Pharmaceutical composition for preventing or treating inflammatory diseases including <i>Toxoplasma gondii </i>GRA9 protein or gene encoding the protein as active ingredient
11939360 ยท 2024-03-26
Assignee
Inventors
Cpc classification
A23L33/40
HUMAN NECESSITIES
A61P37/06
HUMAN NECESSITIES
A23V2002/00
HUMAN NECESSITIES
International classification
A23L33/00
HUMAN NECESSITIES
A61P37/06
HUMAN NECESSITIES
Abstract
The present invention relates to a pharmaceutical composition and a health functional food composition for preventing, alleviating or treating inflammatory diseases, including Toxoplasma gondii GRA9 protein or a gene encoding the protein as an active ingredient. The present inventors have identified the C-terminal region essential for the NLRP3-mediated mechanism of action and function of Toxoplasma gondii GRA9 in macrophages, which are host immune cells and confirmed the substantial anti-inflammatory and antibacterial effects and the antiseptic effect in vivo. Accordingly, Toxoplasma gondii GRA9 protein or a gene encoding the protein is expected to be usefully utilized in the field of prevention or treatment of inflammatory diseases caused by an abnormal NLRP3-mediated inflammatory response, including sepsis.
Claims
1. A method for treating an inflammatory disease, the method comprising a step of administering to an individual a composition including Toxoplasma gondii GRA9 protein as an active ingredient.
2. The method of claim 1, wherein the inflammatory disease is sepsis.
3. The method of claim 1, wherein the GRA9 protein is a C-terminal region corresponding to positions 195 to 288 in an amino acid sequence of the GRA9 protein represented by SEQ ID NO: 1.
4. The method of claim 1, wherein the GRAS protein inhibits formation of NLRP3 (NLR family pyrin domain containing 3) inflammasome by interacting with NLRP3 in mitochondria of macrophages.
5. The method of claim 1, wherein the composition reduces NLRP3-mediated inflammation.
6. The method of claim 1, wherein the composition enhances an anti-inflammatory and antibacterial effect through an increase in polarization and phagocytosis to M2 macrophages.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) These and/or other aspects, features, and advantages of the invention will become apparent and more readily appreciated from the following description of example embodiments, taken in conjunction with the accompanying drawings of which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
DETAILED DESCRIPTION
(9) The present invention relates to the use of Toxoplasma gondii-derived GRA9 for the prevention or treatment of inflammatory diseases, confirms the anti-inflammatory and antibacterial effects of GRA9 and specifically the antiseptic effect, and elucidates the NLRP3-mediated mechanism of GRA9 in macrophages, which are host immune cells to complete the present invention.
(10) Accordingly, the present invention provides a pharmaceutical composition for preventing or treating inflammatory diseases, the composition including the Toxoplasma gondii (T. gondii) GRA9 protein or a gene encoding the protein as an active ingredient.
(11) As used herein, the term prevention refers to any action that suppresses or delays the onset of an inflammatory disease by administration of the pharmaceutical composition according to the present invention.
(12) As used herein, the term treatment refers to any action in which symptoms for inflammatory diseases are alleviated or beneficially changed by administration of the pharmaceutical composition according to the present invention.
(13) The present inventors identified the mechanism of action that Toxoplasma gondii GRA9 inhibits the binding of NLRP3 and ASC in the mitochondria of macrophages in the host and interacts with NLRP3 to inhibit NLRP3 inflammasome formation and inflammatory response in the host through specific examples and confirmed that anti-inflammatory and antibacterial effects were improved through the polarization of phagocytes from M1 to M2, and further confirmed the antiseptic effect in CLP and bacterial sepsis in vivo models.
(14) An inflammatory disease, which is a disease targeted by the present invention, is a disease whose main lesion is inflammation and may be induced by causes such as infection, allergy/hypersensitivity reaction, autoimmunity, or damage/exposure to harmful substances. In the present invention, the inflammatory disease preferably means an inflammatory disease in which NLRP3 is a major mediator of the inflammatory response, more preferably sepsis, but is not limited thereto.
