of a Chimeric Antigen Receptor. The Journal of Immunology. 2008; 180(7):4901-9), prostate-specific membrane antigen (PSMA) for the treatment of prostate cancer (Maher J, et al. Human T-lymphocyte cytotoxicity and proliferation directed by a single chimeric TCR[zeta]/CD28 receptor. Nat Biotech. 2002; 20(1):70-5.), CD19 and CD20 for the treatment of B-cell malignancies (Brentjens R J, et al. Safety and persistence of adoptively transferred autologous CD19-targeted T cells in patients with relapsed or chemotherapy refractory B-cell leukemias. Blood. 2011; 118(18):4817-28.) and estrogen-related receptor beta type 2 (ErRB2) for the treatment of prostate and breast cancer (Pinthus J H, et al. Immuno-Gene Therapy of Established Prostate Tumors Using Chimeric Receptor-redirected Human Lymphocytes. Cancer Research. 2003; 63(10:2470-6.). Furthermore, to pursue a higher selectivity on tumour cell, T cells have been developed through several strategies including dual-CARs T cells that are modified to express two CARs targeting specifically two different antigens expressed on the same tumour cell (Kloss C C, et al. Combinatorial antigen recognition with balanced signalling promotes selective tumor eradication by engineered T cells. Nat Biotechnol. 2013; 31(1):71-5; Wilkie S, et al. Dual targeting of ErbB2 and MUC1 in breast cancer using chimeric antigen receptors engineered to provide complementary signalling. J Clin Immunol. 2012; 32(5):1059-70.).
Molecular Cloning and Genetic Engineering
[0401] Each PAAV-CMV-CD28-IL4, PAAV-CMV-GPI-IL4 and PAAV-CMV-PSMA (
[0402] The new plasmids; PAAV.CMV.MUC1.CD28.IL4, PAAV.CMV.MUC1.GPI.IL4, PAAV.CMV.PSMA, PAAV.Grp78.MUC1.CD28.IL4, PAAV.Grp78.MUC1.GPI.IL4 and PAAV.Grp78.PSMA, were conducted by restriction enzyme digestion and ligation, transformed into TG1 competent E. coli and plated on 2?YT top agar with ampicillin. All constructs were validated firstly by restriction digestion and gel electrophoresis, and secondly by DNA sequencing (MRC CSC Genomics Core Laboratory, UK).
[0403]
CD28, GPI and PSMA Antigen Expression
[0404] HEK 293 cells at approximately 60% confluent in 12-well plate were incubated 24 hours with each vector (1,000,000 TU/cell) in complete media consisting of Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% Fetal Bovine Serum (FBS), L-Glutamine (2 mM, Sigma), penicillin (100 units/ml, Sigma), and streptomycin (100 mg/ml, Sigma). Untreated cells were used as a negative control. Next day, all vectors was removed from the culture and the cells were maintained in a humidified incubator at 37? C. in 5% CO2 as monolayers in complete medium. The medium was renewed every two days.
[0405] At day 6 post-transduction, the cells were harvested with cell dissociation buffer (Invitrogen), washed in washing buffer (PBS containing 2% FBS and 0.1% NaN3) and incubated in Clear Back (human Fc receptor blocking agent, MBL) for 20 minutes at room temperature. The cells were subsequently incubated with either HMFG2 antibody provided by Dr. John Maher (King's College London, UK) or PSMA antibody (MBL) diluted in washing buffer at 4? C. overnight. Next day, the cells were washed in washing buffer and incubated for 30 minutes at room temperature with anti-mouse IgG Alexa fluor 488 conjugated secondary antibodies (Invitrogen). The cells were finally washed in washing buffer and subjected to FACs calibur Flow cytometer (BD Biosciences). The mean fluorescence intensity was measured for at least 20,000 gated cells per triplicate well. Results were analyzed using Flowjo (TreeStar) software.
MUC-1.CD28, MUC-1.GPI and PSMA Antigen Expression on Day 6 Post-Transduction
[0406] HEK 293 cells were transduced by either 10.sup.6 TU/cell of RGD targeted PAAV (RGD) or non-targeted PAAV (NT).
Stable Cell Line Selection
[0407] To select the stable cell line expressing MUC-1.CD28, MUC-1.GPI or PSMA antigen on their cell surfaces', puromycin resistant sequence was inserted in PAAV-CMV-CD28-IL4, PAAV-CMV-GPI-IL4, PAAV-CMV-PSMA, PAAV-Grp78-CD28-IL4, PAAV-Grp78-GPI-IL4 and PAAV-Grp78-PSMA plasmids.
