TOMATO PLANT HAVING IMPROVED INSECT RESISTANCE

Abstract

The present invention relates to a tomato plant having improved insect resistance, more specifically whitefly or mite resistance, wherein the plant comprises a SlAT2 gene encoding for an acetyl-CoA-dependent acyltransferase enzyme and an AP2e gene encoding for a APETALA2 ethylene-responsive transcription factor. The present invention further relates to methods for providing a tomato plant having improved insect resistance and the use of a SlAT2 gene in combination with an AP2e gene for providing insect resistant tomato plants.

Claims

1. A tomato plant having improved whitefly resistance, wherein said plant comprises a combination of an acetyl-CoA-dependent acyltransferase gene (SlAT2) encoding a cDNA sequence having at least 95% sequence identity with SEQ ID No. 2, and an APETALA2e ethylene-responsive transcription factor gene (AP2e) encoding a cDNA sequence having at least 95% sequence identity with SEQ ID No. 5, wherein said combination of SlAT2 and AP2e genes result in an increased C.sub.29H.sub.48O.sub.15 and C.sub.36H.sub.62O.sub.15 acyl sugar content as compared to a tomato plant not comprising said combination of genes.

2. The tomato plant according to claim 1, wherein said tomato plant comprises tetra-acyl (S4) sugar and tri-acyl (S3) sugars, wherein a ratio between tetra-acyl (S4) sugars and tri-acyl (S3) sugars (S4:S3) in the tomato plant is at least 1.

3. The tomato plant according to claim 1, wherein the genomic region encoding the SlAT2 gene comprises SEQ ID No. 1 and wherein the genomic region encoding the AP2e gene comprises SEQ ID No. 4.

4. The tomato plant according to claim 1, wherein the SlAT2 gene encodes for the protein sequence represented by SEQ ID No. 3, and wherein the AP2e gene encodes for the protein sequence represented by SEQ ID No. 6.

5. The tomato plant according to claim 1, wherein the acyl sugar content of C.sub.29H.sub.48O.sub.15 is at least 150 ?g/g of fresh weight (FW) of plant leaves, and/or wherein the acyl sugar content of C.sub.36H.sub.62O.sub.15 is at least 125 ?g/g of FW of plant leaves.

6. The tomato plant according to claim 1, wherein the plant furthermore has an increased acyl sugar content of one or more selected from the group consisting of C.sub.28H.sub.46O.sub.15, C.sub.34H.sub.58O.sub.15 and C.sub.35H.sub.60O.sub.15 as compared to a tomato plant not comprising said combination of genes.

7. The tomato plant according to claim 1, wherein the acyl sugar content of C.sub.28H.sub.46O.sub.15 is at least 10 ?g/g of FW of plant leaves and/or wherein the acyl sugar content of C.sub.34H.sub.58O.sub.15 is at least 15 ?g/g of FW of plant leaves, and/or wherein the acyl sugar content of C.sub.35H.sub.60O.sub.15 is at least 12.5 ?g/g of FW of plant leaves.

8. The tomato plant according to claim 1, wherein the plant is obtainable from deposit NCIMB 43748.

9. The tomato plant according to claim 1, wherein the plant is furthermore resistant to mites.

10. A seed, a fruit, or a plant part of the tomato plant according to claim 1.

11. A method for providing a tomato plant having improved whitefly resistance comprising the steps of: providing a whitefly susceptible tomato plant; and mutating its genome by introducing therein a combination of an acetyl-CoA-dependent acyltransferase gene (SlAT2) encoding a cDNA sequence-having at least 95% sequence identity with SEQ ID No. 2, and an APETALA2e ethylene-responsive transcription factor gene (AP2e) encoding a cDNA sequence having at least 95% sequence identity with SEQ ID No. 5, wherein said combination of SlAT2 and AP2e genes result in an increased C.sub.29H.sub.48O.sub.15 and C.sub.36H.sub.62O.sub.15 acyl sugar content as compared to a tomato plant not comprising said combination of genes.