(15) Sepsis refers to a systemic inflammatory reaction syndrome caused when blood is infected with bacteria invading the human body and the infected subject may die within a short time. There are a wide variety of causative bacteria including Streptococci, Staphylococcus, Escherichia coli, Pneumococcus, Pseudomonas aeruginosa, and fungi. It can be infected by introducing the causative bacteria of purulent diseases in the human body into the blood, and can also be infected through food intake, such as Vibrio sepsis. Even if blood is not directly infected with bacteria, symptoms may appear due to inflammatory substances from an infectious source in one part of the body. It is known that although NLRP3 inflammasome induces an inflammatory response essential to protect the human body from external microorganisms, excessive activation can cause organ damage and, in severe cases, cause sepsis, an excessive systemic immune-inflammatory response.
(16) In the present invention, the Toxoplasma gondii GRA9 protein may include or consist of the amino acid sequence represented by SEQ ID NO: 1, and the gene encoding the protein may include or consist of the nucleotide sequence represented by SEQ ID NO: 2. At this time, it may include an amino acid sequence and a nucleotide sequence having 70% or more, preferably 80% or more, more preferably 90% or more, most preferably 95% or more sequence homology with the amino acid sequence represented by SEQ ID NO: 1 and the nucleotide sequence represented by SEQ ID NO: 2.
(17) In the present invention, the GRA9 protein may preferably be or include a C-terminal region corresponding to positions 195 to 288 in the amino acid sequence represented by SEQ ID NO: 1, in which it may necessarily include glutamine (Q) at position 200 in the C-terminal region.
(18) The pharmaceutical composition according to the present invention includes a GRA9 protein or a gene encoding the protein as an active ingredient and may further include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier is commonly used in formulation and includes, but is not limited to, saline, sterile water, Ringer's solution, buffered saline, cyclodextrin, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome, and the like. If necessary, it may further include other conventional additives such as antioxidants and buffers. In addition, it may be further added with a diluent, dispersant, surfactant, binder, lubricant, etc. to be formulated into an injectable formulation such as an aqueous solution, suspension, emulsion, etc., pills, capsules, granules or tablets. Regarding suitable pharmaceutically acceptable carriers and formulations, formulations may be preferably made according to each component using the method disclosed in Remington's literature. The pharmaceutical composition of the present invention is not particularly limited in formulation, but may be formulated as an injection, inhalant, or external preparation for the skin.
(19) The pharmaceutical composition of the present invention may be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally or topically) according to a desired method, but preferably may be administered orally. The dosage varies depending on the patient's condition and weight, the degree of disease, drug form, administration route and time, but it may be appropriately selected by those skilled in the art.
(20) The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, pharmaceutically effective amount means an amount sufficient to treat or diagnose a disease at a reasonable benefit/risk ratio applicable to medical treatment or diagnosis, and the effective dose level may be determined by factors including the patient's disease type, severity, and drug activity, sensitivity to drugs, administration time, administration route and excretion rate, treatment period, concurrent drugs, and other factors well known in the medical field. The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or may be administered in combination with other therapeutic agents. It may be administered sequentially or simultaneously with conventional therapeutic agents and may be administered single or multiple. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.
(21) In particular, the effective amount of the pharmaceutical composition of the present invention may vary depending on the patient's age, sex, condition, weight, absorption of the active ingredient into the body, inactivation rate and excretion rate, disease type, and drugs used in combination, generally 0.001 to 150 mg, preferably 0.01 to 100 mg per 1 kg of body weight daily or every other day, or divided into 1 to 3 times a day. However, since the dosage may be increased or decreased according to the administration route, the severity of obesity, sex, weight, age, etc., the dosage is not intended to limit the scope of the present invention in any manner.
