AGRICULTURAL FORMULATION COMPRISING AT LEAST ONE BACTERIAL STRAIN B. SAFENSIS RGM 2450, AND/OR A BACTERIAL STRAIN B. SIAMENSIS RGM 2529 AND AGRICULTURAL EXCIPIENTS; USE OF THE FORMULATION AND METHOD FOR STIMULATING GROWTH AND/OR INCREASING CROP YIELDS AND/OR PROTECTING CROPS AGAINST DISEASES AND PESTS

Abstract

An agricultural formulation for stimulating growth and/or increasing crop yields and/or protecting crops against diseases and pests, including at least one bacterial strain of B. safensis having deposit number RGM 2450 and/or a bacterial strain of B. siamensis having deposit number RGM 2529 and excipients for agricultural use. The composition serves as a crop bioprotector and/or biocontroller. A method for stimulating growth and/or increasing crop yields and/or protecting crops against diseases and pests is also related.

Claims

1. An agricultural formulation to promote growth and/or increase crop yield and/or protect against diseases and pests, the agricultural formulation comprising at least: a) One bacterial strain Bacillus safensis deposit RGM 2450, and/or b) One bacterial strain Bacillus siamensis deposit RGM 2529, and c) Excipients for agricultural use.

2. The agricultural formulation for promoting growth and/or increasing crop yield and/or protecting against diseases and pests according to claim 1, wherein the bacterial strain Bacillus siamensis deposit RGM 2529 having a concentration or amount of 3.0?10.sup.6-4.0?10.sup.9 CFU/g in the formulation.

3. The agricultural formulation for promoting growth and/or increasing crop yield and/or protecting against diseases and pests according to claim wherein the bacterial strain Bacillus safensis deposit RGM 2450 having a concentration or amount of 5.0?10.sup.6-4?10.sup.9 CFU/g in the formulation.

4. The agricultural formulation to promote growth and/or increase crop yield and/or protect against diseases and pests according to claim 1, claims wherein excipients for agricultural use corresponding to, but not being limited to: wheat flour, corn starch, gelatin, potato starch, silicon dioxide, citric acid, bicarbonate, polysorbates including Tweens, lactose, soy lecithin, casein, carboxymethyl cellulose or cellulose gum, sucrose esters, mannitol, sorbitans, Pluronic F68, alginate, xanthan gum, PEG (polyethylene glycol), corn syrup, egg, milk, glycerol, fructose, pectins, mineral oil, ester gum, long chain triglycerides.

5. The agricultural formulation for promoting growth and/or increasing crop yield and/or protecting against diseases and pests according to claim 1, wherein the formulation being presented as an extended-release tablet.

6. The agricultural formulation for promoting growth and/or increasing crop yield and/or protecting against diseases and pests according to claim 1, wherein the formulation being presented as a wettable powder.

7. The agricultural formulation for promoting growth and/or increasing crop yield and/or protecting against diseases and pests according to claim 1, wherein the formulation being presented as an effervescent tablet.

8. The agricultural formulation for promoting growth and/or increasing crop yield and/or protecting against diseases and pests according to claim 1 wherein the formulation being presented as a resuspension or emulsion of bacterial strains or a mixture of these.

9. Use of the agricultural formulation according to claim 1, wherein said formulation serving to increase the nitrogen binding of a crop.

10. Use of the agricultural formulation according to claim 1, wherein said formulation serving to increase the solubilization of phosphorus and potassium, and phytohormone production capacity of a crop.

11. Use of the agricultural formulation according to claim 1, wherein said formulation serving as a pathogen control agent or biocontroller in a crop.

12. Use of the agricultural formulation according to claim 11, wherein said formulation serving as a bioprotective agent and/or biocontroller for crops against pathogens such as Fusarum sp., Phytophthora sp., Collectotrichum sp., and Botrytis sp.

