NOVEL CORONAVIRUS NUCLEIC ACID RAPID HYBRID CAPTURE IMMUNOFLUORESCENCE DETECTION KIT, AND PREPARATION METHOD AND DETECTION METHOD THEREOF

20230221304 · 2023-07-13

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to the technical field of nucleic acid detection and discloses a novel coronavirus nucleic acid rapid hybrid capture immunofluorescence detection kit, and a preparation method and a detection method thereof. The kit includes a COVID-19 reaction solution, wherein the COVID-19 reaction solution is prepared from a COVID-19 fluorescence marker and a COVID-19 probe solution; and the COVID-19 probe solution includes: an ORFlab section probe, an N section probe and an E section probe. Compared with general fluorescence PCR and sequencing detection, the kit has the advantages of stronger signal intensity, better specificity, shorter detection time, no need of professional technicians for operation, no need of refrigeration in transportation and storage, no need of a matched laboratory and a matched PCR instrument, and convenience and rapidness in use.

    Claims

    1. A corona virus disease 2019 nucleic acid rapid hybrid capture immunofluorescence detection kit, comprising a COVID-19 reaction solution, wherein the COVID-19 reaction solution is prepared from a COVID-19 fluorescence marker and a COVID-19 probe solution; the COVID-19 probe solution comprises: an ORF1ab section probe, an N section probe and an E section probe; and the ORF1ab section probe is used for detecting an open reading coding frame lab of the COVID-19, the N section probe is used for detecting an envelope protein gene of the COVID-19, and the E section probe is used for detecting a core-shell protein gene of the COVID-19.

    2. The corona virus disease 2019 nucleic acid rapid hybrid capture immunofluorescence detection kit according to claim 1, wherein a sequence of the ORF1ab section probe is: TABLE-US-00026 Aacgattgtgcatcagctgactgaagcatgggttcgcggagttgatcaca actacagccataacctttccacataccgcagac; a sequence of the N section probe is: TABLE-US-00027   Agagcagcatcaccgccattgccagccattctagcaggagaagttc; and a sequence of the E section probe is: TABLE-US-00028   aaggatggctagtgtaactagcaagaataccacgaaagcaagaaaaa.

    3. The corona virus disease 2019 nucleic acid rapid hybrid capture immunofluorescence detection kit according to claim 1, wherein the COVID-19 fluorescence marker is prepared by coupling a fluorescent material and a COVID-19 marking raw material; the COVID-19 marking raw material adopts a COVID-19 antigen or antibody; and the fluorescent material adopts any one of the followings: a FITC fluorescein, a fluorescent microsphere, a fluorescent particle and a biological fluorescein.

    4. The corona virus disease 2019 nucleic acid rapid hybrid capture immunofluorescence detection kit according to claim 1, further comprising a COVID-19 negative reference substance, wherein the negative reference substance comprises one or more of the following reference substances: a normal saline reference substance, a purified water reference substance, a non-COVID-19 pathogen reference substance and a pseudovirus not containing a COVID-19 target sequence.

    5. The corona virus disease 2019 nucleic acid rapid hybrid capture immunofluorescence detection kit according to claim 4, wherein the negative reference substance comprises N1-N17: N1-N2 are normal saline reference substances, N3-N4 are purified water reference substances, N5-N13 are human throat swab samples and N14-N17 are pseudoviruses not containing COVID-19 target sequences; in the human throat swab samples, COVID-19 is negative and the non-COVID-19 pathogen reference substance is positive; and the pseudoviruses not containing the COVID-19 target sequences are subtypes of coronaviruses, N14 being positive for a human coronavirus 229E N section, N15 being positive for a human coronavirus NL63 N section, N16 being positive for a human coronavirus OC43 N section, and N17 being positive for a human coronavirus HKU1 N section.

    6. The corona virus disease 2019 nucleic acid rapid hybrid capture immunofluorescence detection kit according to claim 1, further comprising a COVID-19 positive reference substance, wherein the positive reference substance is a pseudovirus containing a COVID-19 target sequence; the positive control reference substance comprises P1, P2 and P3, P1 being positive for a COVID-19 N section, P2 being positive for a COVID-19 E section, and P3 being positive for a COVID-19 ORF 1ab section; and a concentration of the positive reference substance is 3000 TU/mL±5%.

    7. The corona virus disease 2019 nucleic acid rapid hybrid capture immunofluorescence detection kit according to claim 1, further comprising a precision reference substance and a limit of detection reference substance, wherein the precision reference substance comprises J1, J2 and J3, J1-J2 being pseudoviruses containing COVID-19 target sequences and being positive for a COVID-19 ORF lab section, concentrations of J1-J2 being 2000 TU/mL±5% and 5000 TU/mL±5% respectively, J3 being a mixed human negative throat swab sample and being negative for COVID-19; and the limit of detection reference substance comprises L1, L2 and L3, L1 being positive for a COVID-19 N section, L2 being positive for a COVID-19 E section, L3 being positive for a COVID-19 ORF lab section, and a concentration of the limit of detection reference substance being 1000 TU/mL±5%.

    8. The corona virus disease 2019 nucleic acid rapid hybrid capture immunofluorescence detection kit according to claim 1, further comprising a COVID-19 detection strip, COVID-19 redissolving liquid and COVID-19 sample preserving liquid.

    9. A preparation method of the corona virus disease 2019 nucleic acid rapid hybrid capture immunofluorescence detection kit according to claim 1, comprising a preparation step of the COVID-19 fluorescence marker as follows: activation: adding 1% fluorescent microsphere solution with a ratio of 1.0 mg/mL±5% and an EDC solution with a ratio of 0.6 mg/mL±5% into a prepared borate buffer solution of 0.05M±5%, mixing uniformly, placing the mixture on a rotary mixer to rotate for more than 20 minutes, perform centrifugation at 15000-16000 rpm for more than 30 minutes after activating, removing a supernatant, performing resuspension by the borate buffer solution of 0.05M±5% and mixing uniformly; coupling: adding a COVID-19 antibody in an amount of 0.2 mg/mL±5% into the activated fluorescent microsphere solution, mixing uniformly, and placing the mixture on the rotary mixer to rotate for more than 2 hours to obtain a fluorescent microsphere marking conjugate solution; closing: adding a 10% BSA solution with a ratio of 0.1 ml/mL±5% into the fluorescent microsphere marking conjugate solution, mixing uniformly, and placing the mixture on the rotary mixer to rotate for 12-16 hours; and centrifugal resuspension: centrifuging the fluorescent microsphere marking conjugate solution at 15000-16000 rpm, removing a supernatant, washing with an isovolumetric borate buffer solution of 0.05M±5%, and finally resuspending a precipitate with a marker diluent in a volume which is equal to that of the supernatant solution to prepare the COVID-19 fluorescence marker.

    10. The preparation method according to claim 9, comprising a preparation step of COVID-19 reaction solution as follows: preparation of a fluorescence marker: diluting the COVID-19 fluorescence marker with a marker diluent according to a ratio, wherein the ratio of the diluent to a T line marker to a C line marker is equal to 17:2:1; preparation of a probe solution: diluting a COVID-19 probe with nucleic acid solving liquid to 10 μM±5% to obtain a COVID-19 probe solution; preparation of reaction solution: mixing the diluted COVID-19 fluorescence marker and the COVID-19 probe solution according to a volume ratio of 1:1 to obtain COVID-19 reaction solution; and subpackaging of the reaction solution: subpackaging the COVID-19 reaction solution into reaction tubes and drying for 6 to 8 hours under the conditions that the temperature is 18-28° C. and the humidity is less than or equal to 30%.

    11. The preparation method according to claim 9, further comprising a preparation step of a COVID-19 positive reference substance: diluting artificially synthesized COVID-19 RNA with a positive reference substance diluent to 2000 TU/mL±5%; and subpackaging the diluted positive reference substances into vertical tubes and drying for 6 to 8 hours under the conditions that the temperature is 18-28° C. and the humidity is less than or equal to 30%.

    12. A detection method of the corona virus disease 2019 nucleic acid rapid hybrid capture immunofluorescence detection kit according to claim 1, comprising the following steps: acquiring a target nucleic acid fragment in a to-be-detected sample through hybrid capture; performing nucleic acid hybridization reaction on the target nucleic acid fragment and the COVID-19 reaction solution to obtain to-be-detected liquid; and adding the to-be-detected liquid into a COVID-19 detection strip for fluorescence signal recognition.

    Description

    BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

    [0042] The accompanying drawings described here are provided for further understanding of the invention, and constitute a part of the invention. The exemplary embodiments and illustrations of the invention are intended to explain the invention, but do not constitute inappropriate limitations to the invention. In the accompanying drawings:

    [0043] FIG. 1 is a flowchart of a preparation process of a corona virus disease 2019 nucleic acid rapid hybrid capture immunofluorescence detection kit.

    [0044] FIG. 2 is S9.6 protein model information used in the specific detection process of a corona virus disease 2019 nucleic acid rapid hybrid capture immunofluorescence detection kit.

    DETAILED DESCRIPTION OF THE INVENTION

    [0045] In order to make the technical problems to be solved, technical solutions and beneficial effects of the invention more apparent, the invention will be described in more detail with reference to the drawings and embodiments. It should be understood that the specific embodiments described herein are merely intended to explain the invention, rather than to limit the invention.

    First Embodiment (Kit)

    [0046] The embodiment provides a novel coronavirus nucleic acid rapid hybrid capture immunofluorescence detection kit. The kit includes COVID-19 reaction solution, COVID-19 redissolving liquid, a COVID-19 negative reference substance and COVID-19 sample preserving liquid which are subpackaged into reaction tubes or vertical tubes respectively, and further includes a COVID-19 detection strip, an aluminum foil bag card, a kit label, a kit instruction and the like.

    [0047] The COVID-19 reaction solution is prepared from a COVID-19 fluorescence marker and a COVID-19 probe solution; and the COVID-19 probe solution includes: an ORFlab section probe, an N section probe and an E section probe; wherein the ORFlab section probe is used for detecting an open reading coding frame lab of the COVID-19, the N section probe is used for detecting an envelope protein gene of the COVID-19, and the E section probe is used for detecting a core-shell protein gene of the COVID-19.

    [0048] A sequence of the ORFlab section probe is:

    TABLE-US-00004 Aacgattgtgcatcagctgactgaagcatgggttcgcggagttgatcaca actacagccataacctttccacataccgcagac;

    [0049] a sequence of the N section probe is:

    TABLE-US-00005   Agagcagcatcaccgccattgccagccattctagcaggagaagttc;

    [0050] and

    [0051] a sequence of the E section probe is:

    TABLE-US-00006   aaggatggctagtgtaactagcaagaataccacgaaagcaagaaaaa.

    [0052] The COVID-19 fluorescence marker is prepared by coupling a fluorescent material and a COVID-19 marking raw material; the COVID-19 marking raw material adopts a COVID-19 antibody; and the fluorescent material adopts any one of the followings: a FITC fluorescein, a fluorescent microsphere, a fluorescent particle, a biological fluorescein and other substances capable of emitting fluorescence, but is not limited to this.

    [0053] The COVID-19 negative reference substance includes one or more of the following reference substances: a normal saline reference substance, a purified water reference substance, a non-COVID-19 pathogen reference substance and a pseudovirus not containing a COVID-19 target sequence. Specifically, the negative reference substance includes N1-N17: N1-N2 are normal saline reference substances, N3-N4 are purified water reference substances, N5-N13 are human throat swab samples and N14-N17 are pseudoviruses not containing COVID-19 target sequences; in the human throat swab samples, COVID-19 is negative and the non-COVID-19 pathogen reference substance is positive; and the pseudoviruses not containing the COVID-19 target sequences are subtypes of coronaviruses, wherein N14 is positive for a human coronavirus 229E N section, N15 is positive for a human coronavirus NL63 N section, N16 is positive for a human coronavirus OC43 N section, and N17 is positive for a human coronavirus HKU1 N section.

    [0054] The COVID-19 positive reference substance is a pseudovirus containing a COVID-19 target sequence; the positive control reference substance includes P1, P2 and P3, wherein P1 is positive for a COVID-19 N section, P2 is positive for a COVID-19 E section, and P3 is positive for a COVID-19 ORF lab section; and a concentration of the positive reference substance is 3000 TU/mL±5%.

    [0055] The precision reference substance includes J1, J2 and J3, wherein J1-J2 are pseudoviruses containing COVID-19 target sequences and are positive for a COVID-19 ORF lab section, concentrations of J1-J2 are 2000 TU/mL±5% and 5000 TU/mL±5% respectively, J3 is a mixed human negative throat swab sample and is negative for COVID-19; and the limit of detection reference substance includes L1, L2 and L3, wherein L1 is positive for a COVID-19 N section, L2 is positive for a COVID-19 E section, L3 is positive for a COVID-19 ORF lab section, and a concentration of the limit of detection reference substance is 1000 TU/mL±5. The detail is shown in Table 1 below.

    TABLE-US-00007 TABLE 1 Composition table of reference products Type of Reference Serial Sample Product Number Information Type Concentration Positive P1 Positive for COVID-19 N Pseudovirus 3000 TU/mL reference section product P2 Positive for COVID-19 E Pseudovirus 3000 TU/mL section P3 Positive for COVID-19 ORF Pseudovirus 3000 TU/mL 1ab section Negative N1 Normal saline / / reference N2 Normal saline / / product N3 Purified water / / N4 Purified water / / N5 Negative for COVID-19 Throat / Positive for influenza A virus swab liquid N6 Negative for COVID-19 Throat / Positive for metapneumovirus swab liquid N7 Negative for COVID-19 Throat / Positive for influenza B virus swab liquid N8 Negative for COVID-19 Throat / Positive for parainfluenza virus swab liquid N9 Negative for COVID-19 Throat / Positive for respiratory swab liquid syncytial virus N10 Negative for COVID-19 Throat / Positive for rhinovirus swab liquid N11 Negative for COVID-19 Throat / Positive for adenovirus swab liquid N12 Negative for COVID-19 Throat / Positive for mycoplasma swab liquid pneumoniae N13 Negative for COVID-19 Throat / Positive for chlamydia swab liquid pneumoniae N14 Negative for COVID-19 Pseudovirus / Positive for human coronavirus 229E N section N15 Negative for COVID-19 Pseudovirus / Positive for human coronavirus NL63 N section N16 Negative for COVID-19 Pseudovirus / Positive for human coronavirus OC43 N section N17 Negative for COVID-19 Pseudovirus / Positive for human coronavirus HKU1 N section Detection L1 Positive for COVID-19 N Pseudovirus 1000 TU/mL limit section reference L2 Positive for COVID-19 E Pseudovirus 1000 TU/mL product section L3 Positive for COVID-19 ORF Pseudovirus 1000 TU/mL 1ab section Precision J1 Positive for COVID-19 ORF Pseudovirus 2000 TU/mL reference 1ab section product J2 Positive for COVID-19 ORF Pseudovirus 5000 TU/mL lab section J3 Negative for COVID-19 Throat / swab liquid

    [0056] The detection strip may adopt a chromatography or percolation method. In this embodiment, the detection strip adopts an immunofluorescence chromatography test strip, which includes a water-absorbing pad arranged on an end area of the detection strip, a sample adding area arranged on the other end area of the detection strip, and a nitrocellulose membrane (NC membrane) arranged between the water-absorbing pad and the sample adding area, wherein the nitrocellulose membrane is arranged on a T line detection area. The treated glass fiber pad, the treated nitrocellulose membrane and the water-absorbing pad are sequentially in lap joint with a PVC bottom plate and are cut into test strips with a set width, that is, the detection strip of the invention.

    Second Embodiment (Preparation Method)

    [0057] As shown in FIG. 1, the embodiment provides a preparation method of any one of the above corona virus disease 2019 nucleic acid rapid hybrid capture immunofluorescence detection kits. The preparation method includes:

    [0058] (1) a preparation step of a COVID-19 fluorescence marker as follows:

    [0059] activation: 1% fluorescent microsphere solution with a ratio of 1.0 mg/mL±5% and an EDC solution with a ratio of 0.6 mg/mL±5% were added into a prepared borate buffer solution of 0.05M±5% for uniformly mixing, the mixture was placed on a rotary mixer to rotate for more than 20 minutes, centrifugation was performed at 15000-16000 rpm for more than 30 minutes after activating, a supernatant was removed, resuspension was performed by the borate buffer solution of 0.05M±5% and uniform mixing was performed;

    [0060] coupling: a COVID-19 antibody in an amount of 0.2 mg/mL±5% was added into the activated fluorescent microsphere solution for uniform mixing, and the mixture was placed on the rotary mixer to rotate for more than 2 hours to obtain a fluorescent microsphere marking conjugate solution;

    [0061] closing: a 10% BSA solution with a ratio of 0.1 ml/mL±5% was added into the fluorescent microsphere marking conjugate solution for uniform mixing, and the mixture was placed on the rotary mixer to rotate for 12-16 hours; and

    [0062] centrifugal resuspension: the fluorescent microsphere marking conjugate solution was centrifuged at 15000-16000 rpm, a supernatant was removed, the material was washed with an isovolumetric borate buffer solution of 0.05M±5%, and finally a precipitate was resuspended with a marker diluent in a volume which is equal to that of the supernatant solution to prepare the COVID-19 fluorescence marker.

    [0063] (2) A preparation step of COVID-19 reaction solution as follows:

    [0064] preparation of a fluorescence marker: the COVID-19 fluorescence marker was diluted with a marker diluent according to a ratio, wherein the ratio of the diluent to a T line marker to a C line marker is equal to 17:2:1;

    [0065] preparation of a probe solution: a COVID-19 probe was diluted with nucleic acid solving liquid to 10 μM±5% to obtain a COVID-19 probe solution;

    [0066] preparation of reaction solution: the diluted COVID-19 fluorescence marker and the COVID-19 probe solution were mixed according to a volume ratio of 1:1 to obtain COVID-19 reaction solution; and

    [0067] subpackaging of the reaction solution: the COVID-19 reaction solution was subpackaged into reaction tubes (4 μL/tube) and dried for 6 to 8 hours under the conditions that the temperature is 18-28° C. and the humidity is less than or equal to 30%.

    [0068] (3) A preparation step of a COVID-19 positive reference substance: artificially synthesized COVID-19 RNA was diluted with a positive reference substance diluent to 2000 TU/mL±5%; and the diluted positive reference substances were subpackaged into vertical tubes (5 μL/tube) and dried for 6 to 8 hours under the conditions that the temperature is 18-28° C. and the humidity is less than or equal to 30%.

    [0069] (4) Coating conditions of the COVID-19 detection strip:

    [0070] the T line coating concentration is 0.5 mg/mL±5% and the C line coating concentration is 1.0 mg/mL±5%;

    [0071] the spray amount is 1.0 μL/cm±5%, the speed of a guide rail is 100 mm/s±5%, and nozzle interval is 6 mm±5%; and

    [0072] drying: temperature is 18-28° C. and humidity is less than or equal to 30%, and drying time: 16 h-20 h.

    [0073] (5) Detection conditions of the detection reagent:

    [0074] the adding amount of the reaction tube redissolving liquid is 85 μL±5%;

    [0075] the sampling amount of the sample is 20 μL±5%;

    [0076] the uniformly mixed sample of 100 μL±5% was absorbed and added into a sample hole of a detection card;

    [0077] the nucleic acid hybridization reaction condition is 37° C. and the reaction time is more than 15 minutes; and

    [0078] the reagent detection reaction time is more than 15 minutes.

    [0079] (6) Freeze-drying process:

    [0080] intermediate preparations involved in the reaction process of the preparation method of the embodiment are all freeze-dried products, and it is only necessary to prepare working liquid without complicated operation such as dilution; and the freeze-drying processing method is: freeze drying was performed at −30° C. for 5 hours, the temperature was gradually increased to −10° C. in the subsequent 12-hour freeze-drying process at the heating rate of 5° C./3 h, and finally freeze drying was performed at −10° C. for 7 to 19 hours.

    Third Embodiment (Detection Method)

    [0081] This embodiment further provides a detection method of any one of the above corona virus disease 2019 nucleic acid rapid hybrid capture immunofluorescence detection kits. The detection method includes the following steps:

    [0082] a target nucleic acid section in a to-be-detected sample was acquired through hybrid capture;

    [0083] performing nucleic acid hybridization reaction on the target nucleic acid fragment and the COVID-19 reaction solution to obtain to-be-detected liquid; and

    [0084] the to-be-detected liquid was added into the COVID-19 detection strip for fluorescent signal recognition. In this embodiment, the to-be-detected liquid was added into a sample adding area of the detection strip, 100 ul of washing liquid was added again from the sample adding area after 90 seconds, and after 10 minutes, a detection area of the detection strip was subjected to fluorescence detection to read the detection result.

    [0085] The detection result was judged as follows:

    [0086] irradiation was performed by using 480 nm exciting light to recognize a 520 nm fluorescence emitting signal, and if there is the fluorescence emitting signal, it is interpreted as positive, otherwise, it is interpreted as negative. The intensity of reaction may be interpreted according to the intensity of the emitting signal as required, and the recognition instrument may adopt a general fluorescence reading instrument, for example, a portable immunofluorescence analyzer produced by Suzhou Hemai Science and Technology.

    [0087] It should be noted that the embodiments in this specification are described in a progressive manner. Each embodiment focuses on a difference from other embodiments. The same or similar part of the embodiments may be referenced to each other. The preparation method and detection method embodiments are basically similar to the kit embodiments, so the description is relatively simple, and the relevant points are referenced to the partial description of the kit embodiments.

    [0088] The effect comparison of an existing fluorescence PCR nucleic acid detection method and the corona virus disease 2019 nucleic acid rapid hybrid capture immunofluorescence detection kit based on a nucleic acid hybrid capture immunofluorescence analysis method and the detection method thereof is specifically as follows:

    TABLE-US-00008 TABLE 2 Technical effect comparison diagram Comparison Item Invention Prior Art Methodological Nucleic acid hybrid capture Nucleic acid amplification principle fluorescence method (fluorescence PCR method) Sample Free of nucleic acid extraction Nucleic acid extraction and treatment purification Detection time 30 minutes 1 to 3 hours Usage On-site detection and on-demand Three professional PCR environment detection are realized without a laboratories and a large PCR laboratory central laboratory are required; and if polluted, they cannot be used for a long time Staff No need for professional technicians, Specially trained technicians requirement and personnel can be simply trained are required Device Matched device, which is small, The PCR instrument is light and portable required and cannot swing Application Primary medical care, outpatient Central laboratories of large Scene service, clinical laboratory, Grade III Level A hospitals emergency treatment, exit and entry, customs, center for disease control and prevention, and the like Potential No amplification, no pollution of Nucleic acid amplification, pollution laboratory positive products, and the liable to cause pollution of redissolving liquid has an “anti-virus” laboratory positive products, component and the pollution cannot be eliminated for a long time Transportation Storage at normal temperature of Storage at −20° C., and cold and storage 2-30° C. and transportation at normal chain transportation is temperature required

    [0089] The specific detection process of the invention is described as follows:

    [0090] (1) a throat swab sample was used and put into a sample preserving tube (the sample preserving tube contains preserving liquid), a mixture of the preserving liquid and the sample was obtained, and the mixture was defined as a detection sample.

    [0091] (2) A proper amount of detection sample was put into a reaction tube, wherein the reaction tube contains powder after reaction solution is dried and the power is defined as reaction solution powder. The preparation of the reaction solution powder may be referenced to the followings:

    [0092] preparation of a probe solution: a COVID-19 probe was diluted with nucleic acid solving liquid to 10 μM±5% to obtain a COVID-19 probe solution; preparation of reaction solution: the diluted COVID-19 fluorescence marker and the COVID-19 probe solution were mixed according to a volume ratio of 1:1 to obtain COVID-19 reaction solution; and subpackaging of the reaction solution: the COVID-19 reaction solution was subpackaged into reaction tubes (4 μL/tube) and dried for 6 to 8 hours under the conditions that the temperature is 18-28° C. and the humidity is less than or equal to 30%. The reaction solution powder contains the probe solution and protein marked with a fluorescence signal. The preparation process of the protein marked with the fluorescence signal may be referenced to the followings:

    [0093] activation: 1% fluorescent microsphere solution with a ratio of 1.0 mg/mL±5% and an EDC solution with a ratio of 0.6 mg/mL±5% were added into a prepared borate buffer solution of 0.05M±5% for uniformly mixing, the mixture was placed on a rotary mixer to rotate for more than 20 minutes, centrifugation was performed at 15000-16000 rpm for more than 30 minutes after activating, a supernatant was removed, resuspension was performed by the borate buffer solution of 0.05M±5% and uniform mixing was performed.

    [0094] coupling: a COVID-19 antibody in an amount of 0.2 mg/mL was added into the activated fluorescent microsphere solution for uniform mixing, and the mixture was placed on the rotary mixer to rotate for more than 2 hours to obtain a fluorescent microsphere marking conjugate solution.

    [0095] closing: a 10% BSA solution with a ratio of 0.1 ml/mL±5% was added into the fluorescent microsphere marking conjugate solution for uniform mixing, and the mixture was placed on the rotary mixer to rotate for 12-16 hours.

    [0096] centrifugal resuspension: the fluorescent microsphere marking conjugate solution was centrifuged at 15000-16000 rpm, a supernatant was removed, the material was washed with an isovolumetric borate buffer solution (PH 8.0) of 0.05M±5%, and finally a precipitate was resuspended with a marker diluent in a volume which is equal to that of the supernatant solution to prepare the COVID-19 fluorescence marker.

    [0097] The used fluorescence signal is from a fluorescent microsphere. The protein is S9.6 protein produced by Merck, and the specific model of the protein is referenced to FIG. 2.

    [0098] (3) After the detection sample entered the reaction tube, the reaction solution powder was redissolved under the action of the preserving liquid in the detection sample to form a liquid phase environment. When the redissolving liquid of the reaction solution was insufficient, the redissolving liquid may be properly added, wherein the adding amount is 85 μL±5%, and the redissolving liquid is generally normal saline or normal saline added with a bactericidal component. After the materials were mixed in the reaction tube, the reaction tube was placed in a heater and heated for 37±2° C. In this liquid phase environment, two reactions were carried out, namely:

    [0099] a. DNA recognized, hybridized, captured and combined a target RNA fragment into a DNA-RNA complex; and b. protein 1 specifically recognized and combined the DNA-RNA complex to form a DNA-RNA-protein-fluorescence signal complex which is defined as a reaction complex.

    [0100] (4) The reaction complex was taken out and added into a detection reagent card, and was chromatographed on a test strip under the action of auxiliary liquid until a T line, wherein the T line is coated with S9.6 protein produced by Merck. When the COVID-19 virus was detected in the sample, there would be the DNA-RNA-protein-fluorescence signal complex in the reaction complex. The S9.6 protein produced by Merck may specifically recognize and combine the DNA-RNA complex, so the DNA-RNA-protein-fluorescence signal complex in the reaction complex may be fixed on the T line to form a “protein-DNA-RNA-protein-fluorescence signal”, a fluorescence band was formed on the T line, and the fluorescence signal may be detected on the T line through an instrument. The reaction complex passed through the T line and then was continuously chromatographed to pass through a C line, the C line was coated with a rabbit polyclonal antibody, and the rabbit polyclonal antibody may non-specifically combine the S9.6 protein produced by Merck, so on the premise of excessive amount, a certain amount of protein connected with the fluorescence signal would be captured theoretically to form a fluorescence band, which may be recognized through an instrument. The above-mentioned T line marker and C line marker are precisely S9.6 protein produced by Merck and coated on the T line and a rabbit polyclonal antibody coated on the C line, and all the protein are not marked with the fluorescence signals.

    [0101] The specific experimental data contents of the invention are:

    [0102] First Part Experiment Preparation

    [0103] The main research methods of each performance are all combined with the evaluation method actually adopted in China, including positive reference product coincidence rate and negative reference product coincidence rate of products, minimum detection limit, precision, interference experiment, cross reaction and the like, to complete experimental test.

    TABLE-US-00009 TABLE 3 Material information required for experiment Batch Serial number/model number Name number Status 1 2019-novel coronavirus (2019-nCoV) / nucleic acid assay kit (hybrid capture immunofluorescence method) 2 Immunoassay analyzer 3 2019-nCoV reference product /

    [0104] The information of samples and other materials used in the analytical performance evaluation test is shown in the following table:

    TABLE-US-00010 TABLE 4 The information of samples and other materials used in the analytical performance evaluation test Serial number Name 1 2019-nCoV Throat swab and sputum samples (positive, negative and critically positive samples) 2 Interferent-endogenous 3 Interferent-medicine 4 Cross-pathogenic microorganism 5 Cross sample (Samples collected from different regions with positive endemic coronavirus or positive common respiratory pathogen and negative COVID-19)

    [0105] Second part Positive/negative reference product coincidence rate

    [0106] 1. Standard Requirement

    [0107] 1.1 Positive Reference Product Coincidence Rate

    [0108] 13 positive reference products (P1-P13) were detected, including 5 positive samples in the 2019-CoV N section, the 2019-CoV E section and the 2019-CoV ORF lab section and 5 positive samples in sputum and throat swab liquid, and the results should be positive.

    [0109] 1.2 Negative Reference Product Coincidence Rate

    [0110] 19 negative reference products (N1-N19) were detected, and the results should be negative.

    TABLE-US-00011 TABLE 5 Information of 19 negative reference products (N1-N19) Serial Number Reference product Information Type N5 Negative for 2019-nCoV and Throat positive for influenza A virus swab liquid N6 Negative for 2019-nCoV and Throat positive for metapneumovirus swab liquid N7 Negative for 2019-nCoV and Throat positive for influenza B virus swab liquid N8 Negative for 2019-nCoV and Throat positive for parainfluenza virus swab liquid N9 Negative for 2019-nCoV and Throat positive for respiratory swab liquid syncytial virus N10 Negative for 2019-nCoV and Throat positive for rhinovirus swab liquid N11 Negative for 2019-nCoV and Throat positive for adenovirus swab liquid N12 Negative for 2019-nCoV and Throat positive for mycoplasma swab liquid pneumoniae N13 Negative for 2019-nCoV and Throat positive for chlamydia swab liquid pneumoniae N14 Negative for 2019-nCoV Throat Positive for human coronavirus swab liquid 229E N section N15 Negative for 2019-nCoV Throat Positive for human coronavirus swab liquid NL63 N section N16 Negative for 2019-nCoV Throat Positive for human coronavirus swab liquid OC43 N section N17 Negative for 2019-nCoV Throat Positive for human coronavirus swab liquid HKU1 N section N18 Negative for 2019-nCoV Pseudovirus Positive for human coronavirus MERS N section N19 Negative for 2019-nCoV Pseudovirus Positive for human coronavirus SARS N section

    [0111] 2. Method

    [0112] 8 positive reference products (P1-P8) and 19 negative reference products (N1-N19) were detected for one time by the novel coronavirus (2019-nCoV) nucleic acid assay kit (hybrid capture immunofluorescence method).

    [0113] 3. Result

    TABLE-US-00012 TABLE 6 Results of reagent positive/negative reference product coincidence rate Batch number 401200101 P1 196.77 + P2 178.78 + P3 173.80 + P4 185.63 + P5 132.54 + P6 451.26 + P7 232.15 + P8 110.23 + P9 105.46 + P10 129.75 + P11 206.18 + P12 251.46 + P13 512.48 + N1 45.35 − N2 21.40 − N3 31.98 − N4 55.50 − N5 55.12 − N6 26.08 − N7 57.01 − N8 49.51 − N9 55.62 − N10 26.87 − N11 51.33 − N12 20.59 − N13 41.55 − N14 52.12 − N15 39.56 − N16 60.48 − N17 68.45 − N18 32.15 − N19 29.52 −

    [0114] 4. Conclusion

    [0115] The detection results of 13 positive reference products and 19 negative reference products of three batches of reagents all meet the proposed standard.

    [0116] Third part Determination of minimum detection limit

    [0117] 1. Objective

    [0118] The minimum detection limit of the novel coronavirus (2019-nCoV) nucleic acid assay kit (hybrid capture immunofluorescence method) is determined.

    [0119] 2. Material Information

    TABLE-US-00013 TABLE 7 Material information required for experiment for determining the minimum detection limit Serial number Name Use 1 Pseudovirus (including the 2019-CoV Establishment of the N section, the 2019-CoV E section minimum detection and the 2019-CoV ORF lab section) limit 2 2019-nCoV Establishment of the Throat swab and sputum positive minimum detection samples limit Verification of the minimum detection limit 3 2019-nCoV Containment Throat swab and sputum positive verification of the samples minimum detection limit

    [0120] 3. Establishment

    [0121] 3.1 Preparation of Pseudovirus Sample

    [0122] The pseudoviruses at 3 sections (including the 2019-CoV N section, the 2019-CoV E section and the 2019-CoV ORF lab section) were gradiently diluted with mixed negative samples as diluent respectively into 5000 copies/mL, 2500 copies/m, 1000 copies/mL, 800 copies/mL, 500 copies/mL, 250 copies/mL and 100 copies/mL.

    [0123] 3.3 Sample Measurement

    [0124] The samples (pseudovirus, throat swab sample and sputum sample) were measured by the 2019-novel coronavirus (2019-nCoV) nucleic acid assay kit (hybrid capture immunofluorescence method), each sample was tested for 20 times, and the positive detection rate was detected.

    [0125] 3.4. Determination

    [0126] The minimum concentration with positive detection rate more than or equal to 95% is the minimum detection limit of this section.

    [0127] 3.5 Sample Detection

    TABLE-US-00014 TABLE 8 Measurement result of each dilution sample 5000 2500 1000 800 500 250 100 1 478.70 + 140.58 + 102.13 + 86.19 − 101.27 + 81.04 − 65.58 − 2 470.76 + 145.56 + 104.30 + 104.31 + 99.59 − 84.15 − 76.33 − 3 489.00 + 145.04 + 101.65 + 96.94 − 100.31 + 107.11 + 64.87 − 4 487.85 + 153.84 + 100.36 + 109.97 + 83.41 − 85.45 − 59.10 − 5 455.52 + 147.96 + 101.73 + 95.16 − 106.86 + 89.87 − 55.45 − 6 479.44 + 152.99 + 109.75 + 101.23 + 104.12 + 81.07 − 55.88 − 7 480.61 + 153.19 + 106.66 + 105.74 + 93.48 − 75.35 − 71.57 − 8 487.43 + 157.88 + 100.94 + 88.88 − 89.42 − 74.81 − 59.89 − 9 498.15 + 159.06 + 104.81 + 105.03 + 94.98 − 105.26 + 102.34 + 10 474.14 + 143.43 + 104.61 + 107.44 + 99.14 − 109.91 + 66.23 − 11 482.48 + 141.57 + 104.50 + 108.94 + 108.89 + 84.92 − 62.85 − 12 482.56 + 146.63 + 105.71 + 96.15 − 97.19 − 88.88 − 58.56 − 13 486.82 + 150.40 + 108.79 + 98.33 − 105.89 + 80.79 − 58.68 − 14 477.20 + 142.32 + 106.22 + 107.61 + 83.54 − 107.36 + 74.67 − 15 495.41 + 144.33 + 102.70 + 107.33 + 88.86 − 88.28 − 64.59 − 16 490.73 + 154.63 + 109.02 + 106.97 + 103.16 + 79.22 − 55.57 − 17 497.68 + 154.73 + 107.92 + 107.89 + 105.65 + 80.52 − 65.79 − 18 482.99 + 155.77 + 103.52 + 106.34 + 92.23 − 106.15 − 63.13 − 19 455.93 + 153.44 + 107.27 + 102.48 + 102.37 + 89.60 − 50.94 − 20 470.77 + 144.19 + 107.99 + 108.58 + 103.45 + 72.95 − 64.80 − Positive 100% 100% 100% 70% 50% 20% 5% rate

    [0128] The above result shows that the positive detection rate of the samples with the minimum detection limit concentration of 1000 copies/mL is more than or equal to 95%.

    [0129] 6. Conclusion

    [0130] In conclusion, when the concentration of each sample of the three batches of reagents is 1000 copies/mL, the positive detection rate is more than or equal to 95%, so the minimum detection limit of the product is 1000 copies/mL.

    [0131] Fourth Part Precision Test

    [0132] 1. Standard Requirement

    [0133] (1) The intra-batch precision variable coefficient CV: 10%, and the results are consistent.

    [0134] (2) The inter-batch precision variable coefficient CV: and the results are consistent.

    [0135] (3) The intermediate precision variable coefficient CV: and the results are consistent.

    [0136] 2. Material Information

    TABLE-US-00015 TABLE 9 Material information required for experiment for determining precision Serial number Name 1 Pseudovirus including the 2019-CoV N section, the 2019-CoV E section and the 2019-CoV ORF lab section 2 2019-nCoV Throat swab and sputum samples

    [0137] 3. Method

    [0138] 3.1 Precision Reference Product Measurement

    [0139] Three batches of 2019-novel coronavirus (2019-nCoV) nucleic acid assay kits (hybrid capture immunofluorescence method) were detected by three precision reference products respectively.

    [0140] 20 groups of data were acquired for precision analysis.

    [0141] 4. Result

    [0142] 4.1 Precision Reference Product Result

    TABLE-US-00016 TABLE 10 Three batches of reagent verification precision reference product J1 measurement result First 1-1-1 143.19 + 156.02 + 131.95 + day 1-1-2 143.01 + 153.39 + 137.42 + 1-2-1 134.16 + 136.72 + 131.79 + 1-2-2 150.56 + 134.26 + 130.85 + 2-1-1 145.93 + 149.41 + 140.14 + 2-1-2 152.03 + 140.68 + 138.75 + 2-2-1 158.56 + 141.92 + 158.16 + 2-2-2 131.32 + 157.13 + 132.32 + 3-1-1 135.36 + 141.42 + 138.86 + 3-1-2 136.08 + 132.32 + 159.34 + 3-2-1 141.42 + 157.72 + 158.81 + 3-2-2 134.51 + 141.70 + 135.92 + 4-1-1 136.09 + 144.78 + 156.89 + 4-1-2 145.27 + 142.62 + 154.15 + 4-2-1 155.52 + 142.85 + 151.29 + 4-2-2 153.74 + 139.87 + 146.83 + Second 1-1-1 148.31 + 137.72 + 157.34 + day 1-1-2 151.80 + 154.87 + 150.28 + 1-2-1 138.01 + 130.39 + 148.42 + 1-2-2 155.91 + 154.96 + 149.98 + 2-1-1 152.78 + 157.30 + 144.49 + 2-1-2 145.49 + 158.40 + 140.56 + 2-2-1 146.53 + 137.79 + 135.37 + 2-2-2 130.37 + 154.64 + 141.50 + 3-1-1 145.45 + 140.39 + 133.83 + 3-1-2 143.19 + 130.66 + 143.13 + 3-2-1 143.66 + 142.10 + 158.38 + 3-2-2 158.37 + 136.07 + 143.23 + 4-1-1 151.99 + 147.89 + 145.84 + 4-1-2 141.77 + 141.29 + 157.12 + 4-2-1 150.47 + 140.28 + 149.00 + 4-2-2 159.64 + 135.15 + 145.85 + Third 1-1-1 139.12 + 142.97 + 142.22 + day 1-1-2 133.25 + 141.35 + 158.86 + 1-2-1 151.58 + 146.31 + 152.48 + 1-2-2 154.63 + 149.21 + 130.30 + 2-1-1 140.32 + 134.87 + 154.00 + 2-1-2 144.45 + 154.14 + 135.14 + 2-2-1 135.08 + 137.08 + 142.94 + 2-2-2 136.90 + 131.04 + 134.50 + 3-1-1 144.70 + 147.85 + 154.06 + 3-1-2 139.18 + 159.91 + 134.30 + 3-2-1 141.10 + 133.03 + 133.34 + 3-2-2 146.53 + 146.77 + 145.76 + 4-1-1 140.10 + 137.69 + 141.26 + 4-1-2 142.40 + 130.33 + 156.42 + 4-2-1 140.03 + 150.03 + 146.48 + 4-2-2 130.83 + 134.23 + 149.10 + Fourth 1-1-1 152.65 + 151.81 + 155.90 + day 1-1-2 140.07 + 135.34 + 146.27 + 1-2-1 150.05 + 152.27 + 131.48 + 1-2-2 144.68 + 146.04 + 141.58 + 2-1-1 130.93 + 138.65 + 147.41 + 2-1-2 134.82 + 151.13 + 147.92 + 2-2-1 157.65 + 155.10 + 138.68 + 2-2-2 146.24 + 155.91 + 143.73 + 3-1-1 130.95 + 132.50 + 152.39 + 3-1-2 159.01 + 143.13 + 149.69 + 3-2-1 158.36 + 156.77 + 134.08 + 3-2-2 155.97 + 133.15 + 157.96 + 4-1-1 141.81 + 155.90 + 137.40 + 4-1-2 135.39 + 140.10 + 131.87 + 4-2-1 139.12 + 131.49 + 131.19 + 4-2-2 149.88 + 134.67 + 136.08 + Fifth 1-1-1 139.58 + 144.48 + 132.37 + day 1-1-2 145.98 + 141.89 + 144.37 + 1-2-1 140.56 + 142.87 + 150.13 + 1-2-2 146.31 + 142.76 + 145.09 + 2-1-1 155.69 + 136.51 + 132.72 + 2-1-2 146.21 + 157.54 + 150.66 + 2-2-1 142.93 + 136.56 + 140.59 + 2-2-2 152.48 + 150.50 + 157.51 + 3-1-1 143.65 + 133.76 + 135.82 + 3-1-2 133.17 + 143.60 + 133.49 + 3-2-1 134.58 + 141.09 + 146.31 + 3-2-2 140.71 + 156.01 + 142.23 + 4-1-1 136.64 + 148.33 + 156.66 + 4-1-2 156.38 + 138.11 + 142.04 + 4-2-1 141.65 + 148.78 + 155.72 + 4-2-2 146.64 + 156.64 + 150.29 + Average value.sup.X 144.39 144.04 144.48 Standard deviation (SD) 7.98 8.52 8.81 Intra-batch CV 5.53% 5.91% 6.10% Inter-batch CV 5.83%

    [0143] 4.2 5. Conclusion

    [0144] The products were respectively measured for precision reference products, the variable coefficient CV is not greater than 10%, and the inter-batch variable coefficient CV is not greater than 10%.

    [0145] Fifth Part Endogenous Interference Experiment

    [0146] 1. Objective

    [0147] The influence on the detection result of the 2019-novel coronavirus (2019-nCoV) nucleic acid assay kit (hybrid capture immunofluorescence method) by endogenous interference substances such as hemoglobin and mucoprotein in the common samples was analyzed, and the anti-interference performance of the products was evaluated.

    [0148] 2. Material Information

    TABLE-US-00017 TABLE 11 Material information required for endogenous interference experiment Serial number Name 1 2019-nCoV Throat swab 2 Hemoglobin 3 Mucoprotein

    [0149] 3. Method

    [0150] 3.1 Selection of Throat Swab

    [0151] 3.2 Preparation of Basic Sample

    [0152] Basic sample: clinical sample 0.072 mL+0.008 mL normal saline

    [0153] 3.2 Preparation of Interference Sample

    [0154] The following interferents were added into the above samples respectively to prepare the corresponding interference samples:

    [0155] Hemoglobin interference sample: Sample 0.072 mL+0.008 mL 20 g/L hemoglobin

    [0156] Sample 0.072 mL+0.008 mL 10 g/L hemoglobin

    [0157] Sample 0.072 mL+0.008 mL 5 g/L hemoglobin

    [0158] Mucoprotein interference sample: Sample 0.072 mL+0.008 mL 200 mg/mL mucoprotein

    [0159] Sample 0.072 mL+0.008 mL 100 mg/mL mucoprotein

    [0160] Sample 0.072 mL+0.008 mL 50 mg/mL mucoprotein

    [0161] 3.3 Measurement

    [0162] The above preparation samples were detected by the 2019-novel coronavirus (2019-nCoV) nucleic acid assay kits (hybrid capture immunofluorescence method) respectively, and a ratio of the interference sample detection value to the basic sample detection value was calculated.

    [0163] 4. Result

    [0164] 4.1 Throat Swab Sample Interference Result

    [0165] 4.1.2 Hemoglobin Interference Detection Result

    TABLE-US-00018 TABLE 12 Three batches of reagent throat swab negative sample interference experiment (interferent: hemoglobin) detection result 401200101 401200102 401200103 Critically Interferent Basic Basic Basic positi concen value Interference Ratio value Interference Ratio value Interference Ratio L1 2 g/L 125.48 130.5 1.04 126.73 128.00 1.01 129.24 132.17 1.02 1 g/L 110.37 114.7 1.04 109.27 108.17 0.99 101.54 105.46 1.04 0.5 g/L 100.45 102.4 1.02 103.46 107.88 1.04 108.49 112.83 1.04 L2 2 g/L 110.64 102.9 0.93 109.53 120.49 1.10 120.60 129.04 1.07 1 g/L 121.80 109.6 0.90 125.45 117.93 0.94 125.45 124.20 0.99 0.5 g/L 127.29 115.8 0.91 133.65 124.30 0.93 124.74 116.01 0.93 L3 2 g/L 100.72 106.6 1.06 104.52 106.88 1.02 108.78 110.95 1.02 1 g/L 100.65 108.6 1.08 102.66 103.69 1.01 116.58 119.53 1.03 0.5 g/L 125.66 119.3 0.95 130.69 142.45 1.09 116.86 114.53 0.98

    [0166] 5. Conclusion

    [0167] The interference samples prepared by the above samples and the corresponding basic samples have the consistent detection result, which shows that the hemoglobin with the concentration content of 2 g/L and the mucoprotein with concentration content of 20 mg/mL in the samples do not affect the detection.

    [0168] Sixth Part Cross Reaction Experiment

    [0169] 1. Objective

    [0170] The influence on the detection result of the 2019-novel coronavirus (2019-nCoV) nucleic acid assay kit (hybrid capture immunofluorescence method) by the common respiratory pathogen was analyzed, and the specificity of the products was evaluated.

    [0171] 2. Material Information

    TABLE-US-00019 TABLE 13 Material information required for cross reaction experiment 1 2019-nCoV Throat swab sample 2 2019-nCoV 3 Various pathogenic microorganisms 4 Cross samples (samples collected from different regions with positive endemic coronavirus or positive common respiratory pathogen and negative COVID-19)

    [0172] 3. Method

    [0173] 3.1.2 Preparation of Basic Sample

    [0174] The basic sample is directly applied to detection and the detection result is a basic value.

    [0175] Basic sample: basic sample 0.09 mL+0.01 mL normal saline

    [0176] Preparation of the sample, that is, preparation of 2 cases of negative samples and 2 cases of critically positive samples crossed by each pathogenic microorganism.

    [0177] 4) Preparation Method of Cross Sample

    [0178] Virus cross sample: sample 0.072 mL+0.008 mL 106 pfu/mL

    [0179] Cross samples of bacteria, mycoplasma and chlamydia: sample 0.072 mL+0.008 mL 107 cfu/mL

    TABLE-US-00020 TABLE 14 Various pathogenic microorganism information Cross Serial concen- Number Pathogen Species Concentration Titer test tration  1 H1N1 (Novel A-H1N1-2009 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ influenza A H1N1 mL virus (2009))  2 Seasonal H1N1 A-H1N1 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ influenza virus mL  3 H3N2 A-H3N2 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL  4 H5N1 A-H5N1 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL  5 H7N9 A-H7N9 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL  6 Influenza B virus B-Yamagata 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ Yamagata mL  7 Influenza B virus B-Victoria 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ Victoria mL  8 Respiratory syncytial RSV-A2 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ virus type A mL  9 Respiratory syncytial RSV-B 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ virus type B mL 10 Enterovirus A CV-A10 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 11 Enterovirus B Echovirus 6 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 12 Enterovirus C CV-A21 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 13 Enterovirus D EV-D68 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 14 Parainfluenza virus HPIVs-1 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ type 1 mL 15 Parainfluenza virus HPIVs-2 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ type 2 mL 16 Parainfluenza virus HPIVs-3 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ type 3 VR-93 mL 17 Rhinovirus A HRV-9 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ VR-489 mL 18 Rhinovirus B HRV-52 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ VR-1162 mL HRV-3 VR-1113 19 Rhinovirus C HRV-16 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ VR-283 mL 20 Adenovirus type 1 H AdV-1 VR-1 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 21 Adenovirus type 2 HAdV-2 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ VR-846 mL 22 Adenovirus type 3 HAdV-3 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 23 Adenovirus type 4 HAdV-4 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ VR-1572 mL 24 Adenovirus type 5 HAdV-5 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ VR-1578/1516 mL 25 Adenovirus type 7 HAdV-7 VR-7 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 26 Adenovirus type 55 HAdV-5 5 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 27 Human interstitial HMPV 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ pneumonia mL 28 Human HMPV 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ metapneumovirus mL 29 EB virus HHV-4 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ VR-1492 mL 30 Measles virus MV VR-24 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 31 Human HHV-5 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ cytomegalovirus VR-977 mL 32 Rotavirus RVVR-2018 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 33 Norovirus NOR 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 34 Mumps virus MuV VR-106 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 35 Varicella-zoster virus VZV 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ VR-1367 mL 36 Legionella 33152 10.sup.7cfu/mL Colony 10.sup.5cfu/ counting mL 37 Bordetella pertussis BAA-589 10.sup.7cfu/mL Colony 10.sup.6cfu/ counting mL 38 Haemophilus Hib 10.sup.7cfu/mL Colony 10.sup.6cfu/ influenzae counting mL 39 Staphylococcus CGMCC 10.sup.7cfu/mL Colony 10.sup.6cfu/ aureus 1.2910 counting mL 40 Streptococcus CGMCC 10.sup.7cfu/mL Colony 10.sup.6cfu/ pneumoniae 1.8722 counting mL 41 Pyogenic CGMCC 10.sup.7cfu/mL Colony 10.sup.6cfu/ streptococcus 1.8868 counting mL 42 Klebsiella CGMCC 10.sup.7cfu/mL Colony 10.sup.6cfu/ pneumoniae 1.1736 counting mL 43 Mycobacterium 25177 10.sup.7cfu/mL Colony 10.sup.6cfu/ tuberculosis counting mL 44 Mycoplasma 39505 10.sup.7cfu/mL Colony 10.sup.6cfu/ pneumoniae counting mL 45 Chlamydia VR-2282 10.sup.7cfu/mL Colony 10.sup.6cfu/ pneumoniae counting mL 46 Aspergillus fumigatus AF293 10.sup.7cfu/mL Colony 10.sup.6cfu/ counting mL 47 Candida albicans SC5314 10.sup.7cfu/mL Colony 10.sup.6cfu/ counting mL 48 Candida glabrata ATCC 2001 10.sup.7cfu/mL Colony 10.sup.6cfu/ counting mL 49 Cryptococcus H99 10.sup.7cfu/mL Colony 10.sup.6cfu/ counting mL 50 Cryptococcus Gattii R265 10.sup.7cfu/mL Colony 10.sup.6cfu/ counting mL 51 Coronavirus 229E VR-740 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 52 Coronavirus OC43 VR-1558 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 53 Coronavirus NL63 COV-NL63 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 54 Coronavirus HKU1 COV-HKU1 10.sup.6pfu/mL Plaque test 10.sup.5pfu/ mL 55 Coronavirus MERS MERS 10.sup.8TU/mL Digital PCR 10.sup.7TU/ mL 56 Coronavirus SARS SARS 10.sup.8TU/mL Digital PCR 10.sup.7TU/ mL

    [0180] 3.1.4 Measurement

    [0181] The above preparation samples were detected by the 2019-novel coronavirus (2019-nCoV) nucleic acid assay kits (hybrid capture immunofluorescence method) respectively, and a ratio of the cross sample detection value to the basic sample detection value was calculated.

    TABLE-US-00021 TABLE 15 Reagent cross experiment detection result Basic Interference Pathogenic microorganism value value Ratio H1N1 (Novel influenza A H1N1 virus 52.81 53.45 1.01 (2009)) Seasonal H1N1 influenza virus 54.61 50.41 0.92 H3N2 54.24 52.31 0.96 H5N1 45.59 42.05 0.92 H7N9 42.99 43.74 1.02 Influenza B virus Yamagata 47.67 46.99 0.99 Influenza B virus Victoria 49.92 50.76 1.02 Respiratory syncytial virus type A 43.69 45.32 1.04 Respiratory syncytial virus type B 49.17 44.86 0.91 Enterovirus A 57.68 53.47 0.93 Enterovirus B 46.6 45.68 0.98 Enterovirus C 50.71 49.39 0.97 Enterovirus D 57.93 54.99 0.95 Parainfluenza virus type 1 42.49 39.15 0.92 Parainfluenza virus type 2 53.43 52.17 0.98 Parainfluenza virus type 3 57.72 62.95 1.09 Rhinovirus A 49.79 51.42 1.03 Rhinovirus B 43.52 46.82 1.08 Rhinovirus C 56.86 61.42 1.08 Adenovirus type 1 55.88 53.51 0.96 Adenovirus type 2 44.13 43.11 0.98 Adenovirus type 3 41.84 39.89 0.95 Adenovirus type 4 47.54 51.11 1.08 Adenovirus type 5 53.79 55.41 1.03 Adenovirus type 7 47.45 52.05 1.10 Adenovirus type 55 51.2 48.58 0.95 Human interstitial pneumonia 46.47 41.84 0.90 human metapneumovirus 54.15 57.07 1.05 EB virus 46.21 43.99 0.95 Measles virus 40.82 41.17 1.01 Human cytomegalovirus 50.31 46.43 0.92 Rotavirus 54.68 53.76 0.98 Norovirus 44.1 47.86 1.09 Mumps virus 51.54 51.25 0.99 Varicella-zoster virus 59.03 62.39 1.06 Legionella 47.01 45.7 0.97 Bordetella pertussis 43.73 40.61 0.93 Haemophilus influenzae 43.67 40.46 0.93 Staphylococcus aureus 54.98 58.07 1.06 Streptococcus pneumoniae 57.51 58.41 1.02 Pyogenic streptococcus 49.55 52.47 1.06 Klebsiella pneumoniae 51.69 55.87 1.08 Mycobacterium tuberculosis 47.07 47.6 1.01 Mycoplasma pneumoniae 47.12 51.82 1.10 Chlamydia pneumoniae 53.49 54.68 1.02 Aspergillus fumigatus 58.82 62.28 1.06 Candida albicans 58.43 58.14 1.00 Candida glabrata 40.27 37.9 0.94 Cryptococcus neoformans 45.39 45.35 1.00 Cryptococcus Gattii 43.04 42.55 0.99 Coronavirus 229E 45.69 41.78 0.91 Coronavirus OC43 47.4 51.15 1.08 Coronavirus NL63 49.16 48.21 0.98 Coronavirus HKU1 54.97 58.85 1.07 Coronavirus MERS 40.75 37.32 0.92 Coronavirus SARS 44.39 40.27 0.91

    [0182] 5. Conclusion

    [0183] In conclusion, the detection results of the cross sample prepared by the above sample and the corresponding basic sample are consistent, a ratio of the cross sample detection value to the basic sample detection value is between 0.9 and 1.1, the common pathogenic microorganisms in different regions are positive, and the detection result of the 2019-nCoV negative samples are negative, indicating that there is no cross phenomenon between the reagent and the following common respiratory pathogens.

    TABLE-US-00022 TABLE 16 The common respiratory pathogens which do not cross with the 2019-nCoV negative sample H1N1 (Novel influenza Seasonal H5N1 H7N9 A H1N1 H1N1 H3N2 avian avian Influenza Influenza virus influenza influenza influenza influenza B virus B virus (2009)) virus virus virus virus Yamagata Victoria Respiratory Respiratory Enterovirus Enterovirus Enterovirus Enterovirus Parainfluenza syncytial syncytial A B C D virus virus type A virus type B type 1 Parainfluenza Parainfluenza Rhinovirus Rhinovirus Rhinovirus Adenovirus Adenovirus virus virus A B C type 1 type 2 type 2 type 3 Adenovirus Adenovirus Adenovirus Adenovirus Adenovirus Human human type 3 type 4 type 5 type 7 type 55 interstitial metapneumovirus pneumonia EB virus Measles Human Rotavirus Norovirus Mumps Varicella- virus cytomegalovirus virus zoster virus Legionella Bordetella Haemophilus Staphylococcus Streptococcus Pyogenic Klebsiella pertussis influenzae aureus pneumoniae streptococcus pneumoniae Mycobacterium Mycoplasma Chlamydia Aspergillus Candida Candida Cryptococcus tuberculosis pneumoniae pneumoniae fumigatus albicans glabrata neoformans Cryptococcus Coronavirus Coronavirus Coronavirus Coronavirus Coronavirus Coronavirus Gattii 229E OC43 NL63 HKU1 MERS SARS

    [0184] Seventh part Human genome DNA cross reaction experiment

    [0185] 1. Objective

    [0186] The influence on the detection result of the 2019-novel coronavirus (2019-nCoV) nucleic acid assay kit (hybrid capture immunofluorescence method) by the human genome DNA was analyzed, and the specificity of the products was evaluated.

    [0187] 2. Material Information

    TABLE-US-00023 TABLE 17 Material information required for human genome DNA cross reaction experiment Serial number Name 1 2019-nCoV Throat swab sample 2 Human genome DNA

    [0188] 3. Method

    [0189] 3.1 Source, Preparation and Valuation of Human Genome DNA

    [0190] Three whole blood samples from different sources were taken, 1 mL of each of the three whole blood samples were subjected to DNA extraction by a blood genome DNA extraction system (0.1-20 mL) kit of Tiangen Biotech (Beijing) Co., Ltd., and the extracted DNA was subjected to concentration test by an ultraviolet spectrophotometer.

    [0191] 3.3 Sample Preparation

    [0192] Basic sample: basic sample 0.072 mL+0.008 mL normal saline

    [0193] Cross sample: sample 0.072 mL+0.008 mL DNA extracting solution

    [0194] 3.4 Measurement

    [0195] The above preparation samples were detected by three batches of 2019-novel coronavirus (2019-nCoV) nucleic acid assay kits (hybrid capture immunofluorescence method) respectively, and a ratio of the cross sample detection value to the basic sample detection value was calculated.

    [0196] 4. Result

    [0197] 4.1 DNA Extracting Solution Concentration

    TABLE-US-00024 TABLE 18 DNA extracting solution concentration DNA extracting DNA extracting DNA extracting solution 1 solution 2 solution 3 Concentration 95 μg/mL 90 μg/mL 102 μg/mL Volume 0.1 mL 0.1 mL 0.1 mL

    [0198] 4.2 Throat Swab Sample Cross Result

    TABLE-US-00025 TABLE 19 Reagent cross experiment detection result (critically positive throat swab sample 1) 401200101 Basic Interference value value Ratio DNA extracting solution 1 118.10 112.42 0.95 DNA extracting solution 2 116.28 107.06 0.92 DNA extracting solution 3 111.66 110.98 0.99

    [0199] 5. Conclusion

    [0200] In conclusion, the detection results of the cross sample prepared by the above sample and the corresponding basic sample are consistent, and a ratio of the cross sample detection value to the basic sample detection value is between 0.9 and 1.1, indicating that there is no cross phenomenon between the reagent and the following common respiratory pathogens.

    [0201] The above description shows and describes the preferred embodiments of the invention, it should be understood that the invention is not limited to the form disclosed herein and should not be regarded as an exclusion of other embodiments, but may be applied to various other combinations, modifications and environments and can be modified by the above teaching or technology or knowledge in the related field within the scope of the invention concept. However, the modifications and changes made by those skilled in the art do not depart from the spirit and scope of the invention and should fall within the protection scope of the appended Claims of the invention.