Transgenic microalgae and use thereof as a feed for delivery of interfering RNA molecules
11939576 ยท 2024-03-26
Assignee
Inventors
Cpc classification
A23K50/80
HUMAN NECESSITIES
A01N65/00
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A23K10/16
HUMAN NECESSITIES
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A23K20/00
HUMAN NECESSITIES
A23K20/153
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
C12N15/111
CHEMISTRY; METALLURGY
C12N2320/32
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
A23K50/80
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
A01N65/00
HUMAN NECESSITIES
A23K10/16
HUMAN NECESSITIES
A23K20/00
HUMAN NECESSITIES
A23K20/153
HUMAN NECESSITIES
Abstract
The present invention provides non-propagating transgenic microalgae expressing at least one heterologous RNAi molecule. The RNAi-expressing non-propagating transgenic microalgae are used for oral delivery of the RNAi molecule to a target organism in its intact and functional form. The heterologous RNAi molecule, present within the microalgae, is characterized by being biologically active, exerting at least one specific effect on the organism consuming the microalgae or on a pathogen of said organism. In particular, the non-propagating transgenic microalgae are used as agents for biological control of animal and plant pests.
Claims
1. A non-propagating transgenic Phaeodactylum tricornutum microalga comprising at least one heterologous RNAi molecule, wherein the RNAi molecule is targeted to a clk gene present within an insect plant pest and wherein said RNAi molecule silences the expression of the clk gene present within the insect plant pest when the microalga is consumed by said insect plant pest, wherein said microalga is in a dried form.
2. The non-propagating transgenic P. tricornutum microalga of claim 1, wherein the RNAi molecule comprises a sense strand comprising at least 19 contiguous nucleic acids having at least 90% identity to the insect clk gene or a fragment thereof, and an antisense strand complementary thereto.
3. The non-propagating transgenic P. tricornutum microalga of claim 1 wherein said transgenic microalga is formulated in a form selected from the group consisting of an edible composition and a formulation to be applied onto a plant, wherein the edible composition or the formulation further comprises a substance selected from the group consisting of edible diluents, excipients, and carriers.
4. A method for inhibiting the expression of a clk gene within an insect plant pest, the method comprising providing to the insect plant pest an edible non-propagating transgenic Phaeodactylum tricornutum microalga comprising an RNAi molecule targeted to said clk gene present within said insect plant pest, wherein the microalga is in a dried form.
5. The method of claim 4, wherein the polynucleotide present within the organism is heterologous to said organism and wherein the RNAi molecule is targeted to a virus that infects the organism.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
DETAILED DESCRIPTION OF THE INVENTION
(12) The present invention provides compositions and methods for oral delivery of RNAi molecules to a target organism in an efficient, stable and environmentally safe way. In particular, the present invention provides non-propagating transgenic microalgae comprising polynucleotide molecules mediating RNAi and edible compositions comprising same.
(13) The present invention discloses that the RNAi molecule exerts its biological activity in cells or tissues of the organism consuming the transgenic microalgae. The RNAi molecule comprises a sequence that is complementary to a target gene or a part thereof present in the organism consuming the non-propagating transgenic microalgae. Additionally or alternatively, the target gene is present in a pathogen of said organism. As a result, the target gene expression is inhibited. The RNAi may be used for applying a deleterious effect on the organism, for instance when the organism is a pest or when the organism is a pathogen which invades into a host organism and survives within its cell. In addition, the RNAi may have a beneficial effect on the growth, development or welfare of the consuming organism by altering its endogenous genes expression.
(14) The present invention is based in part on the unexpected discovery that the RNAi molecules remain intact throughout the processing of the transgenic microalgae and up to the consumption of the algae by insects. Without wishing to be bound by any particular theory or mechanism of action, the microalgal cell which serves as a natural encapsulation material together with the relatively stable structure of the dsRNA protect the RNAi molecule from being degraded during processing, particularly during drying and further within the digestive system of organism.
(15) Unexpectedly the algae of the invention can be dried and stored while preserving the RNAi activity once the dried algae are consumed by an organism. A significance advantage of the algae-based RNAi delivery system of the invention is that the dried algae of the invention cannot propagate even if re-hydrated, as exemplified in
(16) Additional advantage of the technology of the present invention is in that the technology is generic in the sense that the microalgae can be applied to a wide range of target organisms, directly or indirectly via the target organism natural food. No specificity for the target organism (apart from the targeted gene) is required in the genetic engineering process. In contrast, in producing transgenic plants (expressing Bacillus thuringiensis for example), there is a need to have the knowledge how to transform each crop individually.
(17) Additional advantage of the present invention is that the algae can be also provided to those animals not consuming the algae as part of their diet, for example by spraying the algae onto regular food of said animals (for example, spraying the transgenic microalgae onto plants consumed by an insect). Additional advantage of the non-propagating transgenic microalgae formulations of the present invention is a long shelf life. According to certain embodiments, the dried transgenic microalgae can be stored at 4? C. for 6-12 months.
(18) Typically, RNA interference (RNAi) refers to the process of sequence-specific post transcriptional gene silencing mediated by small interfering RNAs (siRNA). Long double stranded RNA (dsRNA) in cells typically stimulates the activity of a ribonuclease III enzyme referred to as Dicer. The Dicer is involved in the processing of the long dsRNA into short pieces of siRNA. siRNAs derived from Dicer activity are typically about 21-23 nucleotides in length and include duplexes of about 19 base pairs.
(19) The RNAi response also features an endonuclease complex containing siRNA, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single stranded RNA having sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex. Without being bound to any mechanism of processing or action, the present invention relates to RNAi, whether processed or not, as a tool for down regulating gene expression.
Definitions
(20) The terms microalga or microalgae are used herein in their broadest scope and refer to unicellular microscopic eukaryotic algae, typically found in freshwater and marine systems. Depending on the species, the microalgae size can range from a few micrometers (?m) to a few hundreds of micrometers. According to certain currently specific embodiments, the term refers to marine eukaryotic microalga or microalgae.
(21) As used herein, the terms dry or dried when used with reference to the transgenic microalgae of the present invention refers to microalgae preparation comprising no more than 20% of water, typically no more than 15% of water out of the total mass of the transgenic microalgae.
(22) As used herein, the term non-propagating when used with reference to the transgenic microalgae of the present invention refers to microalgae that are not viable in the sense that the microalgae cannot divide and produce offspring.
(23) The terms RNAi molecule and RNA interfering molecule are used interchangeably herein. These terms encompass double stranded RNA (dsRNA) sequences with sense and antisense strands, wherein the antisense has high complementarity to target genes. The terms also encompass a polynucleotide expressing the dsRNA. The sense and the antisense may have partial or full double stranded character. The double stranded RNA may be cleaved by a Dicer protein into ?20 nucleotides, or the expressed dsRNA may be of a length of ?20 nucleotides, which later induce the cleavage of their complementary mRNA. As a result, the expression of the target gene is reduced.
(24) The terms down regulated, inhibited, reduced and silenced (in any tense used) as referring to genes targeted by the RNAi molecules, refers to a diminishment in the level of expression of a gene(s) in the presence of one or more double stranded RNA(s) or DNA construct(s) expressing same when compared to the level in the absence of such double stranded RNA(s) or DNA construct(s). The terms down regulated, inhibited, reduced, and silenced are used herein to indicate that the target gene expression is lowered by 1-100%. For example, the expression may be reduced by about 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, 99%, or more.
(25) The sequence of the double stranded RNA can correspond to the full length target gene, or to a subsequence thereof. Double stranded RNA is targeted to a gene in that the nucleotide sequence of the duplex portion of the double stranded RNA is substantially complementary to a nucleotide sequence of the target gene. The double stranded RNA of the invention may be of varying lengths. The length of each strand of the double stranded RNA is preferably from about 20 to about 1500 nucleotides in length. Alternatively, the sense strand and antisense strand each comprises from about 50 to about 1000 nucleotides in length, further alternatively each strand comprises from about 100 to about 800 nucleotides, yet further alternatively each strand comprises from about 150 to about 500 nucleotides in length. However, an RNA strand of about 12 to about 20 nucleotides is also encompassed in the present invention.
