OPTIMIZED HOST/VECTOR SYSTEM FOR PRODUCING PROTECTIVE MONO- AND MULTIVALENT SUBUNIT VACCINES ON THE BASIS OF THE YEAST KLUYVEROMYCES LACTIS

Abstract

Described herein are recombinant Kluyveromyces lactis (K. lactis) yeasts which are capable of the highly efficient expression of one or more foreign proteins and are suitable for use as a vaccine for generating a protective immune response against pathogens. The invention provides in particular K. lactis strains for the targeted cloning of foreign antigen-coding nucleic acids into the yeast genome of the K. lactis strain, which is characterized in that the K. lactis strain has integrated expression cassettes for foreign antigens as an alternative or in addition to the KILAC4 locus on the KIURA3-20 locus (KLLA0E22771g) and/or on the KIMET5-1 locus (KLLA0B03938g). The invention further relates to integrative expression vectors and to methods for producing the K. lactis strains of the invention as well as to the use thereof as vaccines.

Claims

1. A method for vaccination, comprising administering to a subject an effective amount of a K. lactis strain sufficient for triggering a protective immune response against one or more foreign antigens in the subject, wherein the K. lactis strain comprises expression cassettes for foreign antigens integrated at: i) the KIURA3-20 locus; ii) the KIMET5-1 locus; iii) the KIURA3-20 locus and the KIMET5-1 locus; iv) the KIURA3-20 locus and the KILAC4 locus; v) the KIMET5-1 locus and the KILAC4 locus; or vi) the KIURA3-20 locus, the KIMET5-1 locus, and the KILAC4 locus.

2. The method of claim 1, wherein the expression cassettes contain the K. lactis LAC4-12 promoter or variants of said promoter, including the intergenic region between LAC12 and LAC4, the antigen-encoding region and the AgTEF1 terminator.

3. The method of claim 1, wherein multiple copies of a foreign antigen-encoding nucleic acid are inserted via tandem expression cassettes or multi-expression cassettes at the KILAC4 locus or at the KIURA3-20 locus or at the KIMET5-1 locus of the resultant K. lactis strains.

4. The method of claim 1, wherein the gene of the foreign antigen IBDV VP2 is present in the form of a tandem expression cassette at the locus KILAC4 of the K. lactis strain.

5. The method of claim 1, wherein one or more copies of different foreign antigen-encoding nucleic acids are inserted via single expression cassettes, tandem expression cassettes or multi-expression cassettes at the KILAC4 locus and/or at the KIURA3-20 locus and/or at the KIMET5-1 locus.

6. The method of claim 1, wherein genes encoding the foreign antigens influenza A HA and influenza A M1 are inserted at the KILAC4 and KIURA3-20 loci of the K. lactis strain and are expressed.

7. The method of claim 1, wherein the K. lactis strain contains, in addition to the genomic KIGAL4 gene, a second ectopic copy of the KIGAL4 gene.

8. The method of claim 7, wherein the ectopic copy of the KIGAL4 gene, which is flanked by the KIGAL4 promoter and KIGAL4 terminator, is integrated in the K. lactis strain at gene locus KLLA0E13795g (SEQ ID NO: 1).

9. The method of claim 1, wherein the K. lactis strain has a modified promoter structure of the LAC4-12 promoter that allows reduced or no foreign protein expression under noninduced conditions, wherein the basal control region of the promoter PLAC4-12-LR2 between ?1065 and ?1540 (SEQ ID NO: 2) is deleted.

10. The method of claim 1, wherein the gene of the foreign antigen influenza A HA is present at the locus KILAC4 of the K. lactis strain.

11. The method of claim 1, wherein the K. lactis strain has a modified promoter structure of the LAC4-12 promoter that allows modulation of foreign protein expression, wherein the number of binding sites for the activator KIGal4 of the promoter varies and 1, 2, 3 or 4 KIGal4-binding sites are present.

12. The method of claim 1, wherein the gene encoding the foreign antigen IBDV VP2 is inserted at the locus KILAC4 of the K. lactis strain.

13. The method of claim 1, wherein the gene function of the alleles KIlac4, KIura3-20 and KImet5-1 is restored and the K. lactis strain is prototrophic.

14. The method of claim 1, wherein the genes of the foreign antigens BVDV E2 ectodomain, BVDV E2 ectodomain, and BVDV Npro-NS3 are inserted at the loci KILAC4, KIURA3-20 and KIMet5-1 of the K. lactis strain.

15. The method of claim 1, wherein the K. lactis strain is selected from the group consisting of: TABLE-US-00009 VAK952 DSM 32705; VAK1111 DSM 32696; VAK1118 DSM 32701; VAK1131 DSM 32700; VAK 1171 DSM 32699; VAK1243 DSM 32702; VAK1283 DSM 32697; VAK1395 DSM 32706; and VAK1400 DSM 32698.

16. The method as claimed in claim 1, wherein the K. lactis strain is administered subcutaneously, intramuscularly, or orally/mucosally.

17. The method as claimed in claim 1, wherein the K. lactis strain triggers a protective immune response against a one or more pathogens in a single application or in a double application.

18. The method as claimed in claim 1, wherein the K. lactis strain triggers a cross-protective immune response against different variants of a pathogen in a single application or in a double application.

19. A method for producing a K. lactis strain comprising expression cassettes for foreign antigens integrated at: i) the KIURA3-20 locus; ii) the KIMET5-1 locus; iii) the KIURA3-20 locus and the KIMET5-1 locus; iv) the KIURA3-20 locus and the KILAC4 locus; v) the KIMET5-1 locus and the KILAC4 locus; or vi) the KIURA3-20 locus, the KIMET5-1 locus, and the KILAC4 locus; the method comprising: (a) inserting the gene sequence of a desired antigen into the KIpURA3 vector and/or KIpMET5 vector, (b) transforming a K. lactis culture with the modified and previously enzymatically digested vector construct(s), (c) selecting transformed K. lactis cells with the aid of a solid medium which does not contain uracil or/and methionine, and (d) optionally restoring prototrophy.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0026] FIG. 1 shows the characterization of a newly generated K. lactis background strain having two KIGAL4 copies. The presence of the second ectopic KIGAL4 copy at the identified integration site was checked and the effect of the integration on yeast growth was analyzed. A: Diagram of the integration site of the ectopic KIGAL4 copy. The integration site is indicated and the gene names are given. B: Agarose gel of PCR-amplified fragments, using the primers VK183 (5-GAGCCCACCACCTGCTCCTG-3) (SEQ ID No.: 9) and VK184 (5-CTGATGTATTGCGCTCCTTACTAAC-3) (SEQ ID No.: 10), of the KIAVT3 locus of a yeast strain with (VAK1110) and without (VAK367) an additionally integrated, ectopic KIGAL4 gene. The respectively expected fragment sizes are given on the right in the diagram. C: Drop test with serial tenfold dilutions (Start-OD 1) on glucose (YPD) or lactose (YPLac). The incubation was carried out at 30? C. and 37? C. in each case. The growth of yeast strains having a KIGAL4 copy at the native gene locus (VAK1139), at the ectopic gene locus and deleted KIGAL4 at the native gene locus (VAK1110), having no KIGAL4 copy (?KIgal4; VAK964) or having two KIGAL4 copies (VAK1168) were compared. What is shown is that the defined integration of a further KIGAL4 gene only leads to marginal growth defects: said defects are only visible at 37? C. and under inducing conditions. What is clearer is the growth defect in the case of complete deletion of KIGAL4.

[0027] FIG. 2 shows the western blot analysis with proteins of an IBDV-VP2-producing K. lactis strain having an additional, ectopic KIGAL4 copy. The effect of an additional KIGAL4 copy on the LAC4-12 promoter-dependent recombinant protein production was analyzed by Western blotting. The test strain used was a yeast strain having an IBDV-VP2 expression cassette, which yeast strain was compared with other IBDV-VP2 yeast strains. The presence (+) or absence (?) of an ectopic KIGAL4 copy and of a tandem IBDV-VP2 expression cassette (see below) are indicated above. In strain VAK911, the ectopic copy was introduced by linearization of the plasmid pLI-1 by means of BstEII (Krijger et al. 2012 and WO 2013107436), and in strain VAK1130, the ectopic KIGAL4 copy was at the KIAVT3 locus (see FIG. 1). Yeast strain VAK367 was included as wild-type control without a foreign gene. The yeast strains were cultivated in YPLac for 15 h after a preliminary culture in YPD. 20 ?g in each case of the protein extract were analyzed per yeast strain by means of SDS-PAGE. The immunoblotting was carried out using anti-IBDV rabbit serum (1:8000) and HRP-conjugated anti-rabbit antibody from goat (1:10 000). Multimeric (agg.) and monomeric (mon.) IBDV-VP2 are indicated on the right by arrows, nonspecific bands by asterisks. What is shown is that the ectopic expression of an additional KIGAL4 gene leads to a strong increase in foreign antigen concentration, as does the presence of a tandem expression cassette (see also below).

[0028] FIG. 3 illustrates the effect of LR2 deletion in the LAC4-12 promoter on noninduced, recombinant protein production and on yeast growth on glucose. The unmodified LAC4-12 promoter also exhibits a basal expression of the GOI (gene of interest) under noninducing conditions. This is particularly problematic in the case of cytotoxically acting foreign antigens. What was tested with these experiments was whether a deletion in the BC region (LR2 deletion) of the LAC4-12 promoter can reduce or even completely suppress recombinant protein production under noninducing conditions. A: Diagram of a LAC4-12 promoter (P.sub.LAC4-12). The basal control region (BCR), the LR2 deletion and the four KIGal4-binding sites (upstream activating sequence: U1, U2, U4, U5) and also the encoding nucleic acid sequence of the foreign gene (GOI) are drawn in. B: Western blotting of IBDV-VP2 yeast strains, with (VAK1131) and without (VAK1130) LR2 deletion, after cultivation under noninducing conditions (YP 3% EtOH). VAK1111 was used as wild-type control without a foreign gene. For each yeast strain, 50 ?g of protein extract were loaded onto a 12% SDS gel. The immunoblotting was carried out using anti-IBDV rabbit serum (1:5000) and HRP-conjugated anti-rabbit antibody from goat (1:10 000). The loading control KINop1 was detected using mouse anti-Nop1 antibody (1:5000) and HRP-conjugated anti-mouse antibody from goat (1:10 000). C: Drop test with serial tenfold dilutions (Start-OD 1) on YPD, YPD containing 0.5% glucose and YPLac. The incubation was carried out at 30? C. and 37? C. in each case. The growth of the yeast strains bearing an influenza A HA foreign gene at the LAC4 locus, with (VAK1243) and without (VAK952) LR2 deletion, was compared. The yeast strain VAK367 was used as wild-type controls without a foreign gene. What is shown is that the LR2 deletion prevents the unwanted, basal foreign protein expression. Furthermore, what is shown is that the LR2 deletion improves the growth of a yeast strain expressing a cytotoxic protein (influenza hemagglutinin, HA), both under noninducing conditions and under inducing conditions. This is particularly clear at 37? C.