(22) As another aspect of the present invention, the present invention provides a health functional food composition for preventing or alleviating inflammatory diseases, the composition including the Toxoplasma gondii (T. gondii) GRA9 protein or a gene encoding the protein as an active ingredient.
(23) As used herein, the term alleviation refers to any action that at least reduces a parameter related to the condition being treated, for example, the severity of symptoms. In this case, the health functional food composition may be used simultaneously with or independently from a drug for treatment before or after the onset of the disease in order to prevent or alleviate an inflammatory disease.
(24) As used herein, the term health functional food composition is formulated into one selected from the group consisting of tablets, pills, grains, granules, powders, capsules and liquid formulations by including one or more of carriers, diluents, excipients and additives. Foods that may be added to the extract of the present invention include various foods, powders, granules, tablets, capsules, syrups, beverages, gums, tea, vitamin complexes, and health functional foods. Additives that may be further included in the present invention may include at least one component selected from the group consisting of natural carbohydrates, flavoring agents, nutrients, vitamins, minerals (electrolytes), flavoring agents (synthetic flavoring agents, natural flavoring agents, etc.), coloring agents, fillers, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, antioxidants, glycerin, alcohols, carbonation agents and pulp. Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; and polysaccharides such as conventional sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the flavoring agent, natural flavoring agents (Thaumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) may be advantageously used. In addition, the composition according to the present invention may include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, antioxidants, glycerin, alcohols, carbonation agents used for carbonated drink. In addition, the composition according to the present invention may contain pulp for the production of natural fruit juices and vegetable beverages. These components may be used independently or in combination. Specific examples of the carrier, excipient, diluent and additive include, but are not limited to, preferably at least one selected from the group consisting of lactose, dextrose, sucrose, sorbitol, mannitol, erythritol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, methylcellulose, water, sugar syrup, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
(25) Hereinafter, preferred examples are provided to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.
EXAMPLE
Example 1. Experimental Materials and Methods
(26) 1-1. Mice and Cell Culture
(27) The wild-type C57BL/6 mice used in Examples of the present invention were purchased from Samtako Bio Korea (Gyeonggi-do, Korea). Primary bone marrow-derived macrophages (BMDM) isolated from 6-week-old C57BL/6 mice were cultured in DMEM in the presence of M-CSF (R & D Systems, 416-ML) for 3 to 5 days according to a known method. HEK293T (ATCC-11268; American Type Culture Collection) or THP-1 (ATCC-TIB-202) cells were cultured in RPMI1640 (Gibco) or DMEM containing 10% FBS (Gibco, NY, USA), sodium pyruvate, non-essential amino acids, penicillin G (100 IU/ml) and streptomycin (100 ?g/ml). In addition, transient transfection was performed in 293T cells using calcium phosphate (Clontech, Mountain View, CA, USA) according to the manufacturer's protocol, and the THP-1 stable cell line was transfected with Lipofectamine 3000 (Invitrogen, Waltham, MA, USA), followed by a standard selection protocol using 400 to 800 ?g/ml of G418.
(28) 1-2. Recombinant Protein
(29) In order to obtain recombinant GRA9 (GenBank Accession No. XP 002367395.1) protein derived from T. gondii ME49 strain, GRA9C amino acid residues (195-288) and GRA9C.sup.Q200L with an N-terminal 6? His tag were cloned into combined with pRSFDuet-1 vector (Novagen, NJ, USA). Then, the expression of the protein was induced from E. coli expression strain BL21(DE3) pLysS according to the standard protocol recommended by the manufacturer, followed by recovery and purification. Next, the purified rGRA9 recombinant protein was dialyzed against a permeable cellulose membrane, and a test of lipopolysaccharide (LPS) contamination was performed by Limulus amebocyte lysate assay (BioWhittaker). It was confirmed that the rGRA9 and mutant proteins used in this Example were contained at a concentration of 20 pg/ml or less.