[0408]
[0409] The new plasmid was conducted by restriction enzyme digestion and ligation, transformed into TG1 competent E. coli and plated on 2?YT top agar with ampicillin. All construct was validated firstly by restriction digestion and gel electrophoresis, and secondly by DNA sequencing (MRC CSC Genomics Core Laboratory, UK)
Results
[0410] PAAV vectors encoding either MUC1 or PSMA transgene were produced using the helper phage system. These transgene products are subjected to display on tumour cell surface after being transduced by PAAV. MUC1 and PSMA antigens are specifically recognised by MUC1-CAR T cells and PSMA-CAR T cells.
[0411] Presented herein are data showing that the phagemid particles of the invention can be used to transduce cancer cells, and that the cancer cells subsequently stably display the delivered antigens in a manner suitable for use as the target of an adoptively transferred T cell.
Discussion
[0412] There is strong evidence to suggest that targeted PAAV vectors are more efficient than AAVP vectors at gene transduction in both commercial and disease cell lines. Both internalisation and gene expression data concordantly indicate that PAAV are more efficient than AAVP. Evidence is also provided to suggest a strong synergistic effect between DEAE-Dex and PAAV vectors on gene transduction that surpasses that of AAVP. Although these data suggest that PAAV are superior to AAVP, it must also be considered that PAAV vector samples contain helper phage contamination. Despite efforts in optimising experimental conditions during vector production, helper phage contamination (in this case, approx. 1/10) is unavoidable and will competitively inhibit transduction as it too displays the RGD targeting sequence on its minor coat protein. Taking this into account, the internalisation and gene expression data may very well be underestimating the true efficacy of RGD.PAAV. Additionally, because the internalisation assay utilises staining of intracellular phage capsid for signal detection, the smaller overall size (and available capsid protein per particle) of the PAAV means that the proportional number of particles internalised cannot be compared directly to that of AAVP, which we have shown using TEM is twice in length compared to PAAV particles. Accordingly, methods of the invention involve a purification step (e.g. FPLC) to remove the helper phage.
[0413] It is essential that in addition to providing mechanistic insight, future work must encompass replication of all experiments using pure PAAV samples. In particular, phagemid-guided rAAV production may benefit greatly from decreased competitive inhibition by helper phage contamination and yield multiple fold higher rAAV particles compared to conventional transfection protocols.
Summary
[0414] Hybrid phagemid vectors that are highly efficient at gene transfer to mammalian cells are described. These phagemid/AAV (PAAV) vectors have very large cloning capacities and are targeted to mammalian cells, meaning transfection reagents are not required.
[0415] This platform allows the production of vectors that are suitable for therapeutic gene therapy. Evidence is provided that this platform can deliver genes, including antigens suitable for targeting by adoptive T cell transfer therapy or CAR T cell therapy, to tumour cells.
Example 11Superior Phagemid/AAV Hybrid Vector for Guided Delivery of TRAIL Gene to Paediatric DIPG Cells
[0416] The use of cytokines in gene therapy was investigated as they serve diverse functions as differentiation, proliferation, activation or induction of cell death by apoptosis. The tumour necrosis factor (TNF) superfamily is one such group of molecules that are of interest because of their ability to induce death of tumour cells. Members of the TNF superfamily including Fas ligand (FasL), CD95 ligand (CD95L) and TNF? have been identified as important therapeutic agents for cancer biological therapy. Their administration can induce apoptosis in different cancer cells but also cause severe toxicity to liver, preventing their application in the clinic.
[0417] Given the dilemma of systemic toxicity, another member of the TNF superfamily, TRAIL, is rising as a promising cancer therapeutic agent. Preclinical and early clinical trials using recombinant TRAIL and antibodies against TRAIL receptors have shown that TRAIL has preferential toxicity toward tumour cells with generally little or no toxicity to normal tissues while retaining its anti-tumour properties. TRAIL is constitutively present in many tissues at the level of mRNA, most predominately in spleen, lung and prostate, and is expressed mainly by cells of the immune system such as natural killer (NK) cells and macrophages.
[0418] TRAIL is synthesized as a Type II transmembrane protein that can also be proteolytically cleaved by a cysteine protease to generate a secreted form7. The membrane-bound conformation appears to be more potent, as TRAIL is biologically active as a homotrimer and this specific conformation presumably facilitates cross-linking of ligand-receptor complexes, thereby increasing signalling strength. The secreted form is less potent, but effects can be enhanced by engineering an extracellular domain fused to motifs such as a leucine zipper, which helps with stabilsation and formation of homotrimers.