[0029] FIG. 4 shows the KIp vectors which can be used for integrating protein expression cassettes into different loci of the K. lactis genome. Whereas the use of the LAC4 locus (KIp3 vector system) has already been described (WO 20101054649 and WO 2013107436), the use of the KIURA3 and KIMET5 loci is new. A: Diagram of the different KIp vectors with their respective integration site in the genome. B & C: Expression cassettes and flanking ends in the KIpURA3 (B) and KIpMET5 (C) vectors that are newly described here. The different DNA sequence segments and relevant restriction sites are indicated. GOI: foreign gene (gene of interest). D: Western blotting analysis of foreign protein expression in yeast strains constructed with the aid of the KIp vectors (A, B & C). Here, the foreign gene is Etx.B-HA. The yeast house-keeping KINop1 protein (KLLA0C04389g) was detected as loading control. The yeast strains were cultivated in YPLac (+U) for 4 h after a preliminary culture in YPD (+U). For each yeast strain, 30 ?g of protein extract were loaded onto a 12% SDS-PAGE. The immunoblotting was carried out using monoclonal mouse anti-HA (1:5000) and anti-KINop1 (1:5000; Santa Cruz, TX, USA) antibodies and also HRP-conjugated anti-mouse antibody from goat (1:10 000; Jackson ImmunoResearch, PA, USA). What is shown is that, similarly to the LAC4 locus (WO 20101054649 and WO 2013107436), both KIURA3 and KIMET5 loci are usable for heterologous gene expression.

[0030] FIG. 5 shows the production of different, recombinant proteins in the same yeast strain. Said yeast strain (VAK1234) was constructed using the KIpURA3 and KIp3-MCS vectors. Western blotting analysis with proteins of a tandem IBDV VP2-expressing yeast strain (see below) into which an additional expression cassette, with Etx.B-HA as foreign gene, was introduced with the aid of the KIpURA3 vector (VAK1234). The controls used were yeast strains bearing only the expression cassette with Etx.B-HA at the LAC4 (VAK899) or KIURA3 locus (VAK1235) or only the tandem IBDV-VP2 expression cassette at the LAC4 locus (VAK1171) in the genome. The yeast strains were cultivated in YPLac for 6 h after a preliminary culture in YPD. For each yeast strain, 30 ?g of protein extract were loaded onto a 12% SDS-PAGE. The detection of the proteins in the immunoblot was carried out using mouse anti-HA antibody (1:5000; Santa Cruz, TX, USA) and HRP-conjugated anti-mouse antibody from goat (1:10 000) for Etx.B-HA and using rabbit anti-IBDV antiserum (1:5000; Granzow et al. (1997)) and HRP-conjugated anti-rabbit antibody from goat (1:10 000; Jackson ImmunoResearch, PA, USA) for IBDV-VP2. What is shown is that both foreign proteins are expressed in the same yeast cell. Surprisingly, the expression level of one antigen is not limited upon coexpression of another antigen. This is clear in the comparison of the expression levels in monovalent and bivalent strains (see also FIG. 12).

[0031] FIG. 6 shows the differently induced LAC4-12 promoter variants for expression cassettes in KIp vectors. The expression cassettes of the KIp vectors were provided with different variants of the LAC4-12 promoter. The effect of the promoter variants on the strength of induction of protein synthesis was tested on the basis of the analysis of yeast strains containing the corresponding expression cassettes with Etx.B-HA as foreign gene. A: Schematic representation of the promoter variant, the associated KIpURA3 vectors with Etx.B-HA as foreign gene and the yeast strains created therefrom. BCR: binding region of the transcription activators KICat8 and KISip4, transcription activators under noninducing conditions; U1, U2, U4, U5: binding regions for the transcription activator KIGal4 (upstream activating sequence). B: Western blotting analysis for characterizing the LAC4-12 promoter variants in the yeast strains created using the KIpURA3 vector (A). The yeast strains were cultivated in YPLac for 4 h after a preliminary culture in YPD. For each yeast strain, 30 ?g of protein extract were loaded onto a 12% SDS-PAGE. The immunoblotting was carried out using monoclonal mouse anti-HA (1:5000) and anti-Nop1 (1:5000) antibody and also HRP-conjugated anti-mouse antibody from goat (1:10 000). What is shown is that the expression rate of the foreign gene varies depending on the nature of the promoter used.

[0032] FIG. 7 shows the effect of doubling the number of foreign gene copies by means of a tandem expression cassette on recombinant protein production. The effect on recombinant protein production (IBDV-VP2) by increasing the number of foreign gene copies by means of a tandem expression cassette was tested. A: Schematic representation of the tandem expression cassette. DNA segments and relevant restriction sites are indicated. GOI: foreign gene (gene of interest). B: The tandem construct derived from (A) for random integration with the aid of an ScURA3 selection marker is depicted. C: Western blotting analysis for comparing IBDV-VP2 protein production in a yeast strain (VAK1118) having a tandem expression cassette (A) and a yeast strain (VAK910) having an expression cassette containing only one foreign gene copy. The yeast strains were cultivated in YPLac for 3 h or 6 h after a preliminary culture in YPD. For each yeast strain, 60 ?g of protein extract were loaded onto a 12% SDS-PAGE. The immunoblotting was carried out using anti-IBDV rabbit serum (1:10 000) and HRP-conjugated anti-rabbit antibody from goat (1:10 000). Aggregated (agg.) and monomeric (mon.) IBDV-VP2 are indicated on the right by arrows, nonspecific bands by asterisks. D: Western analysis of yeast strains having a randomly integrated tandem IBDV-VP2 expression cassette (B) in comparison with a KIp3-MCS-generated yeast strain having one expression cassette (VAK910) and also the yeast strain derived therefrom having additional KIGAL4-1 copies (pLI-1). The yeast strains were cultivated in YPLac for 8 h after a preliminary culture in YPD. The immunoblotting was carried out as described under (b). What is shown is that the use of a tandem expression cassette significantly increases the foreign protein expression rate.

[0033] FIG. 8 shows the gene fragments for restoring the gene function of the alleles KIura3-20 and KImet5-1 (A). Schematically depicted are the gene loci and the gene fragments, amplified using the specified primers, for KIURA3 (A) and KIMET5 (B). The mutations of the alleles KIura3-20 (A) and KImet5-1 (B) reconstituted with these gene fragments by homologous recombination are shown as stars below the genes. The restriction sites with which the subcloned fragments are cut out are drawn in. This diagram illustrates the strategy of generating prototrophic foreign gene-expressing yeast strains at the URA3 or MET5 locus.

[0034] FIG. 9 illustrates, in combination with Table 1 and Table 2, the protective immunization of chickens against vvIBDV in a classic prime-boost vaccination scheme. In two experiments (A and B), groups of at least 16 SPF chickens were vaccinated subcutaneously according to a prime-boost method with lyophilized and heat-inactivated yeast cells of the genetically optimized tandem IBDV-VP2 K. lactis yeast strain VAK1127. The first vaccination took place two weeks after hatching (prime), and the second (boost) two weeks after that. Two weeks after the boost, a virus challenge with a vvIBDV strain (very virulent 89163/7.3) was effected. One subject group serving as infection control was subjected to a mock treatment in which only PBS or adjuvant was administered. In experiment 1 (A), the wild-type yeast (VAK367) was also administered as control. At least seven chickens per group served as control without virus challenge, and at least five in experiment 2 (B). Sera were obtained just before the first administration, before and after the challenge, and otherwise at ten-day intervals. The strength of seroconversion was determined by means of ELISA (ProFLOK IBD Plus, Synbiotics). The converted titers according to the kit information are shown. A: Experiment 2 was performed in the same way as experiment 1 (A). The mean value of the ELISA titers from 12 animals is shown with standard deviation. Both experiments show a strong development of titers of anti-IBDV VP2 antibodies in the case of the VAK1127-vaccinated animals. The associated tables summarize the results of the protection of the vaccinated animals against challenge with the vvIBDV: in both vaccination experiments, it was possible to achieve complete protection against the viral infection.

[0035] FIG. 10 shows the effect of the genetic modifications for restoring prototrophy on the amount of recombinant protein production and immunogenicity of a tandem IBDV-VP2 yeast strain. The auxotrophic tandem IBDV-VP2 yeast strain VAK1127 and the prototrophic yeast strain VAK1171 derived therefrom were compared with regard to efficiency of recombinant protein production and immunogenicity. A: Western blotting analysis for ascertaining the IBDV-VP2 content in freshly harvested yeast material. The yeast strains were cultivated in YPLac for 8 h after a preliminary culture in YPD. 40 ?g of protein extract per yeast strain were loaded onto a 12% SDS-PAGE. The immunoblotting was carried out using anti-IBDV rabbit antiserum (1:10 000) and HRP-conjugated anti-rabbit antibodies from goat (1:10 000). Aggregated (agg.) and monomeric (mon.) IBDV-VP2 are indicated on the right by arrows, nonspecific bands by asterisks. B: Western blotting analysis for ascertaining the IBDV-VP2 content in lyophilized, heat-inactivated yeast material which was used afterwards in an immunization study in BALB/c mice (C). The yeast strains were cultivated in YPLac for 15 h after a preliminary preculture in YPD. For each yeast strain, 10 ?g of protein extract were loaded onto a 12% SDS-PAGE, otherwise the immunoblotting was carried out as (A) above and the bands are indicated correspondingly. C: Testing of the immunogenicity of the two yeast strains VAK1127 and VAK1171 in the immunization experiment in BALB/c mice. Groups of five mice each were vaccinated three times subcutaneously using 0.1 mg (dry weight) of the above-analyzed (B) yeast material. The control used was a wild-type strain (VAK367) without antigen. The first administration was carried out using CFA (complete Freund's adjuvant) as adjuvant, and the further two, at two-week intervals, using IFA (incomplete Freund's adjuvant) as adjuvant. One week after the third administration, the mice were euthanized and bled. The sera were analyzed by IBDV-VP2 ELISA (IDEXX). The absorption at 650 nm, correlating with the anti-IBDV-VP2 antibody titer, is shown with standard error. A monoclonal anti-IBDV-VP2 antibody (pos. mab64) was used as positive control for the ELISA, and either sample buffer (neg. 1) or a nonspecific antibody (neg. 2) was used as negative control. What is shown is that both strains exhibit a similar level of foreign protein expression and exhibit immunogenic potential.

[0036] FIG. 11 shows, in combination with Table 3, the protective immunization of SPF chickens against vvIBDV by means of a single, subcutaneous administration with genetically optimized IBDV-VP2 vaccine yeast. Groups of at least 18 SPF chickens were vaccinated singly subcutaneously with 10 mg of heat-inactivated cells of the genetically optimized tandem IBDV-VP2 K. lactis yeast strain VAK1171 two weeks after hatching. The controls used were animals vaccinated with PBS or 10 mg of VAK367. They were vaccinated two times, two weeks and four weeks after hatching. All animals were challenged with vvIBDV six weeks after hatching. The sera were analyzed by ELISA (ProFLOK IBD Plus, Synbiotics) as described above. The antibody titers ascertained are shown. The individual points represent individual antibody titers of the twelve chickens analyzed per group, and the bar represents the mean value with standard deviation. In the case of the controls, only the antibody titer of the surviving chickens were ascertained after the challenge. What is shown is that just a one-shot vaccination with the yeast subunit vaccine VAK 1171 achieves complete protection against a subsequent exposure to vvIBDV.