13. Use of the agricultural formulation according to claim 1, wherein said formulation serving as a bioprotective agent and/or biocontroller for crops against pathogens such as S. aureus ATCC 25923, M. luteus CMCC 28001, B. pumilus CMCC 63202, B. cereus ATCC 14579, B. subtilis ATCC 168, L. monocytogenes CICC 21662, E. faecalis ATCC 29212 and P. fluorescens ATCC 49642, B. thuringiensis, Klebsiella pneumoniae, M xanthus, P. vulgaris, Serratia marcescens, S. aureus, L. pneumophila, L. monocytogenes, P. syringae, A. solanacearum, Xanthomonas axonopodis pv. Glycines, B. brevis, B. cereus, B. licheniformis, B. megaterium, B. pumilus, B. sphaericus, B. subtilis, C. michiganensis, M luteus, P. granivorans, P. polymyxa, Coriolopsis spp. Fusarium sp, Pseudoxylaria sp., Trichoderma sp., Umbelopsis sp., F. oxysporum f. sp., Capsici, A. niger, F. solani, M. fructigena, Pennicilium expansum, P. italicum, R. solani, Alternaria alternata, A. solani, Aspergillus flavus, Botryosphaerica ribis, C. albicans, C. parasitica, C. acutatum, C. gloesporioides, Didymella bryoniae, F. graminearum, F. oxysporum, Ustilago maydis, Monilinia fructicola, P. expansum, P. gossypii, P. capsici, P. grisea, R. solani, S. rolfsii, S. sclerotiorum, A. solani, B. cinerea, F. graminearum, F. sambucinum, F. oxysporum, P. fusca, P. sukatum, P. ultimum, R. solani, Rhizopus sp., S. sclerotiorum, C. michiganense subsp. sepedonicum, E. amylovora, E. coli, S. typhi, S. pyogenes, C. albicans, M. aeruginosa, P. infestans, S. cerevisiae, A. fumigatus.

14. Use of the agricultural formulation according to claim 1, wherein said formulation serving as an agent for increasing the concentration of chlorophyll in a crop or plant.

15. Use of the agricultural formulation according to claim 1, wherein said formulation serving as an agent for increasing crop growth and/or yield.

16. A method of promoting crop growth and/or increasing yield and/or protecting against diseases and pests, the method including the step of applying an effective amount of the agricultural formulation described in claim 1 to a crop.

17. The method for promoting crop growth and/or increasing yield and/or protecting against diseases and pests according to claim 16, further including the step of applying the agricultural formulation in the form of resuspension, emulsion, effervescent tablet, extended-release tablet, wettable powder, or mixtures thereof.

18. The method for promoting crop growth and/or increasing yield and/or protecting against diseases and pests according to claim 16, wherein its application through sprinkling or direct immersion of the formulation on the seed of the target crop.

19. The method for promoting crop growth and/or increasing yield and/or protecting against diseases and pests according to claim 18, wherein the seed being impregnated in a buffer and fully submerged in a formulation comprising a concentration of 10.sup.9 CFU/mL of the bacteria mixture.

20. The method for promoting crop growth and/or increasing yield and/or protecting against diseases and pests according to claim 16, wherein being applied to the base of the plants' stem.

21. The method for promoting crop growth and/or increasing yield and/or protecting against diseases and pests according to claim 20, wherein being applied to the base of the plants' stem at a concentration of 10.sup.8 CFU/mL.

22. The method for promoting crop growth and/or increasing yield and/or protecting against diseases and pests according to claim 16, wherein the formulation being potentially administered in conjunction with fertilizers.

Description

DESCRIPTION OF FIGURES OF THE INVENTION

[0060] FIG. 1. Phylogenetic tree based on 16S rDNA gene. The Neighbor joining method and K-2 model parameters were used to determine the phylogenetic relationship between Bacillus sp. isolate and other Bacillus species. Micrococcus luteus DSM 20030T was used as an external group. Bootstrap values (expressed as percentages of 1000 replicates) greater than 50% are displayed on nodes. The bar indicates 2 substitutions per 100 nucleotides. The RGM 2450 and RGM 2529 isolates are highlighted with a black circle. On the left side of each type strain (T) is the accession number for the NCBI database.

[0061] FIG. 2. Phylogenetic tree based on pyrE analysis of strain RGM 2450 sp. and related species types. For pyrE genetic marker testing. The Maximum Likelihood method and the Tamura-Nei model were used to determine the phylogenetic relationship between RGM 2450 isolate and strains of the species B. safensis, B. pumilus and B. altitudeinis. The B. cereus ATCC 1479T strain was used as an external group. Bootstrap values (expressed as percentages of 1000 replicates) are displayed on nodes. The bar indicates 5 substitutions per 100 nucleotides. The RGM 2450 strain is highlighted with a black circle.