(26) The terms xenogeneic organism target organism and xenogeneic target organism are used herein interchangeably and refer to an organism other than the transgenic microalgae. According to certain embodiments of the present invention the xenogeneic organism is the organism that consumes the transgenic microalga. The RNAi molecule may be targeted to a polynucleotide of the target organism or to a heterologous polynucleotide within the xenogeneic organism, particularly a virus. According to other embodiments of the present invention, the target organism is a pathogen of a host organism consuming the transgenic microalgae and then the RNAi molecule is targeted to a polynucleotide of the pathogen. According to certain embodiments, the pathogen is a parasite or a bacterium.
(27) The term gene in its broadest sense refers to a discrete genomic region whose transcription is regulated by one or more promoters and distal regulatory elements and which contains the information for the synthesis of functional proteins or non-coding RNAs, related by the sharing of a portion of genetic information at the level of the ultimate products (proteins or RNAs). As used herein, the term gene refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises coding sequences necessary for the production of RNA or proteins. An RNA or a protein can be encoded by a full-length coding sequence or by any part thereof. The term parts thereof when used in reference to a gene refers to fragments of that gene. The fragments may range in size from a few nucleotides to the entire gene sequence minus one nucleotide.
(28) The term gene also encompasses the coding regions of a structural gene and includes sequences located adjacent to the coding region on both the 5 and 3 ends for a distance of about 1 kb on either end such that the gene corresponds to the length of the full-length mRNA. The sequences which are located 5 of the coding region and which are present on the mRNA are referred to as 5 non-translated sequences. The sequences which are located 3 or downstream of the coding region and which are present on the mRNA are referred to as 3 non-translated sequences. The term gene encompasses both cDNA and genomic forms of a gene, wherein a genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed introns or intervening regions or intervening sequences. Introns are removed or spliced out from the nuclear or primary transcript, and therefore are absent in the messenger RNA (mRNA) transcript.
(29) As referred to herein, the terms polynucleotide molecules, polynucleotide, nucleic acid and nucleotide sequences may interchangeably be used herein. The terms are directed to polymers of deoxyribonucleotides (DNA), ribonucleotides (RNA), and modified forms thereof in the form of a separate fragment or as a component of a larger construct, linear or branched, single stranded (ss), double stranded (ds), triple stranded (ts), or hybrids thereof. The term also encompasses RNA/DNA hybrids. The polynucleotides may be, for example, sense and antisense oligonucleotide or polynucleotide sequences of DNA or RNA. The DNA or RNA molecules may be, for example, but are not limited to: complementary DNA (cDNA), genomic DNA, synthesized DNA, recombinant DNA, or a hybrid thereof or an RNA molecule such as, for example, mRNA, shRNA, siRNA, miRNA, and the like. Accordingly, as used herein, the terms polynucleotide molecules, oligonucleotide, polynucleotide, nucleic acid and nucleotide sequences are meant to refer to both DNA and RNA molecules. The terms further include oligonucleotides composed of naturally occurring bases, sugars, and covalent inter nucleoside linkages, as well as oligonucleotides having non-naturally occurring portions, which function similarly to respective naturally occurring portions.
(30) As referred to herein, the term complementary is directed to base pairing between strands of nucleic acids. As known in the art, each strand of a nucleic acid may be complementary to another strand in that the base pairs between the strands are non-covalently connected via two or three hydrogen bonds. Two nucleotides on opposite complementary nucleic acid strands that are connected by hydrogen bonds are called a base pair. According to the Watson-Crick DNA base pairing, adenine (A) forms a base pair with thymine (T) and guanine (G) with cytosine (C). In RNA, thymine is replaced by uracil (U). The degree of complementarity between two strands of nucleic acid may vary, according to the number (or percentage) of nucleotides that form base pairs between the strands. For example, 100% complementarity indicates that all the nucleotides in each strand form base pairs with the complement strand. For example, 95% complementarity indicates that 95% of the nucleotides in each strand from base pair with the complement strand. The term sufficient complementarity may include any percentage of complementarity from about 30% to about 100%.
(31) The term about as used herein in the context of the sequence length refers to within a range of minus or plus 10%.
(32) The term construct, as used herein refers to an artificially assembled or isolated nucleic acid molecule which may be comprises of one or more nucleic acid sequences, wherein the nucleic acid sequences may be coding sequences (that is, sequence which encodes for an end product), regulatory sequences, non-coding sequences, or any combination thereof. The term construct includes, for example, vectors but should not be seen as being limited thereto.
(33) The term expression vector refers to vectors that have the ability to incorporate and express heterologous nucleic acid fragments (such as DNA) in a foreign cell. In other words, an expression vector comprises nucleic acid sequences/fragments (such as DNA, mRNA, tRNA, rRNA), capable of being transcribed. Many viral, prokaryotic and eukaryotic expression vectors are known and/or commercially available. Selection of appropriate expression vectors is within the knowledge of those having skill in the art.
(34) The terms promoter element, promoter or promoter sequence as used herein, refer to a nucleotide sequence that is generally located at the 5 end (that is, precedes, located upstream) of the coding sequence and functions as a switch, activating the expression of a coding sequence. If the coding sequence is activated, it is said to be transcribed. Transcription generally involves the synthesis of an RNA molecule (such as, for example, an mRNA) from a coding sequence. Promoters may be derived in their entirety from a native source, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic nucleotide segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different stages of development, or in response to different environmental conditions, or at various expression levels. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as constitutive promoters.
(35) The term operably linked means that a selected nucleic acid sequence is in proximity with a promoter to allow the promoter to regulate expression of the selected nucleic acid sequence. In general, the promoter is located upstream of the selected nucleic acid sequence in terms of the direction of transcription.
(36) As used herein, the term homology when used in relation to nucleic acid sequences refers to a degree of similarity or identity between at least two nucleotide sequences. There may be partial homology or complete homology (i.e., identity). Sequence identity refers to a measure of relatedness between two or more nucleotide sequences, expressed as a percentage with reference to the total comparison length. The identity calculation takes into account those nucleotide residues that are identical and in the same relative positions in their respective sequences. A gap, i.e. a position in an alignment where a residue is present in one sequence but not in the other is regards as a position with non-identical residues. A widely used and accepted computer program for performing sequence alignments is CLUSTALW v1.6 (Thompson, et al. Nucl. Acids Res., 22: 4673-4680, 1994).
(37) The term transgenic when used in reference to an alga (i.e., a transgenic alga) refers to an alga that contains at least one heterologous polynucleotide.
(38) The term antisense oligonucleotide refers to an oligonucleotide that binds to target RNA by means of RNA-RNA or RNA-DNA or RNA-PNA (protein nucleic acid) interactions and alters the activity of the target RNA (for a review, see Stein and Cheng, 1993 Science 261, 1004-1012). Typically, antisense molecules are complementary to a target sequence along a single contiguous sequence of the antisense molecule. However, in certain embodiments, antisense oligonucleotide can be complementary to two (or even more) non-contiguous target sequences.
(39) The term expression, as used herein, refers to the production of a desired end-product molecule in a target cell. The end-product molecule may be, for example an RNA molecule.
(40) As used herein, the term transformation refers to the transfer of molecules, such as, for example, nucleic acids, polynucleotide molecules, vectors, and the like into a target cell(s), and more specifically into the interior of a membrane-enclosed space of a target cell(s). The molecules can be transformed into the target cell(s) by any means known to those of skill in the art. Means of transforming molecules into a cell include, for example, but are not limited to: heat shock, calcium phosphate transfection, PEI transfection, electroporation, lipofection, gene bombardment, transfection reagent(s), viral-mediated transfer, and the like, or combinations thereof.