[0037] FIG. 12 shows the characterization of the strains VAK952 and VAK1283. (A) The yeast strains VAK952 (monovalent HA) and VAK1283 (bivalent HA, M1) were preincubated in a shake flask in YPD and subsequently induced in YPL for 6 h. The optical density at 600 nm was measured and 30 OD unit of the culture was harvested, the pellet was disrupted using glass beads, and the soluble protein fraction (LF) and the insoluble protein fraction (P, Pellet) were examined in an immunoblot. The primary antibody used was ?-HA1 or ?-M1 and the secondary antibody used was ?-mouse-IR-Dye800CW. The signal was generated via an infrared imaging system (LI-COR Biosciences). (B, C) The yeast strains were preincubated in a shake flask in YPD and subsequently induced in YPL over a period of 24 h. At the specified time points, the optical density of the yeast culture was determined and 30 OD units were harvested. (B) The pellets of VAK1283 were disrupted using glass beads and analyzed in an immunoblot. (C) The values measured for the optical density of VAK952 and VAK1283 were combined as a growth curve as a function of time and averaged from at least two independent experiments. (D) For the dot test, the yeast strains were cultivated on YPD-containing nutrient agar plates at 30? C. for 48 h. Starting with 1 OD unit, the yeasts were serially diluted and subsequently dripped onto YPD-containing or YPL-containing nutrient agar plates. The plates were cultivated at 30? C. for 48 h and subsequently photographed. Ponceau S: staining of total yeast protein of the respective fraction, loading control. What is shown is that VAK952 (monovalent HA) and VAK1283 (bivalent HA, M1) express the HA protein in comparable quantities. Furthermore, what is shown is that VAK1283 and VAK952 have comparable growth properties, with VAK1283 having slight advantages.

[0038] FIG. 13 illustrates the antibody titer in the serum of BALB/c mice after immunization with VAK952 (monovalent HA) and VAK1283 (bivalent HA, M1) before and after exposure infection. Both yeast strains were preincubated in a shake flask with YPD and subsequently induced in YPL for 12 h (VAK952) or 6 h (VAK1283). Thereafter, the cultures were harvested, freeze-dried and the yeast material was inactivated at 90? C. for 2 h. For the immunization, 9-week old, female BALB/c mice were vaccinated subcutaneously twice (prime-boost) or once (one shot) with 2 mg of yeast (VAK952, VAK1283) or with 1 mg of VAK1283 or twice with PBS (without adjuvant), at an interval of three weeks. The adjuvant used was AddaVax. Three or six weeks after the last administration, the animals were infected intranasally with 5?MLD.sub.50 of the influenza A/PR/8/34 (H1N1) virus. The infection control used was mock-infected animals (Mock), to which only PBS without virus was administered intranasally. Three or six weeks after the last administration and during the exposure infection, the serum of the animals was obtained and tested for neutralizing antibodies (nAb) in a VNT. nAb titer.sub.50: serum dilution which reduces the number of plaques by 50% in comparison with the virus-free control. The log.sub.2 of the corresponding serum dilution is specified. Owing to the logarithmic plot, the value: log.sub.2(2)=1 was assigned to serum samples without detectable antibodies. mAb: test system control (?-H1 (H37-66)). What is shown is that both immunization schemes lead to a significant induction of neutralizing Ab. Furthermore, it is clear that the neutralizing anti-HA antibody titers obtained in the case of the primer-boost vaccination experiments and one-shot vaccination experiments do not significantly differ for VAK952 and VAK1283.

[0039] FIG. 14 shows the exposure infection with influenza A/PR/8/34 (H1N1) after immunization with VAK952 (monovalent HA) and VAK1283 (bivalent HA, M1). Three or six weeks after the last administration (see FIG. 13 for the immunization scheme), the BALB/c mice were infected intranasally with 5?MLD.sub.50 of the influenza A/PR/8/34 (H1N1) virus. The infection control used was mock-infected animals (Mock), to which only PBS without virus was administered intranasally. Thereafter, the survival (A), the weight (B) and clinical symptoms (C) of the animals were examined multiple times every day over a period of 14 days. In the case of the clinical symptoms, a score of 0-4 was defined, which was averaged for each group (0: no anomalies; 1: slightly shaggy coat; 2: shaggy coat, reduced activity; 3: shaggy coat, 15% loss of body weight; 4: shaggy coat, >20% loss of body weight). What is shown is that the prime-boost immunization method with VAK952 does not provide optimal protection against a virus exposure, whereas this is the case for VAK1283. With both vaccines, the one-shot scheme generates optimal protection with 2 mg of administered vaccine. When 1 mg is administered, a similar protection rate is achieved with VAK1283 as with 2 mg of VAK952 in the prime-boost method.

BRIEF DESCRIPTION OF THE DESCRIBED SEQUENCES

[0040] The nucleic and/or amino acid sequences provided herewith are shown using standard letter abbreviations for nucleotide bases, and one letter code for amino acids, as defined in with 37 CFR 1.831 through 37 CFR 1.835. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an XML file named 96158_308_1001_seqlist, approximately 77 KB, created Oct. 5, 2023, the contents of which are incorporated by reference herein in their entirety.

DETAILED DESCRIPTION

[0041] In a preferred embodiment, the object of the invention is achieved by providing a K. lactis strain for targeted cloning of foreign gene-encoding nucleic acids into the yeast genome of the K. lactis strain, characterized in that the K. lactis strain has integrated expression cassettes for foreign antigens at the KIURA3-20 locus (KLLA0E22771g) and/or at the KIMET5-1 locus (KLLA0B03938g) as an alternative or in addition to the KILAC4 locus. It is particularly preferred when the K. lactis strain has integrated expression cassettes for foreign antigens at the KIURA3-20 locus (KLLA0E22771g) and/or at the KIMET5-1 locus (KLLA0B03938g) in addition to the KILAC4 locus. It is very particularly preferred when the K. lactis strain has integrated expression cassettes for foreign antigens at the KIURA3-20 locus (KLLA0E22771g) and at the KIMET5-1 locus (KLLA0B03938g) in addition to the KILAC4 locus. Such modified K. lactis strains have the advantage that genes for the expression of foreign genes are integrated at specified, defined loci in the K. lactis genome and the copy number of the foreign genes is controllable. Furthermore, said K. lactis strains allow the integration of different genes for the expression of different foreign antigens at defined loci in the K. lactis genome.

[0042] Foreign antigens or foreign proteins in the context of this invention mean all peptides, polypeptides and proteins which are suitable for generating an immune response, preferably a protective immune response, in humans or in an animal against a pathogen or carcinogenically degenerated cells. Foreign proteins can originate from pathogens or tumors of any kind, for which antigens which are solely capable of inducing a protective immune response, preferably a protective immune response, have been characterized.

[0043] In a preferred embodiment, the foreign proteins originate from pathogens (viruses, bacteria, parasites), for which antigens which are solely capable of inducing a protective immune response, preferably a protective humoral immune response, have been characterized.

[0044] For example, these are:

[0045] Foreign Proteins Originating from Parasites [0046] Necator americanus; Ancylostoma duodenale: ASP protein, hemoglobin-degrading proteases [0047] Leishmania: gp63, 46 kD promastigote antigen, LACK [0048] Plasmodium: CSP protein, CSA-1, CSA-3, EXP1, SSP2, STARP, SALSA, MSP1, MSP2, MSP3, AMA-1, GLURP, Pfs25, Pfs 28, Pvs25, Pvs 28, Pfs 48/45, Pfs 230 [0049] Schistosoma: TP1, Sm23, ShGSTs 26 and 28, paramyosin, parasite myosin, Sm14

[0050] Foreign Proteins Originating from Bacteria [0051] Mycobakterium tuberculosis: Ag85A, Hsp65, R8307, 19 kD, 45 kD, 10.4 [0052] Heliobacterpylori: VacA, LagA, NAP, hsp, urease, catalase [0053] Group A Strepptococcus: M, SCPA peptidase, exotoxins SPEA and SPEC, fibronectin [0054] binding protein [0055] Strepptococcus pneumonia: PspA, PsaA, BHV 3, BHV 4 [0056] Salmonella typhimurium: Vi antigen [0057] Shigella: LPS [0058] Vibrio cholera: CTB [0059] Escherichia coli ETEC: LT, LT-ST, CTB [0060] Yersinia pestis: F1, V

[0061] Foreign Proteins Originating from Tumor Cells/Tumors (Tumor-Associated Antigens, TAA) [0062] CEA [0063] 5T4 [0064] MUC1 [0065] MART1 [0066] HER-2

[0067] Foreign Proteins Originating from Viruses are Especially Preferred. [0068] Caliciviridae (Norwalk, HEV): NV 60 kD; HEV ORF2 [0069] Reoviridae (Rota): VP7, VP4 [0070] Retroviridae (HIV): Gag, Pol, Nef, Env, gp160, gp120, gp140, gp41 [0071] Flaviviridae (genus Flavivirus: WNV, Dengue, YF, TBE, JEV): preM-Env, NS3, NS4, NS5 [0072] Flaviviridae (genus Pestivirus BVDV, CSFV, BDV; genus Hepacivirus HCV): E1, E2, E.sup.RNS (Pesti), C, NS3, NS4, NS5 [0073] Hepadnaviridae (HBV): HBS antigen [0074] Paramyxoviridae (Paramyxovirinae: PIV-1, PIV-2, mumps, Sendai, PIV-2, PIV-4, Morbilli): M, HN, N, F [0075] Paramyxoviridae (Pneumovirinae: RSV): F, G, SH, M [0076] Rhabdoviridae (Rabies): G [0077] Herpesviridae (EBV, HSV2): gp350/220 (EBV), gB2, gD2 (HSV) [0078] Coronaviridae (SARS): CoV, N, M, S [0079] Orthomyxoviridae (Influenza A, B): HA, NA, M1, M2, NP [0080] Papillomaviridae: L2, E6, E7

[0081] In a further embodiment of the invention, the modified K. lactis strains are characterized in that the expression cassettes contain the K. lactis LAC4-12 promoter (P.sub.LAC4-12) or variants of said promoter, the ORF of the antigen to be expressed and the AgTEF1 terminator. Said embodiment has the advantage that the expression of foreign genes under the control of the P.sub.LAC4-12 promoter are induced approximately equally strongly by lactose after integration at the LAC4 and/or KIURA3 and/or KIMET5 locus.

[0082] As described above, there is a positive correlation between the antigen concentration in vaccine strains and the immunogenic effect of the yeast vaccine in the target organism. To prevent a CPE in the case of excessively strong overexpression, for example due to integration of an additional KIGAL4 gene, the above-described vector system can alternatively be modified in order to rapidly and efficiently connect multiple gene copies in series and to introduce this expression cassette in one step at one of the three gene loci (see Example 5 and FIG. 7, panel A).

[0083] In an advantageous further development of the invention, the modified K. lactis strains therefore contain at the KILAC4 locus or at the KIURA3-20 locus or at the KIMET5-1 locus multiple copies of a foreign antigen-encoding nucleic acid sequence that are inserted via tandem expression cassettes or multi-expression cassettes. Said expression cassettes comprise multiple copies of the antigen-encoding regions (genes) flanked in each case by the LAC4-12 promoter (P.sub.LAC4-12) or variants of said promoter and the AgTEF1 terminator. Duplication of the gene copies of the antigen that is performed in this way can significantly increase the expression thereof via one of the respective gene loci.