(30) 1-3. Reagents and Antibodies
(31) LPS (L3024), ATP (A1852), nigericin (N7143) and DSS (D8906) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Specific antibodies against Flag (D-8), GST (B-14), V5 (E10), NLRP3 (H-66), ASC (N-15), TXNIP (D-2), Tubulin (5F131), Calnexin (AF18), FACL4 (N-18), caspase-1 (14F468, M-20) and Actin (I-19) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Specific antibodies against Calreticulin (D3E6) and IL-18 (D2F3B) were purchased from Cell Signaling Technology (Danvers, MA, USA). IL-1? (AF-401-NA) was purchased from R&D Systems, and NLRP3 (AG-20B-0014) was purchased from Adipogen (San Diego, CA, USA). Antibodies against COX IV (ab16056) and AU1 (ab3401) were also purchased from Abcam (Cambridge, UK).
(32) 1-4. Plasmid Construction
(33) The known plasmids encoding the full-length NLRP3, ASC, and NLRP3 mutations were used. Further, plasmids encoding other regions of GRA9 (1-318, 18-171, 195-288, Q200L) were prepared by PCR amplification from the full-length GRA9 cDNA, followed by subcloning between BamHI and NotI restriction enzyme sites of the pEBG derivative encoding the N-terminal GST epitope tag. Transient and stable expression of all constructs in mammalian cells was achieved via the pEBG-GST mammalian fusion vector and the pEF-IRES-Puro expression vector. All constructs were sequenced using an ABI PRISM 377 automated DNA sequencer (Thermofisher, Waltham, MA, USA) to verify that they were 100% identical to the original sequence.
(34) 1-5. Enzyme-Linked Immunosorbent Assay
(35) In order to detect TNF-?, IL-6, IL-1?, IL-18, IL-12p40, IL-10 and TGF-?, cytokine content was analyzed in cell culture and mouse serum using the BD OptEIA ELISA set (BD Pharmingen) according to the manufacturer's recommended protocol.
(36) 1-6. Sepsis Induced by CLP and Bacterial Count
(37) Cecal ligation and puncture (CLP) was attempted using a 6-week-old C57BL/6 female mouse according to a known method. For this purpose, the mice were anesthetized with pentothal sodium (50 mg/kg, i.p.), and then the cecum was exposed through a small incision in the middle of the abdomen. The cecum was connected under the serosal septum, and the abdomen was closed by puncturing it twice through both sides using a 22 gauge needle. Thereafter, the survival rate was monitored daily for 10 days. Further, mice were intraperitoneally injected with PBS, analgesic (1.5 mg/kg nalbuphine; Sigma-Aldrich), and an antibiotic cocktail containing ceftriaxone (25 mg/kg; Sigma-Aldrich) and metronidazole (12.5 mg/kg; Sigma-Aldrich) in 100 ?l PBS at 12 and 24 hours after initiation of CLP to resuscitate the mice. For experiments to isolate blood and organ samples, mice with exposed cecum but not ligated or perforated were used and marked with sham at the time of surgery.
(38) Meanwhile, in order to measure the number of bacteria, blood was collected via cardiac puncture or peritoneal lavage from mice at designated times after CLP. After serial dilution of blood, 5 ?l of each dilution was plated on a blood agar plate. After culturing at 37? C. for 24 hours, the number of bacteria was counted by counting the number of colony forming units per blood or total peritoneal lavage.
(39) All animals were raised in a pathogen-free environment. All animal experiments were conducted after being reviewed and approved by the Animal Experimental Ethics Committee (protocol 2018-0086) of Hanyang University. Post-CLP analgesia, fluid support, and antibiotics were followed by international guidelines defined as minimum quality thresholds in preclinical sepsis studies for the sepsis mouse model to improve the model's mediation relevance.