(41) As used herein, the term heterologous when referred to RNAi molecule is directed to a recombinant DNA or RNA molecule which is introduced to and/or expressed within a target cell. The heterologous RNA molecule may be intact (that is, a full-length molecule) or may be cleaved within the cell at one or more cleavage sites.
(42) As used herein, the term target nucleic acid refers to pre-mRNA and mRNA (or portions thereof).
(43) As used herein, the term heterologous refers to gene or polynucleotide that originates outside of the organism of concern.
(44) As used herein, the term edible refers to a compound or a composition suitable to be eaten as a food. In the context of the present invention, the term encompasses compounds/composition that can be eaten by insects and other plant and/or animal pests.
(45) According to one aspect, the present invention provides a non-propagating transgenic microalga comprising at least one heterologous polynucleotide expressing RNAi molecule, wherein the RNAi molecule is targeted to a polynucleotide present within a xenogeneic organism.
(46) According to certain embodiments, the RNAi molecule silences the expression of the polynucleotide present within the xenogeneic organism when the microalga is consumed by said organism. According to certain embodiments, the polynucleotide present within the xenogeneic organism is endogenous gene of said organism. According to other embodiments, the RNAi molecule is targeted to a gene or part thereof of a parasite or a pathogen of the xenogeneic organism.
(47) According to certain embodiments, the RNAi molecule silences the expression of a polynucleotide present within a xenogeneic organism, wherein the xenogeneic organism is a pathogen of a host organism consuming the microalga.
(48) According to additional embodiments, the RNAi molecule silences the expression of a polynucleotide present within a xenogeneic organism, wherein the xenogeneic organism is fed on a plant, particularly crop plant at least partially covered with the microalga.
(49) According to certain embodiments, the RNAi molecule silences the expression of a polynucleotide present within a xenogeneic organism, wherein the xenogeneic organism is fed on an intervening organism consuming the microalga.
(50) According to certain embodiments, the xenogeneic organism is a plant pest or parasite. According to certain exemplary embodiments, the plant pest is selected from the group presented in Table 1.
(51) TABLE-US-00001 TABLE 1 Plant pests Order Family Genus/Species Affected Plants Orthoptera Acrididae Schistocerca Perl millet (Pennisetum gregaria glaucum), maize, sorghum, barley, rice, pasture grasses, sugarcane, cotton, fruit trees, date palms, banana plants, vegetables and weeds Acrididae locusta Perl millet migratoria (Pennisetum glaucum), maize, sorghum, barley, rice, pasture grasses, sugarcane, cotton, fruit trees, date palms, banana plants, vegetables and weeds Lepidoptera Noctuidae Spodoptera Cotton, Cabbage, Capsicum littoralis Helicoverpa zea Corn, Tomato, Lettuce, Broccoli Heliothis Tobacco, Cotton, Soybean, (genus) Pigeon Pea Geometridae Trichoplusia ni Brassicaceae crops including Cabbage, Tomato, Cucumber, Collard Greens, Potato Ascotis/ Alfalfa, Citrus, Coffee, Mulberry, selenaria Peanuts, Tea, Avocado Plutellidae Plutella/ Cabbage, Radish, xylostella Horseradish Gelechiidae Pectinophora Cotton gossypiella Scrobipalpa Beet ocellatella Phthorimaea Potatoes, Tobacco operculella Castniidae Paysandisia Palm archon Crambidae Duponchelia Corn, Cucumbers, Peppers, fovealis Pomegranate, Tomatoes, certain herbs and flowers as Anemone, Begonia, Cyclamen etc Gracillariidae Phyllonorycter Apples blancardella Phyllonorycter crataegella Tortricidae cacoecimorpha Olive trees and Avocado pronubana Argyrotaenia Vines, Maize and fruit trees ljungiana Tineidae Opogona Banana, Pineapple, Corn sacchari Coleoptera Elateridae Agriotes Leaves but mostly roots of Cereals, sputator Maize, Sunflower, Sugar Beet, Potato and Peanut Agriotes lineatus Capnodis Capnodis Almond, Apricot, Cherry (Prunus carbonaria Vulgaris Linnaeus), Nectarine, Peach, Plum Chrysomelidae Leptinotarsa Potatoes, Tomatoes, Eggplants decemlineata Oulema melanopus Phyllotreta Canola, Brassicaceae crops cruciferae including Radish and Cabbage Phyllotreta Canola, Brassicaceae crops striolata including Radish and Cabbage Scarabaeidae Maladera Sweet potatoes insanabilis Curculionidae Rhynchophorus Palm ferrugineus Sitophilus Maize, Wheat, Rice, Sorghum, zeamais Oats, Barley, Rye, Buckwheat, Peas
(52) According to certain embodiments, the xenogeneic organism is an animal pest or parasite. According to certain exemplary embodiments, the animal is fish, and the pest or parasite is selected from the group presented in Table 2.
(53) TABLE-US-00002 TABLE 2 Fish pests Family Known species Affected animals Insects: Lernaeidae Lernaea cyprinacea Freshwater fish as Cyprinids and Salmonids Caligidae Lepeophtheirus salmonis Farmed and wild Atlantic salmon Caligus elongatus Farmed and wild Atlantic salmon Pennellidae Lernaeocera branchialis Cod or other fishes of the cod family Lernaeocera lusci Cod and sole fish Lernaeopodidae Salmincola californiensis Farmed salmonids Sphyrion lumpi Redfish Argulidae Argulus foliaceus Freshwater fish as carps, salmonids, Argulus japonicus Freshwater fish mainly common car and goldfish Cymothoidae Ceratothoa gaudichaudii Salmon farms in and Ceratothoa cf. Chile and Australia imbricata Worms: Gyrodactylidae Gyrodactylus salaris Salmonids and particularly Atlantic salmon Gyrodactylus salmonis Salmonids Gyrodactylus anguillae Freshwater fish as eels Troglotrematidae Nanophyetus salmincola Salmonids Dactylogyridae Dactylogyrus vastator Freshwater fish as Common carp and goldfish Dactylogyrus extensus Freshwater fish as Common carp and goldfish Dactylogyrus minutus Freshwater fish as Common carp Heterophyidae Centrocestus formosanus Freshwater fish Haplorchis pumilio Freshwater fish Clinosomatidae Clinostomum marginatum Freshwater fish Camallanidae Camallanus cooked Aquarium fish Capillariidae Capillaria Aquarium fish Bothriocephalidae Bothriocephalus Freshwater fish as acheilognathi Cyprinidae Lernaeidae Lernaea Aquarium fish as goldfish and koi Tetraonchidae Tetraonchus awakurai Masou salmon Tetraonchus oncorhynchi Masou salmon Diplectanidae Diplectanum aequans Sea bass Diplectanum Sea bass laubieri Capsalidae Neobenedenia melleni Marine teleost species Diphyllobothriidae Diphyllobothrium Salmonids dendriticum Philometridae Hysterothylacium Sterlet bidentatum
(54) According to certain additional exemplary embodiments, the animal is a domestic animal, and the xenogeneic organism is pest or a parasite selected from the group presented in Table 3.