[0084] In a preferred embodiment of the invention, the gene of the foreign antigen IBDV-VP2 is present in the form of a tandem expression cassette at the locus KILAC4 of the K. lactis strain. Said K. lactis strain has, compared with strains having a single copy of the gene encoding the foreign antigen IBDV-VP2, the advantage that the foreign antigen IBDV-VP2 is expressed with increased quantity. Particular preference according to this embodiment of the invention is given to the strain VAK1118 (DSM 32701), which has the gene of the foreign antigen IBDV-VP2 in the form of a tandem expression cassette at the locus KILAC4.

[0085] It is furthermore preferred when one or more copies of different foreign antigen-encoding nucleic acids are inserted via single expression cassettes, tandem expression cassettes or multi-expression cassettes at the KILAC4 locus and/or at the KIURA3-20 locus and/or at the KIMET5-1 locus of the K. lactis strains according to the invention. As a result, it is possible to express, firstly, different foreign antigens and, secondly, said different foreign antigens in different concentrations in the yeast cell. Particular preference according to this embodiment is given to a K. lactis strain in which the encoding nucleic acid sequences of the foreign antigens influenza A HA (A/Puerto Rico/8/1934(H1N1)) and influenza A M1 (A/Puerto Rico/8/1934(H1N1)) are inserted at the KILAC4 and KIURA3-20 loci of the K. lactis strain and are expressed. Special preference according to this embodiment of the invention is given the strain VAK1283 (DSM 32697), in which the encoding nucleic acid sequences of the foreign antigens influenza A HA (A/Puerto Rico/8/1934(H1N1)) and influenza A M1 (A/Puerto Rico/8/1934(H1N1)) are inserted at the KILAC4 and KIURA3-20 loci of the K. lactis strain.

[0086] As mentioned, it is known that the increase in the KIGAL4 gene dose can lead to raising of antigen production (Krijger et al. 2012 and WO 2013107436). The disadvantages of achieving this via the integration of the KIGAL4-expressing pLI-1 plasmid in a two-step process are stated above. Said disadvantages were overcome according to the invention by providing a stable starting strain for the integration of foreign genes that contains a second copy of the KIGAL4 gene. This ensures that all derived strains have the same genetic background and that exactly one additional KIGAL4 gene copy is present in said strains. This decreases the cytotoxicity which has been observed in the case of expression of multiple copies and reduces the steps in vaccine strain production to just one step. In addition, genetic stability is increased, since the reversible integration/excision of the plasmid is omitted. Such a strain can, for example, be produced as described in Example 1.

[0087] In a further advantageous embodiment of the invention, what is thus provided is a K. lactis strain which contains, in addition to the genomic KIGAL4 gene, additionally a second ectopic copy of the KIGAL4 gene. In said strain, the expression of the KIGAL4 transcription activator can be maximally increased two-fold and the expression of the foreign genes inserted into the KILAC4 locus and/or the KIURA3-20 locus and/or the KIMET5-1 locus can be increased in a defined manner via the LAC4-12 promoter or via below-described variants of said promoter. In conventional practice, plasmids encoding KIGAL4 were introduced into the cell transiently and in a multiple, uncontrolled copy number. As a result, the foreign antigen was often expressed in such a high concentration that this led to cytotoxic effects. In the case of the K. lactis strains of this embodiment of the invention, cytotoxic effects can be reduced or avoided with a high degree of effectiveness. Further gene loci which will be developed in the future for the same purpose (insertion of a LAC4-controlled expression cassette) can also be controlled in this way. It has been found to be advantageous when the ectopic copy of the KIGAL4 gene, which is flanked by the KIGAL4 promoter and KIGAL4 terminator, is integrated in the K. lactis strain at the gene locus KLLA0E13795g (KIavt3::KIGAL4-1, SEQ ID No.: 1). Special preference according to this embodiment of the invention is given to the strain VAK1111 (DSM 32696), which has these properties.

[0088] In a further preferred embodiment, the invention provides a K. lactis strain in which the encoding nucleic acid sequence of the foreign antigen IBDV-VP2 is present at the locus KILAC4. Special preference according to this embodiment of the invention is given to the strain VAK1171 (DSM 32699). Said strain additionally contains a second, ectopic copy of the KIGAL4 gene, at which the encoding nucleic acid sequence of the foreign antigen IBDV-VP2 is likewise present. Said strain exhibits an increased expression of the foreign antigen IBDV-VP2 compared to strains without additional ectopic copy of the KIGAL4 gene.

[0089] Heterologous protein production in microorganisms is problematic when this leads to a cytopathic effect (CPE). The invention therefore provides a way to decouple the antigen production phase from the biomass accumulation phase. Owing to the inducible LAC4 promoter, this is partially possible by a fed-batch fermentation process for example, but is hampered because the promoter P.sub.LAC4-12 is not completely closed down under noninducing conditions (i.e., open to a certain extent). In the case of antigens having a very strong CPE, what occurs as a result is a reduction in the growth rate and an induction of the cellular stress response, with disadvantageous effects for antigen production. This problem is aggravated by the doubling of the KIGAL4 gene dose and/or the increase in the number of antigen-encoding sequences (see below).

[0090] An advantageous further development of the K. lactis strains according to the invention therefore consists in the K. lactis strains having a modified promoter structure of the LAC4-12 promoter that allows only slight foreign protein expression or none under noninducing conditions. The modified structure of the LAC4-12 promoter is especially characterized in that the basal control region (BCR) of the promoter P.sub.LAC4-12 between positions 1065 and 1540 (LR2 deletion; P.sub.LAC4-12-LR2; SEQ ID No.: 2) is deleted (see also Example 2). As already described above, this embodiment of the invention has the advantage, compared to conventional practice, that cytotoxic effects conventionally caused by excessively strong expression of the foreign genes are reduced or avoided with a high degree of effectiveness. Preference according to this embodiment is given to K. lactis strains in which the encoding nucleic acid sequence of the foreign antigen influenza A HA (A/Puerto Rico/8/1934(H1N1)) is present at the locus KILAC4. Special preference according to this embodiment of the invention is given to the strain VAK1243 (DSM 32702). Said strain contains an LR2 deletion in the LAC4-12 promoter. The K. lactis strain can also have a modified structure of the LAC4-12 promoter that allows modulation of foreign protein expression, wherein the number of binding sites for the activator KIGal4 of the promoter (upstream activating sequences 1, 2 and 4, 5) varies and 1, 2, 3 or 4 KIGal4-binding sites are present. In this way, it is possible to express different foreign proteins in differing concentration (quality by design) in a yeast cell. The shortened promoter variants are, inter alia, important for the modularity of the system in order, for example, to express proteins in the same strain in optimal stoichiometric ratios, for example for the formation of highly immunogenic virus-like particles (VLPs). It is preferred according to this embodiment of the invention when the encoding nucleic acid sequence of the foreign antigen IBDV-VP2 is inserted at the locus KILAC4 of the K. lactis strain. Special preference according to this embodiment of the invention is given to the strain VAK1131 (DSM 32700). Said strain contains an LR2 deletion and a deletion of the upstream activating sequences 4 and 5 in the LAC4-12 promoter.

[0091] Part of the object of the invention was to provide K. lactis strains which are better suited to cultivation. This problem is solved by restoring the gene function of the alleles KIlac4, KIura3-20 and KImet5-1 in the K. lactis strains according to the invention. The resultant K. lactis strains are prototrophic (Example 6, FIG. 8). The fermentation of the vaccine strains is thus simplified, and the establishment of the production processes is facilitated and made more cost-efficient. Preference according to this embodiment of the invention is given to K. lactis strains in which the encoding nucleic acid sequences of the foreign antigens BVDV E2 ectodomain (type 1, CP7), BVDV E2 ectodomain (type 2, New York 93) and BVDV Npro-NS3 (type 1, CP7) are inserted into the at the loci KILAC4, KIURA3-20 and KIMet5-1 of the K. lactis strain. Special preference according to this embodiment of the invention is given to the strain VAK1400 (DSM 32698). Said strain is prototrophic.

[0092] In a particularly preferred embodiment, the invention provides a K. lactis strain selected from the strains

TABLE-US-00001 VAK952 DSM 32705; VAK1111 DSM 32696; VAK1118 DSM 32701; VAK1131 DSM 32700; VAK 1171 DSM 32699; VAK1243 DSM 32702; VAK1283 DSM 32697; VAK1395 DSM 32706; VAK1400 DSM 32698

[0093] Said strains were deposited on Nov. 24, 2017 or Dec. 1, 2017 (DSM 32705, DSM 32706) at the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH [German Collection of Microorganisms and Cell Cultures GmbH], DSMZ, Inhoffenstrasse 7B, 38124 Braunschweig, Germany, in accordance with the Budapest Treaty under the above-specified numbers.

[0094] In a further aspect, the invention provides integrative expression vectors, with the aid of which the K. lactis strains of the invention are producible.

[0095] In a preferred embodiment, the invention provides the integrative expression vectors K/pURA3 (SEQ ID No.: 3) and KIpMET5 (SEQ ID No.: 4). Said vectors contain the LAC4-12 promoter (P.sub.LAC4-12) or variants of said promoter (as described above for the K. lactis strains) including the ORF of the antigen to be expressed, additionally the AgTEF1 terminator sequence and also targeting sequences which allow a targeted restoration of the functionality of the KIura3-20 and KImet5-1 alleles after integration. The antigen-encoding sequence is cloned between the promoter sequence and terminator sequence of the expression cassette via defined restriction sites. By means of said vectors, foreign gene-expressing cassettes are integrated into the K. lactis genome in a stable manner, without markers and without use of antibiotic resistances. Accordingly, the strengths of this vector system are that foreign genes are easily exchangeable between the different vectors and that promoters and terminators of the expression cassettes are replaceable with others. The expression cassette consists of the P.sub.LAC4-12 promoter and the AgTEF1 terminator, and also the foreign gene in between. The foreign gene can be exchanged via the restriction sites AscI and NotI. The P.sub.LAC4-12 promoter can be replaced via the restriction sites SmaI and AscI in both vectors, and the terminator can be replaced via NotI and BoxI (or MluI) in KIpURA3 and via NotI and Ec/136II (or SacI) in KIpMET5. Alternative expression cassettes are cloned between the restriction sites SmaI and BoxI (or MluI) in KIpURA3, and between SmaI and Ec/136II (or SacI) in KIpMET5. Using the stated restriction enzymes, the expression cassettes are also exchanged between KIpMET5 and KIpURA3 vectors or additional expression cassettes are introduced. An improvement over the KIp3 and KIp3-MCS vectors (WO 20101054649) is that selection is carried out under noninducing conditions (without lactose), and this leads to higher transformation rates in the case of proteins with CPE and prevents a possible enrichment of transformants with reduced foreign gene expression. See also Examples 3.1 and 3.2.

[0096] In a particularly preferred embodiment of the invention, an integrative expression vector selected from KIpMET5-P.sub.LAC4-12-Et, KIpMET5-P.sub.LAC4-12-LR2-Et, KIpMET5-P.sub.LAC4-Et, KIpMET5-P.sub.LAC4-LR2 and from KIpURA3-P.sub.LAC4-12-Et, KIpURA3-P.sub.LAC4-12-LR2-Et, KIpURA3-P.sub.LAC4-Et and KIpURA3-P.sub.LAC4-LR2 (SEQ ID No.: 3 or SEQ ID No. 4 in combination with SEQ ID No.: 5, 6, 7 or 8) is provided.