(40) 1-7. GST Pulldown, Immunoblotting and Immunoprecipitation Analysis
(41) For GST pulldown, cells were harvested and lysed in NP-40 buffer supplemented with a complete protease inhibitor cocktail (Roche). After centrifugation, the supernatant was first removed with protein A/G beads at 4? C. for 2 hours. The previously removed lysate was mixed with a 50% slurry of glutathione-conjugated Sepharose beads (Amersham Biosciences) and cultured at 4? C. for 4 hours to induce a binding reaction. The precipitate was extensively washed with lysis buffer, and the protein bound to glutathione beads was boiled for 5 minutes and eluted with SDS loading buffer.
(42) For immunoprecipitation, cells were harvested and then lysed in NP-40 buffer supplemented with a complete protease inhibitor cocktail (Roche). The supernatant was first removed with protein A/G agarose beads at 4? C. for 2 hours, and then whole cell lysates were used to perform immunoprecipitation with the indicated antibodies. In general, 1-4 ?g of commercial antibody was added to 1 ml of cell lysate, and the mixture was cultured at 4? C. for 8 to 12 hours. Next, protein A/G agarose beads were added for 6 hours, and the immunoprecipitates were washed extensively with lysis buffer and then boiled for 5 minutes and eluted with SDS loading buffer.
(43) For immunoblotting, polypeptides were separated by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to PVDF membrane (Bio-Rad). Immunodetection was performed with an antibody specific for each protein, and antibody binding was visualized by chemiluminescence (ECL; Millipore) and detected by a Vilber chemiluminescence analyzer (Fusion SL 3; Vilber Lourmat).
(44) 1-8. Histological Analysis
(45) For immunohistochemistry of tissue sections, spleen, liver and lungs of mice were fixed in 10% formalin and embedded in paraffin. Then, paraffin sections were cut to a thickness of 4 and stained with hematoxylin and eosin (H&E). The histopathological score was set based on the number and distribution of inflammatory cells and the degree of inflammation in the tissue. Each organ compartment was scored independently by a professional pathologist without prior information about the treatment group, and each specimen was assigned a histological score ranging from 0 to 4.
(46) 1-9. Protein Purification and Mass Spectrometry
(47) In order to identify GRAS binding proteins, THP-1 cells expressing Flag-GRAS or vector were harvested and dissolved with NP-40 buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% (v/v) NP40) supplemented with a complete protease inhibitor cocktail. After centrifugation, the supernatant was first removed with protein A/G beads at 4? C. for 2 hours, and the previously removed lysate was mixed with agarose beads conjugated with ?Flag antibody at 4? C. for 4 hours. The precipitate was then extensively washed with lysis buffer. The protein bound to the beads was eluted and separated on a Nupage 4-12% Bis-Tris gradient gel (Invitrogen). Next, after silver staining (Invitrogen), a specific protein band was cut out and analyzed by ion-trap mass spectrometry at the mass spectrometry facility at the Korea Institute of Basic Science (Seoul), and tandem mass spectrometry and database search were performed. Amino acid sequences were determined through tandem mass spectrometry and database searches.
(48) 1-10. Quantitative Real-Time PCR
(49) Total RNA was extracted from cells using RNeasy RNA extraction Mini-Kit (Qiagen), and cDNA was synthesized using Enzynomics kit (Enzynomics). Quantitative PCR was performed using a gene-specific primer set (Bioneer) and SYBR Green PCR Master Mix (Roche), and real-time PCR was performed using QuantStudio?3 (ABI) according to the manufacturer's protocol. The data were corrected for the expression level of ?-actin, and the relative expression level of mRNA was calculated using the delta-delta Ct method. Sequence information of primers specific for each gene used in this PCR is shown in Table 1 below.
