NOVEL SCHIZOCHYTRIUM SP. STRAIN AND POLYUNSATURATED FATTY ACID PRODUCTION METHOD USING SAME
20240101953 ยท 2024-03-28
Inventors
- Jung Woon Choi (Seoul, KR)
- Sung Hoon Jang (Seoul, KR)
- Ji Young Kim (Seoul, KR)
- Won Sub Shin (Seoul, KR)
- Hae Won Kang (Seoul, KR)
Cpc classification
A23K20/158
HUMAN NECESSITIES
A23K50/80
HUMAN NECESSITIES
C12P7/6427
CHEMISTRY; METALLURGY
A23K10/16
HUMAN NECESSITIES
C11B1/00
CHEMISTRY; METALLURGY
A23K10/30
HUMAN NECESSITIES
International classification
Abstract
The present application relates to a novel strain of the genus Schizochytrium (Schizochytrium sp.) and a method of producing polyunsaturated fatty acids by using the same. According to one aspect, novel microalgae of the genus Schizochytrium have a high content of fat in biomass, and particularly, a high content of polyunsaturated fatty acids such as docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA), and therefore, the microalgae, and biomass or bio-oil prepared therefrom, may be useful as a feed source or the like.
Claims
1. Microalgae of the genus Schizochytrium (Schizochytrium sp.), deposited under an accession number of KCTC14344BP or KCTC14345BP, and having an ability to produce docosahexaenoic acid (DHA), eicosapentaenoic acid (EPA), and palmitic acid (PA).
2. The microalgae of claim 1, wherein the microalgae produce 35 wt % to 60 wt % of docosahexaenoic acid based on a total weight of fatty acids.
3. The microalgae of claim 1, wherein the microalgae produce 0.5 wt % to 10 wt % of eicosapentaenoic acid based on a total weight of fatty acids.
4. The microalgae of claim 1, wherein the microalgae produce 10 wt % to 30 wt % of palmitic acid based on a total weight of fatty acids.
5. The microalgae of claim 1, wherein the microalgae have an ability to produce carotenoids.
6. The microalgae of claim 5, wherein the carotenoids are at least one selected from the group consisting of ?-carotene, lutein, astaxanthin, capsanthin, annatto, canthaxanthin, lycopene, ?-apo-8-carotenal, zeaxanthin, and ?-apo-8-carotenal-ester.
7. Biomass derived from microalgae of the genus Schizochytrium, comprising: the microalgae of the genus Schizochytrium of claim 1, cultures of the microalgae, dried products of the cultures, or lysates of the dried products.
8. A feed composition, comprising the biomass derived from the microalgae of the genus Schizochytrium of claim 7, or concentrates or dried products of the biomass.
9. A method of preparing biomass derived from microalgae of the genus Schizochytrium, comprising: culturing microalgae of the genus Schizochytrium, which are deposited under an accession number of KCTC14344BP or KCTC14345BP, and have an ability to produce docosahexaenoic acid, eicosapentaenoic acid, and palmitic acid; and recovering biomass from the microalgae, cultures of the microalgae, dried products of the cultures, or lysates of the dried products.
10. The method of claim 9, wherein the culturing is performed under heterotrophic conditions.
11. The method of claim 9, wherein the culturing is performed by using a medium comprising a carbon source and a nitrogen source.
12. The method of claim 11, wherein the carbon source is at least one selected from the group consisting of glucose, fructose, maltose, galactose, mannose, sucrose, arabinose, xylose, and glycerol.
13. The method of claim 11, wherein the nitrogen source is: i) at least one organic nitrogen source selected from the group consisting of yeast extract, beef extract, peptone, and tryptone, or ii) at least one inorganic nitrogen source selected from the group consisting of ammonium acetate, ammonium nitrate, ammonium chloride, ammonium sulfate, sodium nitrate, urea, and monosodium glutamate (MSG).