[0062] FIG. 3. Phylogenetic tree based on gyrB analysis of RGM 2529 strain and related species types. The Maximum Likelihood method and Tamura-3-parameter model were used to determine the phylogenetic relationship between the RGM 2529 strain and the type strains. B. cereus ATCC 14579 was used as an external group. Bootstrap values (expressed as percentages of 1000 replicates) are displayed on nodes. The bar indicates 5 substitutions per 100 nucleotides.

[0063] FIG. 4. Evaluation of Nitrogen (N2) binding and phosphorus (P) solubilization of RGM 2450, RGM 2529 and commercial strain QST 713. The different bacterial strains were cultured in Ashby medium to test for N2 binding, whereas the assay in modified Pikovskaya medium was applied to evaluate P solubilization. The brightness of the photographs was adjusted by 60% from the original shot. The negative control is not shown in the figure; A) indicates nitrogen binding assays, B) indicates phosphorus solubilization assays, while 1) represents assays in the RGM 2450 strain, 2) assays in the RGM 2529 strain, and 3) assays with a commercial product.

[0064] FIG. 5. Evaluation of Potassium (K) solubilization of RGM 2450, RGM 2529 strains compared to commercial strain QST 713. All strains were cultured in modified Pikovskaya medium. A) Bacteria-free control plate; B) Plate cultured with RGM 2450 strain; C) Plate cultured with RGM 2529 strain; D) Plate cultured with QST 713 commercial product strain. The brightness of the photographs was adjusted by 60% from the original shot.

[0065] FIG. 6. Nitrogen binding for RGM 2450, RGM 2529 and QST 713 strains in modified Ashby medium (Nitrogen-free). The strains were cultured in Ashby medium in the absence of N2 sources to assess their binding capacity over time. The lines represent the evolution in the number of viable cells for the RGM 2450 (?), RGM 2529 (?) and QST 713 (?) strains.

[0066] FIG. 7. Antagonist activity of RGM 2450, RGM 2529 and commercial strain QST 713 against phytopathogen Botrytis sp. A) Antagonistic activity from direct pathogen contact with all three strains separately; B) Antagonistic activity from antifungal factor secretion; C) Antagonistic activity from antifungal volatile compound secretion. The graphs show the growth diameter in millimeters (mm) of Botrytis sp, where 1) corresponds to the control (untreated Botrytis), 2) corresponds to a commercial product vs. Botrytis, 3) RGM 2450 vs. Botrytis, 4) RGM 2529 vs. Botrytis. Average values are expressed along with their respective standard deviation. Letters indicate significant differences (p-value <0.05, ANOVA, LSD).

[0067] FIG. 8. Antagonist activity of RGM 2450, RGM 2529 and commercial strain QST 713 against the phytopathogen Colletotrichum sp. A) Antagonistic activity from direct pathogen contact with all three strains separately; B) Antagonistic activity from antifungal factor secretion; C) Antagonistic activity from antifungal volatile compound secretion. The graphs show the growth diameter in millimeters (mm) of Colletotrichum sp, where 1) corresponds to the control (untreated Colletotrichum), 2) corresponds to a commercial product vs. Colletotrichum, 3) RGM 2450 vs. Colletotrichum, 4) RGM 2529 vs. Colletotrichum. Average values are expressed along with their respective standard deviation. Letters indicate significant differences (p-value <0.05, ANOVA, LSD).

[0068] FIG. 9. Antagonist activity of RGM 2450, RGM 2529 and commercial strain QST 713 against Phytophthora sp. A) Antagonistic activity from direct pathogen contact with all three strains separately; B) Antagonistic activity from antifungal factor secretion; C) Antagonistic activity from antifungal volatile compound secretion. The graphs show the growth diameter in millimeters (mm) of Phytophthora sp., where 1) corresponds to the control (untreated Phytophthora), 2) corresponds to a commercial product vs. Phytophthora, 3) RGM 2450 vs. Phytophthora, 4) RGM 2529 vs. Phytophthora. Average values are expressed along with their respective standard deviation. Letters indicate significant differences (p-value <0.05, ANOVA, LSD).

[0069] FIG. 10. Antagonist activity of RGM 2450, RGM 2529 and commercial strain QST 713 against the phytopathogen Fusarium sp.A) Antagonistic activity from direct pathogen contact with all three strains separately; B) Antagonistic activity from antifungal factor secretion; C) Antagonistic activity from antifungal volatile compound secretion. The graphs show the growth diameter in millimeters (mm) of Fusarium sp., where 1) corresponds to the control (untreated Fusarium), 2) corresponds to a commercial product vs. Fusarium, 3) RGM 2450 vs. Fusarium, 4) RGM 2529 vs. Fusarium. Average values are expressed along with their respective standard deviation. Letters indicate significant differences (p-value <0.05, ANOVA, LSD).