[0419] Like other TNF superfamily members, TRAIL induces apoptosis through interacting with cross-linked receptor molecules on the surface of the target cells5,10. There are 5 receptors that have been identified: TRAIL R-1 and R-2 are death receptors that contain a cytoplasmic sequence death domain (DD) which triggers apoptosis, while TRAIL R-3, R-4 and osteoprotegrin are decoy receptors that prevent apoptosis5,6,10.
[0420] When homotrimer TRAIL binds to death receptors, the receptors form a trimer and recruit adaptor protein Fas-associated death domain (FADD). FADD recruits initiator caspases 8 or 10, forming the death inducing signal complex (DISC), where initiator caspases are auto-activated by proteolysis. Activated caspase 8 or 10 then cleave the effector caspase 3, causing cleavage of death substrates and cell death. If TRAIL binds to the decoy receptors instead, FADD is not recruited and apoptosis is not triggered. Even in cells resistant to TRAIL-induced apoptosis, TRAIL can induce necroptosisn. The TRAIL-receptor system can induce direct killing of tumour-supportive immune cells and its expression on NK cells is an important mechanism used by the immune system to kill cancer cells.
[0421] Current clinical trials to deliver agonists of those in the TNF superfamily, including recombinant TRAIL or agonist antibodies against TRAIL receptors, have unfortunately failed to produce a clinical benefit in cancer patients, partly due to insufficient agonistic activity and short half-life of the drugs. Additionally, often these drugs are limited in their efficacy from design due to concerns that systemic delivery of stronger agents can induce lethal adverse effects. In order to ensure the delivery of TRAIL at optimal concentrations to produce clinical results, a suitable vector is required to selectively target and transport TRAIL to cancer cells.
[0422] Using phage display-based technology, viral vectors that display ligands that target and bind receptors selectively expressed in tumour tissues can be used to deliver TRAIL. Most research has focused on the use of eukaryotic viruses such as retrovirus and adenovirus as vectors as they provide superior transgene delivery. However, they have had limited success in systemic gene therapy due to their wide tropism for mammalian cell-membrane receptors, leading to undesired uptake by the liver, reticuloendothelial system and unwanted tissues, as well as immunogenicity. In contrast, prokaryotic viruses are advantageous, as they do not require ablation of native tropism for use in mammalian cells, are cost effective and readily produced in high titres. As they lack tropism, they are inherently poor vehicles for mammalian cell transduction13. However, by altering their coat proteins to display selective ligand peptide motifs, phages can be internalised into cells.
[0423] Effective administration of treatment solely to the tumour for prolonged effects without systemic toxicity can be achieved using vectors based on bacterial viruses, bacteriophage or phage. These bacteriophage-based vectors can be engineered to display selective ligand peptide motifs on its coat proteins to allow viral binding to targeted cells and subsequent internalisation for ligand-directed delivery of genes19. By combining the favourable biological attributes of eukaryotic and prokaryotic viruses, a chimeric virus vector was constructed comprising of recombinant adeno-associated virus (AAV) and M13-derived filamentous phage, named AAV/Phage or AAVP13. The pIII coat protein of the phage was engineered to display the double-cyclic peptide CDCRGDCFC (RGD-4C, SEQ ID NO: 7), which binds to specific ?v integrin receptors (?v?3 or ?v?5) that are over-expressed in both tumour and supporting angiogenic vaculature. This allows for superior ligand-directed delivery and cellular transduction of therapeutic transgenes as a targeted platform and these functional attributes have been confirmed in preclinical models of several cancers including prostate, breast cancer and soft-tissue sarcomas.
[0424] The inventors have improved known vector platforms by using the phagemid system to produce the next-generation vector known as Phagemid-AAV (PAAV) (
[0425] In this hybrid vector model, most of the phage genome is removed which allows for longer DNA sequences to be accommodated, but necessitates the use of helper viruses to provide the capsid and other phage components. RGD-4C peptide motif is first displayed on the pIII coat protein of the M13 bacteriophage to produce a targeted backbone helper virus. The helper virus is then used to transduce TG1 E. coli bacteria containing the engineered phagemid, and selection of the targeted vectors containing phagemid can be conducted using selection pressure with antibiotics. The new model was able to accommodate longer DNA sequences, had higher transduction efficiency and could be produced at higher titre over the original AAVP.