(50) TABLE-US-00001 TABLE 1 Gene Diresction Sequence (5-3) SEQ ID No. mCD86 Forward gcacgtctaagcaaggtcac 3 Reverse catatgccacacaccatccg 4 miNOS Forward ccccgctactactccatcag 5 Reverse ccactgacacttcgcacaaa 6 mCD163 Forward tgtgaccatgctgaggatgt 7 Reverse ctcgaccaatggcactgatg 8 mArg1 Forward ctgagctttgatgtcgacgg 9 Reverse tcctctgctgtcttcccaag 10 m?-Actin Forward aagtgtgacgttgacatc 11 Reverse gatccacatctgctggaagg 12
(51) 1-11. Confocal Fluorescence Microscopy
(52) Immunofluorescence analysis was performed according to a known method. Specifically, cells were fixed on coverslips with 4% (w/v) paraformaldehyde diluted in PBS, and then permeabilized for 10 minutes using 0.25% (v/v) Triton X-100 at 25? C. Thereafter, the cells were treated with the primary antibody that specifically binds to TRAF6 or His, which was diluted 1/100, reacted at 25? C. for 1 hour, and washed. The cells were treated with an appropriate fluorescently-labeled secondary antibody, and then reacted at 25? C. for 1 hour. Then, the slides were observed with a laser scanning confocal microscope (model LSM 800; Zeiss).
(53) 1-12. Cell Fraction
(54) Cytoplasm and mitochondria were isolated from cells using a mitochondrial fractionation kit (Active Motif, 40015) or according to a known method. Next, the intracellular protein fraction was dissolved in a buffer containing 2% SDS. 2? reducing sample buffer was added and the mixture was boiled, and SDS-PAGE was performed.
(55) 1-13. MTT Assay
(56) Relative cell viability for the non-treated group was measured via MTT assay. More specifically, after culturing the cells for a set time period, a 5 mg/ml of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) solution was added instead of the medium, and the cells were further cultured for 4 hours. Thereafter, all the medium was removed, and formazan was dissolved by adding an equal volume of dimethyl sulfoxide (DMSO) solution for 15 minutes. Each well of the plate was measured at an absorbance of 540 nm using a UV/VIS spectrophotometer to measure the relative cell viability.
(57) 1-14. Flow Cytometry
(58) Flow cytometry data were obtained via FACSCanto (BD Biosciences, San Diego, CA) and analyzed with FlowJo software (Tree Star, Ashland, OR). In order to check the expression of cell surface proteins, the cells were treated with the corresponding primary antibody and cultured at 4? C. for 20 to 30 minutes. Then the cells were fixed using Cytofix/Cytoperm Solution (BD Biosciences), some of which were cultured with antibodies so as to detect intracellular proteins. The primary antibodies used for this flow cytometry are as follows: NK1.1 (PK136, eBioscience), LY6G (1A8-Ly6g eBioscience), SR-A (PSL204, eBioscience), FcR (MAR-1, eBioscience), TLR2 (6C2, eBioscience), TLR4 (HTA125, eBioscience), NRP1 (3DS304M, eBioscience), and CXCR2 (eBio5E8-C7-F10 (5E8-C7-F10), eBioscience).
(59) 1-15. Statistical Analysis
(60) All data were analyzed using Student's t-test with Bonferroni adjustment for multiple comparisons and expressed as mean?SD. Statistical analyzes were performed using the SPSS (version 12.0) statistical software program (SPSS, Chicago, IL, USA). Differences were considered statistically significant at p<0.05. For viability, the log-rank (Mantele-Cox) test for comparison using GraphPad Prism (version 5.0, La Jolla, CA, USA) was used to graph and analyze the data with the product restriction method of Kaplan and Meier.
Example 2. Confirmation of Interaction Between GRA9 and NLRP3
(61) In order to confirm the function of Toxoplasma gondii (T. gondii) GRA9 in the host immune response of macrophages, the present inventors investigated whether GRA9 interacts with components related to inflammation. To this end, the GRA9 complex was co-immunoprecipitated with a vector or THP-1 cells containing Flag-GRA9.