[0097] The vectors KIpURA3-P.sub.LAC4-12-Et, KIpURA3-P.sub.LAC4-12-LR2-Et, KIpURA3-P.sub.LAC4-Et and KIpURA3-P.sub.LAC4-LR2 are variants of the vector KIpURA3-Et, into which the encoding nucleic acid sequence for the Etx.B-HA protein is inserted in each case. The vectors KIpURA3-P.sub.LAC4-12-Et, KIpURA3-P.sub.LAC4-12-LR2-Et, KIpURA3-P.sub.LAC4-Et and KIpURA3-P.sub.LAC4-LR2 have differences in the promoter compared to the vector KIpURA3-Et.

[0098] The vectors KIpMET5-P.sub.LAC4-12-Et, KIpMET5-P.sub.LAC4-12-LR2-Et, KIpMET5-P.sub.LAC4-Et, KIpMET5-P.sub.LAC4-LR2 are variants of the vector KIpMET5, into which the encoding nucleic acid sequence for the Etx.B-HA protein is inserted in each case. The vectors KIpMET5-P.sub.LAC4-12-Et, KIpMET5-P.sub.LAC4-12-LR2-Et, KIpMET5-P.sub.LAC4-Et, KIpMET5-P.sub.LAC4-LR2 have differences in the promoter compared to the vector KIpMET5.

[0099] In a further aspect, the invention provides a method for producing a K. lactis strain according to the invention, comprising the steps of: [0100] (i) inserting the encoding nucleic acid sequence of the desired antigen into the KIpURA3 or KIpMET5 vector, [0101] (ii) transforming a K. lactis culture with the modified and previously enzymatically digested vector construct, [0102] (iii) selecting transformed K. lactis cells with the aid of a solid medium which does not contain uracil or/and methionine, and [0103] (iv) optionally: restoring prototrophy.

[0104] In one embodiment of the method according to the invention, the gene sequences of multiple antigens can be inserted ectopically at the same time and expressed in a regulated manner. It is preferred when different gene sequences encoding antigens of different variants of a pathogen are inserted ectopically and expressed in a regulated manner. Furthermore, it is preferred when different gene sequences encoding antigens of different pathogens are inserted ectopically and expressed in a regulated manner.

[0105] In a further aspect, the invention provides pharmaceutical or veterinary-medicine compositions for parenteral, enteral, intramuscular, mucosal or oral administration, containing a K. lactis strain according to the invention, optionally in combination with customary vehicles and/or excipients. In particular, the invention provides pharmaceutical or veterinary-medicine compositions suitable for vaccination.

[0106] Preferably, the pharmaceutical or veterinary-medicine composition comprises at least one physiologically compatible vehicle, diluent, adjuvant and/or excipient. The K. lactis strains according to the present invention can be contained in a pharmaceutically compatible vehicle, for example in a conventional medium, such as an aqueous saline medium or a buffer solution as pharmaceutical composition for injection. Such a medium can also contain conventional pharmaceutical substances, such as, for example, pharmaceutically compatible salts for setting the osmotic pressure, buffers, preservatives and the like. The preferred media include physiological saline solution and human serum. A particularly preferred medium is PBS-buffered saline solution.

[0107] Further suitable pharmaceutically compatible vehicles are known to a person skilled in the art from, for example, Remington's Practice of Pharmacy, 13th edition and J. of Pharmaceutical Science & Technology, Vol. 52, No. 5, September-October, pages 238-311.

[0108] A further aspect of the invention provides for the use of the recombinant K. lactis yeasts according to the invention for vaccination, such as, for example, for generating a protective immunization, especially a protective immunization directed against a pathogen.

[0109] A corresponding method for generating a protective immunization comprises, for example, the following steps: [0110] a) cultivating and propagating the recombinant yeasts according to the invention, [0111] b) harvesting and inactivating the yeasts, [0112] c) administering the recombinant yeasts according to an immunization scheme to be defined, [0113] d) determining the titer of the antibodies formed and/or [0114] e) detecting the immunization.

[0115] The cultivation and propagation of the recombinant yeasts according to the invention can be achieved using any conventionally available method. Particular preference is given to methods which lead to high cell yields in a cost-effective manner. These include fermentation methods, especially high-cell-density fermentation methods.

[0116] Carrying out the fermentation using a fed-batch fermentation protocol has been found to be particularly advantageous. In a preferred embodiment, the protective immunization is achieved in that the recombinant yeasts are administered orally/mucosally, intramuscularly or subcutaneously.

[0117] The recombinant yeast cells should be used in an inactivated/killed state in the method according to the invention. To this end, the yeasts are dried after cultivation and expression of the foreign genes and subsequently inactivated. The inactivation can be carried out using any conventionally available method. Particularly suitable for use in the method according to the invention are heat inactivation (e.g., heat inactivation for 2 hours at 90? C.) or ?-irradiation (e.g., with 25 or 50 kGy).

[0118] The invention also provides a method for vaccination, comprising administering a K. lactis strain according to the invention to a subject, for example an animal or a human, preferably an animal, in an amount sufficient for triggering an immune response, preferably a protective immune response against one or more foreign antigens, in the subject.

[0119] A particular advantage is that, using the K. lactis strains according to the invention, a protective immune response against one pathogen is triggered solely after a single application/immunization (one shot) or after a double application/immunization (prime-boost). What has been found to be a further advantage is that, using the K. lactis strains according to the invention, a cross-protective immune response against different variants of a pathogen can be triggered after a single application/immunization (one shot) or after a double application/immunization (prime-boost). If the K. lactis strains according to the invention bear and express different foreign genes against antigens of different pathogens, it is even possible to trigger a protective immune response against different pathogens after a single application/immunization (one shot) or in a double application/immunization (prime-boost).

SUMMARY OF THE ADVANTAGES OF THE INVENTION

[0120] The described improvements in the K. lactis platform result in numerous advantages: [0121] a. A great simplification (ready to use toolbox/kit) and a high reproducibility in the construction of strains of subunit vaccines based on yeast is made possible. They can now be generated within a defined, short time span. [0122] b. The yeast vaccines can contain one or more antigens; they can be customized in a flexible manner and produced in different quantities. [0123] c. Moreover, an efficient fermentation of the prototrophic yeasts is made possible. [0124] d. A stringent inducibility of recombinant protein production is made possible. The latter is particularly important for proteins which can trigger a CPE. [0125] e. The targeted, stable, genomic integration of the foreign genes and the associated genetic stability of the strains offers the advantage that production processes proceed reproducibly. This is particularly important for GMP production. [0126] f. The protectivity of the yeast vaccine is improved with the increase in recombinant antigen production that is achieved as a result of an increase in foreign gene copies and/or in KIGAL4 concentration. [0127] g. In addition, the vaccine dose to be administered can be reduced with the increase in recombinant antigen production that is achieved as a result of an increase in foreign gene copies and/or in KIGAL4 concentration. Yeast production is thereby more cost-efficient and the compatibility of the vaccine for the vaccine recipient is improved. [0128] h. Multivalent yeast vaccines can be used in a cross-protective or multivalent protective manner for prophylaxis against different variants of the same pathogen or against different pathogens. Apart from inactivation and admixing with an adequate adjuvant and/or a suitable liquid volume, no further downstream processing of the yeast for use as vaccine is required.

[0129] The invention is more particularly elucidated below on the basis of the drawings and exemplary embodiments.

EXEMPLARY EMBODIMENTS

Example 1: Generation of a Host Strain Having Two KIGAL4 Gene Copies, Stably Integrated, at Noncoupled Gene Loci

[0130] A second KIGAL4 gene copy without a selection marker was inserted at a different gene locus (ectopically). It was possible to locate the insertion in the KIAVT3 gene (KLLA0E13795g) by sequencing (KIavt3::KIGAL4-1, SEQ ID No.: 1) (FIG. 1). The resultant strain is called VAK1111. The independent meiotic segregation of the two KIGAL4 copies, which are on chromosome E (ectopic copy) and D (genomic copy), was confirmed by a crossing experiment. Moreover, in the same experiment, the number of exactly two KIGAL4-1 gene copies in the genome was established.

[0131] To use VAK1111 for the targeted integration of an expression cassette at the LAC4 locus in analogy to VAK367-D4, the lac4::ScURA3 disruption was introduced, which makes it possible in one step, under selection for lactose growth, to integrate the desired foreign gene between LAC4 promoter and LAC4 reading frame by means of KIp vector technology without a marker (Krijger et al. (2012)). The resultant strain VAK1123 only differs from VAK367-D4 by the second, ectopic KIGAL4 gene copy.

Example 1.1: Improved Productivity of a Yeast Vaccine Strain Having an Additionally Integrated KIGAL4 Gene

[0132] In one exemplary embodiment, the IBDV-oVP2.sub.T2S (Arnold et al. (2012)) gene was inserted into the LAC4 locus of the strain VAK1123 (resultant strain VAK1130). It was possible to establish an increased production of IBDV-VP2 compared to the otherwise isogenic strain having only one KIGAL4 copy (VAK910). As comparison, strain VAK1118, which bears only one KIGAL4 gene, but two CDS VP2.sub.IBDV copies (see below), is additionally shown (FIG. 2).

Example 2: P.SUB.LAC4-12LR2 Promoter Having Reduced Basal Activity for Optimizing the Expression of Antigens Having a Cytopathic Effect

[0133] Heterologous protein production in microorganisms is problematic when this leads to a cytopathic effect (CPE). Therefore, the task faced is to find a way to decouple the antigen production phase from the biomass accumulation phase. Owing to the inducible LAC4 promoter, this is partially possible by a fed-batch fermentation process, but is hampered because the promoter P.sub.LAC4-12 is not completely closed down under noninducing conditions. In the case of antigens having a very strong CPE, what occurs is a reduction in the growth rate and an induction of the cellular stress response, with disadvantageous effects on antigen production. This problem is aggravated by the doubling of the KIGAL4 gene dose and/or the increase in the number of antigen-encoding sequences (see below). The solution was to delete the basal control region (BCR) of the promoter P.sub.LAC4-12 (FIG. 3, panel A) (Mehlgarten et al. (2015)) between ?1065 and ?1540 (LR2 deletion; P.sub.LAC4-12-LR2; SEQ ID No.: 2). Said deletion was introduced into the starting strains VAK367 (one KIGAL4 copy) and VAK1111 (two KIGAL4 copies) at the genomic LAC4 locus together with the lac4::ScURA3 disruption. The resultant strains VAK1109 and VAK1124 are suitable for the expression of antigens having CPE. The promoter P.sub.LAC4-12LR2 was also inserted into the integrative vectors KIpURA3-Et and KIpMET5-Et (see below). Example 2.1: Inhibition of the basal (noninduced) expression of antigen by a modified promoter.

[0134] After integration of a tandem IBDV-VP2 expression cassette into VAK1124 (resultant yeast strain: VAK1131; see below and FIG. 7 for an explanation of the term tandem expression cassette), it was possible to show that the LR2 deletion in the LAC4-12 promoter leads to a strong reduction in VP2 protein production under noninducing conditions (FIG. 3, panel B). With strains expressing the influenza A antigen hemagglutinin (VAK952 without LR2 deletion in the promoter, VAK1243 with LR2 deletion in the promoter), it was possible to show that the cytopathic effect of the influenza A HA antigen is suppressed and growth under noninducing conditions is improved as a result of the LR2 deletion (FIG. 3, panel C).