[0426] Without wishing to be bound to any particular theory, further improvements to transduction efficiency can be achieved via two methods. First, by engineering the RGD-4C peptide to display on pVIII instead of pIII coat protein. pVIII, being the major coat protein, is expressed in up to 2700 copies while pIII is only expressed up to 5 copies. A greater number of RGD-4C ligands that are available for targeting and binding integrins are therefore thought to be have higher efficiency at binding and transducing cells.
[0427] Without wishing to be bound to any particular theory, another strategy to enhance efficiency is by displaying the histidine rich H5W ligand, an endosomal escape peptide on the recombinant pVIII coat proteins. Intracellular barriers such as endosomes can limit the rate of gene expression even if the efficiency of internalisation is high, by trapping vectors and preventing it from exerting its therapeutic effects. The histidine side chain can form zwitterions, allowing it to act as a proton sponge and buffer the low pH in the endosome following ligand-directed endocytosis of the phage vector. When protons enter the endosome, water is drawn into the endosome via a vacuolar membrane proton pump, causing pores to form on the endosome and thereby releasing the phage vector.
[0428] The aim of this study was to develop a superior PAAV vector with optimal transduction efficiency of DIPG cells, by altering the peptides displayed on the vector's coat proteins. Next, the most suitable PAAV vector was used to deliver the TRAIL transgene to assess the effectiveness of TRAIL as a therapeutic gene in the treatment of DIPG.
[0429] Without being bound to any particular theory, the inventors hypothesised that: [0430] 1. Specificity of targeting and efficacy of genetic transfer can be enhanced by displaying the RGD-4C ligand on pVIII coat proteins or H5W peptide on the recombinant pVIII coat proteins [0431] 2. TRAIL is an effective therapeutic gene to specifically induce DIPG cell death in in vitro experiments and in an in vivo orthotopic DIPG animal model
Aims of Study
[0432] 1. Design and produce a viral vector for specific targeting of DIPG cells with optimal expression of the desired gene. [0433] 2. Assess and investigate the killing potential of therapeutic gene TRAIL against DIPG [0434] 3. To assess the specificity of targeting TRAIL expression to DIPG in vivo and investigate the therapeutic efficacy following intravenous administration of vector to immunodeficient mice with established orthotopic human DIPG.
Protocol
Cell Culture
[0435] HEK293T cell lines were maintained in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% foetal bovine serum (FBS) and 1% penicillin and streptomycin. DIPG tumour cell lines were obtained from Hospital Saint Joan de Deu Barcelona. They were maintained in Tumour Stem Medium (TSM) Base supplemented with 10% FBS. TSM is made according the recipe provided (Table XXX).
Integrin Staining
[0436] DIPG cells were seeded on poly-D-lysine coated coverslips in 24-well plates and grown until 60-70% confluent. 5 wells were used to stain for: control, secondary antibody only, ?v, ?3 and ?5 integrins. Cells were washed and fixed in 4% formaldehyde for 10 minutes at room temperature (RT). Cells were washed three times in PBS and incubated with 50 mM ammonium chloride for 5 minutes. Cell were washed again with PBS for three times and blocked for 30 minutes in 2% bovine serum album (BSA-PBS). Subsequently, cells were incubated with primary antibodies anti-av (1:100), anti-133 (1:50) and anti-?5 integrins (1:100) diluted in 1% BSA-PBS for one day and kept in a moist chamber at 4? C. Following which, cells were washed with three times with 1% BSA-PBS and incubated for 1 hour with secondary Alex Fluor 488-conjugated antibodies (1:750) and 4,6-diamidino-2-phenylindole (DAPI, 1:2000). Coverslips were washed three times with 1% BSA-PBS, three times with PBS and once with sterile water. After air-drying, coverslips were mounted in Mowiol mounting medium. Cells were viewed and images were taken with a fluorescence microscope.
Production, Purification and Titration of Helper Phage with RGD-4C Ligand Displayed on pVIII Coat Proteins (
[0437] Wild-type M13 phage DNA was modified to express RGD-4C on pVIII coat proteins by polymerase chain reaction (PCR). The primers used in the PCR were designed by a colleague (Sajee Waramit) prior to the start of this project. PCR product was ligated using T4 DNA ligase (NEB) and transformed into DH5a bacteria for cloning. Plasmids are extracted by Miniprep (QIAGEN), validated by restriction digestion and gel electrophoresis and then sent for sequencing to ensure integrity of DNA sequences (MRC CSC Genomics Core). The selected clone was then transformed into TG1 competent E. coli (Zymo research) and plated on 2?YT (Sigma) agar with 50 ?g/ml kanamycin overnight in an incubator at 37? C.
