METHODS OF PRECISE GENOME EDITING BY IN SITU CUT AND PASTE (ICAP)
20240100184 ยท 2024-03-28
Inventors
- Ping Jiang (Bryn Mawr, PA, US)
- Kevin M. Kemper (Voorhees, NJ, US)
- Salvatore J. Caradonna (Voorhees, NJ, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
A61K31/7088
HUMAN NECESSITIES
A61K38/465
HUMAN NECESSITIES
C12N2800/80
CHEMISTRY; METALLURGY
A61K48/0016
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
A61K31/7088
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
Abstract
The present invention relates to innovative means of DNA sequence editing involving in-situ cut-and-paste (iCAP) or alternatively cut-and-paste in-situ (CAPi). Thus, in various embodiments described herein, the methods of the invention relate to methods of generating paired-end nucleic acid fragment sharing common linker nucleic acid sequences using a nicking endonuclease, a T7 endonuclease, a restriction enzyme or a transposase, methods of analyzing the nucleotides sequences from the linked-paired-end sequenced fragments and methods of de novo whole genome mapping.
Claims
1. A method of editing, mutating, or modifying a genomic target DNA sequence in a cell, the method comprising: a. providing a DNA replacement template (RT) comprising (i) the target DNA sequence comprising the desired edited, mutated, and/or modified nucleotide(s), and (ii) a sequence encoding a nuclease, b. contacting the genomic target DNA sequence, the DNA RT, and heterologous guide-RNAs (gRNAs) under conditions that allow for the gRNAs to induce double-strand breaks of the genomic target DNA sequence and the DNA RT by the nuclease generating either blunt ends or overhanging ends, c. subjecting the blunt ends of the genomic target DNA sequence and DNA RT to 5 to 3 DNA end resection to generate complementary 3 overhangs, d. annealing complementary 3 overhangs of the DNA replacement template to the complementary 3 overhang sequences flanking the genomic target DNA sequence, and e. ligating the annealing sites, thereby resulting in incorporation of the DNA RT into the place of the genomic target DNA sequence.
2. The method of claim 1, further comprising: f. subjecting the overhanging ends flanking the endogenous genomic target DNA sequence and the DNA RT to modification resulting in blunt ends, and g. ligating the blunt ends of RT to the genomic target DNA sequence, thereby resulting in incorporation of the DNA RT into the place of the genomic target DNA sequence.
3. The method of claim 1, wherein the blunt ends generated by the nuclease or resulting from modification of the overhanging ends of the target DNA sequence are ligated together, thereby resulting in the deletion of the target DNA sequence.
4. The method of claim 1, wherein the nuclease is a Cas9 nuclease.
5. The method of claim 4, wherein the Cas9 nuclease is a naturally-occurring variant thereof.
6. The method of claim 5, wherein the naturally-occurring Cas9 nuclease variant comprises at least one of SpCas9, SaCas9, StCas9, NmCas9, FnCas9, CjCas9, CasX, CasY, Cas12a, Cas14a, BlCas9, ScCas9, LmoCas9, TdCas9, Nme2Cas9, GsCas9, BlatCas9, and FnCas9-RHA.
7. The method of claim 6, wherein the naturally-occurring Cas12a nuclease variant comprises at least one of AsCpf1, FnCpf1, LbCpf1, AsCpf1-RR, LbCpf1-RR, and AsCpf1-RVR.
8. The method of claim 1, wherein the nuclease is a Cas variant nuclease.
9. The method of claim 8, wherein the Cas variant nuclease comprises at least one of Cas13a/b(C2c2), Cas12b(C2c1), and Cas12c(C2c3).
10. The method of claim 1, wherein the Cas9 nuclease is an engineered variant thereof.
11. The method of claim 10, wherein the engineered Cas9 nuclease variant comprises at least one of eSpCas9, SpCas9-HF1, Fok1-Fused dCas9, xCas9, SpCas9-VQR, SpCas9-VRER, SpCas9-D1135E, SpCas9-EQR, SpCas9-QQR1, Cas9-DD, HypaCas9, evoCas9, xCas9-3.7, SniperCas9, Cas9-CtIP, SpCas9-NG, Split-SpCas9, SpCas9-K855A, ScCas9+, ScCas9++, SaCas9-KKH, and SaCas9.
12. The method of claim 1, wherein the cell is a eukaryotic cell.
13. The method of claim 12, wherein the eukaryotic cell is a mammalian cell.
14. The method of claim 13, wherein the mammalian cell is part of a tissue or organism and the method is performed in situ.
15. The method of claim 13, wherein the mammalian cell is a developing embryo.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] For the purpose of illustrating the invention, there are depicted in the drawings certain embodiments of the invention. However, the invention is not limited to the precise arrangements and instrumentalities of the embodiments depicted in the drawings.
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0041] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described.
[0042] As used herein, each of the following terms has the meaning associated with it in this section.
[0043] The articles a and an are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, an element means one element or more than one element.
[0044] About as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ?20% or ?10%, more preferably ?5%, even more preferably ?1%, and still more preferably ?0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
[0045] A disease is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated, then the animal's health continues to deteriorate. In contrast, a disorder in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
[0046] As used herein, isolated means altered or removed from the natural state through the actions, directly or indirectly, of a human being. For example, a nucleic acid or a peptide naturally present in a living animal is not isolated, but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is isolated. An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
[0047] By nucleic acid is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).
[0048] The term, polynucleotide includes cDNA, RNA, DNA/RNA hybrid, anti-sense RNA, siRNA, miRNA, snoRNA, genomic DNA, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified to contain non-natural or derivatized, synthetic, or semisynthetic nucleotide bases. Also, included within the scope of the invention are alterations of a wild type or synthetic gene, including but not limited to deletion, insertion, substitution of one or more nucleotides, or fusion to other polynucleotide sequences.
[0049] Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5-direction.
[0050] The term oligonucleotide typically refers to short polynucleotides, generally no greater than about 60 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which U replaces T.
[0051] As used herein, the terms peptide, polypeptide, or protein are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that may comprise the sequence of a protein or peptide. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. Polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs and fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides or a combination thereof. A peptide that is not cyclic will have a N-terminal and a C-terminal. The N-terminal will have an amino group, which may be free (i.e., as a NH.sub.2 group) or appropriately protected (for example, with a BOC or a Fmoc group). The C-terminal will have a carboxylic group, which may be free (i.e., as a COOH group) or appropriately protected (for example, as a benzyl or a methyl ester). A cyclic peptide does not have free N- or C-terminal, since they are covalently bonded through an amide bond to form the cyclic structure. Amino acids may be represented by their full names (for example, leucine), 3-letter abbreviations (for example, Leu) and 1-letter abbreviations (for example, L). The structure of amino acids and their abbreviations may be found in the chemical literature, such as in Stryer, Biochemistry, 3rd Ed., W. H. Freeman and Co., New York, 1988. tLeu represents tert-leucine. neo-Trp represents 2-amino-3-(1H-indol-4-y)-propanoic acid. DAB is 2,4-diaminobutyric acid. Orn is ornithine. N-Me-Arg or N-methyl-Arg is 5-guanidino-2-(methylamino) pentanoic acid.
[0052] Sample or biological sample as used herein means a biological material from a subject, including but is not limited to organ, tissue, cell, exosome, blood, plasma, saliva, urine and other body fluid, A sample can be any source of material obtained from a subject.
[0053] The terms subject, patient, individual, and the like are used interchangeably herein, and refer to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein. In certain non-limiting embodiments, the patient, subject or individual is a human. Non-human mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals. Preferably, the subject is human. The term subject does not denote a particular age or sex.
[0054] The term measuring according to the present invention relates to determining the amount or concentration, preferably semi-quantitatively or quantitatively. Measuring can be done directly.
[0055] As used herein the term amount refers to the abundance or quantity of a constituent in a mixture.
[0056] The term concentration refers to the abundance of a constituent divided by the total volume of a mixture. The term concentration can be applied to any kind of chemical mixture, but most frequently it refers to solutes and solvents in solutions.
[0057] As used herein, the terms reference, or threshold are used interchangeably, and refer to a value that is used as a constant and unchanging standard of comparison.
[0058] As used herein, paired-end sequencing is a sequencing method that is based on high throughput sequencing, particular based on the platforms currently sold by Illumina and Roche. Illumina has released a hardware module (the PE Module) which can be installed in an existing sequencer as an upgrade, which allows sequencing of both ends of the template, thereby generating paired end reads. Paired end sequencing may also be conducted using Solexa technology in the methods according to the current invention. Examples of paired end sequencing are described for instance in US20060292611 and in publications from Roche (454 sequencing).
[0059] As used herein the term sequencing refers to determining the order of nucleotides (base sequences) in a nucleic acid sample, e.g. DNA or RNA. Many techniques are available such as Sanger sequencing and high-throughput sequencing technologies (also known as next-generation sequencing technologies) such as the GS FLX platform offered by Roche Applied Science, based on pyrosequencing.