14. A method of preparing bio-oil derived from microalgae of the genus Schizochytrium, comprising: culturing microalgae of the genus Schizochytrium, which are deposited under an accession number of KCTC14344BP or KCTC14345BP, and have an ability to produce docosahexaenoic acid, eicosapentaenoic acid, and palmitic acid; and recovering lipids from the microalgae, cultures of the microalgae, dried products of the cultures, or lysates of the dried products.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0063]
[0064]
[0065]
MODE FOR INVENTION
[0066] Hereinafter, the present disclosure will be described in more detail through examples. However, these examples are intended to illustrate at least one specific example, and the scope of the present disclosure is not limited to these examples.
Example 1. Isolation of Microalgae which are Thraustochytrids
[0067] In order to isolate microalgae which are Thraustochytrids, environmental samples in a form of seawater, soil, and sediment were collected from a total of 50 coastal areas in Taean, Chungcheongnam-do, and Gunsan, Jeollabuk-do, Korea. The collected environmental samples were transported to a laboratory environment, and contaminants such as fungi, other bacterial microorganisms, and protozoa, etc. were removed within 7 days, while direct plating and pine pollen baiting were used to isolate microalgae which are Thraustochytrids. During the process of continuous removal of contaminants and microalgae isolation, samples that show similar forms to cells that form zoospores and include the same, which are characteristics of microalgae which are Thraustochytrids, were isolated, and smeared on a modified yeast extract peptone (YEP) medium (1 g/L of yeast extract, 1 g/L of peptone, 2 g/L of MgSO.sub.4.Math.7H.sub.2O, 20 g/L of sea salt, 5.0 mg/L of H.sub.3BO.sub.3, 3.0 mg/L of MnCl.sub.2, 0.2 mg/L of CuSO.sub.4, 0.05 mg/L of NaMo.sub.4.Math.2H.sub.2O, 0.05 mg/L of CoSO.sub.4, 0.7 mg/L of ZnSO.sub.4.Math.7H.sub.2O, and 15 g/L of agar), a medium for isolating marine microalgae. The obtained colonies were pure isolated by subculture several times. Colonies with persistent contamination were exposed to an antibiotic cocktail mix solution (0 mg/L to 100 mg/L of streptomycin sulfate, 0 mg/L to 100 mg/L of ampicillin, 0 mg/L to 100 mg/L of penicillin G, and 0 mg/L to 100 mg/L of kanamycin sulfate) to control and eliminate the contaminants. Through the above process, about 50 colonies were isolated and obtained.
[0068] The pure isolated colonies were cultured in a 250 mL flask under conditions of 10? C. to 35? C. and 100 rpm to 200 rpm for about 7 days, by using a modified glucose yeast extract peptone (GYEP) medium (10 g/L of glucose, 1 g/L of yeast extract, 1 g/L of peptone, 2 g/L of MgSO.sub.4.Math.7H.sub.2O, 20 g/L of sea salt, 5.0 mg/L of H.sub.3BO.sub.3, 3.0 mg/L of MnCl.sub.2, 0.2 mg/L of CuSO.sub.4, 0.05 mg/L of NaMo.sub.4.Math.2H.sub.2O, 0.05 mg/L of CoSO.sub.4, and 0.7 mg/L of ZnSO.sub.4.Math.7H.sub.2O). Among the colonies, one type of microalgae capable of growing at a temperature of 25? C. or higher, having an excellent growth rate, and from which a sufficient number of cells may be secured were finally selected and named CD01-5000. Morphology of the selected strain was observed by using an optical microscope (
Example 2. Identification of a Novel Schizochytrium Sp. Strain CD01-5000
[0069] For molecular biological identification of the microalgal strain CD01-5000 isolated and selected in Example 1, the 18S rRNA gene sequence was analyzed.
[0070] Specifically, after extracting and separating gDNA from colonies of pure isolated microalgae CD01-5000, a PCR reaction was performed by using the primers shown in Table 1 below as primers for gene amplification of the 18S rRNA region.