Example 3: Versatile Vector System for the Targeted Integration of Multiple Expression Cassettes into the K. lactis Genome

[0135] As before for VAK367-D4 (Krijger et al. (2012), WO 20101054649), the yeast strain VAK367 forms the genetic background of all K. lactis strains described here. This strain background has a need for uracil and methionine (uracil-and-methionine auxotrophy) owing to mutations in two genes, KIURA3 (KLLA0E22771g) and KIMET5 (KLLA0B03938g), which are referred to as alleles KIura3-20 (absent base pair at position +345) and KImet5-1 (G2555A; and A3682T); the alleles are thus nonfunctional gene variants.

[0136] These mutated alleles were used in order to use further loci for targeted integration besides the integration site LAC4 already developed with the KIp3/KIp3-MCS (Krijger et al. (2012)) and to thereby generate multivalent vaccine strains (FIG. 4, panel A). Selection is achieved by restoring the gene function of these mutated genes without additional insertion of a selection marker. To this end, new integration vectors were created. In said vectors, the expression cassettes (under the control of the LAC4-12 promoter or the variants thereof in each case) are flanked by gene segments which allow the upstream integration of the KIURA3 gene and downstream integration of the KIMET5 gene by homologous recombination and restore the wild-type sequences of these genes at the same time.

[0137] Further loci can be analogously developed as integration sites by mutagenesis and selection for auxotrophy for alternative growth substances.

Example 3.1: Vectors KIpURA3 and KIpMET5 for the Targeted Integration of Expression Cassettes (Having an Inducible LAC4-12 Promoter) at the KIURA3 (KLLA0E22771g) and/or KIMET5 (KLLA0B03938g) Loci of K. lactis Strains Having the KIura3-20 and/or KImet5-1 Allele

[0138] The integrative expression vectors KIpURA3 (SEQ ID No.: 3) and KIpMET5 (SEQ ID No.: 4) were constructed by means of suitable gene fragments (KIMET5/KIURA3 targeting sequences) which allow a targeted restoration of the functionality of the KIura3-20 and KImet5-1 alleles, respectively.

[0139] The KIpMET5 expression vector contains the expression cassette consisting of the LAC4-12 promoter (P.sub.LAC4-12 or the variants thereof), the encoding nucleic acid sequence of the antigen to be expressed and the AgTEF1 terminator; it is flanked upstream by the genomic KIMET5 fragment having an introduced ScCYC1 terminator and downstream by the KIAIM18 promoter having a downstream KIAIM18 gene.

[0140] The KIpURA3 expression vector contains the expression cassette consisting of the LAC4-12 promoter (P.sub.LAC4-12 or the variants thereof), the encoding nucleic acid sequence of the antigen to be expressed and the AgTEF1 terminator; it is flanked upstream by KLLAOE22749g having an associated promoter and downstream by the KIURA3 promoter having a downstream KIURA3 fragment (FIG. 4, panels B, C).

[0141] In each case, the antigen-encoding sequence is cloned between promoter and terminator via AscI and NotI restriction sites. By Eco91I or KpnI restriction of the resultant plasmid, the entire expression cassette is separated from the KIpURA3 vector backbone, and by HindIII or BoxI restriction of the resultant plasmid, the entire expression cassette is separated from the KIpMET5 vector backbone, and the restriction material is transformed into K. lactis host strains having a KIura3-30 and/or KImet5-1 allele. The foreign gene-containing expression cassette integrated in this way into KIURA3-20 or KIMET5-1 thus exactly corresponds to that which is also integrable into LAC4 in VAK367-D4 with the KIp3-MCS vector (WO 20101054649). Checking for uracil-prototrophic and/or methionine-prototrophic transformants is carried out in a standard manner via colony PCR using the primers MAB6 and VK211 for KIpMET5 transformants, and the primers MAB6 and VK71 for KIpURA3 transformants. Integration of the expression cassette at the correct target site between KIURA3 or KIMET5 and the respectively adjacent gene yields products of 1652 bp in size for KIpMET5 transformants and of 1307 bp in size for KIpURA3 transformants. No indications were obtained that the functionality of the neighboring genes is impaired by the insertion.

TABLE-US-00002 Primers: MAB6: (SEQIDNo.:11) 5-CCCAGATGCGAAGTTAAGTG-3 VK71: (SEQIDNo.:12) 5-TACAACAGATCACGTGATCTTTTTGTAAG-3 VK211: (SEQIDNo.:13) 5-GATTTCGTAACCCTATTGTTCATGAATG-3

Example 3.2: Expression of a Foreign Antigen after Integration of the Encoding Gene Cassette at the KIURA3 or KIMET5 Locus

[0142] A foreign gene under the control of the P.sub.LAC4-12 promoter is induced approximately equally strongly by lactose after integration at the LAC4, KIURA3 and KIMET5 locus. The heat-labile, nontoxic, enterotoxin subunit B (Etx.B) from E. coli and an (HA).sub.3 epitope at the C-terminus (Etx.B-HA) was used as test protein for evaluating the vector system. The encoding sequence was cloned into the vectors KIpMET5, KIpURA3 and KIp3-MCS and integrated at the gene loci KIMET5 (VAK1251), KIURA3 (VAK1235) and LAC4 (VAK899) (FIG. 4, panel D). As shown by western blotting, the concentration of the Etx.B-HA protein in all three strains is very similar (FIG. 4, panel D). Therefore, it was not possible to establish any position effect, dependent on the integration site of the expression cassette in the genome, on the amount of recombinant protein production.

Example 3.3: Coexpression of Two Foreign Antigens in the Same Yeast Cell

[0143] The possibility of producing different heterologous proteins under the control of the P.sub.LAC4-12 promoter in the same yeast strain via the new vector system was able to be shown by the construction of a yeast strain having an Etx.B-HA expression cassette at the KIURA3 locus and an expression cassette at the LAC4 locus having two VP21BDV copies present as a tandem (VAK1234; FIG. 5; see below and FIG. 7 for an explanation of the tandem cassette). Compared to yeast strains in which only one of the expression cassettes was present in the genome in each case (VAK1235 or VAK1171), it was not possible to establish any reduction in the protein concentration of Etx.B-HA or VP21BDV in the case of VAK1234.

Example 4: LAC4 Promoter Variants for Modulating Recombinant Protein Synthesis Under Similar Induction Conditions

[0144] The immunogenic effect of antigens is often based on the assembling of multiple proteins in a nonstoichiometric ratio. To make this possible in yeast-based vaccines, variants of the P.sub.LAC4-12LR2 promoter were generated (FIG. 6, panel A) which can be differently induced by lactose or galactose. They are characterized by the number of binding sites for the activator KIGal4 (U1, U2, U4, U5; G?decke et al. (1991)) and the presence/absence of the basal control region BCR. In addition to the constructs shown in FIG. 3, panel A, which were inserted into the KIpURA3 vector, it was possible to generate promoter variants having increased promoter strength by insertion of further binding sites. The result of this is synthetic, lactose-inducible promoters for expanding the vector system and it is possible to realize different protein production or gene expression rates under the same induction conditions.

Example 4.1: Expression of a Foreign Antigen Under the Control of Various LAC4 Promoter Variants

[0145] Expression of Etx.B-HA under the control of four LAC4-12 promoter variants. What were tested were four LAC4 promoter variants differing in the number of binding sites for the transcription activator KIGal4 and the presence/absence of a control region for basal expression under noninducing conditions (basal control region, BCR; FIG. 6, panel A; SEQ ID No.: 14). Using said promoter variants, the KIpURA3-Et vector variants KIpURA3-PL412-Et, KIpURA3-PL412LR2-Et, KIpURA3-PL4-Et and KIpURA3-PL4LR2 were generated and the Etx.B-HA protein was inserted as test GOI in each case. As described above, the insertion of alternative GOIs is possible via the restriction sites AscI and NotI. The expression cassettes were integrated into the KIURA3 locus and the protein concentration of Etx.B-HA was quantified via western blotting (FIG. 6, panel B). What is shown is that, under identical induction conditions (4 h in complete medium containing lactose), the longest promoter variant P.sub.LAC4-12, which comprises the entire intergenic region between the LAC4 and LAC12 gene and contains four KIGal4-binding sites (U1, U2, U4, U5) (G?decke et al. (1991)), leads to the highest protein concentration. If only the two U1 and U2 binding sites proximal to LAC4 are present (?1064 to ?10), the additional deletion of the BCR (?1540 to ?1065) also has a protein-reducing effect under inducing conditions.

Example 5: Raising of Antigen Production by Increasing the Copy Number of the Antigen-Encoding Gene

[0146] The above-described vector system was therefore modified in order to rapidly and efficiently connect multiple gene copies in series and to introduce this expression cassette in one step at one of the three gene loci (FIG. 7, panel A).

[0147] To produce a tandem expression cassette integrable at the LAC4 locus, three PCR-amplified fragments are fused by any desired KIp3(-MCS)-GOI template in one step (in-fusion cloning): (1 and 2) expression cassette containing P.sub.LAC4-LR2 and T.sub.TEF (primers: VK30 & VK31, and VK32 & VK33) and (3) LAC4 targeting sequence (VK34 & VK35)). After restriction, for example using HpaI, the tandem expression cassette can be integrated into the lac4::URA3 locus as described (FIG. 7). After successful integration of the expression cassette, the first foreign gene copy is regulated by either P.sub.LAC4-12 or P.sub.LAC4-12-LR2 depending on the starting strain and the second is regulated by PLAC4-LR2. Alternatively, insertion of a selection marker between the two expression cassettes into the restriction sites SmiI, MluI or PmeI and removal of the LAC4 targeting sequence via KpnI give rise to a tandem cassette which can be integrated into the genome in an undirected manner via NHEJ. If the expression cassette is cut out using MreI and Aval, the compatible ends can be ligated and long, multiple expression cassettes can thereby be generated. By repeated restriction using MreI and Aval, fragments in which the expression cassettes are arranged in tandem (head to tail) are enriched in the ligation mix. They are transformed and integrated in an undirected manner under selection for the marker.

TABLE-US-00003 Primers: VK30: (SEQIDNo.:15) 5- TATAGGGCGAATTGGAGCTCCGCCGGCGGAAGAGGTAACGCCTTTTGTTA AC-3 VK31: (SEQIDNo.:16) 5-CTAAACGGAACTCGCATTTAAATCTCGTTTTCGACACTGGATGG-3 VK32: (SEQIDNo.:17) 5- GCGAGTTCCGTTTAGACGCGTTTAAACTTGTTTAATTATTATGGGGCAGG CGAGA-3 VK33: (SEQIDNo.:18) 5-CGGGGAATGCGCTGCTTTTCGACACTGGATGGCGGCGTTA-3 VK34: (SEQIDNo.:19) 5-GCAGCGCATTCCCCGGGTACCGCTCTCGACTAGGTGATTAGCG-3 VK35: (SEQIDNo.:20) 5- AAAAGCTGGGTACCGGGCCCACTAGTCGAGAGTTAACCGTGACTACAGCT A-3

Example 5.1: Successful Use of the Multicopy Strategy

[0148] The strategy was confirmed using IBDV-VP2 as antigen and a KIp3-derived expression cassette containing two IBDV-VP2-encoding sequences (CDS-VP2.sub.IBDV) in tandem. The tandem IBDV-VP2 expression cassette (FIG. 7, panel A) in the KIp3 vector (plasmid KIp3-tandem-oVP2.sub.T2S, SEQ ID No.: 21) consists of two LAC4 promoter-regulated encoding sequences for VP2.sub.IBDV (CDS-VP2.sub.IBDV) from KIp3-MCS-oVP2.sub.T2S (Arnold et al., (2012)). The promoter sequences consist of the region ?1123 to ?10 of the LAC4 promoter for the first copy, and ?1099 to ?10 for the second copy. Both CDS-VP2.sub.IBDV are flanked at the 3 end by an AgTEF1 terminator. The plasmid KIp3-tandem-oVP2.sub.T2S was cut using HpaI and the restriction material was transformed into strain VAK367-D4. The yeast strain VAK1118 thus generated contains the tandem expression cassette integrated at the LAC4 locus. As shown by western blotting, there is a higher IBDV-VP2 protein concentration in said strain compared to the isogenic strain having only one copy (FIG. 7, panel B). The tandem expression cassette is genetically highly stable: after growth over 78 generations in inducing medium (YNB+Lactose), none of 100 colonies tested by PCR exhibited a genetic change to the expression cassette (data not shown).