[0070] FIG. 11. Evaluation of N2 binding activities and P and K solubilization of the RGM 2450 strain in the different formulation formats. Figure presents the different assays in which nitrogen (N) binding and phosphorus (P) and potassium (K) solubilization of the RGM 2450 strain were evaluated. Different presentation formats for the formulation are evaluated, where 1) corresponds to the control, 2)-3)-4) correspond to the extended-release tablet formulation without gelatin, 0.5? gelatin and 1? gelatin, respectively, 5) wettable powder, and 6) effervescent tablet.

[0071] FIG. 12. Evaluation of N2 binding activities and P and K solubilization of the RGM 2529 strain in the different formulation formats. Figure presents the different assays in which nitrogen (N) binding and phosphorus (P) and potassium (K) solubilization of the RGM 2529 strain were evaluated. Different presentation formats for the formulation are evaluated, where 1) corresponds to the control, 2)-3)-4) correspond to the extended-release tablet formulation without gelatin, 0.5? gelatin and 1? gelatin, respectively, 5) wettable powder, and 6) effervescent tablet.

[0072] FIG. 13. Effect of RGM 2450 and/or RGM 2529 strains on tomato seedling growth. The evaluation was performed 21 days after inoculation of the seeds in the described treatments. A) Control; B) Resuspension of RGM 2450 strain in isotonic solution; C) Emulsion of RGM 2450 strain; D) Resuspension of RGM 2529 strain in isotonic suspension; E) Emulsion of RGM 2529 strain; F) Resuspension of RGM 2450 and 2529 strain mixture in isotonic solution; G) Emulsion of RGM 2450 and 2529 strain mixtures.

[0073] FIG. 14. Evaluation of the growth of tomato seedlings from seeds inoculated with bacteria. The evaluation was performed 21 days after inoculation of the seeds in the described treatments. A) Wet biomass assessment; B) Dry biomass assessment; C) Outbreak length assessment; D) Root length assessment; E) True leaf count assessment. Different letters indicate that there are significant differences between treatments (p-value <0.05, ANOVA, LSD).

[0074] FIG. 15. Antagonist activity of PGPR strains against B. cinerea in grape berry assays. The photo is a representative snapshot of the activity of the RGM 2450 and RGM 2529 strains, the mixture of both, and the commercial strain QST 713. A) indicates berries inoculated with B. cinerea and B) indicates berries not inoculated with B. cinerea. The photograph was taken after incubating the experimental units for 72 hours at 25? C. and high humidity.

[0075] FIG. 16. Cumulative weight response surface of tomato fruits. On the Y axis is the cumulative weight (g) in X treatments and Z weeks. The colors represent the different surfaces covered according to the g achieved in each treatment.

[0076] FIG. 17. Quantification of total chlorophyll with respect to each treatment. The bars represent the average values. Lines represent standard deviations and the letters the LSD test (?=0.05).

[0077] FIG. 18. Grouping involved in the synthesis and transport of the microfine plantazolicin. The gene cluster of the RGM 2450 strain is compared to the gene cluster of the B. pumilus ATCC 7061 and B. venelenzis FZB42 strains involved in the synthesis of plantazolicin.

[0078] FIG. 19. Prediction of gene cluster encoding non-ribosomal peptide synthetase and other enzymes that would be involved in the synthesis of bacillibactin. A) Gene cluster encoding enzymes involved in the synthesis of bacillibactin and adjacent genes involved in transport and regulation functions. B). Schematic plotting the role of enzymes in the synthesis of bacillibactin and the role of this compound. Bacillibactin is synthesized by an NRPS assembly system (DhbACEBF) and secreted into the extracellular space. Bacillibactin chelates iron with very high affinity, and the resulting ferric-bacillibactin complex is imported back into the cytosol via the FeuABC-YusV system and hydrolyzed by BesA esterase to release iron, which produces three bacillibactin monomers (2,3-dihydroxybenzoate-Gly-Thr). The released iron serves as an enzyme cofactor.