(55) TABLE-US-00003 TABLE 3 Pests of domestic animals Family Known species Affected animals Insects: Haematopinidae Haematopinus Cattle eurysternus Haematopinus suis Swine Trichodectidae Bovicola bovis Bovicola ovis Sheep Damalinia limbata Goat Menoponidae Menacanthus Chickens stramineus Menopon gallinae Chickens Pulicidae Echidnophaga Chickens gallinacea Worms: Fasciolidae Fasciola hepatica Sheep and cattle Fascioloides magna Domestic ruminants Dicrocoeliidae Dicrocoelium Cattle dendriticum Paramphistomatidae Paramphistomum cervi Cattle and sheep Calicophoron daubneyi Cattle and sheep Taeniidae Taenia saginata Cattle and human taenia solium Pigs and human Anoplocephalidae Moniezia expansa Sheep, goats and cattle moniezia benedini Sheep, goats and cattle thysanosoma actinoides Sheep, goats Trichostrongylidae Trichostrongylus axei horse, cattle, sheep, goat Trichostrongylidae Teladorsagia Sheep and goats circumcincta Ostertagia ostertagi Cattle Haemonchus contortus Sheep and goats mecistocirrus digitatus Cattle, sheeps, goat, pigs Strongylidae Strongylus vulgaris Horse Oesophagostomum Goats, pigs bifurcum stephanuridae stephanurus dentatus Pigs Ascarididae Ascaris suum Pigs Trichinella Trichinella spiralis Pigs, horses
(56) According to certain embodiments, the RNAi molecule comprises a sense strand and an antisense strand, the sense strand and the antisense strand together form a duplex, said sense strand comprises at least 19 contiguous nucleic acids having at least 90% identity to the target polynucleotide present within a xenogeneic target organism.
(57) According to certain embodiments, the RNAi molecule is targeted to a polynucleotide of an insect. According to certain exemplary embodiments, the RNAi molecule is targeted to the clk gene. According to some embodiments, the clk gene comprises the nucleic acid sequence set forth in SEQ ID NO:1 (GenBank: HQ428033.2).
(58) According to these embodiments, the RNAi molecule comprises a sense strand comprising a polynucleotide sequence having at least 90% homology, typically at least 95% homology, more typically at least 99% homology to the nucleic acids sequence set forth in SEQ ID NO:1 or a fragment thereof, and an antisense strand comprising a polynucleotide having at least 90% homology, typically at least 95% homology, more typically at least 99% homology to a nucleic acids sequence complementary to SEQ ID NO:1 or a fragment thereof.
(59) According to certain exemplary embodiments, the RNAi molecule comprises a sense strand comprising the polynucleotide sequence set forth in SEQ ID NO:2 and an antisense strand comprising the polynucleotide sequence set forth in SEQ ID NO:3.
(60) SEQ ID NO:1 encodes for the clock gene (clk) of desert locust. It was shown that treatment with double-stranded RNA targeted to clk is lethal in adults and fifth instar nymphs of the desert locust, Schistocerca gregaria (Tobbacka et al. 2011. Insect Biochemistry and Molecular Biology 41:313-321). The present invention provides a method for feeding the desert locust or the migratory locust (Locusta migratoria) with RNAi molecules produced by microalgae. The non-propagating microalgae of the invention are applied onto wheat sprouts, seedlings or mature plants which are later consumed by the locust. According to certain exemplary embodiments, the non-viable microalgae or a composition comprising same are sprayed on plants consumed by the locust.
(61) According to certain embodiments, the RNAi molecule is targeted to a polynucleotide of a copepod. According to certain exemplary embodiments, the copepod is Lepeophtheirus salmonis and the RNAi molecule is targeted to the Lepeophtheirus salmonis COPB2 gene. According to these embodiments, the RNAi molecule comprises a sense strand comprising a polynucleotide sequence having at least 90% homology, typically at least 95% homology, more typically at least 99% homology to the nucleic acids sequence set forth in SEQ ID NO:35 or a fragment thereof, and an antisense strand comprising a polynucleotide having at least 90% homology, typically at least 95% homology, more typically at least 99% homology to a nucleic acids sequence set forth in SEQ ID NO:36 or a fragment thereof.
(62) According to other embodiments, the RNAi has a beneficial effect on at least one of the growth, development and survival of the consuming animal. Each possibility represents a separate embodiment of the present invention.
(63) According to other embodiments, the RNAi has a therapeutic effect on the animal consuming the transgenic microalgae. According to certain embodiments, the RNAi provides resistance to a land pest. According to certain embodiments, the RNAi provides resistance to an aquatic pest According to certain embodiments, the RNAi provides resistance to a virus.
(64) According to certain embodiments, the organism is a fish. The fish may optionally be grown for food or for a non-food purpose (the latter including but not limited to ornamental and the like).
(65) According to certain embodiments, the organism is a crustacean. The crustacean may optionally be grown for food or for a non-food purpose (the latter including but not limited to ornamental and the like).
(66) According to another embodiment, the organism is a poultry animal. Poultry are typically grown in large numbers therefore an advantageous means of providing them a biologically active agent is by oral delivery.
(67) According to certain embodiments, the non-propagating transgenic microalgae of the present invention can be administered per se, or can be formulated into an edible composition further comprising edible diluents, excipients or carriers. According to certain exemplary embodiments, the non-propagating transgenic microalgae are dried, when administered alone as well when administered within a composition.
(68) Drying the transgenic microalgae of the present invention requires the use of drying techniques which are suitable for preserving the function of the RNAi activity once the microalgae is consumed by the xenogeneic organism. Typically, the entire drying process is performed at a temperature below 50? C.
(69) According to certain exemplary embodiments, the transgenic microalgae are freeze-dried. According to other embodiments, the transgenic microalgae are dried using microwave vacuum drying techniques. Both methods are designed for high-volume, low-temperature dehydration of solid, liquid, granular or encapsulated material.
(70) According to certain exemplary embodiments, the dried transgenic microalgae are mixed with at least one edible diluent, excipient or carrier.
(71) According to certain exemplary embodiments, the dried transgenic microalgae are mixed with gelatin. According to additional exemplary embodiments, the dried transgenic microalgae are mixed with fish oil. According to some embodiments, the gelatin or fish oil is added at an amount of 0.1-10%, typically 0.5-5% w/w.
(72) The microalgae or the composition comprising same can be further used as food additive. According to certain embodiments, the algae-based edible composition is an animal food composition.
(73) According to yet other embodiments, the algae-based edible composition serves as a food source for insect either alone or in combination with the natural food of the insect. According to certain exemplary embodiments, the edible composition serves as a food source for insects of the order selected from, but not limited to, the group consisting of Lepidoptera, Coleoptera and Orthoptera. According to other exemplified embodiments, the algae-based edible composition is a food source for desert locust (Schistocerca gregaria). According to yet other embodiments, the algae-based edible composition is a food source for migratory locust (Locusta migratoria). According to yet other embodiments, the algae-based edible composition is a food source for Spodoptera littoralis According to yet other embodiments, the algae-based edible composition is a food source for nematode. According to yet other embodiments, the algae-based edible formulation is a food source for the host of sea lice. According to yet other embodiments, the algae-based edible composition is for feeding fish. According to yet other embodiments, the algae-based edible formulation is a food source for crustaceans. According to certain exemplary embodiments, the fish and/or crustaceans are infected with a virus. According to these embodiments, the RNAi molecule within the transgenic molecule is targeted to silence a viral gene. According to yet other embodiments, the algae-based edible composition is for feeding poultry. According to certain embodiments, the edible composition may further comprise additional active therapeutic and/or nutritional agents.
(74) The algae-based edible composition of the invention may also be admixed, encapsulated, or associated with other molecules, or mixtures of compounds, or attractants as for example liposomes, pheromones for assisting in uptake, distribution and/or a absorption.
(75) Composition and formulation for oral administration include powders, granules, microparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets, or minitablets.
(76) Composition and formulation suitable for applying the algae-based edible composition on plants and/or animals include powders, granules, microparticulates, suspensions or solutions in water or non-aqueous media such as gelatin or oil.