[0060] A restriction endonuclease or restriction enzyme refers to an enzyme that recognizes a specific nucleotide sequence (target site) in a double-stranded DNA molecule, and will cleave both strands of the DNA molecule at or near every target site, leaving a blunt or a staggered end.
[0061] A Type-IIs restriction endonuclease refers to an endonuclease that has a recognition sequence that is distant from the restriction site. In other words, Type IIs restriction endonucleases cleave outside of the recognition sequence to one side. Examples thereof are NmeAlll (GCCGAG(21/19)) and FokI, AlwI, Mme I. Also included in this definition are Type IIs enzymes that cut outside the recognition sequence at both sides.
[0062] A Type IIb restriction endonuclease cleaves DNA at both sides of the recognition sequence.
[0063] Restriction fragments or DNA fragments refer to DNA molecules produced by digestion of DNA with a restriction endonuclease are referred to as restriction fragments. Any given genome (or nucleic acid, regardless of its origin) can be digested by a particular restriction endonuclease into a discrete set of restriction fragments. The DNA fragments that result from restriction endonuclease cleavage can be further used in a variety of techniques and can, for instance, be detected by gel electrophoresis or sequencing. Restriction fragments can be blunt ended or have an overhang. The overhang can be removed using a technique described as polishing. The term internal sequence of a restriction fragment is typically used to indicate that the origin of the part of the restriction fragment resides in the sample genome, i.e. does not form part of an adapter. The internal sequence is directly derived from the sample genome, its sequence is hence part of the sequence of the genome under investigation.
[0064] The term transposon or transposable element (TE) or retrotransposon refers to a DNA sequence that can change its position within the genome, sometimes creating or reversing mutations and altering the cell's genome size. Transposition often results in duplication of the TE. Transposable elements (TEs) represent one of several types of mobile genetic elements. TEs are assigned to one of two classes according to their mechanism of transposition, which can be described as either copy and paste (class I TEs) or cut and paste (class II TEs). Class I TEs are copied in two stages: first they are transcribed from DNA to RNA, and the RNA produced is then reverse transcribed to DNA. This copied DNA is then inserted at a new position into the genome. The reverse transcription step is catalyzed by a reverse transcriptase. The cut-and-paste transposition mechanism of class II TEs does not involve an RNA intermediate. The transpositions are catalyzed by several transposase enzymes. Some transposases non-specifically bind to any target site in DNA, whereas others bind to specific DNA sequence targets. The transposase makes a staggered cut at the target site resulting in single-strand 5 or 3 DNA overhangs (sticky ends). This step cuts out the DNA transposon, which is then ligated into a new target site; this process involves activity of a DNA polymerase that fills in gaps and of a DNA ligase that closes the sugar-phosphate backbone. This results in duplication of the target site.
[0065] As used herein, Ligation refers to the enzymatic reaction catalyzed by a ligase enzyme in which two double-stranded DNA molecules are covalently joined together is referred to as ligation. In general, both DNA strands are covalently joined together, but it is also possible to prevent the ligation of one of the two strands through chemical or enzymatic modification of one of the ends of the strands. In that case, the covalent joining will occur in only one of the two DNA strands.
[0066] Adapters are short double-stranded DNA molecules with a limited number of base pairs, e.g. about 10 to about 30 base pairs in length, which are designed such that they can be ligated to the ends of restriction fragments. Adapters are generally composed of two synthetic oligonucleotides that have nucleotide sequences which are partially complementary to each other. When mixing the two synthetic oligonucleotides in solution under appropriate conditions, they will anneal to each other forming a double-stranded structure. After annealing, one end of the adapter molecule is designed such that it is compatible with the end of a restriction fragment and can be ligated thereto; the other end of the adapter can be designed so that it cannot be ligated, but this need not be the case (double ligated adapters). Adapters can contain other functional features such as identifiers, recognition sequences for restriction enzymes, primer binding sections etc. When containing other functional features the length of the adapters may increase, but by combining functional features this may be controlled.
[0067] Adapter-ligated restriction fragments refer to restriction fragments that have been capped by adapters on one or both ends.
[0068] As used herein, barcode or tag refer to a short sequence that can be added or inserted to an adapter or a primer or included in its sequence or otherwise used as label to provide a unique barcode (aka barcode or index). Such a sequence barcode (tag) can be a unique base sequence of varying but defined length, typically from 4-16 bp used for identifying a specific nucleic acid sample. For instance 4 bp tags allow 4.sup.4=256 different tags. Using such an barcode, the origin of a PCR sample can be determined upon further processing or fragments can be related to a clone. Also clones in a pool can be distinguished from one another using these sequence based barcodes. Thus, barcodes can be sample specific, pool specific, clone specific, amplicon specific etc. In the case of combining processed products originating from different nucleic acid samples, the different nucleic acid samples are generally identified using different barcodes. Barcodes preferably differ from each other by at least two base pairs and preferably do not contain two identical consecutive bases to prevent misreads. The barcode function can sometimes be combined with other functionalities such as adapters or primers and can be located at any convenient position. A barcode is often used as a fingerprint for labeling a DNA fragment and/or a library and for constructing a multiplex library. The library includes, but not limited to, genomic DNA library, cDNA library and ChIP library. Libraries, of which each is separately labeled with a distinct barcode, may be pooled together to form a multiplex barcoded library for performing sequencing simultaneously, in which each barcode is sequenced together with its flanking tags located in the same construct and thereby serves as a fingerprint for the DNA fragment and/or library labeled by it. A barcode is positioned in between two restriction enzyme (RE) recognition sequences. A barcode may be virtual, in which case the two RE recognition sites themselves become a barcode. Preferably, a barcode is made with a specific nucleotide sequence having 0 (i.e., a virtual sequence), 1, 2, 3, 4, 5, 6, or more base pairs in length. The length of a barcode may be increased along with the maximum sequencing length of a sequencer.
[0069] As used herein, primers refer to DNA strands which can prime the synthesis of DNA. DNA polymerase cannot synthesize DNA de novo without primers: it can only extend an existing DNA strand in a reaction in which the complementary strand is used as a template to direct the order of nucleotides to be assembled. The synthetic oligonucleotide molecules which are used in a polymerase chain reaction (PCR) as primers are referred to as primers.
[0070] As used herein, the term DNA amplification will be typically used to denote the in vitro synthesis of double-stranded DNA molecules using PCR. It is noted that other amplification methods exist and they may be used in the present invention without departing from the gist.
[0071] As used herein, aligning means the comparison of two or more nucleotide sequences based on the presence of short or long stretches of identical or similar nucleotides. Several methods for alignment of nucleotide sequences are known in the art, as will be further explained below.
[0072] Alignment refers to the positioning of multiple sequences in a tabular presentation to maximize the possibility for obtaining regions of sequence identity across the various sequences in the alignment, e.g. by introducing gaps. Several methods for alignment of nucleotide sequences are known in the art, as will be further explained below.
[0073] The term isogenic as used herein refers to sections of nucleotide sequence which are identical on separate DNA molecules or sections of the same larger DNA molecules. For example, the homologous flanking sequences of a replacement template of the current invention can be isogenic or identical to the corresponding sequences of the target locus in the genomic DNA.
[0074] The term contig is used in connection with DNA sequence analysis, and refers to assembled contiguous stretches of DNA derived from two or more DNA fragments having contiguous nucleotide sequences. Thus, a contig is a set of overlapping DNA fragments that provides a partial contiguous sequence of a genome. A scaffold is defined as a series of contigs that are in the correct order, but are not connected in one continuous sequence, i.e. contain gaps. Contig maps also represent the structure of contiguous regions of a genome by specifying overlap relationships among a set of clones. For example, the term contigs encompasses a series of cloning vectors which are ordered in such a way as to have each sequence overlap that of its neighbors. The linked clones can then be grouped into contigs, either manually or, preferably, using appropriate computer programs such as FPC, PHRAP, CAP3 etc.
[0075] Fragmentation refers to a technique used to fragment DNA into smaller fragments. Fragmentation can be enzymatic, chemical or physical. Random fragmentation is a technique that provides fragments with a length that is independent of their sequence. Typically, shearing or nebulisation are techniques that provide random fragments of DNA. Typically, the intensity or time of the random fragmentation is determinative for the average length of the fragments. Following fragmentation, a size selection can be performed to select the desired size range of the fragments
[0076] Physical mapping describes techniques using molecular biology techniques such as hybridisation analysis, PCR and sequencing to examine DNA molecules directly in order to construct maps showing the positions of sequence features.
[0077] Genetic mapping is based on the use of genetic techniques such as pedigree analysis to construct maps showing the positions of sequence features on a genome
[0078] The term genome, as used herein, relates to a material or mixture of materials, containing genetic material from an organism. The term genomic DNA as used herein refers to deoxyribonucleic acids that are obtained from an organism. The terms genome and genomic DNA encompass genetic material that may have undergone amplification, purification, or fragmentation.