(62) As a result, it was confirmed that the immunoprecipitated and purified GRA9 complex included NLRP3 (118K) and metallothionein 2A (metallothionein 2A; MT2A, 6K) through mass spectrometry as shown in
(63) Therefore, in order to investigate the correlation between NLRP3 and GRA9, the present inventors stimulated THP-1 cells through LPS treatment and activated them by treatment with ATP or nigericin, and then THP-1 cells that do not express GRA9 (THP-1-Vector) and THP-1 cells expressing GRA9 (THP-1-GRA9), respectively, were co-immunoprecipitated.
(64) As a result, as shown in
Example 3. Inhibition of NLRP3 Inflammasome Formation by Blocking Binding of ASC and Confirmation of Interaction Between GRA9 and NLRP3 in Mitochondria
(65) Mitochondria are organelles involved in the induction of recruitment of NLRP3 to construct the NLRP3 inflammasome in the mitochondria-related membrane (MAM) through the generation of mitochondrial reactive oxygen species. The present inventors confirmed that GRA9 is the binding partner of NLRP3, and thus they investigated the binding site in macrophages.
(66) To this end, THP-1 cells were stimulated with LPS, activated by treatment with ATP, and then intracellular fractionation of organelles was performed. As a result, as shown in
(67) Furthermore, in order to confirm whether GRA9 interacts with NLRP3 in mitochondria, NLRP3 was immunoprecipitated from the cytoplasmic or mitochondrial fraction of the vector or GRA9-expressing THP-1 cells. As a result, as shown in
(68) In order to verify the results in
(69) These results indicate that GRA9 acts as a binding partner of NLRP3 while competitively inhibiting the binding of ASC to NLRP3 in mitochondria.
Example 4. Confirmation of Inhibition of GRA9's C-Terminal Mediated NLRP3 Inflammasome Activation
(70) The present inventors investigated a more specific interaction domain between GRA9 and NLRP3 in macrophages from the results confirmed in Example 3, and for this purpose, a method of immunoprecipitating wild-type or mutant GRA9 and NLRP3 was used.
(71) As shown in
(72) The formation of NLRP3 inflammasomes with ASC and pro-caspase 1 is induced with activation of immune responses in host cells. Caspase 1 is a truncated form of pro-caspase 1, which is known to be important for the cleavage of IL-1? and IL-18 secreted from macrophages. Accordingly, the present inventors performed immunoblotting to investigate the specific role of GRA9 in macrophages and measured the expression level of cytokines related to inflammation.
(73) First, THP-1 cells expressing the vector, the C-terminus of GRA9 (GRA9C), and the C-terminus of GRA9 (GRA9C.sup.Q200L) containing the Q200L mutation, respectively, were stimulated with LPS and activated by treatment with ATP or DSS, respectively. After cell culture, immunoblotting was performed using cell culture supernatant (SN) and whole cell lysate (WCL) to compare and analyze the cleavage and secretion patterns of caspase 1, IL-1? and IL-18 proteins. As shown in
(74) Next, as a result of measuring the expression levels of cytokines IL-1?, IL-18, TNF-?, IL-6 and IL-12, which are cytokines related to inflammation in each THP-1 cell identical to the above, interestingly, as shown in
(75) Combining the above results, it can be seen that GRAS, particularly the C-terminus containing the Q200 residue, is essential for interaction with NLRP3 and inhibits the formation of NLRP3 inflammasome to reduce the inflammatory response induced by NLRP3.
Example 5. Confirmation of NLRP3-Mediated Inflammation Reduction Through Interaction of rGRA9C with NLRP3
(76) The present inventors confirmed the function of GRA9C identified in the above examples under physiological conditions. For this, rGRA9C or rGRA9C.sup.Q200L protein bound to His tag purified from bacteria was prepared. As shown in
(77) Therefore, the present inventors first treated the BMDMs with rGRA9C and observed the location of the rGRA9C protein through confocal microscopy images. As shown in
(78) As shown in
(79) Combining the above results, it can be seen that rGRA9C reduces NLRP3-mediated inflammation through interaction with NLRP3 in macrophages.