[0438] After colonies form, a single colony is selected and grown in 1 L of 2?YT media with kanamycin in a shaking incubator (32? C., 220 rpm) for 18 hours. The overnight culture was centrifuged at 6000 g for 30 minutes at 4? C. Phage supernatant was collected and 20% v/v PEG/NaCl (20% PEG 6000, 2.5M NaCl) was added and mixed thoroughly.
[0439] After incubation in the cold room overnight, the supernatant was centrifuged again at 10000 g for 30 minutes at 4? C. Phage pellet was re-suspended in 16 mL phosphate buffer saline (PBS) and 20% v/v PEG/NaCl and kept in the cold room overnight. The final phage suspension was centrifuged at 10,000 g for 30 minutes at 4? C. and the supernatant discarded. The purified phage pellet was re-suspended in 1-2 mL of PBS (depending on the pellet size) and sterile-filtered through a 0.45 ?m filter cartridge.
[0440] Titration was carried out using serial dilutions of 10-fold increments. 5 ?L of each dilution of phage was used to infect 500 ?L of na?ve TG1 E. coli that has been grown to log phase (OD600=0.45-0.50) by incubating them for 30 minutes at 37? C. Following incubation, 100 ?L of the bacteria was plated on 2?YT agar with kanamycin overnight in an incubator at 37? C. Colonies were counted on the following morning after 18 hours of incubation and virus titre estimated and expressed as bacterial transducing units (TU).
Production, Purification and Titration of RGD pVIII Vectors Containing Reporter Genes (Green Fluorescent Protein [GFP] and Lucia Luciferase [Lucia]) (
[0441] To assess efficiency in transduction of DIPG cells, vectors were constructed containing phagemids with the reporter genes green fluorescent protein (GFP) and lucia (InvivoGen). GFP expression can be detected via fluorescent microscopy, while lucia is a secreted luciferase that can be quantified with its substrate Quanti-Luc by measuring Relative Luciferase Units (RLUs). The following protocol uses PAAV-GFP plasmid or PAAV-lucia plasmids.
[0442] Plasmids were first transformed into TG1 competent E. coli (Zymo research) and plated on 2?YT (Sigma) agar with 50 ?g/ml ampicillin overnight in an incubator at 37? C. After colonies form, a single colony is selected and grown in 2?YT media with ampicillin in a shaking incubator (32? C., 220 rpm). 100 mL of the bacteria is grown to log phase (OD600=0.45-0.50), following which 15-20 ?L of the RGD pVIII helper phage is added and incubated in a shaking incubator (32? C., 150 rpm). The bacteria are then grown in it of 2?YT media containing kanamycin and ampicillin in a shaking incubator (32? C., 150 rpm) for 18 hours. Purification was carried out as per previous investigation. Titration was carried out by growing bacteria on 2?YT with ampicillin only and on another plate with kanamycin only, in order to estimate titre of reporter gene vector and helper phage respectively.
Production, Purification and Titration of H5W Peptide RGD Pill Vectors Containing Reporter Gene (Lucia)
[0443] H5W RGD pIII helper phage was produced by a colleague (Sajee Waramit) prior to the start of this project. Production was largely similar to previous stated protocol, with the exception that 1 mM isopropyl ?-D-1-thiogalactopyranoside (IPTG) was also added to select for H5W RGD pIII vectors. Purification and titration of vectors were carried out as per previous investigation.
Transduction of Vector into Cells
[0444] Cells used in transduction (HEK293T or DIPG) were seeded in plates until 60-70% confluent. The media is then removed and cells were incubated overnight with vectors diluted in OptiMEM, the amount of which is derived based on the virus titre obtained from titration. The transduction media is then removed and replaced with complete media. For cells transduced with GFP, at indicated time points the cell is viewed under fluorescence and images taken to look for cells expressing GFP. For cells transduced with lucia, at indicated time points 10 ?l of cell media and 250 of Quanti-Luc (InvivoGen), the substrate for the lucia, were mixed in a white polystyrene 96-well plate then incubated for 5 minutes at RT. Luciferase expression was quantified using a Promega Glomax microplate reader.