(77) Various microalgae species can be used according to the teachings of the present invention as long as the microalgae maintain or regenerate their cell wall structure after transformation. According to certain embodiments, the microalga used according to the teachings of the present invention is a marine microalga. According to certain embodiments, the microalga is selected from the group consisting of, but not restricted to, Phaeodactylum tricornutum; Dunaliella spp.; Nannochloropsis spp. including Nannochloropsis oculata, Nannochloropsis sauna, Nannochloropsis gaditana; Nannochloris spp., Tetraselmis spp. Including Tetraselmis suecica, Tetraselmis chuii; Isochrysis galbana; Pavlova spp.; Amphiprora hyaline; Chaetoceros muelleri; and Neochloris oleoabundans. Each possibility represents a separate embodiment of the present invention.
(78) According to certain specific embodiments, the microalga is selected from the group consisting of Phaeodactylum tricornutum, Nannochloris spp., Nannochloropsis spp. and Dunaliella spp. Each possibility represents a separate embodiment of the present invention.
(79) According to other specific embodiments, the microalga is Phaeodactylum tricornutum.
(80) According to certain embodiments, the target gene expression is being inhibited by at least 10%, 30%, 50%, 70%, 90%, typically 99% when compared to same target gene once an organism is not consuming said transgenic microalga.
(81) According to an additional aspect, the present invention provides a method for oral delivery of RNAi molecule to an organism, the method comprising orally administering to the organism a non-propagating transgenic microalga comprising at least one heterologous RNAi molecule, wherein the RNAi molecule is targeted to a polynucleotide present within said organism thereby inhibiting its expression.
(82) According to some embodiments, the non-propagating transgenic eukaryotic microalgae are administered within an animal food composition. The composition is formulated by any means as described hereinabove. The composition is formulated for feeding any of the organisms as described hereinabove.
(83) According to yet additional embodiments, the non-propagating transgenic eukaryotic microalgae are administered with the natural food of the organism. According to these embodiments, the microalgae coat, at least partially, the natural food of the organism. The microalgae can be formulated to coat the organism natural food as is known in the art and as described hereinabove.
(84) Any method for transforming microalgae as is known in the art can be used according to the teachings of the present invention. Transformation methods include particle bombardment, electroporation, microporation, vortexing cells in the presence of heterologous DNA, acid washed beads and polyethylene glycol-mediated transformation. Methods and tools for transformation of eukaryotic algae can be found, for example, in International (PCT) Application Publication No. WO 1997/039106.
(85) Typically, to prepare vectors for making the transgenic algae, the polynucleotide transcribing the RNAi is first cloned into an expression vector, a plasmid that can integrate into the algal genome. In such an expression vector, the DNA sequence which encodes the heterologous RNAi is operatively linked to an expression control sequence, i.e., a promoter, which directs RNA synthesis. The promoter can be an endogenous promoter, i.e., a promoter that directs transcription of genes that are normally present in the algae. According to certain embodiments, the vector further comprises a polynucleotide encoding a resistance gene to enable selection of transformed algae. According to certain currently exemplary embodiments, the vector comprises a polynucleotide encoding a protein conferring resistance to zeocine and phleomycin.
(86) Culturing conditions of the transformed algae depend on the alga species used, as is known to the skilled Artisan and as exemplified herein below. Typically, the algae are grown under conditions that enable photosynthesis. Since photosynthesis requires sunlight and CO.sub.2 and the microalgae further require either fresh, brackish or marine water mixed with the appropriate fertilizers to grow, microalgae can be cultivated in, for example, open ponds and lakes. However, the open systems are more vulnerable to contamination than a closed system, and furthermore, genetically modified microalgae grown in open aqueous reservoirs may be taken as hazardous to the environments. In addition, in open systems there is less control over water temperature, CO.sub.2 concentration, and lighting conditions. The growing season is largely dependent on location and, aside from tropical areas, is limited to the warmer months of the year. An open system, however, is cheaper to set up and/or maintain than a closed system.
(87) Another approach to growing the microalgae is thus to use a semi-closed system, such as covering the pond or pool with a structure, for example, a greenhouse-type structure. While this can result in a smaller system, it addresses many of the problems associated with an open system. The advantages of a semi-closed system are that it can allow for the desired microalgae to be dominant over an invading organism by allowing the microalgae of interest to out-compete the invading organism for nutrients required for its growth, and it can extend the growing season. For example, if the system is heated or cooled, the microalgae can grow year round.
(88) Alternatively, the microalgae can be grown in closed structures such as photobioreactors, where the environment is under stricter control than in open systems or semiclosed systems. A photobioreactor is a bioreactor which incorporates some type of light source to provide photonic energy input into the reactor. The term photobioreactor can refer to a system closed to the environment and having no direct exchange of gases and contaminants with the environment. A photobioreactor can be described as an enclosed, illuminated culture vessel designed for controlled biomass production of phototrophic liquid cell suspension cultures. Examples of photobioreactors include, for example, glass containers, plastic/glass tubes, tanks, plastic sleeves, and bags. Examples of light sources that can be used to provide the energy required to sustain photosynthesis include, for example, fluorescent bulbs, LEDs, and natural sunlight. Because these systems are closed everything that the organism needs to grow (for example, carbon dioxide, nutrients, water, and light) must be introduced into the bioreactor. Photobioreactors, despite the costs to set up and maintain them, have several advantages over open systems, they can, for example, prevent or minimize contamination, offer better control over the culture conditions (for example, pH, light, carbon dioxide, and temperature), prevent water evaporation, lower carbon dioxide losses due to degassing, and permit higher cell concentrations. On the other hand, certain requirements of photobioreactors, such as cooling, mixing, control of oxygen accumulation and bio-fouling, make these systems more expensive to build and operate than open systems or semi-closed systems. Photobioreactors can be set up to be continually harvested (as is with the majority of the larger volume cultivation systems), or harvested one batch at a time (for example, as with polyethlyene bag cultivation). A batch photobioreactor is set up with, for example, nutrients, microalgae, and water, and the microalgae is allowed to grow until the batch is harvested. A continuous photobioreactor can be harvested, for example, either continually, daily, or at fixed time intervals.
(89) CO.sub.2 can be delivered to any of the systems described herein, for example, by bubbling in CO.sub.2 from under the surface of the liquid containing the microalgae. Also, sparges can be used to inject CO.sub.2 into the liquid. Spargers are, for example, porous disc or tube assemblies that are also referred to as Bubblers, Carbonators, Aerators, Porous Stones and Diffusers.
(90) Nutrients that can be used in the systems described herein include, for example, nitrogen (in the form of NO.sub.3.sup.? or NH.sub.4), phosphorus, and trace metals (Fe, Mg, K, Ca, Co, Cu, Mn, Mo, Zn, V, and B). The nutrients can come, for example, in a solid form or in a liquid form. If the nutrients are in a solid form they can be mixed with, for example, fresh or salt water prior to being delivered to the liquid containing the microalgae, or prior to being delivered to a photobioreactor.
(91) The microalgae can be grown in large scale cultures, where large scale cultures refers to growth of cultures in volumes of greater than about 5 liters, or greater than about 10 liters, or greater than about 90 liters. Large scale growth can also be growth of cultures in volumes of 300 liters or more, 1000 liters or more, or 5000 liters and up.
(92) Optimal growth temperature is typically about 18? C. to about 25? C., however it is species dependent. According to certain embodiments microalgae cell reach a density of 10.sup.5 to 10.sup.8/ml before harvesting.
(93) Post-harvest processing of some sort may be used to prepare the material for oral consumption or as a food composition. Conventional processes typically include at least partial separation of the algal biomass from the liquid culture in which the algae were grown. Optionally, the algal biomass can be homogenized and/or dried to form pellets of various sizes, depending on the target subject and mode of application. Other modes of preparation include spray drying, fluid bed drying, or even providing the material as a liquid suspension.
(94) The following examples are presented in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.