Example 6. Confirmation of Improvement of Anti-Inflammatory and Antibacterial Effect Through Polarization from M1 to M2 by rGRA9C
(80) Macrophages are essential for the innate immune response and play important roles including phagocytosis, inflammatory activation and wound healing. In order to find the effect of GRA9C related to macrophage function, the present inventors treated LPS-treated BMDMs with rVehicle, rGRA9C or rGRA9C.sup.Q200L at various concentrations and then measured the levels of inflammatory and anti-inflammatory cytokines through ELISA. As shown in
(81) Based on the above results, the present inventors investigated whether rGRA9C is related to macrophage polarization based on the fact that the role of macrophages is differentiated depending on M1 or M2 polarization. To this end, BMDMs were treated with PBS, Vector, GRA9C, and GRA9C.sup.Q200L, respectively, and then the relative expression levels of M1 markers (CD86 and iNOS) and M2 markers (CD163 and Arg1) were measured and analyzed. As shown in
(82) In addition, the present inventors investigated whether GRA9C mediates antibacterial effects in macrophages upon bacterial infection. As shown in
(83) The above results show that rGRA9C not only regulates the activation of NLRP3 inflammasome through interaction with NLRP3 but also regulates the function of macrophages. In conclusion, it was found that rGRA9C increases M2 polarization and phagocytosis, thereby increasing the anti-inflammatory and antibacterial effects of macrophages.
Example 7. Confirmation of Protective Effect of rGRA9C in CLP and Bacterial-Infected Sepsis Mice
(84) The present inventors investigated whether rGRA9C could protect mice from septic shock due to multiple microbial peritonitis, which induces systemic inflammatory response syndrome and is usually fatal in humans, using either cecal ligation and puncture (CLP) or bacterial infection models of multiple microbial infections.
(85) 7-1. Validation of Effect of rGRA9C in CLP Sepsis Mice
(86) First, the protective effect of rGRA9C and mutants on death due to CLP septic shock in mice was tested. Specifically, a sepsis model through CLP was prepared, and PBS, Vehicle, rGRA9C or rGRA9C.sup.Q200L was intraperitoneally administered to the mouse model as shown in
(87) As a result, in the case of rGRA9C-administered mice (CLP+GRA9C), compared to the control group, the survival rate was proportionally increased at all administration concentrations (0.1, 1 and 10 mg/kg), thereby showing that it protects the mice from CLP-induced septic shock. However, in the case of GRA9C.sup.Q200L-administered mice (CLP+GRA9C.sup.Q200L, 10 mg/kg), this protective effect did not appear. Further, as a result of measuring the cytokine levels in the serum in each mouse group, as shown in
(88) In addition to the above results, as shown in
(89) Additionally, the present inventors evaluated whether GRA9C was specifically associated with macrophages only or with other immune cells. As a result, interestingly, the number of macrophages was significantly increased in CLP sepsis mice administered with rGRA9C, but there was no significant difference in other immune cells. In addition, as shown in
(90) 7-2. Validation of Effect of rGRA9C in Bacterial Sepsis Mice
(91) In order to evaluate the effect of GRA9C in bacterial sepsis, the present inventors intravenously or intraperitoneally infected mice with E. coli or P. aeruginosa, respectively, and administered rGRA9C or a mutant thereof according to the method shown in
(92) Summarizing the above results, it can be seen that rGRA9C increases anti-inflammatory and antibacterial effects by interacting with NLRP3 in CLP-induced sepsis and bacterial sepsis model mice.
(93) It may be easily understood by those of ordinary skill in the art to which the present invention pertains that the description of the present invention is for illustration, and it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. Therefore, it should be understood that the embodiments described above are illustrative and not restrictive in all respects.