[0079] The term reference genome, as used herein, refers to a sample comprising genomic DNA to which a test sample may be compared. In certain cases, reference genome contains regions of known sequence information.
[0080] The term double-stranded as used herein refers to nucleic acids formed by hybridization of two single strands of nucleic acids containing complementary sequences. In most cases, genomic DNA are double-stranded.
[0081] As used herein, the term single nucleotide polymorphism, or SNP for short, refers to single nucleotide position in a genomic sequence for which two or more alternative alleles are present at appreciable frequency (e.g., at least 1%) in a population.
[0082] The term chromosomal region or chromosomal segment, as used herein, denotes a contiguous length of nucleotides in a genome of an organism. A chromosomal region may be in the range of 1000 nucleotides in length to an entire chromosome, e.g., 100 kb to 10 MB for example.
[0083] The terms sequence alteration or sequence variation, as used herein, refer to a difference in nucleic acid sequence between a test sample and a reference sample that may vary over a range of 1 to 10 bases, 10 to 100 bases, 100 to 100 kb, or 100 kb to 10 MB. Sequence alteration may include single nucleotide polymorphism and genetic mutations relative to wild-type. In certain embodiments, sequence alteration results from one or more parts of a chromosome being rearranged within a single chromosome or between chromosomes relative to a reference. In certain cases, a sequence alteration may reflect a difference, e.g. abnormality, in chromosome structure, such as an inversion, a deletion, an insertion or a translocation relative to a reference chromosome, for example.
[0084] As used herein, the term endonuclease refers to a family of enzymes that has an activity described as EC 3.1.21, EC 3.1.22, or EC 3.1.25, according to the IUBMB enzyme nomenclature. Site-specific endonucleases recognize specific nucleotide sequences in double-stranded DNA. Some sequence-specific endonucleases cleave only one of the strands in a duplex and are referred to herein as nicking endonucleases. Nicking endonuclease catalyzes the hydrolysis of a phosphodiester bond, resulting in either a 5 or 3 phosphomonoester.
[0085] A site-specific nicking endonuclease, as used herein, denotes a nicking endonuclease that cleaves one strand of a double-stranded nucleic acid by recognizing a specific sequence on the nucleic acid. The cleavage site or nick site of the phosphodiester backbone may fall within or immediately adjacent the recognition sequence of the site-specific nicking endonuclease.
[0086] The terms edited fragment, edited isogenic fragment, edited DNA fragment, edited isogenic DNA fragment, repair fragment, patching repair template, donor fragment, donor construct, DNA donor, and inserted construct are interchangeable terms used herein to describe a polynucleotide molecule which is pre-constructed in vitro and used to replace the endogenous, homologous section of genomic DNA after it is cleaved from a DNA replacement template. The edited DNA fragment contains the identical endogenous DNA sequences with altered nucleotide compositions, and the edited DNA fragment can additionally includes overhang substrate sequences that are the endogenous DNA sequences adjacent to 5 and 3 ends of the excised DNA section of genome and placed on both of the 5 and 3 ends of the edited fragment.
[0087] The term overhang substrates, homology arms, and homology regions are interchangeable terms used herein to refer to homologous DNA sequences flanking the target DNA sequence in both the repair template and genomic DNA. Overhang substrates are sites of 5 to 3 resection, which provide sticky end overhangs that enable the edited fragment to bind and anneal to the genomic DNA. The nucleotide length and sequence of overhang substrates required for iCAP is flexible and can be adapted to achieve the specificity required to edit a particular target DNA sequence.
[0088] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2, 7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
DESCRIPTION
[0089] The present invention provides methods editing, mutating, or modifying a genomic target DNA sequences in a cell using the in situ cut and paste or iCAP method. The iCAP method enables excising (the cut) a section of DNA sequence (referred to as genomic target sequence or genomic target DNA sequence) of a genome and patching (the paste) the lost section with an edited DNA fragment released from a DNA replacement template (dRT) in the target sequence's natural location (in-situ), a scheme heretofore only achievable for recombinant DNA in the test tube (in-vitro) using restriction enzymes. The edited DNA fragment (1) contains altered nucleotide compositions in the identical endogenous DNA sequences as those to be excised from a genome, (2) may or may not include overhang substrate sequences that are the extra endogenous DNA sequences adjacent to 5 and 3 ends of the excised DNA section of genome and presented (placed) on both of the 5 and 3 ends of the edited fragment, (3) resides in the dRT, which is pre-constructed in-vitro prior to the actual genome editing in cells or zygotes, and (4) is released from the dRT by programmable nucleases' cleavage occurring only inside cells or zygotes. The edited DNA fragment is also referred to as the edited isogenic fragment.
[0090] The iCAP method is based on the concept that when DNA cleavage (double strand break, DSB) occurs at two sites within a genome, the intervening sequence between the two cleavage sites is excised. The same scenario will also occur to dRT which contains (1) the same intervening sequence with precisely altered nucleotide compositions (called an edited isogenic fragment) and (2) either the same two cleavage sites as those present on genome or unrelated and unique designed cleavage sites flanking the edited isogenic fragment. This process allows the edited fragment to be excised from dRT by cleavage occurring within cells or zygotes where the genomic target sequence resides. When such DNA cleavages occur to both genome and dRT in situ, the edited isogenic fragment excised from dRT can patch (replace) the lost endogenous intervening sequence by re-joining the fragment at the two cleavage sites on genome, resulting in the altered nucleotide compositions incorporated into the precise locations of a genome.
[0091] The iCAP process achieves precise genome editing through a coordinated selection or design of two cleavage (DSB) sites (a 5 and a 3 locations) in the genome and on the dRT, respectively. Using two cleavage sites allows Crispr/Cas programmable nucleases, (i.e. Cas9, Cas12a (Cpf1), among others) to simultaneously cut and excise (1) a section of the endogenous DNA sequence, within which nucleotide alterations are to be made, from genome and (2) an edited isogenic fragment, constructed beforehand to contain those alterations, from dRT. The excision step is followed by re-joining the edited fragment at upstream (5) and downstream (3) cleavage sites in the genomic DNA to replace the lost section of the endogenous sequence between the two DSBs. The re-joining step is mediated by endogenous DNA repair pathways of either classic non-homologous end joining (c-NHEJ) or end-resection associated homology directed repair (ER-HDR) or a combination of both. The ER-HDR may dominantly mediate the re-joining if extra DNA sequences, which flank the 5 side of the upstream cleavage site and the 3 side of the downstream cleavage site in genome, respectively, are also included and presented at the 5 and 3 ends of an edited isogenic fragment in dRT (Design A). The extra DNA sequences included in the edited fragment serve as overhang substrate sequences which are homology to those flanking the cleavage sites of genome. The overhang substrate sequences, which are also called mini homology sequences if less than 100 bp, provide sequence zones for 5.fwdarw.3 end-resection to create single stranded 3 overhangs which will be complementary between cleavage ends of genome and the ends of the an edited isogenic fragment. In contrast, when the same 5 as well as the same 3 gRNA target sites presented on both genome and dRT (Design B) are selected as cleavage sites, the re-joining is most likely mediated by c-NHEJ to bridge the broken genome with the edited isogenic fragment, which bears no overhang substrate sequences, at the corresponding 5 and 3 cleavage ends.
[0092] In Design A, through a specific and coordinated design, an uniquely engineered gRNA cleavage recognition site, which is completely different from those for excising endogenous DNA sequence, is incorporated in dRT to allow excision of an edited fragment bearing overhang substrate sequences (mini-homology sequences). This design utilizes ER-HDR to allow (1) using Crispr/Cas programmable nucleases, i.e. Cas9, to simultaneously make blunt-ended cuts to excise a section of endogenous DNA sequence from genome as well as an edited fragment from dRT in-situ, resulting in DNA damages (DSB) at these excision sites; (2) the 5.fwdarw.3 resection, which is the initial steps to repair damaged DNA at DSB ends of genome, may also take place at DSB ends of the edited fragment excised from dRT (or alternatively to say, takes place not only at the damaged ends of genome but also at the DSB ends of an edited fragment released from dRT); (3) the 5.fwdarw.3 resection in the overhang substrate sequences flanking the DSB ends results in formations of complementary 3 overhang sequences at the broken ends of genome and the edited fragment; (4) the edited fragment patches (paste) the broken genome by annealing the complementary 3 overhang sequences at both of the upstream and downstream DSB sites and (5) DNA synthesis and ligation at the annealing sites complete the repairs, leading to the genome edited as a result of the replacement of the original section of endogenous DNA sequence with the edited fragment which is in-vitro pre-constructed to contain altered nucleotide compositions.
[0093] In Design B, there will be no overhang substrate sequences presented and flanking the edited isogenic fragment in dRT. Therefore, the 5 side and 3 side sequences flanking the 5 (upstream) and 3 cleavage sites (downstream), respectively, on genome, are not homology to those on the 5 and 3 ends of the edited fragment following cut and excision occurred to genome and dRT. The iCAP precise genome editing by this design likely utilizes either c-NHEJ or alternative-NHEJ (alt-NHEJ, one of ER-HDR pathways) to re-join the 5 and 3 DSB ends between genome and the edited fragment, respectively. The re-joining can also be mediated by c-NHEJ at one DSB end (5 or 3 cleavage site) and by alt-NHEJ at the other DSB end (3 or 5 cleavage site). The Design B was exemplified by editing human mutant MED13L gene allele using the programmable nuclease Cas12a (Cpf1).
[0094] The iCAP process also allows a precise deletion of a section of endogenous genome sequences between two gRNA target sites cleaved by programmable nucleases such as Cas9 and Cpf1 (Cas12a), resulting in a flawless end re-joining of the broken genome without the intervening sequence between the two target sites, regardless if a dRT is present or not. To differentiate the iCAP process which leads to a replacement of a section of endogenous sequences with an edited fragment (iCAP replacement or iCAP-r), the perfect deletion of a section of endogenous genome sequence achieved by iCAP is called iCAP deletion or iCAP removal (iCAP-d or iCAP-r).
Cas and Cpf1 Nucleases
[0095] In some embodiments, the invention includes a method of editing, mutating, or modifying a genomic target DNA sequence in a cell, the method comprising: providing (i) a DNA replacement template (dRT) comprising the target DNA sequence comprising the desired edited, mutated, or modified nucleotide(s), and (ii) a sequence encoding a nuclease; contacting the genomic target DNA sequence, the DNA RT, and heterologous guide-RNAs (gRNAs) under conditions that allow for the gRNAs to induce double-strand breaks of the genomic target DNA sequence and the DNA RT by the nuclease; subjecting the blunt ends at excision sites of genome and DNA RT to 5.fwdarw.3 DNA end resection to generate complementary 3 overhangs; annealing 3 complementary overhangs of the edited fragment released from dRT to the complementary 3 overhang sequences at excision sites of genome; and ligating the annealing sites, thereby resulting in incorporation of the edited fragment in the place of the genomic target DNA sequence. In some embodiments, the nuclease is a Cas9 or Cpf1 nuclease or a natural or engineered variant thereof. One who is skilled in the art would recognize the advantages and features of the various nucleases, and would be able to identify the variant most suitable for the application of the iCAP method of the current invention.
[0096] Cas9 nucleases, or CRISPR-associated protein 9 (formerly called Cas5, Csn1, or Csx12) is a 160 kDa dual RNA-guided DNA endonuclease that catalyzes site-specific cleavage of double-stranded DNA. Cas9 was originally discovered as a key component in the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system, a form of adaptive immune system in Streptococcus pyogenes. The bacterial immune system uses Cas9 to monitor and degrade foreign DNA from invading bacteriophages or plasmids. Cas9 exists as a complex of a nuclease enzyme protein and a guide RNA or gRNA molecule, which confers target DNA sequence specificity. Cas9 is able to detect foreign DNA molecules by unwinding the target DNA to expose any base sequences what are complementary to a 20 base pair spacer region of the guide RNA. If the target molecule is complementary to the guide RNA and associated with a PAM (protospacer adjacent motif) site, the nuclease activity of Cas9 is activated, resulting in cleavage of the invading DNA. Studies of CRISPR-like systems in other bacteria have identified a number of naturally-occurring variants of Cas9 which can be adapted for use in DNA-editing systems, such as the iCAP system of the current invention. Examples of naturally-occurring Cas9 enzymes include, but are not limited to SpCas9, SaCas9, StCas9, NmCas9, FnCas9, CjCas9, CasX, CasY, Cas12a, Cas14a, BlCas9, ScCas9, LmoCas9, TdCas9, Nme2Cas9, GsCas9, BlatCas9, and FnCas9-RHA. In some embodiments, the Cas12a may be one of the natural variants known to the art, which include but are not limited to AsCpf1, FnCpf1, LbCpf1, AsCpf1-RR, LbCpf1-RR, AsCpf1-RVR. In some embodiments, the invention includes a naturally occurring Cas nuclease variant. Examples of Cas-variant nucleases include but are not limited to Cas13a/b(C2c2), Cas12b(C2c1), Cas12c(C2c3). In some embodiments, the iCAP method of the current invention comprises the use of a naturally-occurring Cas9 nuclease.
[0097] The popularity of Cas9 in molecular biology applications has led to the development of modified or engineered versions of the Cas9 nuclease which provide improved function or specificity, depending on the desired application including but not limited to reducing off-target effects and modifying the rate of reaction. In certain embodiments of the current invention, the Cas9 nuclease is an engineered variant thereof. Examples of engineered Cas9 nucleases include, but are not limited to eSpCas9, SpCas9-HF1, Fok1-Fused dCas9, xCas9, SpCas9-VQR, SpCas9-VRER, SpCas9-D1135E, SpCas9-EQR, SpCas9-QQR1, Cas9-DD, HypaCas9, evoCas9, xCas9-3.7, SniperCas9, Cas9-CtIP, SpCas9-NG, Split-SpCas9, SpCas9-K855A, ScCas9+, ScCas9++, SaCas9-KKH, and SaCas9 among others. In certain embodiments of the invention, other endonucleases may also be used, including but not limited to Cpf1, T7, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, other nucleases known in the art, and any combination thereof.
[0098] Cpf1 or CRISPR from Prevotella and Francisella 1, which is also known as Cas12a in the art is a nuclease similar to Cas9 and can similarly be used in DNA editing methods, including those of the current invention. Cpf1 often offers certain advantages over Cas9 in DNA editing systems. Cpf1 endonuclease is smaller in size compared to Cas9 and requires shorter a CRISPR RNA (crRNA) to work properly. Cpf1 does not require a trans-activating crRNA (tracrRNA) while processing Cpf1-associated CRISPR repeats into mature crRNAs. Naturally-occurring variants or orthologs of Cpf1 nucleases from various bacteria have been isolated and assessed for genome editing, including AsCpf1 and LbCpf1, which were isolated from Acidaminococcus sp. BV3L6 and Lachnospiraceae bacterium ND2006, respectively, and are commonly used in DNA editing systems known in the art. The main advantage of a CRISPR/Cpf1-mediated genome-editing tool is the reengineering of the desired DNA as the target and that the PAM sequence (5-TTTN-3) remains intact.
Cas Nuclease Programming
[0099] Cas and Cpf1 nuclease-based DNA editing systems such as those of the current invention are facile and efficient for inducing targeted genetic alterations. Target recognition by the nuclease enzyme requires a seed sequence within the guide RNA (gRNA) and a conserved tri-nucleotide containing protospacer adjacent motif (PAM) sequence upstream of the gRNA-binding region. Cas and Cpf1 nucleases can thereby be engineered to cleave virtually any DNA sequence by redesigning the gRNA to be complementary to the target DNA sequence. The iCAP system of the current invention can simultaneously target multiple genomic loci by co-expressing a single Cas9 protein with two or more gRNAs, making this system uniquely suited for multiple gene editing or synergistic activation of target genes.
[0100] Cas and Cpf1-based gene editing occurs when a guide nucleic acid sequence specific for a target gene and a Cas endonuclease are introduced into a cell and form a complex that enables the Cas endonuclease to introduce a double strand break at the target gene and a replacement template DNA construct containing the desired sequence alteration or mutaiton. In certain embodiments, the iCAP system comprises one of more expression vectors. In other embodiments, the iCAP expression vector induces expression of Cas9 endonuclease. Other endonucleases may also be used, including but not limited to Cpf1, T7, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, other nucleases known in the art, and any combination thereof.
[0101] In certain embodiments, inducing the iCAP expression vector comprises exposing the cell to an agent that activates an inducible promoter in the Cas expression vector. In such embodiments, the iCAP expression vector includes an inducible promoter, such as one that is inducible by exposure to an antibiotic (e.g., by tetracycline or a derivative of tetracycline, for example doxycycline). However, it should be appreciated that other inducible promoters can be used. The inducing agent can be a selective condition (e.g., exposure to an agent, for example an antibiotic) that results in induction of the inducible promoter. This results in expression of the Cas expression vector.
[0102] The guide nucleic acid sequence is specific for a gene and targets that gene for Cas or Cpf1 endonuclease-induced double strand breaks. The sequence of the guide nucleic acid sequence may be within a loci of the gene. In one embodiment, the guide nucleic acid sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more nucleotides in length.
[0103] The guide nucleic acid sequence may be specific for any gene, such as a gene that would reduce immunogenicity or reduce sensitivity to an immunosuppressive microenvironment. The guide nucleic acid sequence includes a RNA sequence, a DNA sequence, a combination thereof (a RNA-DNA combination sequence), or a sequence with synthetic nucleotides. The guide nucleic acid sequence can be a single molecule or a double molecule. In some embodiments, the guide nucleic acid sequence comprises a single guide RNA.
[0104] In the context of formation of a gRNA/Cas9 complex, target sequence refers to a sequence to which a guide sequence is designed to have some complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a gRNA/Cas9 complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a gRNA/Cas9 complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In certain embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. In other embodiments, the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or nucleus. Typically, in the context of an endogenous iCAP system, formation of a gRNA/Cas9 complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g., within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs) the target sequence. As with the target sequence, it is believed that complete complementarity is not needed, provided this is sufficient to be functional. In certain embodiments, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned. In other embodiments, one or more vectors driving expression of one or more elements of a iCAP system are introduced into a host cell, such that expression of the elements of the iCAP system direct formation of a iCAP complex at one or more target sites. For example, a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements may be combined in a single vector, with one or more additional vectors providing any components of the iCAP system not included in the first vector. iCAP system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5 with respect to (upstream of) or 3 with respect to (downstream of) a second element. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction. In certain embodiments, a single promoter drives expression of a transcript encoding a nuclease enzyme and one or more of the guide sequence, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g., each in a different intron, two or more in at least one intron, or all in a single intron).
[0105] The Cas and Cpf1 nucleases of the invention can be modified to increase nucleic acid binding affinity and/or specificity, alter an enzymatic activity, and/or change another property of the protein. In certain embodiments, the Cas and Cpf1 nucleases of the invention can be fusion proteins derived from a wild type Cas9 proteins or fragments thereof. In other embodiments, the nucleases can be derived from modified Cas9 proteins. For example, the amino acid sequence of the Cas9 protein can be modified to alter one or more properties (e.g., nuclease activity, affinity, stability, and so forth) of the protein. Alternatively, domains of the nuclease protein not involved in RNA-guided cleavage can be eliminated from the protein such that the modified nuclease protein is smaller than the wild type nuclease protein. In general, a Cas9 or Cpf1 protein comprises at least two nuclease (i.e., DNase) domains. For example, a Cas9 or Cpf1 protein can comprise a RuvC-like nuclease domain and a HNH-like nuclease domain. The RuvC and HNH domains work together to cut single strands to make a double-stranded break in DNA. (Jinek et al., 2012, Science, 337:816-821). In certain embodiments, the Cas9- or Cpf1-derived protein can be modified to contain only one functional nuclease domain (either a RuvC-like or a HNH-like nuclease domain). For example, the Cas9- or Cpf1-derived protein can be modified such that one of the nuclease domains is deleted or mutated such that it is no longer functional (i.e., the nuclease activity is absent). In some embodiments in which one of the nuclease domains is inactive, the Cas9-derived protein is able to introduce a nick into a double-stranded nucleic acid (such protein is termed a nickase), but not cleave the double-stranded DNA. In any of the above-described embodiments, any or all of the nuclease domains can be inactivated by one or more deletion mutations, insertion mutations, and/or substitution mutations using well-known methods, such as site-directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis, as well as other methods known in the art.
Vectors
[0106] In one non-limiting embodiment, a vector drives the expression of the iCAP system. The art is replete with suitable vectors that are useful in the present invention. The vectors to be used are suitable for replication and, optionally, integration in eukaryotic cells. Typical vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the desired nucleic acid sequence. The vectors of the present invention may also be used for nucleic acid standard gene delivery protocols. Methods for gene delivery are known in the art (U.S. Pat. Nos. 5,399,346, 5,580,859 & 5,589,466, incorporated by reference herein in their entireties).
[0107] Further, the vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (4.sup.th Edition, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 2012), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, Sindbis virus, gammaretrovirus and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193).
Introduction of Nucleic Acids
[0108] Methods of introducing nucleic acids into a cell include physical, biological and chemical methods. Physical methods for introducing a polynucleotide, such as DNA and RNA, into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. DNA and RNA can be introduced into target cells using commercially available methods which include electroporation (Lonza 4D-Nucleofector, Amaxa Nucleofector-II, (Amaxa Biosystems, Cologne, Germany), ECM 830 (BTX) (Harvard Instruments, Boston, Mass.) or the Gene Pulser II (BioRad, Denver, Colo.), Multiporator (Eppendorf, Hamburg Germany). DNA and RNA can also be introduced into cells using cationic liposome mediated transfection using lipofection, using polymer encapsulation, using peptide mediated transfection, or using biolistic particle delivery systems such as gene guns (see, for example, Nishikawa, et al. Hum Gene Ther., 12(8):861-70 (2001).
[0109] Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.
[0110] Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
[0111] Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine (DMPC) can be obtained from Sigma, St. Louis, MO; dicetyl phosphate (DCP) can be obtained from K & K Laboratories (Plainview, NY); cholesterol (Choi) can be obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol (DMPG) and other lipids may be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform/methanol can be stored at about ?20? C. Chloroform is used as the only solvent since it is more readily evaporated than methanol. Liposome is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5: 505-10). However, compositions that have different structures in solution than the normal vesicular structure are also encompassed. For example, the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules. Also contemplated are lipofectamine-nucleic acid complexes.
[0112] Regardless of the method used to introduce exogenous nucleic acids into a host cell or otherwise expose a cell to the inhibitor of the present invention, in order to confirm the presence of the nucleic acids in the host cell, a variety of assays may be performed. Such assays include, for example, molecular biological assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; biochemical assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
[0113] Moreover, the nucleic acids may be introduced by any means, such as transducing the target cells, transfecting the target cells, and electroporating the target cells. One nucleic acid may be introduced by one method and another nucleic acid may be introduced into the target cell by a different method.
EXAMPLES
[0114] The invention is now described with reference to the following Examples. These Examples are provided for the purpose of illustration only and the invention should in no way be construed as being limited to these Examples, but rather should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
[0115] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out the preferred embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure.
[0116] The materials and methods employed in the experiments disclosed herein are now described.
Mouse Genome Editing;
[0117] Analysis of gene loci, editing locations and identifications of gRNA target sites. Genomic DNA sequences of slc35F2 and slc35F6 were obtained from online resources, seast dot ensemble dot org/index dot html and ncbi dot nlm idot nih dot gov/pubmed/, and then catalogued & annotated using Snapgene software (Version 2.1.1) for further sequence analysis. Sequences of 500 nucleotides, flanking and spanning the editing locations, one at the intron 5 of the last exon for FRT3 insertion and the other at the immediate 5 side of a stop codon in the last exon for in-frame insertion of the expression cassette, were selected and analyzed for identifying gRNA target sites to induce inner cuts using the online tool Benchling (benchling dot com). Based on a category of programmable nuclease (Cas9, Cpf1, etc.), Benchling software analyzed the selected sequences for all available target sites and scores the sites according to established parameters and variables effecting on-target & off-target efficiencies. The gRNA target sites with favorable scores were chosen for validation assay in vitro, according to (1) a favorable combination of on-target and off-target scores (an on-target score>60 and an off-target score close to 100 are optimum) and (2) the close proximity to the desired site of insertion of any exogenous DNA sequence (for example, the endogenous STOP codon, if creation of an in-frame protein fusion is the goal.)
[0118] In vitro transcription of sgRNAs and validation of gRNA target sites. Templates for in vitro transcription of SpCas9 guides were amplified from the plasmid pX330 (Addgene, MA) using primer pairs with 65 oligonucleotides as a 5 primer (forward) and the oligonucleotides AAAAGCACCGACTCGGTGCC (SEQ ID NO: 1) as a 3 primer (reverse) The 65 oligonucleotides are comprised of GCGCGCTAATACGACTCACTATAGGNNNNNNNNNN NNNNNNNNNNGTTTTAGAGCTAGAAATAGC (SEQ ID NO: 2), in which NNN - - - represents 20 oligonucleotide protospacer proceeded with T7 minimal promoter. The protospacer corresponds to gRNA target sequences for inner cuts and to the engineered gRNA target sequence GTGCTTCGATATCGATCGTT (SEQ ID NO: 3) for outer cuts. The Phusion DNA Polymerase (NEB M0530S, neb dot com) was used for the amplification according to manufacturer's protocols, and amplified templates were purified with QIAquick PCR Purification Kit (Qiagen 28104, qiagen dot com). The in vitro transcription was performed using MEGAshortscript T7 Transcription Kit (LifeTechnologies AM1354, thermofisher dot com) following manufacturer's protocols. After incubation for 4 hours at 37? C., samples were treated with DNase I for 15 minutes at 37? C. to remove DNA templates. In vitro transcribed sgRNAs were purified and eluded with MEGAclear Purification Kit (LifeTechnologies AM1908M, thermofisher dot com) according to manufacturer's protocol, and the final concentration was measured using Nanodrop and was stored at ?80? C. for subsequent uses. In assays to validate sgRNAs' on-target cut induced by programmable nuclease, 30 nM in vitro transcribed sgRNAs, 3 nM RNAse-free DNA fragments containing gRNA target sequences and 30 nM Cas9 protein (NEB Cas9 Nuclease M0386T, neb dot com) were mixed in reaction tubes as per manufacturer's protocol. At the end of the reaction, a 1 l RNAse A was added and then incubated for additional 15 minutes at 37? C. to degrade sgRNA. DNA fragments in the reaction were purified with QIAquick PCR Purification column (Qiagen 28104, qiagen dot com) to remove residual protein, followed by analysis in an agarose gel.
[0119] Construction of DNA replacement template containing edited nucleotide alterations. The intended editing was to make nucleotide alterations at two locations in gene loci of interests, (1) to insert a FRT3 sites in the intron 5 of the last exon and (2) in-frame to insert a 3.7 expression cassette immediately 3 side of the last codon of endogenous genes. Based on the analysis of gene loci, the editing locations and identification and validation of gRNA target sites, the edited fragment was designed in a pre-constructed replacement template to be organized in a 5 to 3 direction as 5 overhang substrate sequence (40 bp intron sequence)-FRT3 (exogenous gene)-intron sequence-coding sequence of last exon-expression cassette ending with FRT-3 overhang substrate sequence (40 bp sequence around and 3 of the endogenous stop codon), as shown in
[0120] Animal Production. The mice were contractively produced by the transgenic mouse facility at University of Pennsylvania School of Veterinary Medicine. The protocols and procedures for animal productions were approved by the Institutional Animal Care and Use Committee (IACUC). Briefly, a buffer solution mixed with sgRNAs (40-60 ng/?l), DNA replacement templates (1.5-2 ng/?l) and Cas9 mRNA (100 ng/?l, Trilink Biotechnologies, CA) was microinjected into pronuclei and cytoplasm of one-cell stage embryos obtained from superovulated B6D2F1 female mice (Jackson Laboratory, Maine). The injected embryos were maintained in M16 medium and cultured for at least one hour in a 100% humidified incubator with 5% C02 at 37? C. before implantation. A group of 20 injected embryos on average were transferred into oviducts of a pseudopregnant mouse for a full term development.
[0121] Isolation of genomic DNA from animals. Biopsies from ear were dissolved in 50 ?l of Extracta DNA Prep Extraction Buffer (Quanta BioSciences 5091-025, quantabio dot com), and genomic DNAs were extracted following manufacturer protocol. Biopsies from tails were dissolved in lysis buffer (50 mM Tris-Cl, pH 8.0, 50 mM EDTA, 100 mM NaCl, 1% SDS, 0.2 mg/ml Proteinase K) and incubated for overnight at 55? C. with agitation, and then genomic DNAs were extracted by adding isopropanol to the dissolving buffer, in which tissue debris were prior eliminated, to obtain DNA precipitates. The extracted DNAs were resuspended in TE buffer after clean washes with ethanol.
[0122] PCR and sequence analysis. The oligonucleotides of primer pairs are either the sequences corresponding to endogenous areas outside the edited fragment in replacement template, or a combination of one primer sequence corresponding to endogenous areas outside the edited fragment with the other primer sequence corresponding to the areas present in the edited fragment, as shown in
[0123] SURVEYOR Assay. The amplified PCR products from animal genomic DNAs were also analyzed with SURVEYOR Mutation Detection Kit (IDT 706020, idtdna dot com) for detections of indels at the endogenous gRNA target sites (either of the inner cut sites). In brief, a 10 ?l of PCR products were denatured for 5 min at 100? C., and re-hybridized by slowly cooling to room temperature over the period of one hour, followed by adding 1 of Surveyor assay buffer containing MgCl.sub.2, Surveyor Nuclease & Surveyor Nuclease Enhancer to each samples and incubation for one hour at 42? C. Mismatch mutations were detected when smaller bands were generated after the nuclease treatment, and visualized in an agarose gel. The PCR products containing indels were further analyzed by sequencing in the same way as described above.
Human Genome Editing
[0124] Confirmation of a mutation in exon 20 on the mutant MEDI3L gene allele in MED13L syndrome patient cells. Genomic DNA was extracted from cultured human cell lines of WI-38 normal lung fibroblasts and MED13L Syndrome patient cells of fibroblasts using DNeasy Blood & Tissue Kit (Qiagen #69504) according to manufacturer protocols. Each of the genomic DNA samples was used as templates to produce a DNA fragment by PCR with primers flanking exon 20 of the MED13L gene. The forward primer pJ327 (AGCCTAGTCCAAGTTTTAGAGAG)(SEQ ID NO: 4) and reverse primer pJ328 (AAACTGCCCAGAACACCAAACTGG)(SEQ ID NO: 5) were custom-made (sigmaaldrich dot com). All other primers in the studies were also custom-made using the same source. The PCR primed with pJ327-pJ328 was performed using Fusion High Fidelity DNA Polymerase (NEB #M0530S) according to manufacturer with an Applied Biosystems 2720 Thermal Cycler. A PCR product of 561 bp generated from genomic DNAs of the WI-38 cells and a PCR product of approximate 561 bp produced from genomic DNAs of the MED13L Syndrome patient cells were first incubated with Choice-Taq DNA polymerase (Thomas Scientific #CB4050-1) and then TA cloned into the pGEM-T Easy Vector (Promega #A1360). The cloned PCR products were Sanger Sequenced with M13 Forward (TGTAAAACGACGGCCAGT)(SEQ ID NO: 6) and Reverse (CAGGAAACAGCTATGAC)(SEQ ID NO: 7) primers and the DNA sequence reads from sequencing were analyzed with Geneious software (geneious.com). A single nucleotide addition of thymine in exon 20 of mutant MED13L gene allele in patient cells was revealed, in comparison with the sequence from human WI-38 normal cells, confirming the presence a mutant MED13L allele in the patient cells. The single thymine addition (either by duplicating or inserting) at the codon for Serine results in an animo acid mutation S1497F and consequently reading frame shift which causes an early termination of transcription at exon 21 and production of a truncated MED13L protein with a deletion of approximately 690 amino acids at the C-terminus. The single nucleotide mutation is most likely responsible for the disease of MED13L haploinsufficiency syndrome (MED13L Syndrome).
[0125] Identifications of gRNA target sites for iCAP editing to eliminate the single nucleotide mutation. Intronic sequences flanking exon 20 on either the wild type allele or on the mutant allele of MED13L gene are identical and were analyzed to search for potential gRNA target sequences recognized by Cas9 or Cpf1 nucleases using the online tool Benchling (benchling dot com). The gRNA target sequences assigned favorable high scores by algorithms for off-target and/or on-target scores were selected as potential gRNA target sites for in vitro assay to validate Cas nuclease's recongniation and cleavage.
[0126] In vitro transcription of sgRNAs and validation of gRNA target sites. DNA templates for in vitro transcription of Cas9 sgRNAs were PCR generated with oligoes including a minimal T7 promoter (GCGCGCTAATACGACTCACTATAGG) (SEQ ID NO: 8) and various targets as forward primers (pJ335, pJ336, pJ337 and pJ338) and a gRNA-scaffolding oligo as the reverse primer pJ161 (AAAAGCACCGACTCGGTGCC)(SEQ ID NO: 9) using plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230) as PCR templates. Approximately 120 bp PCR products were produced with various forward primers and the reverse primer and each of the PCR products was used as a template for in vitro transcription of an Cas9 sgRNA with the corresponding gRNA target site in the template. For generations of DNA templates used for in vitro transcription of Cpf1 sgRNAs, a minimal T7 promoter+tracrRNA (nuclease binding scaffold RNA) oligo primer pJ227 (GCGCGCTAATACGACTCACTATAGGTAATTTCTACTAAGTGTAGAT)(SEQ ID NO: 10), was annealed with variously specific crRNA target oligo primers (pJ343, pJ344, pJ345, pJ346, pJ347, pJ348, pJ362, pJ363, and pJ364) containing overlapping sequence with pJ227, followed by extention in a simple PCR reaction to generate approximately 70 bp products. Each of the PCR products was used as a template for in vitro transcription of one Cpf1 sgRNA with the corresponding gRNA target site in the template. PCR products were column purified with either the Qiaquick PCR Purification Kit (Qiagen #28104) for Cas9 templates, or with the QIAEX II Gel Extraction Kit (Qiagen #20021) for Cpf1 templates, and all templates were treated with Proteinase K (0.2 mg/ml with 0.5% SDS) at 50? C. for 30 minutes to remove any traces of contaminating RNAse. In vitro transcription of sgRNAs was performed using the MEGAshortscript T7 Transcription Kit (LifeTechnologies #AM1354) according to manufacturer protocols. The RNA products were column purified with either the MEGAclear Purification Kit (LifeTechnologies #AM1908M) for the Cas9 102 nucleotide RNA products, or the mirVana miRNA isolation kit (Ambion #AM1560) for the Cpf1 44 nucleotide RNA products. The genomic target sequence is a PCR generated 561 bp DNA fragment with primers of J327-pJ328 and genomic DNAs extracted from WI-38 cells and include exon 20 (193 bp), partial 5 flanking intronic sequence (219 bp) and partial 3 flanking intronic sequence (149 bp). The intronic sequences were used for gRNA target site search and idenfications. To validate the identified gRNA target sites by in vitro assay, the genomic target sequence, in vitro transcribed sgRNA and assoicated Cas9 (NEB #M0646T) or Cpf1 (NEB #M0653S) nuclease were mixed in 1:10:10 molar ratios respectively, and incubated at 37? C. according to NEB protocols. Results were analyzed on 2% agarose gels with ethidium bromide staining to determine cleavage efficiencies. Validated gRNA target sequences with accurate Cas recongnition and efficient cleavage were chosen and paired to flank exon 20 as the 5 and 3 DSB sites according to iCAP editing. The chosen validated gRNA target sites are the guide sequences in oligo primers of pJ335 (GAATCTCCCTTGCTAACCAT) (SEQ ID NO: 11) as 5 DSB site and pJ338 (ATGTTGCATCTATAAAAGAA) (SEQ ID NO: 12) as 3 DSB site for Cas9, and in oligoes of pJ343 (GGTTTGATTGCATGTGATAACCC) (SEQ ID NO: 13) as 5 DSB site and pJ348 (AAAGAAATATAATGTTGCATCTA) (SEQ ID NO: 14) as 3 DSB site for Cpf1. The validation results from in vitro assay provided molecular bases for constructions of sgRNAs/Cas9 and sgRNAs/Cpf1 expression vectors and for designs and constructions of DNA replacement templates according to iCAP methods.
[0127] Constructions of sgRNAs Cas9 and sgRNAs Cpf1 expression vectors. In construction of sgRNAs/Cas9 expression vector, two complementary oligoes corresponding to crRNA sequences were denatured in STE buffer (10 mM tris, 1 mM EDTA, 100 mM NaCl) at 100? C. for 10 minutes and then annealed slowly by cooling to room temperature. The annealed oligo products were directionally cloned into the Addgene Multiplex CRISPR/Cas9 Assembly Kit (Addgene #1000000055) as crRNA genes for sgRNA expression. In addition to Cas9 gene, the expression vector as a final plasmid product contains three crRNA genes for expressions of three different sgRNAs with two validated for targeting a 5 and a 3 gRNA sites flanking exon 20 of MED13L gene as described above and a third sgRNA validated for targeting an engineered gRNA target site (GTGCTTCGATATCGATCGTT)(SEQ ID NO: 15) placed to flank an edited fragment containing wildtype exon20 and flanking intron sequences within the Cas9 DNA replacement templates (
[0128] Construction of DNA replacement templates (dRT). The backbone sequence of dRT is the 561 bp genomic target sequence generated from PCR amplification of wildtype MED13L allele with primers of pJ327-pJ328. The sequence contains wildtype exon 20 of MED13L gene and partial 5 and 3 flanking intron sequences as described above and was cloned into a pGEM-T Easy vecotor to generate the plasmid of MED13L ex20 pJ327-328 in pGEM-T Easy. A puromycin resistant gene unit was amplified from plasmid pGL3-U6-sgRNA-PGK-puromycin (Addgene #51133) by PCR and the 1493 bp product was then inserted at an intron EcoRV restriction site just 5 of MED13L exon 20, resulting in the plasmid of MED13L ex20 pJ327-328+Puro in pGEM-T Easy. SphI-SacI restriction digestions of the plasmid generated the 2139 bp dRT for iCAP editing through usage of Cpf1 (Cpf1 dRT). To construct the Cas9 dRT which contains 100 bp mini-homology sequences as overhang substrates, the MED13L ex20 pJ327-328+Puro in pGEM-T Easy plasmid was used as a template for incorporating modifications necessary for a proper dRT structure, using primer sets of pJ356 (GAAAAAGGAAAATGCTTCCATATGTATGTTAAAGAATCTCCCTTGCTAACCATTT TTACTGAATGAAGGAATGGCTCCTG)(SEQ ID NO: 16) with pJ358 (CTTAACAAATACAGCATTACTTGAGACAAAA GAAATATAATGTTGCATCTATAAAAGAATTTATGGGACGGATTTGCTATTTTAC) (SEQ ID NO: 17) and pJ357 (GTGCTTCGATATCGATCGTTTGGGAAAGGACCAACTTGT AATGTTGGTTTGATTGCATGTGATAACCCTAAAAGAAAAAGGAAAATGCTTCCA) (SEQ ID NO: 18) with pJ359 (GTGCTTCGATATCGATCGTTTGGCATATAGAAATTAGCA TTAAACTGCCCAGAACACCAAACTGGACCTTAACAAATACAGCATTAC)(SEQ ID NO: 19) in sequential PCR reactions. The modifications incorporated in the new dRT resulted in the changes of (i) 100 bp intronic sequences on the 5 side of the upstream Cas9 gRNA target site and 100 bp intronic sequences on the 3 side of the downstream Cas9 gRNA target site were tailored to flank the 5 and 3 gRNA target sites as overhang substrates (mini-homology arms) by a 58 bp deletion from the 5 end of upstream intron sequence of exon 20 and a 18 bp addition to the 3 end of downstream intron sequence of exon 20 as being compared with the original 561 bp genomic target sequence, (ii) the PAM associated with the 5 and 3 gRNA target sites were mutated to prevent Cas9 cleavage at the sites (called inner cuts) on dRT and (iii) a uniquely engineered Cas9 gRNA target sites as described above was placed in both ends of 5 and 3 mini-homology arms serving as cleavage sites (called outer cuts) for excision a pacthing repair template (an edited fragment) from dRT. The 2060 bp fragment with PCR mediated modifications was TA cloned into the pGEM-T Easy vector to generate a final product of plasmid MED13L ex20 pJ327-328+Puro Cas9 Donor in pGEM-T Easy. SphI-SacI restriction digestions of the plasmid generated the 2145 bp dRT for iCAP editing through usage of Cas9. Structures of both Cpf1 dRT and Cas9 dRT were confirmed by sequencing.
[0129] Cell culture and transfection of dRTs and sgRNA Cas expression vectors. Human cell lines of WI-38 lung fibroblasts and MED13L syndrome patient cells of fibroblasts were propagated in culture plates with DMEM (Dulbecco's Modified Eagle Medium, Thermo Fisher Scientific-US) containing 10% fetal bovine serum (Thermo Fisher Scientific-US) and 100 unit/ml penicillin/100 ?g/ml streptomycin (Sigma-Aldrich) and maintained in a 37? C. humidified incubator supplied with 5% CO2. For transfection, 1.0?10.sup.6 of patient cells carrying MED13L mutant allele were suspended in 80 ?l of Opti-MEM medium (Invitrogen #31985-062). The cell suspension was combined with 20 ?l of genome editing constructs containing 6 ?g of either Cpf1 SphI-SacI dRT fragments with 6 ?g of the matching sgRNA/Cpf1 expression plasmid or 6 ?g of Cas9 SphI-SacI dRT fragments with 6 ?g of the matching sgRNA/Cas9 expression plasmid. The combined suspension of 100 ?l was electroporated by NEPA21 Electro-Kinetic Transfection System (Bulldog Bio, Portmouth, NH) with parameters of 175 voltage, 2 pulses of 5 msec length and 10% decay rate for pouring pulse and manufacturer pre-set parameters for transfection pulse. The cells transfected with Cpf1 dRT and sgRNA/Cpf1 expression plasmid were labeled as 5-1-2 while the cells transfected with Cas9 dRT and sgRNA/Cas9 expression plasmid were labeled as 4-1-2. After transfection, the cells were cultured in the same culture medium for 48 hours and then selected in the medium with 1 ?g/ml of puromycin (Sigma-Aldrich) for 10 days. The surviving cell populations were pooled and harvested for genotypic analysis to examine genome editing at mutant MED13L allele. In another set of experiments, 1.0?10.sup.6 of patient cells carrying MED13L mutant allele suspended in 80 ?l of Opti-MEM medium were combined with either 20 ?l of 10 ?g sgRNA/Cpf1 expression plasmids or 20 ?l of 10 ?g sgRNA/Cas9 expression plasmids without dRT included, followed by electroporations in the same parameters. The cell populations transfected with sgRNA/Cpf1 expression plasmids and sgRNA/Cas9 expression plasmids were labeled as iCAP Cpf1 and iCAP Cas9, respectively. These transfected cells were cultured for 24 hours and then harvested for genotypic analysis.