TABLE-US-00001 TABLE1 SeqNo. Primer Sequence(5-3) 2 18s-001F AACCTGGTTGATCCTGCCAGTA 3 18s-013R CCTTGTTACGACTTCACCTTCCTCT
[0071] For the PCR reaction, denaturation at 95? C. for 5 minutes, followed by denaturation at 95? C. for 30 seconds, annealing at 55? C. for 30 seconds, and polymerization at 72? C. for 1 minute 30 seconds, were repeated 38 times, and then polymerization was performed at 72? C. for 5 minutes, by using a reaction solution containing taq polymerases. The reaction solution amplified through the PCR process was electrophoresed on 1% agarose gel to confirm that DNA fragments having a size of about 1600 bp to 2000 bp were amplified, and sequencing analysis was performed. As a result of the analysis, a nucleotide sequence of about 1800 bp in size (SEQ ID NO: 1) was obtained, and the corresponding sequence was confirmed to show homology of 99.3% with a 18S rRNA nucleotide sequence of a Schizochytrium limacinum strain OUC192 (NCBI accession No.: HM042913.2) belonging to microalgae which are Thraustochytrids, and homology of 99.3% with a 18S rRNA nucleotide sequence of a Schizochytrium sp. strain SH104 (NCBI accession No.: KX379459.1) through NCBI BLAST searches. Through this, it was confirmed that the isolated microalgae CD01-5000 is a novel strain of the genus Schizochytrium, and the strain was named Schizochytrium sp. CD01-5000, and on Oct. 26, 2020, was deposited with the Korean Collection for Type Cultures (KCTC), an international depository institution under the Budapest treaty, and was given an accession number of KCTC14344BP.
Example 3. Development of Mutant Microalgal Strains
Example 3-1. Measurement of Mortality Rate According to Irradiation of Gamma Rays
[0072] In order to develop an artificial mutant strain from the novel microalgae CD01-5000 identified in Example 2, gamma irradiation conditions were selected by measuring mortality rates according to doses of gamma rays.
[0073] Specifically, the novel microalgae CD01-5000 were cultured in a modified GYEP medium containing 3% glucose for about 20 hours or more to reach an exponential phase. The cultured cell culture medium sample was centrifuged at 4,000 rpm for 15 minutes to harvest the cells, and the microalgae culture medium sample suspended in PBS to 10.sup.9 cells/mL was placed in a 50 mL conical tube and used for gamma irradiation experiments. The gamma ray irradiation experiments were conducted at the Advanced Radiation Research Center of the Korea Atomic Energy Research Institute, and gamma rays of 2000 Gy, 2500 Gy, 3000 Gy, 3500 Gy, 4000 Gy, 4500 Gy, 5000 Gy, 5500 Gy, 6000 Gy, 7000 Gy, or 8000 Gy were irradiated to the microalgae culture medium sample. After removing the supernatant by centrifuging the microalgae culture medium sample irradiated with gamma rays, the sample was inoculated into a GCBS medium containing 1% glucose (10 g/L of glucose, 5 g/L of corn steep liquor, 5 g/L of beef extract, 5 g/L of MgSO.sub.4.Math.7H.sub.2O, 15 g/L of sea salt, 20.08 mg/L of citric acid, 5.3 mg/L of FeSO.sub.4.Math.7H.sub.2O, 0.5 mg/L of ZnSO.sub.4.Math.7H.sub.2O, 1.0 mg/L of MnCl.sub.2, 0.1 mg/L of CuSO.sub.4, 0.1 mg/L of NaMo.sub.4.Math.2H.sub.2O, 0.1 mg/L of CoSO.sub.4, 1.0 mg/L of biotin, 1.0 mg/L of thiamine hydrochloride, 1.0 mg/L of CAPA, and 0.1 mg/L of vitamin B12) and cultured at 30? C. for about 48 hours. Thereafter, the culture medium was inoculated and smeared on GYEP medium containing 2% (20 g/L) agar, and cultured at 30? C. for 48 hours, and then a number of growing colonies was counted and mortality rates according to doses of gamma rays were calculated by the following Equation 1.