EXAMPLES
(95) Materials and Methods
(96) Algae Culturing and Harvesting
(97) Algae culturing and harvesting was done as described in U.S. Patent Application Publication No. 2011/0081706 to the Applicant of the present invention. Briefly, algae (Phaeodactylum tricornutum) were cultured in filtered sea water enriched with F/2 nutrient for growing diatoms (modified from Andersen R et al. 2005. Recipes for freshwater and seawater media. In: Algal Culturing Techniques (R. A. Andersen, Eds), pp. 429-538. Elsevier, Amsterdam). F/2 was added every 72 h at a dosage of 1:1000 to the final culture volume. A constant temperature regime was maintained at 21? C. Light: dark was set at 16:8 hours at a light intensity of 100 ?mol photons per m.sup.2s.sup.1. CO.sub.2 was mixed with air and delivered to the cultures at controlled ratio via the aeration systems. Algae were harvested for experiment near their maximal culture densities. To help flocculation of the algae calcium hydroxide was added to the culture as a fine suspension of particles in water containing 0.15 g/ml Ca(OH).sub.2, and the culture was then filtered or centrifuged. The resulting algae sediment was lyophilized to form algae powder. The algae powder was kept in vacuum bag at a temperature of 2-8? C.
(98) Algae Transformation
(99) I. Transformation by Particle Bombardment
(100) Fresh algal culture were grown to mid exponential phase (2-5?10.sup.6 cells/ml) in artificial sea water (ASW) F/2 media as described above. 24 hours prior to bombardment cells were harvested, washed twice with fresh ASW+F/2 and resuspended in 1/10 of the original cell volume in ASW+F/2. 0.5 ml of the cell suspension was spotted onto the center of a 55 mm Petri dish containing solidified ASW+F/2 media. Plates were left to dry under normal growth conditions. Bombardment was carried out using a PDS 1000/He biolistic transformation system according to the manufacturer's instructions (BioRad Laboratories Inc., Hercules, Calif. USA) using M17 tungsten powder (BioRad Laboratories Inc.) for cells larger than 2 microns in diameter, and tungsten powder comprised of particles smaller than 0.6 microns (FW06, Canada Fujian Jinxin Powder Metallurgy Co., Markham, ON, Canada) for smaller cells. The tungsten was coated with linear DNA. 1100 or 1350 psi rupture discs were used. All disposables were purchased from BioRad Laboratories Inc. After bombardment the plates were incubated under normal growth conditions for 24 hours after which the cells were plated onto selective solid media and incubated under normal growth conditions until single colonies appeared.
(101) II. Transformation by Microporation
(102) A fresh algal culture was grown to mid exponential phase in ASW+F/2 media as described above. A 10 ml sample of the culture was harvested, washed twice with Dulbecco's phosphate buffered saline (DPBS, Gibco, Invitrogen, Carslbad, Calif., USA) and resuspended in 250 ?l of buffer R (supplied by Digital Bio, NanoEnTek Inc., Seoul, Korea, the producer of the microporation apparatus and kit). After adding 8 ?g linear DNA to every 100 ?l cells, the cells were pulsed. A variety of pulses is typically needed, depending on the type of cells, ranging from 700 to 1700 volts, 10-40 msec pulse length; each sample was pulsed 1-5 times. Immediately after pulsing, the cells were transferred to 200 ?l fresh culture media (non-selective). After incubating for 24 hours in low light at 25? C., the cells were plated onto selective solid media and incubated under normal culture conditions until single colonies appeared.
(103) Hemolymph Collection
(104) Animals (of the species described herein below) were washed in water and hemolymph of a pool of 8-10 animals was collected into an eppendorf tube. Samples were centrifuged at 14000 g, 4? C. for 5 minutes and transferred into a new Eppendorf tube containing Trizol (Ambion life technologies; Cat #15596026). Samples were put into liquid nitrogen and kept frozen until use.
(105) RNA Purification
(106) RNA extraction from algae was performed using Master Pure Plant RNA kit (Epicentre; cat #MPRO9100), according to the manufacturer's instructions. The samples were resuspended in RNAse-free water and incubated with TURBO DNA free kit (Ambion cat #AM1907), according to the manufacturer's instructions.
(107) RNA extraction from insects hemolymph was performed using either Trizol (Ambion life technologies; Cat #15596026) or by miRNeasy Serum/Plasma Kit (QIAGEN Cat #217184) according to the manufacturer's instructions.
(108) RNA extraction from insects' organs was performed using Trizol (Ambion life technologies; Cat #15596026). The RNA was incubated with TURBO DNA free kit (Ambion cat #AM1907), according to the manufacturer's instructions.
(109) cDNA Synthesis
(110) 1 ?g of total RNA was used as a template for cDNA synthesis using SuperScriptII Reverse Transcriptase (Invitrogen; cat #100004925) supplemented with Random Hexamer primers (Fermentas; cat #S0142) or using iScript? cDNA Synthesis Kit (Bio-Rad; cat #170-8890) according to the manufacturer's instructions.
(111) qRT-PCR Analysis
(112) Analysis of cDNA was performed by qRT-PCR relative quantification using Biorad CFX96 with Platinum SYBR green (Invitrogen; cat #11744500) according to the manufacturer's instructions. dsRNA targeted to Green Fluorescent Protein (GFP) encoding mRNA was amplified using ds-GFP Q2 For junc and ds-GFP Q2 Rev linker primers (Table 1). TBP (encoding TATA box binding protein) was used as a reference gene and was amplified with Q-TBP-fw and Q-TBP-ry (Table 1). dsRNA targeted to the red fluorescent protein mCherry was amplified using ds-mCherry Q1 For 5 and ds-mCherry Q1 Rev junc (Table 1). Internal control (Primerdesign, UK; Cat #INT-RNA-FAM) was used as reference. Data analysis was performed according to the ??Ct method (Livak et al., 2001. Methods 25:402-408).
(113) Analysis of the expression levels of the clock (clk) gene was performed using Sg_clk_F and Sg_clk_R primers, designated to amplify Schistocerca gregaria clock mRNA sequence. The primers dsCLOCK Q4 fw and dsCLOCK rev were designed to specifically amplify the clock dsRNA sequence that was transformed and expressed in the algae (Table 4). Quantification of timeless and period genes was performed using the Sg_tim_F and Sg_tim_R and Sgper_F and Sgper_R, respectively (Table 4). Beta actin or GAPDH were used as reference genes and were amplified with Sg_b_actin_F and Sg_b_actin_R and Sg_GAPDH_F and Sg_GAPDH_R, respectively (Table 4). Data Analysis was performed according to the ??Ct method and by separation of the qRT-PCR products on agarose gel.