[0130] Genotyping & Sequencing. Genomic DNAs were extracted from puromycin selected population pools of 4-1-2 and 5-1-2, respectively, after transfection with editing constructs. Briefly, 50 ?l cell samples were lysed in an equal volume of Proteinase K (1 mg/ml) in PBS with incubation on a thermal cycler at 65? C. for 1 hour followed by incubating at 95? C. for 20 minutes. 5 ?l of the lysates with genomic DNA extracted was used for PCR genotyping analysis with appropriately designed primers for each unique editing constructs as illustrated in figures. Primer pair of pJ375 (CGATCAGCATACTCACTGCTTCAG (SEQ ID NO: 20), corresponding to 5 endogenouse genomic sequence not present in the 5 end of the edited fragment in dRT) and pJ361 (CAGGAGGCCTTCCATCTGTTGCTG (SEQ ID NO: 21), corresponding to sequence of puromycin resistant gene) would yield an approximate 1392 bp fragment, an indication of successful iCAP paste at the 5 cleavage sites while an approximate 1378 bp fragment generated with the primer pair of pJ360 (AGCTGCAAGAACTCTTCCTCACG (SEQ ID NO: 22), corresponding to sequence of puromycin resistant gene) and pJ355 (GTCTCCTTTCAGACTGATTCCATG (SEQ ID NO: 23), corresponding to 3 endogenouse genomic sequence not present in the 3 end of the edited fragment in dRT) suggests successful iCAP paste at the 3 cleavage sites. Genomic DNAs of transfected cell populations of iCAP Cpf1 and iCAP Cas9 were extracted in the same way, and used for PCR genotypic analysis with the primer pair of pJ375-pJ355 which sequences are corresponding to endogenous genomic DNAs outside the 5 and 3 Cpf1 gRNA target sites as well as outside of the 5 and 3 Cas9 gRNA target sites in introns flanking exon20 of MED13L gene. A 1080 bp PCR fragment would indicate un-edited allele, whereas deletions would result in a shortened PCR fragment implying cleavages at the upstream and downstream gRNA targets. All PCRs were performed using Fusion High Fidelity DNA Polymerase (NEB #M0530S) according to manufacturer protocols on an Applied Biosystems 2720 Thermal Cycler. PCR fragments with expected size were purified and TA cloned in the pGEM-T Easy Vector (Promega #A136) for sequencing to reveal the details of the edited allele. Sanger Sequencing for cloned PCR fragments were ordered and performed by Genewiz (genewiz.com). All the sequence data obtained were analyzed with Geneious software (geneious.com).
Example 1: Description of Genomic Editing Using iCAP
[0131] The process of iCAP genomic editing begins by identifying the target endogenous DNA sequence (
Example 2: DNA Replacement Template (Donor) Design A for Insertions of a FRT3 and an APEX2-IRES-CRE Expression Cassette at Two Locations in Slc35f2 Gene by iCAP
[0132] As an example of the use of the iCAP genomic editing to precisely insert a large DNA construct with alterations at two locations into the mouse genome in situ, a study was then conducted in which a 48 bp FRT3 site and a 3.7 kb APEX2-IRES-CRE expression cassette ending with a FRT site were inserted into the mouse slc35f2 locus at two locations, respectively. The construct was synthesized to form the edited fragment residing in the DNA replacement template (dRT) as illustrated in
Example 3: iCAP Editing of the Mouse slc35f2 Locus
[0133] A total of 74 one-cell stage embryos of strain B6D2F1 were injected with a buffer mixture (Cas9 mRNA, 3 sgRNAs, and DNA replacement template excised from a plasmid with restriction enzymes NdeI and XmaI). Surviving embryos were re-implanted into the oviduct of pseudo pregnant surrogate mothers for development to term. A total of 9 pups were born. Genotyping by PCR & DNA sequencing was performed on biopsy samples collected at 3 weeks of age. A SURVEYOR Nuclease assay testing for evidence of CRISPR/Cas9 mediated DSBs revealed 5/9 animals (
[0134] The presence of edited slc35f2 alleles in the nine surviving animals was then verified by PCR.
Example 4: Strategy (Design A) for Editing the Mouse slc35f6 Locus by iCAP
[0135] As a further example of the use of iCAP to efficiently edit genomic DNA, a follow-up study was designed in which the slc35f6 locus was targeted for editing.
[0136] Similarly,
[0137] In
[0138]
Example 5: Successful Editing of the slc35f6 Locus by iCAP
[0139] A total of 65 one-cell stage embryos of strain B6D2F1 were injected with a buffer mixture (Cas9 mRNA, 3 sgRNAs, and DNA replacement template excised from a plasmid with restriction enzymes NdeI and XmaI). Surviving embryos were re-implanted into the oviduct of pseudo pregnant surrogate mothers for development to term. A total of 16 pups were born. Genotyping by PCR & DNA sequencing was performed on biopsy samples collected at 3 weeks of age. A table summarizing the outcome of the microinjection and animal production studies is shown in
[0140] In order to screen the resulting pups, a SURVEYOR Nuclease assay was performed to verify evidence of CRISPR/Cas9 mediated DSBs occurred on the targeted genomic DNA region amplified using the same PCR primers as shown in
[0141]
Example 6: iCAP DNA Replacement Template (Donor) Design A for Deletion of a Single Disease-Causing Nucleotide Duplication from Exon20 of Human Mutant MED13L Allele in Patient Cells
[0142] As an example of the use of the iCAP genomic editing to precisely alter genome sequence at the level of individual nucleotides in human genome, a study was conducted to eliminate a single nucleotide duplication from exon20 of MED13L gene in genome of patient cells. The single base Thymine duplication in coding sequence (
Example 7: Successful iCAP Editing to Eliminate a Single Disease-Causing Nucleotide Duplication from Exon20 of Human Mutant MED13L Allele in Patient Cells
[0143] Patient cells of fibroblasts carrying mutant MED13L gene allele were transfected with a sgRNAs/Cas9 expression vector and the dRT, which is a SphI-SacI fragment (
[0144] Using primers F1-R1 and F2-R2 as shown in
[0145] The predicted structure of the successfully edited MED13L allele by PCR genotyping was further analyzed by DNA sequencing. As shown in the bottom sequence panel of
[0146] The sequences of the edited fragment pasted in the MED13L mutant allele and flanking endogenous genomic DNAs are illustrated in
Example 8: iCAP DNA Replacement Template (Donor) Design B for Deletion of a Single Disease-Causing Nucleotide Duplication from Exon20 of Human Mutant MED13L Allele in Patient Cells
[0147] As an example of the use of the iCAP genomic editing Design B to precisely alter genome sequence at the level of individual nucleotides in human genome, a study was conducted to eliminate a single nucleotide duplication from exon20 of MED13L gene in genome of patient cells. As described in Example 6, the single base Thymine duplication in coding sequence (
Example 9: Successful iCAP Editing (Design B) to Eliminate a Single Disease-Causing Nucleotide Duplication from Exon20 of Human Mutant MED13L Allele in Patient Cells
[0148] Patient cells of fibroblasts were transfected with a sgRNAs/Cas12a expression vector and dRT (Design B,
[0149] Shown in
[0150] The PCR products were further analyzed by DNA sequencing to confirm a successfully iCAP editing of the mutant MED13L allele with the elimination of the single nucleotide duplication by the replacement of mutant exon20 as designed. As shown in the bottom sequence panel of
[0151] As the gRNA target sites are intentionally screened and selected in the intron sequences for the reason that is no significant impact on gene functions if certain changes occurred in the introns, less than 10 bp deletions observed here therefore did not compromise the structure of the edited area containing wildtype exon20 as the single nucleotide duplication was eliminated from the exon resulting in a restoration of TCC codon for Serine (F1497S) as shown in red frame in the middle sequence panel of
[0152] The sequences of the edited fragment pasted in the MED13L mutant allele and flanking endogenous genomic DNAs are illustrated in
[0153] In total, these data illustrate the successful use of the iCAP process through usage of Cpf1 programmable nuclease to precisely delete a single disease-causing nucleotide duplication in an exon of human genome to restore codon and the reading-frame, further demonstrating the versatile utility of iCAP genome editing and the flexibility of iCAP in using different Cas programmable nucleases and thereby enabling iCAP with significantly increased availabilities and choices of gRNA target sites to edit complex genome. In addition, the data also indicate that through flexible design choices iCAP genome editing process could mobilize the appropriate DNA damage repair pathways, if not all, to facilitate end re-joining of a broken genome at two designed DSB sites with an edited isogenic fragment which can be pre-constructed to contain altered nucleotide sequence compositions and replaces the excised endogenous intervening sequence between the two DSBs.
Example 10: Successfully Perfect Deletion of a Section of Endogenous Sequences Between DSBs and Flawless Re-Joining of the Broken Genome without the Intervening Sequences by iCAP
[0154] The iCAP genome editing also demonstrated that it enables a precise deletion of a section of endogenous genome sequences between two gRNA target sites cleaved by programmable nucleases such as Cas9 and Cpf1 (Cas12a) and results in a flawless end re-joining of broken genome with or without the presence of dRT. In a study, gRNA target sites recognized by either Cas9 or Cpf1 were identified in introns on either sides of exon20 of human MED13L gene as shown in
Other Embodiments
[0155] The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or sub combination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
[0156] The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.