Mortality rate (%)=[{(Number of colonies in untreated group)?(Number of colonies in treated group)}/(Number of colonies in untreated group)]?100Equation 1
TABLE-US-00002 TABLE 2 Number of Gamma ray dose growing colonies (Gy) (EA) Mortality rate (%) 2000 ?90 2500 ?90 3000 ?90 3500 ?90 4000 ?10 90.5 4500 ?5 95.5 5000 ?3 98.89 5500 ?1 99.99 6000 0 100 7000 0 100 8000 0 100 Untreated group ?90 0 (Ctrl)
[0074] As a result, when gamma rays were irradiated at a dose of 6,000 Gy or more, microalgae were all killed and colonies could not be secured, and a gamma ray dose condition of 5,500 Gy was selected, which showed a mortality rate of 99.99%.
Example 3-2. Isolation of Mutant Microalgal Strains
[0075] After irradiating gamma rays at a dose of 5000 Gy to the novel microalgal strain CD01-5000 in the same manner as described in Example 3-1, the microalgal culture samples were inoculated and smeared on GYEP solid medium and GYEP solid medium supplemented with butanol and isoniazid, respectively, and cultured at 30? C. Microalgal colonies grown on each solid plate for about 4 weeks were selected and separated by subculturing in the same medium and culture conditions. Each colony separated by subculturing was judged as a different mutant strain, and colonies and strains capable of continuous growth were additionally selected.
Example 3-3. Selection of Excellent Mutant Microalgal Strains
[0076] Culture evaluation was performed on a flask scale for the mutant strains selected in Example 3-2, and an excellent mutant strain was selected through analyses of crude fat and fatty acids.
[0077] Specifically, in order to culture the novel wild-type microalgae CD01-5000 confirmed in Example 2 and the mutant microalgae selected in Example 3-2 on a flask scale, a working volume was set to 50 mL in a 500 mL flask, and in GYEP medium including 3% (30 g/L) glucose, the microalgae were cultured at 30? C. and 180 rpm for 24 hours to obtain a certain number of cells that may be analyzed. Thereafter, the culture medium was centrifuged by using a 50 mL conical tube, then the supernatant was removed, and the cells were collected and washed three times with PBS of pH 7.5, and then dried in a dry oven at 60? C. overnight to obtain each group of dried cells.
[0078] 8.3 M of hydrochloric acid solution was added to 2 g of each group of the obtained dried cells to hydrolyze the cell walls of the microalgae cells at 80? C., and then processes of adding 30 mL of ethyl ether and 20 mL of petroleum ether, mixing for 30 seconds, and then centrifuging, were repeated three or more times. The separated solvent layer was collected, transferred to a pre-weighed round flask, and then the solvent was removed by nitrogen purging and dried in a desiccator until the weight became constant. A weight of the dried oil was measured by subtracting a weight of the empty flask from a weight of the flask after the drying. In addition, the obtained dried oil was pre-treated with 0.5 N of methanolic NaOH and 14% trifluoroboran methanol (BF.sub.3), and then contents of the palmitic acid (PA), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA) included in the oil were measured by using gas chromatography, and the content was calculated as a percentage relative to the total oil, that is, a weight of the crude fat.
TABLE-US-00003 TABLE 3 Fatty acid content based on crude fat (w/w %) Strain PA EPA DHA Wildtype (CD01-5000) 26.3 1.1 52.7 Variant 1 23.4 0.5 17.6 Variant 2 25.9 0.9 26.5 Variant 3 (CD01-5004) 26.2 1.4 56.3 Variant 4 28.3 1.3 22.7 Variant 5 28.1 1.5 25.2 Variant 6 28.2 1.2 21.4 Variant 7 29.0 1.5 22.9 Variant 8 25.1 1.1 34.8 Variant 9 11.8 0.6 11.5 Variant 10 25.1 1.1 20.7 Variant 11 24.4 0.7 33.0 Variant 12 29.7 0.8 18.0 Variant 13 29.6 1.2 21.4 Variant 14 24.7 1.5 20.4 Variant 15 28.7 0.6 16.9 Variant 16 24.8 1.5 19.7 Variant 17 24.8 1.5 21.4 Variant 18 28.2 0.7 17.8 Variant 19 29.9 0.6 17.9 Variant 20 24.9 0.7 21.6 Variant 21 22.4 1.6 19.5 Variant 22 12.4 0.4 7.4
In Table 3, PA denotes palmitic acid, EPA denotes eicosapentaenoic acid, and DHA denotes docosahexaenoic acid.