(114) TABLE-US-00004 TABLE4 Listofprimers SEQID Primername Primersequence NO. Q-TBP-fw ACCGGAGTCAAGAGCACACAC 7 Q-TBP-rv CGGAATGCGCGTATACCAGT 8 ds-GFPQ2 GCAGCTCGCCGGTACCTA 9 Forjunc ds-GFPQ2 TTGTTTCCGACGGCACACT 10 Revlinker ds-mCherryQ1 CCGTCATGCAGAAAAAGACCAT 11 For5 ds-mCherryQ1 CTGCGTAGGTACCCTGCTTGA 12 Revjunc dsCLOCKQ4fw GGACATTCTCCCTCACAAAACAA 13 dsCLOCKQ4rev CAAATGCGATACCAACCTCAAC 14 Sg_GAPDH_F GTCTGATGACAACAGTGCAT 15 Sg_GAPDH_R GTCCATCACGCCACAACTTTC 16 Sg_b_actin_F AATTACCATTGGTAACGAGCGATT 17 Sg_b_actin_R TGCTTCCATACCCAGGAATGA 18 Sg_tim_F TTGGAATTGGAGTTGGAACATGT 19 Sg_tim_R AGTCTACCAATGGATGGTTTGACA 20 Sg_per_F ACCAGATCGGAGCCAGCTT 21 Sg_per_R CTTCTGGATGTTGTCGTTGTAGTT 22 Sg_clk_F CCATGAAGCTTTGATGCAGAAG 23 Sg_clk_R CTGGCTTTGAGTTCCATTGATG 24
Example 1: Expression of clk, GFP and mCherry dsRNA in Algae
(115) Construction of dsRNA Targeted to clk mRNA of Schistocerca gregaria
(116) The sense (SEQ ID NO:2) and antisense (SEQ ID NO:3) fragments of the clk gene were synthesized by Biomatik USA. The sense fragment was cloned by BamHI, SacII and the antisense fragment was cloned by SacI, KpnI. The clk fragments were cloned in the sense and antisense orientations into an intron contained pPhaT-cassette (
(117) Construction of dsRNA Targeted to GFP and mCherry mRNA:
(118) GFP sense strand (SEQ ID NO:4) was amplified by PCR with the following oligonucleotides: BamHI Sense GFP F 5-GGGATCCATGGTGAGCAAGGGC GAGG-3 (SEQ ID NO:25). SacII Sense GFP R 5-GCCGCGGGGCGAGCTGCACGCTGCC-3 (SEQ ID NO:26). GFP antisense strand (SEQ ID NO:5) was amplified by PCR with the following oligonucleotides: SacI Antisense GFP F 5-GGAGCTCATGGTGA GCAAGGGCGAGG-3 (SEQ ID NO:27). KpnI Antisense GFP R 5-GGGTACCG GCGAGCTGCACGCTGCC-3 (SEQ ID NO: 28).
(119) mCherry sense strand (SEQ ID NO:29) was amplified by PCR with the following oligonucleotides: BamHI Sense mCherry F 5-GGGATCCATGGTAAGTAAGGGGGAGG-3 (SEQ ID NO:30) and SacII Sense mCherry R: 5-GCCGCGGCTGCTTGATTTCGCCCTTG-3 (SEQ ID NO:31). For the amplification of the mCherry antisense strand (SEQ ID NO:32) the following primers were used: SacI Antisense mCherry F: 5-GGAGCTCATGGTAAGTAAGGGGGAGG-3 (SEQ ID NO:33). KpnI Antisense mCherry R 5-GGGTACCCTGCTTGATTTCGCCCTTG-3 (SEQ ID NO:34).
(120) Constructs of clk, and mCherry dsRNA were prepared in pPhaT under the fcpA constitutive promoter and a construct of GFP was prepared in pPhaT under the inducible promoter ptCAI (
Example 2: Delivery by Feeding of an Intact dsRNA to the Mealworm Beetle Hemolymph
(121) Larvae of mealworm beetle, Tenebrio molitor, were placed in cultivation chambers, with 12 h/12 h light/dark illumination regime at constant temperature of 24? C. and relative humidity of 50%. Leaves of cabbage were brushed with powder of transgenic algae expressing the dsRNA targeted to mCherry (dsRNA-mCherry or dsmCherry) or with powder of wild type algae such that all the leaves were homogenously covered with the alga powder. To enable good application of the algae powder onto the plant material algae powder (of wild type as well as of transformed algae) was mixed with 5% gelatin in artificial sea water (ASW) diluted 1:3 with double-distilled water (DDW). The Tenebrio molitor larvae were deprived of food for 16 hours. At the day of the experiment the larvae were fed with the algae-brushed cabbage leaves or with leaves covered only with gelatin (mock) for 3 to 5 hours. Thereafter hemolymph was collected and samples were flash-frozen and stored at ?80? C. until RNA extraction.
(122) RNA extracted from the hemolymph samples was subjected to relative quantification by qRT-PCR analysis with primers specific to dsmCherry. Synthetic RNA (Primer Design) was used as a reference. Analysis was performed using the ??Ct method. Over 20 fold increase in dsmCherry RNA levels was demonstrated in 3 out of the 5 samples obtained from animals fed with dsmCherry expressing algae, compared to animals fed with WT algae. Each sample contained a pool of hemolymph from 5 animals (
(123) The results presented herein demonstrate for the first time the ability to deliver dsRNA molecules to the hemolymph of mealworm beetle by feeding larvae with algae expressing the dsRNA.
Example 3: Delivery by Feeding of an Intact dsRNA to Spodoptera littoralis Hemolymph
(124) Larvae of Spodoptera littoralis (Prodenia littoralis) at the 5.sup.th instar stage were placed in cultivation chambers, with 12 h/12 h light/dark illumination regime at constant temperature of 24? C. and relative humidity of 50%. Leaves of Ricinus communis (castorbean) were brushed with powder of transgenic algae expressing the dsRNA targeted to GFP (dsRNA-GFP) or of wild type algae such that all the leaves were homogenously covered with the algae powder (mixed with gelatin as described above). The Spodoptera littoralis were fed with the alga powder brushed leaves. For each treatment 5 independent repeats of 10 larvae each were used. Hemolymphs were collected from the fifth instar nymphs and were subjected to RNA preparation followed by qRT-PCR analysis using the specific primers of dsRNA-GFP (SEQ ID NOs. 9-10) and of TATA box binding protein (TBP) mRNA (SEQ ID NOs 7-8) as loading control (Table 4). The RT-PCR products were loaded on agarose gel. Full size amplicon products of 175 bp for the TBP segment were detected in all 8 hemolymphs samples (obtained from larvae fed with leaves covered with powder of wild type as well as of transgenic algae). Full size amplicon products of dsRNA-GFP of 83 bp were detected only in the 4 hemolymph samples of animals fed with dsRNA-GFP expressing algae and not in hemolymph of animals fed with WT algae (
Example 4: Reduced Expression of clk and Period mRNA Levels in Locusts by Feeding Nymphs with Algae Expressing dsRNA-Clock
(125) Schistocerca gregaria timeless and period genes are two genes that their expression is directly regulated by clock protein. The expression level of these genes is often used to demonstrate downregulation of clock expression and activity (Tobback J et al., 2011, ibid).
(126) Newly emerged S. gregaria fifth nymphs were placed at a density of 40 animals in 30?30?35 cm controlled chambers with 14 h/10 h light/dark illumination regime at constant temperature of 37? C. For each treatment 3 independent repeats of 40 locusts each were used. Wheat sprouts grown in pots were brushed with a powder of transgenic algae expressing either dsRNA targeted to clk (dsRNA-clock) or with a powder of wild type (WT) algae (algae powder mixed with gelatin as described above) till all the leaves were homogenously covered with the alga powder. The locusts were then fed with the algae-brushed wheat sprouts during 4 weeks. The wheat sprouts were brushed daily with the algae powder to ensure continuous treatment.