[0445] Assess and investigate the killing potential of therapeutic gene TRAIL against DIPG Production of PAAV-human TRAIL (hTRAIL) plasmid for transfection (
TABLE-US-00023 TABLE1 Primersequences(Invitrogen) usedtoproducehTRAILfragmentwith restrictionssites(EcoRI/SalI)using pUNO1-hTRAILandPCR. Forwardprimer5-3 GAGTGAATTCGCTGTGACCGGCGCCTAC- SEQIDNO:24 Reverseprimer5-3 GCTCGTCGACTCATGTCTGGCCAGCTAGCT TAGCC-SEQIDNO:25
Transfection of Plasmids into Cells
[0446] DIPG cells were seeded in 48 well-plates until 60-70% confluent. Prior to start of experiment, cells were incubated in OptiMEM low serum media for 1-2 hours. For 48-well plates, the FuGENE HD transfection protocol (Promega) the protocol advises to aim for a media volume of 0.5-2.0 ml, FuGENE volume of 0.6-1.8 ?l and DNA amount of 0.2-0.6 ?g. Transfection efficiency depends on the ration of FuGENE to DNA, in this case a ratio of 3:1 is used.
[0447] Eppendorf tubes were prepared and labelled for use in the experiment. OptiMEM was added to each tube up to 20 ?l, depending on the volume of FuGENE to be used. FuGENE is then directly added into the medium without contact with the walls of the plastic tube, and the mixture is incubated for 5 minutes at RT. Plasmid DNA is added to the tubes and the transfection reagent:DNA complex is incubated for 15 minutes at RT. The complex is then added to DIPG cells in a drop-wise manner and the plate swirled to ensure even distribution. Cells were incubated at 37? C. for 6 hours, following which the transfection media is changed TSM media supplemented with FBS without antibiotic. Cells are replaced in the incubator and observed for cell viability in the next 24-48 hours.
Results
DIPG Cells Express Integrin Receptors for RGD-4C Ligand Binding
[0448] To establish the suitability of this vector model in this cell line for targeted gene delivery, cells were first investigated for expression of the integrins ?v?3 and ?v?5, by means of fluorescence microscopy. As shown in
RGD-4C Ligand as Displayed on pIII Coat Protein Produced Higher Transduction Efficiency and Gene Expression Levels than pVIII Coat Protein
[0449] Previous data from the inventor's lab has shown that targeted RGD-4C pIII vector mediated gene delivery and expression was selective and efficient as compared to un-targeted vector. In order to optimise transduction, one of the hypotheses was to display the RGD-4C on the pVIII coat protein in order to increase the number of copies of ligand per phage (
[0450] Using reporter gene vectors (GFP or lucia), transduction efficiency was compared using human kidney embryonic cells, HEK293T, a cellular model that was continuously used to characterise phage vectors. Cells were incubated with un-targeted vector (control lacking RGD-4C), targeted RGD pIII PAAV-GFP or RGD pVIII PAAV-GFP vectors and viewed under fluorescent microscopy (
[0451] Similarly, in HEK293T cells transduced with un-targeted, RGD pIII PAAV-lucia or RGD pVIII PAAV-lucia vectors, the highest RLU is observed in RGD pIII PAAV-lucia (
H5W Peptide as Displayed on Recombinant pVIII Coat Protein Improves Transduction Efficiency and Gene Expression
[0452] An alternative strategy to optimise the vector was to display H5W peptide on recombinant pVIII coat protein. Previous data from the lab showed that in a transduction experiment using vectors containing reporter gene lucia (Sajee Waramit, unpublished data), display of H5W peptide increases luciferase expression in HEK293T cells as compared to RGD pIII alone (
[0453] To investigate if this finding could be applied to DIPG cells, DIPG cells were incubated with un-targeted, RGD pIII PAAV-lucia or H5W RGD pIII PAAV-lucia vectors. Consistent with that of HEK293T data, the highest RLU in DIPG cells is observed in H5W RGD pIII PAAV-lucia (
Transfection of PAAV-hTRAIL Plasmid into DIPG Cells Induced Cell Death
[0454] Following optimisation of vector and before further experiments were conducted, it was essential to determine if the selected gene of interest, human TRAIL (hTRAIL), was able to induce cell death in DIPG cells via transfection.