[0079] As a result, as shown in Table 3, the novel Schizochytrium sp. strain CD01-5000 showed a very high DHA content of 50% or higher, and contents of palmitic acid and EPA were also shown to be higher than other variants. In addition, Variant 3 that showed DHA contents higher than the wild type strain, and also showed higher palmitic acid and EPA contents than other variants, was selected as an excellent variant among the experimented variants, named Schizochytrium sp. CD01-5004, and on Oct. 26, 2020, was deposited with the Korean Collection for Type Cultures (KCTC), an international depository institution under the Budapest treaty, and was given an accession number of KCTC14345B P.
Example 4. Confirmation of Culture Characteristics of Wild-Type Schizochytrium Sp. Strain CD01-5000, and Mutant Schizochytrium Sp. Strain CD01-5004
[0080] Additional culture characteristics of the novel wild-type Schizochytrium sp. strain CD01-5000, and a mutant thereof, Schizochytrium sp. strain CD01-5004, were confirmed.
Example 4-1. Analysis of Biomass and Fatty Acid Content
[0081] The CD01-5000 strain, the CD01-5004 strain, and a Schizochytrium sp. ATCC20888 strain, which is a control group, were cultured in a 5 L fermenter, until the total volume reached 3 L. The strains were cultured under conditions of 20? C. to 35? C., 100 rpm to 500 rpm, and 0.5 vvm to 1.5 vvm, in GYEP medium including 5 g/L of yeast extract and 10 g/L of peptone as nitrogen sources, and dried cells were obtained from the culture medium in the same manner as described in Example 3-3, and contents of intracellular crude fat and fatty acids were analyzed.
TABLE-US-00004 TABLE 4 Weight of Fatty acids among crude fat dried cells (w/w %) Strain (g/L) EPA DHA Schizochytrium sp. ATCC20888 49.70 0.86 22.40 Schizochytrium sp. CD01-5000 45.80 2.95 47.00 Schizochytrium sp. CD01-5004 53.00 4.25 42.90
In Table 4, EPA denotes eicosapentaenoic acid, and DHA denotes docosahexaenoic acid.
[0082] As a result, as shown in Table 4, the CD01-5000 and CD01-5004 strains were confirmed to show biomass growth similar to the strain Schizochytrium sp. ATCC20888, which was cultured as a control group, while producing and accumulating high levels of EPA and DHA in the cells.
Example 4-2. Analysis of Contents of Proteins and Amino Acids
[0083] Additional culture tests were conducted on the CD01-5004 strain, which showed the highest biomass content and EPA content, in order to analyze contents of intracellular proteins and amino acids.
[0084] Specifically, the strain was cultured for a total of 63 hours under the same culturing conditions as described in Example 4-1, except that GYEP medium including 10 g/L of yeast extract and 10 g/L of ammonium chloride as nitrogen sources was used. After the culturing is ended, dried cells were obtained from the culture medium in the same manner as described in Example 3-3.
[0085] For an analysis of protein contents, nitrogen contents present in the sample were quantified by using an element analyzer for 0.5 g to 1.0 g of dried cells, respectively. A weight ratio (TN %) of nitrogen present in each sample was multiplied by 6.25 to calculate a content of crude proteins in the sample.
[0086] In order to analyze the amino acid content, 0.5 g to 1 g of each group of dried cells was acid hydrolyzed, and then liquid chromatography was performed thereto. A component ratio (%) of each amino acid was calculated as a percentage of each amino acid relative to the total amino acid concentration in the sample.