Example 6: Tools for Producing Prototrophy in K. lactis Strains for Simplified Fermentation in Synthetic Medium and Complete Medium

[0149] In studies carried out, it had become apparent that uracil-auxotrophic yeast strains grow more poorly in complete medium than uracil-prototrophic strains, an effect which could be neutralized only in part by the addition of uracil. To simplify the fermentation of the vaccines strains, to facilitate the establishment of the production processes and to make them more cost-efficient and to avoid growth effects due to insufficient uptake of methionine and/or uracil, what should therefore be found are ways of rapidly and reproducibly achieving the neutralization of these auxotrophies that are required for strain construction. For the reconstitution of KIURA3 from KIura3-20, a DNA fragment is generated via PCR with the aid of the primers VK67 and VK69 and the wild-type KIURA3 gene as template (FIG. 8, panel A). To repair the KImet5-1 allele, a PCR fragment is analogously generated with the aid of the primers VK74 and VK75 and the wild-type allele KIMET5 as template (FIG. 8, panel B). Transformation of the PCR fragments into the corresponding mutated strains (individually or together) and selection on medium without methionine and/or without uracil led to reconstitution of the wild-type alleles with high efficiency. This process was carried out in order, inter alia, to generate the strains VAK1171 and VAK1400 (see above).

TABLE-US-00004 Primers VK67: (SEQIDNo.:22) 5-GACATCACTGTCTCTTCCCCTTAATGATC-3 VK69: (SEQIDNo.:23) 5-TCAGCAAGCATCAATAATCCCCTTGGTTC-3 VK74: (SEQIDNo.:24) 5-GAAAGAAAGACGTTGGTCTCTACGCTTG-3 VK75: (SEQIDNo.:25) 5-AGATTATAAGTTCCTGGGGCTTTACCCAC-3

Example 7: Protective Immunization by Optimized, Inactivated Vaccine Yeasts

[0150] The modifications and optimizations of the K. lactis vaccine platform that were carried out as per Examples 1 to 5 were validated in various vaccination studies.

Example 7.1: Immunogenicity of an Optimized K. lactis Platform, Using the Example of an IBDV-VP2 Yeast Strain (VAK1127)

[0151] The VAK1127 strain contains a tandem IBDV-VP2 expression cassette (SEQ ID No.: 21), two KIGAL4 copies and the LR2 deletion in the LAC4 promoter. To characterize the immunogenicity of the yeast strain, immunization experiments were carried out in the target organism chicken. In challenge experiments, complete protection of SPF chickens against the very virulent (vv) IBDV strain 89163/7.3 (AFSSA, Ploufragan, France) that has been well characterized by Eterradossi and colleagues (1997) was achieved (Table 1 and 2). To this end, in the two experiments independently carried out, 1 mg of lyophilized, heat-inactivated (2 h, 90? C.) yeast (VAK1127) with incomplete Freund's adjuvant (IFA) was administered two times (FIG. 9, panels A and B) subcutaneously (prime-boost). The administrations were carried out two weeks and four weeks after hatching, and the viral exposure (challenge) was effected six weeks after hatching. After 19 days, high titers of anti-IBDV-VP2 antibodies are already measurable in the case of the VAK1127-vaccinated animals. In the controls, titers of anti-IBDV-VP2 antibodies only occur after challenge with vvIBDV (FIG. 9). In both experiments, complete protection (0% morbidity, 0% mortality) of the VAK1127-vaccinated animals against the challenge with vvIBDV was observed (Table 1 and 2). With these experiments, it was possible to observe protection against vvIBDV using a subunit vaccine in a classic primer-boost vaccination method.

[0152] The immunogenicity of the vaccine yeasts is not influenced by the genetic back-mutation to antigen-bearing prototrophic yeast strains. It was possible to demonstrate this in a vaccination experiment in mouse with the aid of the auxotrophic form or prototrophic form of an IBDV-VP2 yeast strain (FIG. 10, panel C). The yeast strain VAK1127 (auxotrophic) was, as described above (Example 6; FIG. 8), made prototrophic in two steps using PCR fragments for creating VAK1171. Both strain forms exhibit no significant difference in the expression level of recombinant protein (FIG. 10, panels A and B). The mice were vaccinated three times subcutaneously with 0.1 mg of heat-inactivated yeast subcutaneously with IFA at two-week intervals. It was not possible to establish any difference in the strength of seroconversion between the auxotrophic IBDV-VP2 strain (VAK1127) and the prototrophic descendant (VAK1171) (FIG. 10, panel C).

Example 7.2: Complete Protection by Vaccination in a One-Shot Scheme

[0153] A one-shot vaccination, i.e., vaccination by a single administration of the vaccine, is normally not effective with subunit vaccines owing to lack of immunogenicity. However, the antibody titer-developing data obtained using the optimized strain VAK1127 in the prime/boost method (FIG. 9) indicate the possibility of obtaining protection even in a one-shot approach. This was checked by carrying out a one-shot vaccination with the prototrophic yeast strain VAK1171 (FIG. 11; Table 3). To this end, the yeast was administered only singly, in an elevated dose for this purpose (10 mg), and a challenge was then carried out at an interval of 4 weeks. It became apparent that, with VAK1171, complete protection against vvIBDV (0% morbidity, 0% mortality) can actually be achieved using one shot (Table 3). This result could be attributed to the development of high, protective antibody titers, approx. 20 days after vaccination (FIG. 11). The fact that a one-shot vaccination scheme protects against vvIBDV with a high degree of protection shows the strong immunogenic potential of the vaccine used and provides impressive validation of the optimized vaccine platform.

Example 7.3: Improved Protection of a Bivalent Yeast Vaccine Compared to a Monovalent Yeast Vaccine when Used Against Influenza a Virus Infections

[0154] To vaccinate against influenza virus type A, three different vaccines strains were generated. Firstly, VAK952 (DSM 32705) was generated, which expresses the major antigen of an influenza A strain (Puerto Rico/8/1934; PR8/34), the HA (hemagglutinin) gene. In VAK952, the gene is integrated into the genome into the LAC4 locus as described by Krijger et al. (2012) and Arnold et al. (2012). Secondly, VAK1283 (DSM 32697) was generated. Here, in addition to the HA gene from PR8/34 in the LAC4 locus, the M1 gene is additionally integrated into the URA3 locus. The M1 gene encodes a further important influenza A antigen which is distinctly more conserved than HA. Reports already published were able to show that combining both antigens can raise the immunogenicity of a vaccine against influenza A and also achieve a cross-protectivity against different influenza viruses. To also validate this aspect with a bivalent yeast vaccine, a further strain (VAK1395; DSM 32706) was generated, which likewise contains the M1 gene in the URA3 locus and where the HA gene from PR8/34 is replaced with the HA gene of the influenza virus California/4/2009. The comparable expression of HA and the additional expression of M1 of the respective strains was checked; it was also shown that the strains exhibit a comparable growth, with VAK1283 having slight advantages over VAK952 (FIG. 12). In vaccination studies in which a prime-boost scheme and one-shot scheme with different yeast concentrations in a mouse model were used in each case, it was shown that VAK952 and VAK1283 each induce comparable titers of virus-neutralizing antibodies (FIG. 13). However, in the challenge experiment, it then became clear that the bivalent VAK1283 vaccine allows maximum protection both in the prime-boost schema and in the one-shot schema, whereas this is not the case with the monovalent VAK952 vaccine. Moreover, with the vaccine VAK1283 in the one-shot experiment at half of the yeast material used, a similar protective effect was achieved as with VAK952 in the prime-boost approach (FIG. 14 and Table 3). In experiments in which VAK1395 was used as vaccine, it was also possible to establish protection against influenza PR8/34. Cross-protection against different influenza variants was thus achieved using a bivalent yeast vaccine.

TABLE-US-00005 TABLE 1 Indications for exposure protection in vaccinated SPF chickens Vaccination (a) VP2 Histopathological amount per bursal lesion Yeast strain vaccine assessment bu/bod index (c) Morbidity Mortality (VAK) dose Adjuvant 0 1 2 3 4 Exposed Unexposed (%) (d) (%) (e) 367 none IFA 1 7 2.80 ? 1.32 5.36 ? 0.65 6/10 (60) 4/10 (40) 1127 4.1 ? 0.25 ?g IFA 8 1 4.40 ? 0.76 4.89 ? 0.63 0/10 0/10 PBS IFA 10 4.08 ? 1.91 4.92 ? 0.94 10/10 (100) 8/10 (80)

TABLE-US-00006 TABLE 2 Indications for exposure protection in vaccinated SPF chickens Histopathological Vaccination (a) bursal lesion Yeast strain VP2 amount per assessment bu/bod index (c) Morbidity Mortality (VAK) vaccine dose Adjuvant 0 1 2 3 4 Exposed Unexposed (%) (d) (%) (e) 1127 4.1 ? 0.71 ?g IFA 6 5.10 ? 0.78 4.81 ? 1.20 0/9 (0) 0/9 (0) PBS IFA 8 4.09 ? 1.87 5.32 ? 0.85 9/9 (100) 7/9 (78)

TABLE-US-00007 TABLE 3 Indications for exposure protection in vaccinated SPF chickens Histopathological Vaccination (a) bursal lesion Yeast strain VP2 amount per assessment bu/bod index (c) Morbidity Mortality (VAK) vaccine dose Adjuvant 0 1 2 3 4 Exposed Unexposed (%) (d) (%) (e) PBS none MF59 9 3.73 ? 1.92 4.77 ? 1.02 9/9 (100) 6/9 (66) VAK367 none MF59 10 4.09 ? 1.58 3.60 ? 0.89 10/10 (100) 9/10 (90) VAK1171 35 ? 4.2 ?g IFA 10 4.48 ? 0.37 3.96 ? 1.02 0/10 (0) 0/10 (0)

[0155] Explanatory Notes for Table 1 [0156] (a) The chickens were vaccinated subcutaneously with 1 mg of yeast (or PBS) and IFA as adjuvant two weeks after hatching. Two weeks after vaccination, they were boosted in the same manner. Another two weeks later, the viral exposure test was carried out via the oculonasal route with 10.sup.4 EID vvIBDV (very virulent 89163/7.3). Inactivated, whole yeast of the strain VAK1127 was used as vaccine yeast, and a group which was only vaccinated with PBS and IFA was used as the infection control. A group in which wild-type yeast without antigen (VAK367) was administered acted as the control for the yeast effect alone. [0157] (b) The histopathological bursal lesion assessment was carried out using a scale of 0-4: 0: no lesions; 1: 5-25% of follicles affected; 2: 26-50% of follicles affected; 3: 51-75% of follicles affected; 76-100% bursal damage (loss of structure). [0158] (c) The mean value of the bursa-to-body weight index (bu/bod) was calculated using the formula: (bursa weight/body weight)*1000. The nonexposed control group consisted of at least seven chickens, the exposed group ten. The standard deviation is given. [0159] (d) Morbidity is represented as the number of morbid chickens per number of chickens in the group overall. The percentage of morbid chickens is shown between parentheses. [0160] (e) Mortality is represented as the number of dead chickens per number of chickens in the group overall. The percentage of dead chickens is shown between parentheses.