[0455] DIPG cells were transfected with either PAAV-hTRAIL or control PAAV-GFP plasmid. There was significantly more cell death in cells transfected with PAAV-hTRAIL according to microscopic images taken 18 hours post-transfection at all DNA concentrations (
Discussion
[0456] Without wishing to be being bound to any given theory, the data thus far show that vectors expressing H5W and RGD-4C on pIII coat proteins were most optimal in targeting and inducing expression of desired genes in DIPG cells. Data from transfection experiments also suggests that the therapeutic gene TRAIL is able to induce DIPG cell death, which warrants further investigation.
Example 12Hybrid IL2-TNF?
[0457] To increase targeted loco-regional production of TNF? within the tumour site, the inventors constructed a phagemid encoding a secreted TNF? by inserting a signal peptide from IL-2 to precede the TNF? sequence lacking the transmembrane domain. To the inventor's knowledge this is the first time that a hybrid IL2-TNF? was designed and their data suggest that preceding TNF? gene with the IL2 signal peptide sequence significantly enhanced expression and secretion of TNF? in cancer cells. Such modifications represent a significant advance in the technique available for targeted production and release of TNF? in the tumour microenvironment and should be considered for increasing the therapeutic levels of TNF?.
Protocol
[0458] PAAV.Grp78.IL-2SP.hTNF? Construction
[0459] The coding therapeutic sequence inserted in the phagemid is a hybrid sequence that contained a tumour specific promoter of the Glucose Regulated protein (Grp78), signal peptide (SP) sequence from IL-2 (
[0460] The TNF?_ is transmembrane, to generate a secreted TNF?_ with better availability for its receptor on the cell surface of tumour cells, we generated a secreted form of TNF?, by removing the transmembrane domain of TNF?_ and replacing it with the signal peptide of interleukin-2 (IL-2). The IL-2 was previously used as an effective signal peptide tested in various studies to enhance the secretion of other cytokines or growth factors into the extracellular milieu and subsequently increased their efficacy and availability for their corresponding receptors. IL-2 signal peptide sequence flanked by BamHI and EcoRI restriction sites (Thermoscientific, UK) was ligated to PAAV.Grp78 backbone. hTNF?_ sequence flanked by EcoRI and SalI restriction sites was provided from pUNO1-hTNF?_plasmid (Invivogen, France) by polymerase chain reaction (PCR), then ligated to PAAV.Grp78.IL-2 backbone. Molecular cloning steps were conducted using restriction enzyme digestion (NEB, UK) and quick T4 DNA ligase for ligation (NEB, UK). The modified plasmid was transformed into TG1 competent E. coli (Zymo research, USA). The bacteria carrying the plasmid were then selected by ampicillin selection on 2?YT agar plate. The construct was validated by restriction digestion and gel electrophoresis, and DNA sequencing (MRC CSC Genomics Core Laboratory, UK) see
Example 13Application of PAAV-Delivered TNF? Cytokine Gene Therapy in DIPG
Introduction
[0461] Diffuse intrinsic pontine glioma (DIPG) is the most aggressive brain tumour that arise exclusively in children with poor survival of only 6-10% beyond two years. Due to its diffuse nature and its sensitive location in the brainstem, surgical removal is not feasible and there is no effective therapeutic strategy for this type of cancer. The current standard treatment for DIPG is radiotherapy, which is not showing any success, as all children relapse afterwards, even in combination with radio-sensitizers. Many clinical trials have tested the effect of chemotherapy in combination with the conventional radiotherapy, yet no improvement on increasing the overall survival even when combining high doses of chemotherapeutic drugs. This resistance to chemotherapy is due to the intact blood brain barrier as well as the anatomical location of DIPG in the pons makes it more difficult for any drug to reach the targeted location. To overcome this issue, a clinical trial has applied the use of convection-enhanced delivery (CED) to deliver the chemodrug, topotecan, for the treatment of DIPG in 2 children. In this pilot study, both patients died after treatment although initially there was a reduction in tumour size. CED is a technique that directs the delivery of chemotherapeutic drugs to the brain tumours through sustained flow. This technique is being used lately by clinical trials to overcome the drug delivery challenges by bypassing the blood brain barrier.