TABLE-US-00005 TABLE 5 Weight of dried cells 60.5 (g/L) Crude protein (%) 74.38 Amino acid composition (%) Aspartic acid 4.55 Serine 2.97 Glutamate 23.31 Glycine 3.65 Alanine 7.73 Valine 7.35 Methionine 5.03 Isoleucine 3.10 Leucine 3.53 Phenylalanine 20.51 Histidine 11.85 Proline 6.42
[0087] As a result, as shown in Table 5, total production of the cells was 60.5 g/L and the crude protein content in the dried cells was confirmed to be 74.38%. Intracellular amino acids were mainly composed of glutamate at 23.31% and phenylalanine at 20.51%, followed by histidine, alanine, valine, proline, methionine, aspartic acid, glycine, leucine, isoleucine, and serine.
Example 5. Confirmation of Growth Rate of Wild-Type Schizochytrium Sp. Strain CD01-5000, and Mutant Schizochytrium Sp. Strain CD01-5004
[0088] Growth rates of the novel wild-type Schizochytrium sp. strain CD01-5000, and a mutant thereof, Schizochytrium sp. strain CD01-5004, were measured and compared.
[0089] Specifically, CD01-5000 and CD01-5004 strains were each inoculated into GYEP medium containing 3% glucose so that the final working volume was 50 mL in a 500 mL flask, and cultured in a shaking incubator under conditions of 30? C. and 180 rpm. During the culturing, absorbance was measured as an optical density (OD) value at a wavelength of 680 nm by using a UV/Visible spectrophotometer to measure degrees of cell growth at each stage.
[0090] As a result, as shown in
Example 6. Confirmation of Growth Characteristics of Wild-Type Schizochytrium Sp. Strain CD01-5000, and Mutant Schizochytrium Sp. Strain CD01-5004
[0091] It was confirmed whether growth was possible in a wide pH range when culturing the novel wild-type Schizochytrium sp. strain CD01-5000, and a mutant thereof, Schizochytrium sp. strain CD01-5004.
[0092] Specifically, the CD01-5000 and CD01-5004 strains were inoculated into GYEP medium having a pH of 2, 3, 3.5, 4, 6, 8, 8.5, 9, or 9.5 each in a 500 mL flask, and cultured in the same manner as described in Example 4, and then the absorbance of each at 0, 24, 40, and 48 hours after initiating the culturing was measured to evaluate degrees of cell growth.
TABLE-US-00006 TABLE 6 Culture time (h) 0 24 40 48 pH 2 1.29 0.81 0.77 0.74 pH 3 0.31 0.39 3.43 3.94 pH 3.5 0.31 18.60 20.05 20.00 pH 4 1.29 16.08 17.70 19.30 pH 6 1.29 13.52 19.30 15.75 pH 8 1.29 13.78 18.15 16.05 pH 8.5 0.31 14.05 14.55 14.20 pH 9 0.31 4.95 15.35 12.95 pH 9.5 0.31 2.35 0.30 0.64
In Table 6, each value is absorbance for each culture time according to pH conditions.
[0093] As a result, as shown in Table 6 and
[0094] In addition, in view of the fact that the culture medium showed a deep red color when culturing the CD01-5000 and CD01-5004 strains, the strains were found to produce antioxidant pigments of the carotenoid family, such as ?-carotene, lutein, astaxanthin, capsanthin, annatto, canthaxanthin, lycopene, ?-apo-8-carotenal, zeaxanthin, ?-apo-8-carotenal-ester, etc.
[0095] From the above description, those skilled in the art to which the present disclosure belongs will be able to understand that the present disclosure may be embodied in other specific forms without changing its technical idea or essential characteristics. Therefore, it should be understood that the above examples are not limitative, but illustrative in all aspects. A scope of the present application should be construed as including all changes or modifications derived from the meaning and scope of the claims to be described later and equivalent concepts, rather than the detailed description above.