(127) On days 8-11 and 28-30 of the experiment gonads and brains were harvested from young adults after the first molting, and from adult locusts, respectively, from each treatment. The organs were harvested 3 hrs after feeding. RNA was extracted and then subjected to reverse transcription followed by qRT-PCR analysis. The expressions of the locust's housekeeping genes GAPDH, (3-actin and of the clock and period genes were detected with specific primers. Relative quantifications of clock and period transcripts in locusts' gonads and brains were performed using the ?Ct method. The relative expression levels of the clock gene in locusts fed with leaves brushed with algae expressing dsRNA-clock was found to be down-regulated by 36% compared to locusts fed with leaves brushed with WT algae. The relative expression levels of the period gene in locusts fed with leaves brushed with algae expressing dsRNA-clock were found to be down-regulated by 27% compared to the locusts fed with leaves brushed with WT algae. GAPDH was used as a housekeeping gene (
Example 5: Feeding Locust with Algae Expressing dsRNA Targeted to the Clock Gene Reduced the Locust Egg Fertility
(128) Instar larvae (stages 4-5) of the locust Schistocerca gregaria were continuously fed with wheat sprouts brushed either with powder of algae expressing dsRNA-clock or with WT algae as described above. On day 17, when the animals were sexually mature, pots filled with sand were placed in each cage to allow the females to lay eggs. The pots were collected every 48 hrs and incubated at 37? C. for 10 days to allow the larvae to hatch. The egg pods and the hatched larvae were counted and the ratio of hatched larvae to the number of the egg pods was calculated for each treatment. Locusts females fed with transgenic algae expressing the dsRNA-clock laid 31 egg pods among of which 128 were hatched, while locusts' female fed with WT algae laid 28 egg pods among of which 262 were hatched. The ratio of hatched larva to the number of egg pods (average of all repeats) was 2.3 fold lower in locusts fed with the dsRNA-clock expressing algae compared to locusts fed with WT algae (
(129) In an additional experiment, Schistocerca gregaria third nymphs were placed at a density of 100 animals in 45?45?50 cm controlled chambers with a 14 h/10 h light/dark illumination regime at temperature range of 30-37? C. For each treatment 4 independent repeats of 100 locusts each were used. Wheat sprouts grown in pots were brushed with powder of transgenic algae expressing either dsRNA targeted to clk (dsRNA-clock) or dsGFP till all the leaves were homogenously covered with the alga powder. The locusts were then fed with the algae-brushed wheat sprouts during 4 weeks with daily new algae-brushed wheat sprouts to ensure continuous treatment. The animals were then counted and 10 male locusts and 10 female locusts (n=20) were placed in 45?45?50 cm controlled chambers with a 14 h/10 h light/dark illumination regime at temperature gradient of 30-37? C. in 4 independent repeats for each treatment. The animals were allowed to mate and lay eggs in plastic cylinders filled with sand for 36 days. Every 3 days the cylinders were replaced with fresh ones. The used cylinders were collected and placed in a controlled chamber with a 14 h/10 h light/dark illumination regime at temperature gradient of 30-42? C. Following 10-15 days of incubation hatched larvae were observed and counted. The number of larvae hatched from eggs of locusts fed with leaves brushed with algae expressing dsRNA-clock was lower compared to the number of larvae hatched from eggs of locusts fed with leaves brushed with dsGFP expressing algae throughout the experiment (
(130) These results are in support with previous findings suggesting that the circadian clocks govern many metabolic and behavioral processes in an organism. In insects, these clocks and their molecular machinery have been found to influence reproduction in many different ways. Reproductive behavior including courtship, copulation and egg deposition, was found to be under strong influence of the daily rhythm (Tobback et. al 2011, ibid).
Example 6: Oral Delivery of Algae Expressing dsRNA Targeted Specifically Toward the clk Gene Reduced Locust Motility
(131) The locust Schistocerca gregaria were continuously fed with wheat sprouts brushed either with powder of algae expressing dsRNA-clock or with powder of WT algae (algae powder mixed with gelatin as described above). One cage from each treatment was continuously monitored with LifeCam HD-3000 camera and recorded with ActiveWebCam program. Measurements of the locusts' motility, during 3 days of feeding, demonstrated that the total motility of the locusts that were fed with the dsRNA-clock expressing algae was reduced by about 1.7-2.5 fold compared to the locusts that were fed with the WT algae (
Example 7: Delivery of an Intact dsRNA to Crustaceans by Feeding with Transgenic Algae
(132) Cherax quadricarinatus animals (30?10 g) were placed in cages dedicated to each treatment. The animals were fed daily for 28 days with feed pellet containing either dsRNA-GFP-expressing algae or with WT algae (7.5 gr algae/gr animal). On days 0 and 28, 72 hrs post feeding, 100 ?l of hemolymph was sampled from each animal. For dsRNA-GFP-expressing algae 6 independent repeats were used and for WT algae 3 independents repeats were used. Hemolymphs collected were subjected to RNA preparation and the samples were analyzed by RNA dot blot hybridizations. The dot blot hybridization procedure was performed according to the manufacturer instructions (Roche Applied Science, cat #11 603 558 001, cat #11 585 762 001, cat #11 093 274 910, cat #11 685 627 001). Single-stranded RNA probes of dsRNA-GFP labeled with Digoxigenin-11-dUTP were synthesized from linearized template DNA according to the manufacturer's instructions (Roche Applied Science, Cat. No. 11175025910).
(133) As is demonstrated in
Example 8: Oral Delivery of Algae Expressing dsRNA Targeted Specifically Toward the Clk Gene Affects Male/Female Distribution in Schistocerca gregaria
(134) Schistocerca gregaria third nymphs were placed at a density of 100 animals in 45?45?50 cm controlled chambers with a 14 h/10 h light/dark illumination regime at temperature gradient of 30-37? C. For each treatment 4 independent repeats of 100 locusts each were used. Wheat sprouts grown in pots were brushed with powder of transgenic algae expressing either dsRNA targeted to clk (dsRNA-clock) or dsRNA targeted to GFP (dsGFP) till all the leaves were homogenously covered with the alga powder (algae powder mixed with gelatin as described above). The locusts were then fed with the algae-brushed wheat sprouts during 4 weeks with daily new algae-brushed wheat sprouts to ensure continuous treatment. Then the animals were counted and the ratio of males to females was calculated for each treatment. The ratio in locusts fed with leaves brushed with dsRNA-clock-expressing algae was significantly lower (p-value=0.01) compared to the locusts that were fed with leaves brushed with dsGFP expressing algae (48% reduction,
(135) Taken together, the present invention clearly demonstrates that feeding locust with transgenic algae expressing dsRNA targeted to a specific gene of the locust down regulate the expression and/or activity of the targeted gene.
Example 9: Freeze-Dried Algal Powder is not Viable
(136) Algae liquid culture was harvested using the GEA Westfalia Separator (model SSD18-06-007, spin at 9790 rpm) or the Alfa Laval Separator model IFB 303X-73, at 7500 rpm. Algae paste was placed in either 1 cm?14 cm?14 cm trays or in 2 cm?25 cm?52 cm plates and stored at ?80? C. for 24 hours. The next day the trays were freeze-dried using VirTis lyophilizer (item number 270389) at ?50? C. and 2*10.sup.?1 Torr for 24-48 hours. Algal powder was used for a viability assay.
(137) 1 gram of freeze-dried Phaeodactylum tricornutum algae powder (3.42*10.sup.10 cells) was mixed with 9 ml of ASW?1. 400 ul of the mixture were plated on either ASW agar plates or in suspension of ASW?1 and maintained for 10 days (
Example 10: Construction of COPB2 dsRNA in Algae
(138) The sense (SEQ ID NO:35) and antisense (SEQ ID NO:36) fragments of the Lepeophtheirus salmonis COPB2 gene are synthesized by Biomatik USA. The sense fragment is cloned by BamHI, SacII and the antisense fragment is cloned by EcoRI, KpnI. The fragments of COPB2 are cloned in the sense and antisense orientations into an intron contained pPhaT-cassette.
Example 11: Oral Delivery of Algae Expressing dsRNA Targeted Specifically Toward the COPB2 Gene Increases Mortality of Lepeophtheirus salmonis
(139) Atlantic salmon (Salmo salary, with average body weight of 80 grams, are placed in plastic water tanks of 0.75 m.sup.3 and maintained in seawater (salinity 34.5 ppt) at a temperature of 10? C.). The fish are fed twice a day at 1% of their body weight with either commercial fish food homogenously coated with 15% of COPB2 dsRNA-expressing algal powder (w/w relative to total weight of fish food) or with commercial fish food that is homogenously coated with 15% (w/w) of algal powder expressing GFP dsRNA. For each treatment 3 independent repeats of 25 fish are used.
(140) After 14 days of feeding the fish are challenged with 120 parasitic copepodids of the fish louse (Lepeophtheirus salmonis) for each water tank. 10 and 24 days after the additions of copepodids 5 fish of each group are anesthetized, sacrificed and the lice are counted under the microscope.
(141) The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. The means, materials, and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention.