USE OF 4-AMINOQUINOLINE COMPOUND IN TREATMENT OF CORONAVIRUS INFECTION

Abstract

Disclosed are hydroxychloroquine or chloroquine, or a geometric isomer thereof, or a pharmaceutically acceptable salt thereof, and/or a solvate thereof, and/or a hydrate thereof, and a pharmaceutical composition containing the above-mentioned compound, and the use thereof in the treatment of diseases or infections caused by SARS-CoV-2.

Claims

1-4. (canceled)

5. A method for treating and/or preventing a disease or a viral infection in a mammal in need thereof, wherein the method comprises administering to the mammal in need thereof i) a therapeutically and/or prophylactically effective amount of hydroxychloroquine represented by Formula I or chloroquine represented by Formula II, a geometric isomer, a pharmaceutically acceptable salt, a solvate and/or a hydrates thereof, or ii a therapeutically and/or prophylactically effective amount of a pharmaceutical composition comprising hydroxychloroquine represented by Formula I or chloroquine represented by Formula II, a geometric isomer, a pharmaceutically acceptable salt, a solvate and/or a hydrate thereof, ##STR00019## ##STR00020## wherein, the disease includes a disease caused by a SARS-CoV-2, and the viral infection includes an infection caused by a SARS-CoV-2.

6-7. (canceled)

8. The method according to claim 5, wherein the pharmaceutically acceptable salt of hydroxychloroquine represented by Formula I or chloroquine represented by Formula II comprises one or more salts selected from a group consisting of: sodium salt, potassium salt, calcium salt, lithium salt, meglumine salt, hydrochloride salt, hydrobromide salt, hydroiodide salt, nitrate salt, sulfate, hydrogen sulfate, phosphate, hydrogen phosphate, acetate, propionate, butyrate, oxalate, pivalate, adipate, alginate, lactate, citrate, tartrate, succinate, maleate, fumarate, picrate, aspartate, gluconate, benzoate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and embonate of the compound.

9. The method according to claim 5, wherein the disease caused by a SARS-CoV-2 is COVID-19.

10. The method according to claim 5, wherein the disease caused by a SARS-CoV-2 is a respiratory disease, sepsis, or septic shock.

11. The method according to claim 5, wherein the disease caused by a SARS-CoV-2 is simple infection, fever, cough, sore throat, pneumonia, acute respiratory infection, severe acute respiratory infection, hypoxic respiratory failure or acute respiratory distress syndrome.

12. The method according to claim 8, wherein the pharmaceutically acceptable salt of chloroquine represented by Formula II is chloroquine sulfate or chloroquine phosphate.

13. The method according to claim 5, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient.

14. The method according to claim 13, wherein the pharmaceutical composition is a solid preparation, an injection, an external preparation, a spray, a liquid preparation, or a compound preparation.

15. A method for inhibiting the replication or reproduction of SARS-CoV-2 in a mammal in need, wherein the method comprises administering to the mammal in need thereof i) a therapeutically and/or prophylactically effective amount of hydroxychloroquine represented by Formula I or chloroquine represented by Formula II, a geometric isomer, a pharmaceutically acceptable salt, a solvate and/or a hydrates thereof, or ii) a therapeutically and/or prophylactically effective amount of a pharmaceutical composition comprising hydroxychloroquine represented by Formula I or chloroquine represented by Formula II, a geometric isomer, a pharmaceutically acceptable salt, a solvate and/or a hydrate thereof, ##STR00021## ##STR00022##

16. The method according to claim 15, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient.

17. The method according to claim 16, wherein the pharmaceutical composition is a solid preparation, an injection, an external preparation, a spray, a liquid preparation, or a compound preparation.

18. The method according to claim 15, wherein the mammal is bovine, equine, caprid, suidae, canine, feline, rodent, or primate.

19. The method according to claim 15, wherein the mammal is a human, a cat, a dog, or a pig.

20. The method according to claim 15, wherein the pharmaceutically acceptable salt of hydroxychloroquine represented by Formula I or chloroquine represented by Formula II comprises one or more salts selected from a group consisting of: sodium salt, potassium salt, calcium salt, lithium salt, meglumine salt, hydrochloride salt, hydrobromide salt, hydroiodide salt, nitrate salt, sulfate, hydrogen sulfate, phosphate, hydrogen phosphate, acetate, propionate, butyrate, oxalate, pivalate, adipate, alginate, lactate, citrate, tartrate, succinate, maleate, fumarate, picrate, aspartate, gluconate, benzoate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and embonate of the compound.

21. The method according to claim 20, wherein the pharmaceutically acceptable salt of chloroquine represented by Formula II is chloroquine sulfate or chloroquine phosphate.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0048] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0049] FIG. 1 shows the experimental results of effectiveness and safety of chloroquine phosphate on vero-E6 cells infected by SARS-CoV-2, wherein (A) shows the half-maximal effective concentration .Math.M) and the half-cytotoxic concentration (.Math.M) of chloroquine phosphate 48 hours after the cells were infected with SARS-CoV-2; (B) shows the immunofluorescence image after the cells infected with SARS-CoV-2 were treated with chloroquine phosphate.

[0050] FIG. 2 shows the research results of effectiveness and safety of chloroquine phosphate and hydroxychloroquine against SARS-CoV-2 in vitro (vero-E6 cells), wherein (A) shows the cytotoxicities and the half-cytotoxic concentrations of chloroquine phosphate and hydroxychloroquine; (B) shows the antiviral activities and half-maximal effective concentrations of chloroquine phosphate and hydroxychloroquine at MOI of 0.01; (C) shows the antiviral activities and half-maximal effective concentrations of chloroquine phosphate and hydroxychloroquine at MOI of 0.02; (D) shows the antiviral activities and half-maximal effective concentrations of chloroquine phosphate and hydroxychloroquine at MOI of 0.2; (E) shows the antiviral activities and half-maximal effective concentrations of chloroquine phosphate and hydroxychloroquine at MOI of 0.8.

[0051] FIG. 3 shows the research results of antiviral mechanism of chloroquine phosphate and hydroxychloroquine, wherein (A) shows the quantitative analysis results of co-localization of virus particles and early endosomes or lysosomes in cells after treatment with chloroquine phosphate and hydroxychloroquine; (B) shows the confocal micrograph of representative co-localization.

SPECIFIC MODELS FOR CARRYING OUT THE INVENTION

[0052] The technical solutions in the examples of the present application will be described clearly and completely in combination with the drawings in the examples of the present application. Obviously, the described examples are only a part of the examples of the present application, rather than all the examples. The following description of at least one exemplary example is actually only illustrative, and is not intended to limit the present application and its application or use. On the basis of the examples in the present application, all other examples obtained by those skilled in the art without creative work shall fall within the protection scope of the present application.

[0053] When the specific techniques or conditions are not indicated in the Examples, the Examples are carried out according to the techniques or conditions described in the literature in the field or according to the product specifications. The materials or equipment used herein, the manufacturers of which are not indicated, are the conventional products that are commercially available.

Example 1: Experiment on Chloroquine Phosphate Reducing Viral Nucleic Acid Load in SARS-CoV-2 Infected Cells

Drug Treatment of Virus-Infected Cells

[0054] Vero E6 cells (purchased from ATCC, Catalog No. 1586) was inoculated on a 24-well plate, cultured for 24 hours; then virus infection was carried out. Specifically, SARS-CoV-2 (2019-nCoV) virus (nCoV-2019BetaCoV/Wuhan/WIV04/2019 strain, preserved by Wuhan Institute of Virology, Chinese Academy of Sciences) was diluted with 2% cell maintenance solution (formulation: FBS (purchased from Gibco company, Catalog No. 16000044) was added to MEM (purchased from Gibco, Catalog No. 10370021) at a volume ratio of 2%, thereby obtaining the 2% cell maintenance solution) to a corresponding concentration, and then added to a 24-well plate so that each well contained a viral load of 1OOTCID.sub.50. Next, chloroquine phosphate and hydroxychloroquine (chloroquine phosphate was purchased from Sigma-Aldrich, Catalog No. C6628; hydroxychloroquine was purchased from MCE company, Catalog No. HY-B1370) were diluted with 2% cell maintenance solution to corresponding concentrations and added separately to the corresponding wells, so that the final concentrations of the drugs were 50 .Math.M, 16.67 .Math.M, 5.56 .Math.M, 1.85 .Math.M, 0.62 .Math.M, 0.21 .Math.M, 0.068 .Math.M, respectively, then the plate was placed in a 37° C., 5% CO.sub.2 incubator and cultured for 48 hours. To the vehicle control group, the 2% cell maintenance solution without any test drugs was added.

RNA Extraction

[0055] RNA extraction kit was purchased from Qiagen Company, Catalog No. 74106. The consumables (spin columns, RNase-free 2ml collection tubes, etc.) and reagents (RLT, RW1, RPE, RNase-free water, etc.) involved in the following RNA extraction steps were part of the kit. The following extraction steps were recommended steps in the kit instruction. [0056] 1) 100 .Math.L of the supernatant was taken from the tested plate and added to a nuclease-free EP tube (purchased from Axygen, Catalog No. mct-150-c), then 350 .Math.L of Buffer RLT was added to each well and mixed by beating with a transfer liquid gun until complete lysis was achieved, then centrifugation was carried out to obtain a supernatant; [0057] 2) an equal volume of 70% ethanol was added to the supernatant obtained in 1) and mixed well; [0058] 3) the mixture solution obtained in 2) was transferred to a RNase-free spin column, and centrifuged at 12000 rpm for 15 seconds, and the waste liquid was discarded; [0059] 4) 700 .Math.L of Buffer RW1 was added to the spin column, and centrifuged at 12000 rpm for 15 seconds to clean the spin column, and the waste liquid was discarded; [0060] 5) 500 .Math.L of Buffer RPE was added to the spin column, and centrifuged at 12000 rpm for 15 seconds to clean the spin column, and the waste liquid was discarded; [0061] 6) 500 .Math.L of Buffer RPE was added to the spin column, and centrifuged at 12000 rpm for 2 min to clean the spin column, the waste was discarded, and then the spin column was transferred to a new RNase-free 2 ml collection tube of step 7); [0062] 7) a new RNase-free 2 ml collection tube was used for replacement, centrifugation was carried out at 12000 rpm for 1 min, the spin column was dried, and then the spin column was transferred to a 1.5 ml collection tube in step 8); [0063] 8) a new 1.5 ml collection tube was used for replacement, in which the spin column dried in step [0064] 7) was placed, and 30 .Math.l of RNase-free water was added to the spin column, and centrifugation was carried out at 12000 rpm for 2 minutes, the obtained eluate contained the corresponding RNA, then the RNase inhibitor (purchased from NEB company, Catalog No. M0314L) was added, and Nano Drop (purchased from Thermo scientific, Nano Drop One) was used to detect each RNA concentration.

RNA Reverse Transcription

[0065] In the experiment, the reverse transcription kit (PrimeScript™ RT reagent Kit with gDNA Eraser, Catalog No. RR047Q) produced by TaKaRa was used for RNA reverse transcription. The steps were as follows. [0066] ① Removal of gDNA: RNA samples of each experimental group were collected, 1 .Math.g of each sample was taken for reverse transcription. First, 2 .Math.l of 5× gDNA Eraser Buffer was added to the RNA sample of each experimental group, the reaction system was supplemented with RNase-free water to reach 10 .Math.l, mixed well, and subjected to water bath at 42° C. for 2 min to remove the gDNA that might be present in the sample; [0067] ② Reverse transcription: Appropriate amounts of enzyme, primer Mix and reaction buffer were added to the sample obtained in ①, RNase-free water was added to supplement to reach a volume of 20 .Math.l, the reaction was performed in a water bath at 37° C. for 15 minutes, and then in water bath at 85° C. for 5 seconds, to obtain cDNA by transcription.

Real-Time PCR

[0068] Fluorescence quantitative PCR was used to detect the number of copies per milliliter of the original virus solution.

[0069] The reaction system was mixed by using TB Green Premix (Takara, Cat#RR820A), and the amplification reaction and reading were carried out with StepOne Plus Real-time PCR instrument (brand: ABI). The copy number contained in per milliliter of the original virus solution was calculated. The steps were as follows: [0070] ① Establishment of standard product: the plasmid pMT-RBD (the plasmid was preserved by Wuhan Institute of Virology, Chinese Academy of Sciences) was diluted to 5×10.sup.8 copies/.Math.L, 5×10.sup.7 copies/.Math.L, 5×10.sup.6 copies/.Math.L, 5×10.sup.5 copies/ .Math.L, 5×10.sup.4 copies/.Math.L, 5×10.sup.3 copies/.Math.L, 5×10.sup.2 copies/.Math.L, respectively. 2 .Math.L of standard product or cDNA template was taken for qPCR reaction. [0071] ② The primer sequences used in the experiment were as follows (all indicated in the 5’-3’ direction): [0072] RBD-qF:

TABLE-US-00001 CAATGGTTTAACAGGCACAGG

[0073] RBD-qR:

TABLE-US-00002 CTCAAGTGTCTGTGGATCACG

[0074] ③ The reaction procedure was as follows: [0075] Pre-denaturation: 95° C. for 5 minutes; [0076] Cycle parameters: 95° C. for 15 seconds, 54° C. for 15 seconds, 72° C. for 30 seconds, a total of 40 cycles.

Cytotoxicity Test of Drugs

[0077] The cytotoxicity test of drugs was carried out by using CCK-8 kit (Beyotime). Specific steps were as follows: [0078] ① 1×10.sup.4 Vero-E6 cells were inoculated in a 96-well plate and incubated at 37° C. for 8 hours. [0079] ② The drug was diluted with DMSO to an appropriate concentration of mother solution, and then diluted with MEM (purchased from Gibco, Catalog No. 10370021) medium containing 2% FBS (purchased from Gibco company, Catalog No. 16000044) to the same concentration as that for the drug treatment. The original medium in the 96-well plate was discarded, 100 .Math.L of the drug-containing MEM medium was taken and added to the cells, and three replicate wells were set for each concentration. A vehicle control (adding DMSO and medium to cells in wells, without adding drug) and a blank control (adding DMSO and medium to the wells, without cells) were set up. After the drug was added, the cells were incubated at 37° C. for 48 hours. [0080] ③ 20 .Math.L of CCK-8 solution (Beyotime) was added to the well to be tested, mixed gently without generating bubbles, and incubated subsequently at 37° C. for 2 hours. OD.sub.450 was read on a microplate reader (purchased from Molecular Devices, model: SpectraMax M5), and the reading was substituted into the following formula to calculate cell viability: Wherein, A was the reading of the microplate reader.

Experimental Results

[0081] The results of the virus proliferation inhibition experiment showed that the test compound chloroquine phosphate at concentrations of 50 .Math.M, 16.67 .Math.M, and 5.56 .Math.M could effectively inhibit the replication of SARS-CoV-2 virus genome in the infected supernatant.

[0082] The results of cytotoxicity test (see: FIG. 1) showed that the treatment of the test compound chloroquine phosphate did not change cell viability at all test concentrations, that was, the test compound had no toxic effect on cells at all concentrations.

[0083] According to calculations, the half-maximal effective concentration (EC.sub.50) of chloroquine phosphate was 1.13 .Math.M, the half-cytotoxic concentration (CC.sub.50) to cells was greater than 100 .Math.M, and the selectivity index (SI) was greater than 88.5. The results showed that chloroquine phosphate could effectively block SARS-CoV-2 virus infection at low micromolar concentrations, and showed a higher SI.

Example 2: Experiment on Chloroquine Phosphate and Hydroxychloroquine Reducing Viral Nucleic Acid Load in SARS-CoV-2 Infected Cells at 4 Multiplicities of Infections (MOIs)

Drug Treatment

[0084] Vero E6 cells were inoculated into a 24-well plate, cultured for 24 hours, and then subjected to virus infection. Four groups of different infection doses were set, which are MOI of 0.01, MOI of 0.02, MOI of 0.2 and MOI of 0.8, respectively. SARS-CoV-2 (2019-nCoV) viruses were diluted with 2% cell maintenance solution to the corresponding concentration, and then added to a 24-well plate so that the cell viral load in each well reached the set infection dose. Then, chloroquine phosphate and hydroxychloroquine were separately diluted with 2% cell maintenance solution to reach corresponding concentrations, and added to the corresponding wells so that the final concentrations of the drugs were 50 .Math.M, 16.67 .Math.M, 5.56 .Math.M, 1.85 .Math.M, 0.62 .Math.M, 0.21 .Math.M, 0.068 .Math.M, respectively, then they were placed in a 37° C., 5% CO.sub.2 incubator and cultured for 48 hours. To the cell control group, 2% cell maintenance solution without any test drugs was added.

RNA Extraction

[0085] RNA extraction was carried out by referring to the method as described in step (2) in Example 1.

RNA Reverse Transcription

[0086] RNA reverse transcription was carried out by referring to the method as described in step (3) in Example 1.

Real-Time PCR

[0087] With reference to the method as described in step (4) in Example 1, fluorescence quantitative PCR was used to detect the number of copies per milliliter of the original virus solution.

Cytotoxicity Test of Drugs

[0088] Cytotoxicity test of drugs to cells was carried out by referring to the method as described in step (5) in Example 1.

Experimental Results

[0089] The results of cytotoxicity test (see: A in FIG. 2) showed that the treatment of the test compounds did not change the cell viability at the test concentration of 100 .Math.M, that was, the test compounds had no toxic effect on the cells at this concentration. According to calculations, the CC.sub.50 of hydroxychloroquine was greater than 249.50 .Math.M, and the CC.sub.50 of chloroquine phosphate was greater than 273.20 .Math.M.

[0090] The results of the virus proliferation inhibition experiment showed that the test compounds can effectively inhibit the replication of SARS-CoV-2 viral genome in the infection supernatant at the MOI of 0.01, 0.02, 0.2 and 0.8 (see: B to E in FIG. 2). At different MOIs, the EC.sub.50 values of the test compounds were as follows:

TABLE-US-00003 MOI=0.01 Hydroxychloroquine: EC.sub.50=4.51 .Math.M; Chloroquine phosphate: EC.sub.50=2.71 .Math.M; MOI=0.02 Hydroxychloroquine: EC.sub.50=4.06 .Math.M; Chloroquine phosphate: EC.sub.50=3.81 .Math.M; MOI=0.2 Hydroxychloroquine: EC.sub.50=17.31 .Math.M; Chloroquine phosphate: EC.sub.50=7.14 .Math.M; MOI=0.8 Hydroxychloroquine: EC.sub.50=12.96 .Math.M; Chloroquine phosphate: EC.sub.50=7.36 .Math.M.

Example 3: Experiment on Mechanism of Chloroquine Phosphate and Hydroxychloroquine Inhibiting SARS-CoV-2 Virus Invasion

Experimental Method

[0091] 1) chloroquine phosphate or hydroxychloroquine was formulated with MEM medium containing 2% FBS to prepare 50 .Math.M of drug-containing culture solution, and then veroE6 cells were treated with the above-mentioned drug-containing culture solution for 1 hour; [0092] 2) the veroE6 cells were allowed to bind with SARS-CoV-2 virus for 1 h at 4° C. (at MOI of 10); [0093] 3) the veroE6 cells were washed twice with PBS (purchased from Gibco, Catalog No. C10010500BT) to remove unbound virus particles, freshly pre-warmed MEM culture medium containing 2% FBS was added, and then the veroE6 cells were incubated at 37° C. for 90 min; [0094] 4) the cells were fixed, and the immunofluorescence staining of cells was performed by using anti-virus NP protein antibody (red) (preserved by Wuhan Institute of Virology, Chinese Academy of Sciences) and anti-early endosomal protein EEA antibody (green) (purchased from Cell Signaling Technology, Catalog No. 48453) or anti-lysosomal protein LAMP antibody (green) (purchased from Cell Signaling Technology company, Catalog No. 3243); the nuclei were stained with Hoechst (blue) (purchased from Invitrogen company, Catalog No. H21492); [0095] 5) quantitative analysis of co-localization of virus particles and endosomes of the cells in each group was performed, and co-localization rate was calculated.

Experimental Results

[0096] The results of immunofluorescence analysis (IFA) and confocal micrograph analysis (see: FIG. 3) showed that after treatment with chloroquine phosphate or hydroxychloroquine, the co-localization rate of virus particles and early endosomes (EES) increased significantly (the co-localization rate of chloroquine phosphate was 35.3%; the co-localization rate of hydroxychloroquine was 29.2%; P<0.001), and the co-localization rate of virus particles and endolysosomes (ELs) was significantly reduced (the co-localization rate of chloroquine phosphate was 2.4%; the co-localization rate of hydroxychloroquine was 0.03%; P<0.001), indicating that chloroquine phosphate or hydroxychloroquine inhibited viral infection by blocking the transport process of SARS-CoV-2 virus from early endosome to lysosome.

[0097] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application rather than to limit them; although the present application has been described in detail with reference to the preferred examples, those of ordinary skill in the art should understand that the specific implementation of the present application may be modified or some technical features may be equivalently replaced without departing from the spirit of the technical solutions of the present application, and all of them shall be covered by the scope of the technical solution sought to be protected by the present application.