12. A method for providing a tomato plant having improved whitefly resistance, wherein the method comprises the steps of: a) crossing a tomato plant that is susceptible to whitefly with the tomato plant according to claim 1; and b) selecting S. lycopersicum plants having improved insect resistance that comprise the SlAT2 gene and AP2e gene.

13. The method according to claim 12, wherein the selection of S. lycopersicum plants having improved insect resistance is by determination of C.sub.29H.sub.48O.sub.15 and/or C.sub.36H.sub.62O.sub.15 acyl sugar content, wherein the acyl sugar content of C.sub.29H.sub.48O.sub.15 is at least 150 ?g/g of fresh weight (FW) of plant leaves and/or wherein the acyl sugar content of C.sub.36H.sub.62O.sub.15 is at least 125 ?g/g of fresh weight (FW) of plant leaves.

14. A combination of two genomic regions for providing insect resistance in tomato plants, wherein one genomic region comprising SEQ ID No. 1 that encodes an acetyl-CoA-dependent acyltransferase gene (SlAT2) and a second genomic region comprising SEQ ID No. 4 that encodes an APETALA2e ethylene-responsive transcription factor gene (AP2e).

15. A combination of two genes for providing insect resistance in tomato plants, wherein one gene encodes an acetyl-CoA-dependent acyltransferase (SlAT2) protein comprising SEQ ID No. 3 and a second gene that encodes an APETALA2e ethylene-responsive transcription factor (AP2e) comprising SEQ ID No. 6.

16. (canceled)

17. The tomato plant according to claim 1, wherein a ratio between tetra-acyl (S4) sugars and tri-acyl (S3) sugars (S4:S3) in the tomato plant is at least 1.7.

18. The tomato plant according to claim 1, wherein the tomato plant is furthermore resistant to spider mites.

Description

[0034] The present invention will be further detailed in the following examples and figures wherein:

[0035] FIG. 1: Shows the leaves of a tomato plant (S. lycopersicum) according to present invention (A and B) and an insect susceptible tomato plant (S. lycopersicum) (C and D). Both tomato plants have been exposed to a whitefly infestation in a commercial greenhouse where a whiteflies infestation was promoted. The leaves of the plants of present invention are free from whitefly infestation, whereas the leaves of the insect susceptible tomato plant are clearly infected by whitefly. Figure E shows the leaves of the insect susceptible tomato plant (S) and of the tomato plant according to present invention (R); it is clear that the whitefly are alive and on the leaf surface of the S plant, whereas on the R plant the whiteflies are dead and absent on the leave surface.

[0036] FIG. 2: Shows the ratio of dead whiteflies (WF) in against increasing concentrations of acyl sugar in a tomato plant. The graph 2A shows that there is a linear relationship between the number of dead whiteflies and the concentration of acyl sugar C36H62O15. The graph 2B shows the dose response of C29H48O15 acyl sugar. Both specific acyl sugars show to negatively affect the survival of the whiteflies. On the other hand, other acyl sugars present in the plant like C32H54O15 (graph 2C) does not affect the whiteflies as such. The fresh weight (FW) is the weight of a plant, in this case FW of plant leaves when harvested. The bioassay shows that the level of acyl sugar content in the leaves of the plant directly affects the level of resistance that is observed as whitefly mortality.

[0037] FIG. 3: Shows a LC-MS superimposed chromatogram showing the presence and relative concentrations of various acyl sugars of insect resistant plants (red peaks), intermediate resistant plants (orange peaks), and susceptible plants (greenpeaks). The acyl sugar compounds that are labelled in red are present in high concentrations in plants that are insect resistant and are considered to play a vital role in insect resistance in the plant. The acyl sugars labelled in green are mainly present in susceptible plants. From this analysis, it can be concluded that plants having improved insect resistance is linked to high levels of C.sub.29H.sub.48O.sub.15 (S4:C17) and C.sub.36H.sub.62O.sub.15 (S4:C24) acyl sugars. Furthermore, no significant changes were observed in the acyl sugar content of C.sub.27H.sub.46O.sub.14 (S3:C15), C.sub.32H.sub.56O.sub.14 (S3:C20), C.sub.33H.sub.58O.sub.14 (S3:C21), C.sub.34H.sub.60O.sub.14 (S3:C22) and C.sub.39H.sub.68O.sub.15 (S4:C27) in relation to insect resistance of the plants.