[0161] Explanatory Notes for Table 2 [0162] (a) The chickens were vaccinated subcutaneously with 1 mg of yeast (or PBS) and IFA as adjuvant two weeks after hatching. Two weeks after vaccination, they were boosted in the same manner. Another two weeks later, the viral exposure test was carried out via the oculonasal route with 10.sup.4 EID vvIBDV (very virulent 89163/7.3). Inactivated, whole yeast of the strain VAK1127 was used as vaccine yeast, and a group which was only vaccinated with PBS and IFA was used as the infection control. [0163] (b) The histopathological bursal lesion assessment was carried out using a scale of 0-4: 0: no lesions; 1: 5-25% of follicles affected; 2: 26-50% of follicles affected; 3: 51-75% of follicles affected; 76-100% bursal damage (loss of structure). [0164] (c) The mean value of the bursa-to-body weight index (bu/bod) was calculated using the formula: (bursa weight/body weight)*1000. The nonexposed control group consisted of at least five chickens, the exposed group nine. The standard deviation is given. [0165] (d) Morbidity is represented as the number of morbid chickens per number of chickens in the group overall. The percentage of morbid chickens is shown between parentheses. [0166] (e) Mortality is represented as the number of dead chickens per number of chickens in the group overall. The percentage of dead chickens is shown between parentheses.

[0167] Explanatory Notes for Table 3 [0168] (a) The chickens were vaccinated subcutaneously with 10 mg of yeast (or PBS) and IFA as adjuvant two weeks after hatching. Four weeks later, the viral exposure test was carried out via the oculonasal route with 10.sup.4 EID vvIBDV (very virulent 89163/7.3). Inactivated, whole yeast of the strain VAK1171 was used singly yeast vaccine. The infection control used was, firstly, a group vaccinated only with PBS and MF59 and, secondly, a group vaccinated with wild-type yeast and MF59; two weeks after the first vaccination, both were administered a boost containing the same amount of yeast or PBS. [0169] (b) The histopathological bursal lesion assessment was carried out using a scale of 0-4: 0: no lesions; 1: 5-25% of follicles affected; 2: 26-50% of follicles affected; 3: 51-75% of follicles affected; 76-100% bursal damage (loss of structure). [0170] (c) The mean value of the bursa-to-body weight index (bu/bod) was calculated using the formula: (bursa weight/body weight)*1000. Each group consisted of at least nine chickens. The standard deviation is given. [0171] (d) Morbidity is represented as the number of morbid chickens per number of chickens in the group overall. The percentage of morbid chickens is shown between parentheses. [0172] (e) Mortality is represented as the number of dead chickens per number of chickens in the group overall. The percentage of dead chickens is shown between parentheses.

[0173] Sequences

[0174] The patent application contains the following sequences as part of the description:

TABLE-US-00008 SEQ ID. No. Designation 1 K. lactis avt3::LAC9 2 P.sub.LAC4-12-LR2 3 KlpURA3 vector 4 KlpMET5 vector 5 LAC4-12 promoter variant PLAC4-12 6 LAC4-12 promoter variant P.sub.LAC4-12-LR2 7 LAC4-12 promoter variant P.sub.LAC4 8 LAC4-12 promoter variant P.sub.LAC4-LR2 9 Primer sequence VK183 10 Primer sequence VK184 11 Primer sequence MAB6 12 Primer sequence VK71 13 Primer sequence VK211 14 BCR from P.sub.LAC4-12 15 Primer sequence VK30 16 Primer sequence VK31 17 Primer sequence VK32 18 Primer sequence VK33 19 Primer sequence VK34 20 Primer sequence VK35 21 Klp3-tandem-oVP2T2S 22 Primer sequence VK67 23 Primer sequence VK69 24 Primer sequence VK74 25 Primer sequence VK75

REFERENCES

[0175] Arnold, M.; Durairaj, V.; Mundt, E.; Schulze, K.; Breunig, K. D. & Behrens, S.-E. Protective Vaccination against Infectious Bursal Disease Virus with Whole Recombinant Kluyveromyces lactis Yeast Expressing the Viral VP2 Subunit, PLoS ONE, Public Library of Science, 2012, 7, e42870 [0176] Berthoud, T. K.; Hamill, M.; Lillie, P. J.; Hwenda, L.; Collins, K. A.; Ewer, K. J.; Milicic, A.; Poyntz, H. C.; Lambe, T. & Fletcher, H. A. [0177] Potent CD8+ T-cell immunogenicity in humans of a novel heterosubtypic influenza A vaccine, MVA-NP+M1, Clinical infectious diseases, Oxford University Press, 2011, 52, 1-7 [0178] Bathurst, I. C. [0179] Protein expression in yeast as an approach to production of recombinant malaria antigens, The American journal of tropical medicine and hygiene, ASTMH, 1994, 50, 20-26 [0180] Breunig, K. D. [0181] Multicopy plasmids containing the gene for the transcriptional activator LAC9 are not tolerated by K. lactis cells, Current genetics, Springer, 1989, 15, 143-148 [0182] de Silva; Chandimal, U.; Tanaka, H.; Nakamura, S.; Goto, N. & Yasunaga, T. [0183] A comprehensive analysis of reassortment in influenza A virus, Biology open, The Company of Biologists Ltd, 2012, 1, 385-390 [0184] Eterradossi, N.; Toquin, D.; Abbassi, H.; Rivallan, G.; Cotte, J. & Guittet, M. Passive Protection of Specific Pathogen Free Chicks Against Infectious Bursal Disease by In-Ovo Injection of Semi-Purified Egg-Yolk Antiviral Immunoglobulins, Zoonoses and Public Health, Wiley Online Library, 1997, 44, 371-383 [0185] Gellissen, G. & Hollenberg, C. P. [0186] Application of yeasts in gene expression studies: a comparison of Saccharomyces cerevisiae, Hansenula polymorpha and Kluyveromyces lactis-a review, Gene, Elsevier, 1997, 190, 87-97 [0187] G?decke, A.; Zachariae, W.; Arvanitidis, A. & Breunig, K. D. [0188] Coregulation of the Kluyveromyces lactis lactose permease and ?-galactoidase genes is achieved by interaction of multiple LAC9 binding sites in a 2.6 kbp divergent promoter, Nucleic acids research, Oxford University Press, 1991, 19, 5351-5358 [0189] Granzow, H.; Birghan, C.; Mettenleiter, T. C.; Beyer, J.; K?llner, B. & Mundt, E. [0190] A second form of infectious bursal disease virus-associated tubule contains VP4., Journal of virology, Am Soc Microbiol, 1997, 71, 8879-8885 [0191] Kasanga, C. J.; Yamaguchi, T.; Wambura, P. N.; Maeda-Machang'u, A. D.; Ohya, K. & Fukushi, H. [0192] Molecular characterization of infectious bursal disease virus (IBDV): diversity of very virulent IBDV in Tanzania, Archives of virology, Springer, 2007, 152, 783-790 [0193] Kirchenbaum, G. A. & Ross, T. M. [0194] Eliciting broadly protective antibody responses against influenza, Current opinion in immunology, Elsevier, 2014, 28, 71-76 [0195] Kirunda, H.; Erima, B.; Tumushabe, A.; Kiconco, J.; Tugume, T.; Mulei, S.; Mimbe, D.; Mworozi, E.; Bwogi, J. & Luswa, L. [0196] Prevalence of influenza A viruses in livestock and free-living waterfowl in Uganda, BMC veterinary research, BioMed Central, 2014, 10, 50 [0197] Krammer, F. & Palese, P. [0198] Influenza virus hemagglutinin stalk-based antibodies and vaccines, Current opinion in virology, Elsevier, 2013, 3, 521-530 [0199] Krijger, J.-J.; Baumann, J.; Wagner, M.; Schulze, K.; Reinsch, C.; Klose, T.; Onuma, O. F.; Simon, C.; Behrens, S.-E. & Breunig, K. D. [0200] A novel, lactase-based selection and strain improvement strategy for recombinant protein expression in Kluyveromyces lactis, Microbial Cell Factories, 2012, 11, 112 [0201] Kumar, K.; Singh, K. C. P. & Prasad, C. B. [0202] Immune responses to intermediate strain IBD vaccine at different levels of maternal antibody in broiler chickens, Tropical animal health and production, Springer, 2000, 32, 357-360 [0203] Negash, T.; Gelaye, E.; Petersen, H.; Grummer, B. & Rautenschlein, S. [0204] Molecular evidence of very virulent infectious bursal disease viruses in chickens in Ethiopia, Avian diseases, BioOne, 2012, 56, 605-610 [0205] Rautenschlein, S.; Kraemer, C. H.; Vanmarcke, J. & Montiel, E. [0206] Protective efficacy of intermediate and intermediate plus infectious bursal disease virus (IBDV) vaccines against very virulent IBDV in commercial broilers, Avian diseases, BioOne, 2005, 49, 231-237 [0207] Remington's Practice of Pharmacy, 13th edition and J. of Pharmaceutical Science & Technology, Vol. 52, No. 5, September-October, pages 238-311 [0208] Ridpath, J. F. [0209] Emerging pestiviruses infecting domestic and wildlife hosts, Animal Health Research Reviews, Cambridge University Press, 2015, 16, 55-59 [0210] RKI, Influenza (Teil2): Erkrankungen durch zoonotische Influenzaviren [Influenza (part 2): diseases due to zoonotic influenza viruses], 2016 [0211] Schrauwen, E. J. A. & Fouchier, R. A. M. [0212] Host adaptation and transmission of influenza A viruses in mammals, Emerging microbes & infections, Nature Publishing Group, 2014, 3, e9 [0213] Short, K. R.; Richard, M.; Verhagen, J. H.; van Riel, D.; Schrauwen, E. J. A.; van den Brand, J. M. A.; M?nz, B.; Bodewes, R. & Herfst, S. [0214] One health, multiple challenges: The inter-species transmission of influenza A virus, One health, Elsevier, 2015, 1, 1-13 [0215] Steel, J.; Lowen, A. C.; Wang, T. T.; Yondola, M.; Gao, Q.; Haye, K.; Garcia-Sastre, A. & Palese, P. [0216] Influenza virus vaccine based on the conserved hemagglutinin stalk domain, MBio, Am Soc Microbiol, 2010, 1, e00018-10 [0217] WHO, Influenza (Seasonal), 2016 [0218] WHO, Biologicals, Influenza, 2017