[0462] Targeted therapy for DIPG seems to be the best solution due to its diffuse nature and sensitive location. In an attempt to target DIPG tumour, an ongoing clinical trial applying the concept of targeted radiation through labelling a radioactive substance, 124I, with 8H9 antibody, which is known to bind selectively to cancer cells sparing the healthy brain cells (clinicaltrials.gov ID NCT01502917) [8]. Another candidate to target brain tumours, as suggested by our group (Hajitou's lab) and showed high selectivity in glioblastoma, are the integrins ?v?3 and ?v?5 through the binding of RGD4C peptide as discussed in chapter 3. In fact, RGD4C targeting DIPG is currently being used in an ongoing phase I clinical trial (clinicaltrials.gov ID NCT03178032). In this trial an oncolytic adenovirus, DNX2401, is used to target tumour cells and induce cell death. Among thirty ongoing clinical trials for DIPG, the majority are focused on testing different drugs and radiotherapy, other treatments including gene therapy has not yet been applied. TNF? is an inflammatory cytokine that is known for its anticancer properties by mediating apoptosis, necrosis, and immune cell activation. Depending on the cell context, it can also induce cell proliferation and angiogenesis. Its anti-tumour activity has been studied in many solid tumours including colon cancer, oesophageal adenocarcinoma, melanoma, pancreatic cancer and many others. Yet, the efficiency as a therapeutic agent was very limited due to its significant toxicities when introduced systemically. This limited the clinical use of TNF? in the clinic as a therapeutic agent for cancer to be used for soft tissue sarcoma, melanoma and other irresectable tumours confined to the limb in the form of isolated limb perfusion (ILP) to avoid limb amputation. Indeed, TNF? works synergistically with chemotherapeutic drugs in vivo through targeting tumour vasculature disrupting the VE-cadherins and thus increase the penetration of the chemotherapeutic drugs to tumour environment. Thus, efforts to overcome the limitation of systemic toxicity are required to enhance therapeutic efficacy of TNF?. One strategy was made to decrease TNF? toxicity and yet retain its anti-tumour activity by making a mutant form of TNF?. This mutated TNF? was further targeted to the tumour environment by the signalling peptide RGD4C and enhanced the efficiency of the chemotherapeutic drugs in hepatoma and sarcoma allografts.
[0463] In vitro studies for DIPG are very limited with little human tissue available for study, restricting the understanding of this devastating type of brain cancer. Therapeutic applications, other than chemotherapeutic drugs and radiotherapy, are also hindered due to the lack of in vitro applications and understanding. Thus, in the inventors investigated the therapeutic effect of two forms of TNF?, transmembrane (tmTNF?) and secreted (sTNF?), against DIPG. TNF? was used in the form of gene therapy to be expressed and delivered to the cells using PAAV targeted by the signalling peptide RGD4C. Without wishing to be bound to any particular theory, the use of RGD4C-targeted PAAV as a therapeutic gene delivery vehicle to the tumour site will ensure safer, selective and efficient gene transfer for the treatment of DIPG.
[0464] In order to understand the mechanism of cell death induced by TNF?, the inventors studied the viability and apoptotic activity in response to transduction of PAAV carrying two different forms of TNF?, tmTNF? and sTNF?. The apoptotic activity was determined by measuring the activity of caspase3/7, caspase 8, and caspase 9.
[0465] Finally, the effect of chemotherapeutic drug, cisplatin, in enhancing gene therapy was studied. Thus, two different promoters, GRP78 and CMV, upstream of TNF? were used to understand the synergestic effect of gene therapy with cisplatin. Lucia reporter gene under the control of GRP78 and CMV promoters was used for quantitative analysis for gene expression after cisplatin treatment and further understand the role of cisplatin in enhancing gene expression.
Results
[0466] Transduction of DIPG with PAAV Carrying the Transmembrane tmTNF? and Secreted sTNF? Transgene:
[0467] Transmembrane TNF? gene and secreted TNF? were cloned into PAAV vector, PAAV-tmTNF? and PAAV-sTNF? (comprising the vector as shown in example 12), followed by the production of targeted (RGD4C) and non-targeted (Mi3/control) viruses. DIPG cells were transduced and cell viability was measured at day 7 post-transduction. The transduction efficiency was further enhanced with 40 ng/?g of phage protein DEAE dextran. DIPG cells showed better response to PAAV-sTNF? in inducing cell death compared to PAAV-tmTNF?, where the former shows about 50% cell death on day 7 compared to only 20% cell death that was induced by the transmembrane form as shown in
Gene Delivery and TNF? Expression after Transduction with PAAV:
[0468] The efficiency of PAAV gene delivery was assessed by measuring mRNA levels after transduction. Both forms of TNF? were expressed in the transduced cells with high specificity as the non-targeted (M13) form shows negligible mRNA expression of TNF? compared to the targeted PAAV (RGD4C) as shown in