[0038] FIG. 4: Shows the genomic region (gDNA), coding sequence (cDNA) and protein sequence of the SlAT2 (SEQ ID No. 1 to 3, respectively), and gDNA, cDNA and protein sequence of the AP2e (SEQ ID No. 4 to 6, respectively), wherein SlAT2 in combination with AP2e provides whitefly resistance in tomato plants.

EXAMPLES

Detached Leaves Bioassay

[0039] Young leaves of at least 12 weeks old plants (S. lycopersicum) of about 4 cm long were detached from the top of approximately 50 tomato plants grown in a plastic greenhouse. Petiole of the leaf was placed into a tube containing a nutritive agarose gel. The tube, with the adaxial part of the leaf side up, was placed (using blu-tack) in horizontal, on the wall of a glass petri dish at medium height, such that the leaf had space between the leaf and the petri dish on both the adaxial and abaxial sides. Each petri dish was then inoculated with 25 whiteflies, which were anaesthetized with CO.sub.2 for 3 seconds.

[0040] After 24-48 hours, the number of whiteflies in the adaxial or abaxial surface was counted together with the number of dead whiteflies. Each plant was tested twice and the number of whiteflies that were alive (feeding from the adaxial and the abaxial part of the leaf plus the whiteflies still flying around in the petri dish) versus the dead whiteflies were used to calculate the percentage of dead whiteflies. Correlation analysis between specific acyl sucroses and the whitefly mortality revealed that different specific acyl sucrose molecules play a different role in the resistance/susceptibility to whiteflies. As showed in FIG. 2 representing whitefly (WF) mortality versus the specific acyl sucrose content present in the plant, mainly C.sub.29H.sub.48O.sub.15 (S4:C17) and C.sub.36H.sub.62O.sub.15 (S4:C24) acyl sugars showed have a high impact on resistance. Other acyl sugar compounds that also showed a link with resistance are the C.sub.28H.sub.46O.sub.15 (S4:C16), C.sub.34H.sub.58O.sub.15 (S4:C22), C.sub.35H.sub.60O.sub.15 (S4:C23), C.sub.33H.sub.56O.sub.15 (S4:C21), and C.sub.37H.sub.64O.sub.15 (S4:C25) acyl sugars.

Liquid Chromatograpy Mass Spectrometry (LC-MS) Analysis Acyl Sugar Content in Tomato

[0041] A chemical analysis by LC-MS of the leaf surface was performed on a set of tomato plants, including insect resistant tomato plants according to present invention, intermediate resistant plants, and susceptible plants (all S. lycopersicum). Plants were grown till 10 side shoots and two opposite leaflets (3?3?3 cm) from the 3.sup.rd or 4.sup.th apical leaf were put in a 10 ml glass vial. Two milliliters of methanol with internal standard (Sucrose octaacetate, 10 mg/l) was added and the vial was shaken for 15 seconds. The leaflets were taken out and 300 ?l of methanol extract was transferred to an LC-vial and analyzed using an Agilent 1290 Infinity II UHPLC coupled to an Agilent 6230 TOF mass spectrometer.

[0042] One ?L of extract was injected and separated on an Agilent ZORBAX RRHD Eclipse Plus C18 column at 50? C. with a mobile-phase flow-rate of 0.3 m/min. The mobile phase was comprised of water+0.1% formic acid (A) and acetonitrile+0.1% formic acid (B) in the following A:B gradient; from 60:40 to 45:55 in 6 minutes to 10:90 in 8 minutes to 60:40 in 3 minutes. Molecules were ionised at 325 eV (positive mode) and detected in a range of 50-1500 mu at 1 spectrum/second. The extract comprised mainly of acylsugars that were detected as sodium adducts in the mass spectrometer.

[0043] Individual acyl sugars were identified using MassHunter Qualitative Analysis software (Agilent) by calculating the molecular formulas on the basis of the mother ion constituting the chromatographic peaks. Here, molecular formulas were constrained by allowing carbon, hydrogen and oxygen atoms to form the mother ion, in combination with H.sup.+, Na.sup.+ and K.sup.+ and formate adducts to appear, plus a double bond equivalent (DBE) range of 1-10. The exact mass of the mother ion in combination with the DBE allows extrapolation of the basic structure of the acyl sugar molecule; the backbone moiety, number of acyl chains and the total number of carbon atoms forming the acyl chains. Amounts of acylsugars were calculated by using MassHunter Quantitative Analysis Software (Agilent) for chromatogram peak integration and comparing the total peak area of the individual acylsugars to that of the internal standard (sucrose octaacetate).

[0044] With the LC-MS corresponding results were obtained as obtained with the detached leaves bioassay as described above. Further evidence that specific acyl sugars are involved in the insect resistance can be derived from the LC-MS chromatogram plot, FIG. 3. The individual chromatograms of methanolic leaf dips of insect resistant plants (red), intermediate resistant plants (orange), and susceptible plants (green) were superimposed. The acyl sugar compounds that are labelled in red are present in high concentrations in plants that showed to be highly resistant to whiteflies. In contrast in plants that showed to be susceptible to whitefly, no or only low concentrations of these specific acyl sugars were detected by LC-MS. Furthermore, in respect to the whitefly susceptible plants the acyl sugars that were mainly present are labelled in green, and remarkably were not, or at low concentrations, present in the resistant plants. From this analysis, it can be concluded that plants having improved insect resistance is linked to high C.sub.29H.sub.48O.sub.15 (S4:C17) and C.sub.36H.sub.62O.sub.15 (S4:C24) acyl sugars. No significant changes were observed in the acyl sugar content of C.sub.27H.sub.46O.sub.14 (S3:C15), C.sub.32H.sub.56O.sub.14 (S3:C20), C.sub.33H.sub.58O.sub.14 (S3:C21), C.sub.34H.sub.60O.sub.14 (S3:C22) and C.sub.39H.sub.68O.sub.15 (S4:C27) in insect susceptible and resistant plants.

Genotypic Analysis, Mapping of SlAT2 and AP2e.

[0045] The production of acyl sugars in tomato plants is linked with high levels of insect resistance in the plant. Important is to know which type of acyl sugars are needed for insect resistance. Looking into genotypic data on the resistant tomato plant population (S. lycopersicum) by marker analysis, marker M8 and M5 (Table 1) were used to identify the QTLs that clearly correlate with the production of (C.sub.36H.sub.62O.sub.15) (S4:C24) and (C.sub.29H.sub.48O.sub.15) (S4:C17) acyl sucrose.

[0046] Briefly, genomic regions that are linked to the amount of acyl sugars which are produced by type IV trichomes have been mapped on chromosome 6, based on the reference genome SL2.40. It was determined that the region involved in acyl sugar production linked to insect resistance is located between positions 43250794 bp and 43259933 bp. Marker M5 is 100% linked with the amount of acyl sugars (Table 1) being produced. Based on the reference genome SL2.40 and in silico prediction analysis (ITAG 2.3), one gene Solyc06g075510.2 is located in the fine mapped region that encodes for an APETALA2 ethylene-responsive transcription factor (AP2e).

[0047] Furthermore, the type of acyl sugars is crucial for providing the whitefly resistance in tomato plants. It was observed that plants comprising the AP2e gene and producing acyl sugars are not always resistant for whitefly. Comparing the acyl sugar profiles of the susceptible and resistant plants, it was concluded that plants having improved insect resistance are linked to high levels of tetra-acyl (S4) sucroses C.sub.29H.sub.48O.sub.15 (S4:C17) and C.sub.36H.sub.62O.sub.15 (S4:C24) in comparison to susceptible plants that mostly accumulate tri-acyl sucroses (S3). Marker M8 is 100% linked with the type of acyl sugars (Table 1), and one specific sequence was mapped on chromosome 1, which encoded a member of the BAHD family of acyltransferases, more specifically an acetyl-CoA-dependent acyltransferase enzyme SlAT2, capable of acyl sucrose acetylation and responsible for the production of C.sub.29H.sub.48O.sub.15 (S4:C17) and C.sub.36H.sub.62O.sub.15 (S4:C24).

[0048] Sequencing of the functional SlAT2 gene resulted in a genomic sequence including promotor region (SEQ ID No. 1). Plants comprising SEQ ID No. 1, i.e. a functional SlAT2, in combination with AP2e have an increased S4/S3 ratio and are highly resistant to whitefly compared to the plants without SEQ ID No. 1, these plants are not capable to produce S4 sugars which results in susceptibility to whitefly. SEQ ID No. 1 shows the genomic sequence comprising the SlAT2 gene including promotor region of the whitefly resistant plant of present invention. SEQ ID No. 2 shows the coding sequence of SlAT2 in the plant of present invention that encodes for the SlAT2 protein of SEQ ID No. 3. SEQ ID No. 4 shows the genomic sequence of the AP2e gene including promotor region of the whitefly resistant plant of present invention. SEQ ID No. 5 shows the coding sequence of AP2e in the plant of present invention that encodes for the AP2e protein of SEQ ID No. 6.

TABLE-US-00001 TABLE1 MarkersequencesusedforQTLmapping Marker Sequence M5_F(SEQIDNo.7) GCGAGGCATTTGTTGAAGTTGC TAATGC M5_R(SEQIDNo.8) GGTTGATACAAACAGCCCATTG M8_F(SEQIDNo.9) AAGCAATGCGAAATATCGTAAC M8_R(SEQIDNo.10) GAGAGACCCTCACATTTTGTC

[0049] It was found that the SlAT2 in combination with the AP2e gene specifically promotes and regulates the production of specific types of acyl sugars like C.sub.29H.sub.48O.sub.15 (S4:C17 acyl sucrose) and/or C.sub.36H.sub.62O.sub.15 (S4:C24 acyl sucrose) and more in general increases the ration between tetra- (S4) and tri-acylated (S3) sugar. The combination AP2e (marker M5)+SlAT2 (marker M8) increases the level of S4:C17 and S4:C24 acyl sucrose that is needed for whitefly resistance. Several tomato plants were selected for their presence of AP2e gene and the presence/absence of SlAT2 gene, homo/heterozygous using the M5 and M8 markers. Total acyl sugars content (g per gram plant fresh weight (gFW) per plant was determined, as well as the presence of specifically specific acyl sugars C.sub.29H.sub.48O.sub.15 (S4:C17 acyl sucrose) and C.sub.36H.sub.62O.sub.15 (S4:C24 acyl sucrose), the ratio between tetra- (S4) and tri-acylated (S3) sucroses, and the resistance to whitefly. The genotypes of SlAT2 are co-segregating with the production of S4:C17 and S4:C24 acyl sucrose and increased S4/S3 ratio, and is linked with the white fly resistance level, see Table 2.

TABLE-US-00002 TABLE 2 AP2e, SIAT2 presence in plants and the effect on Acyl sugars and whitefly resistance. Total Sum S4C17 + Ratio WF AP2e SIAT2 AcS S4C24 S4:S3 resistance Plant (M5) (M8) (?g/gFW) (?g/gFW) AcS % 1. b b 1038.7 479.7 1.46 60 2. b b 1503.8 551.9 2.33 49 3. b b 1060.5 431.5 1.67 44 4. b a 823.1 9.6 0.05 21 5. b a 579.8 5.6 0.33 7 6. b a 1872.4 12.6 0.33 22 7. b b 1735.8 544.3 1.95 74 8. b h 1316.5 350.4 1.12 60 9. b h 1820.4 632.2 1.87 45 10. b a 2090.5 59.4 0.48 30 11. b a 1180.0 28.7 0.57 21 a = absent b = present h = heterozygous