[0079] FIG. 20. Prediction of gene cluster encoding NRPS that would be involved in the synthesis of cyclolipopeptide. A) genes encoding NRPS and its gene neighborhood. B) prediction of non-ribosomal peptide synthetase encoded by biosynthetic genes along with amino acids that are recognized by their adenylation domains. Cal, Co-enzyme A ligase domain, Ag, fatty acid; X, identified amino acid; val, valine; le, [sic] isoleucine; leu, leucine; asp, aspartate; glu, glutamic acid. Partial prediction of molecule synthesized by NRPS.

[0080] FIG. 21. Gene cluster arrangement that would be involved in the synthesis of cyclolipopeptide in strains of the genus Bacillus sp. A) Gene cluster arrangement in strains phylogenetically close to the RGM 2450 strain. B) Comparison of the RGM 2450 strain gene cluster with that of the B. licheniformis DSM 13 strain involved in the synthesis of the cyclolipopeptide of lichenysin.

[0081] FIG. 22. Prediction of gene cluster encoding NRPS that would be involved in bacilysin synthesis. A) Genes involved in the synthesis and transport of the bacilysin peptide are illustrated. B) Bacilysin structure. C) Gene cluster arrangement in other strains phylogenetically close to the RGM 2450 strain.

[0082] FIG. 23. AcnABCD gene cluster encoding amylocyclicin. A) Gene cluster encoding amylocyclicin in the RGM 2529 strain. B) Presence of gene cluster in strains of PGPR species.

[0083] FIG. 24. DhbACEBF gene cluster of RGM 2529 strain involved in bacillibactin synthesis. The 13034 bp DhbACEBF gene cluster involved in the synthesis and assembly of the bacilllbactin siderophore was detected in the vicinity of the amylocyclicin gene neighborhood.

[0084] FIG. 25. Gene cluster that would be involved in the synthesis of surfactin. A) Gene cluster arrangement of surfactin in the RMG 2529 strain. B) Gene cluster of surfactin in strains phylogenetically close to the RGM 2529 strain.

[0085] FIG. 26. Gene cluster that would be involved in the synthesis of fengycin. A) Gene cluster arrangement of fengycin in the RMG 2529 strain. B) Gene cluster of fengycin in strains phylogenetically close to the RGM 2529 strain. C) Fengycin structure.

[0086] FIG. 27. Gene cluster that would be involved in the synthesis of bacillomycin D. A) Gene cluster arrangement of bacillomycin D in the RMG 2529 strain. B) Gene cluster of bacillomycin D in strains phylogenetically close to the RGM 2529 strain.

[0087] FIG. 28. Gene cluster that would be involved in the synthesis of bacillaene. A) Gene cluster arrangement of bacilaene in the RMG 2529 strain. B) Gene cluster of bacilaene in strains phylogenetically close to the RGM 2529 strain.

APPLICATION EXAMPLES

Example 1. Characterization of Bacterial Strains RGM 2450 and RGM 2529

[0088] The characterization of the bacterial strains RGM 2450 and RGM 2529, active ingredients of the formulation described herein, is presented in this application example Molecular characterization and its characterization from the point of view of its nitrogen binding capacity and solubilization of phosphorus and potassium, and phytohormone production capacity (IAA) are described. Its ability to control pathogens is also evaluated.

1.1 Molecular Characterization

[0089] DNA Extraction and Amplification of 16s, pyrE and rpoB genes.

[0090] DNA extraction was performed for RGM 2450 and RGM 2529 strains. Genetic markers were amplified: rRNA 16S and pyrE for the RGM 2450 strain, and rRNA 16S and rpoB for the RGM 2529 strain. The amplification reaction of each genetic marker consisted of 25 to 50 ng DNA from the strain, 1? DreamTaq Green PCR Master Mix, 400 ?Mol from each splitter (Table 1), and nuclease-free Millipure water in a final reaction volume of 50 ?L. The amplification thermal profile consisted of an initial denaturation at 95? C. for 2 min, followed by 35 amplification cycles (denaturation at 98? C. for 30 s, alignment at 55? C. for 30 s, and an extension at 72? C. for 45 s) and a final extension at 72? C. for 5 min. PCR products were visualized by 1% agarose gel electrophoresis and GelRed 1? staining. The band corresponding to the expected size was cut and purified with the Zymo Clean Kit (Qiagen, Hilden, Germany) under the manufacturer's instructions. The purified fragment of this reaction was sent to sequence to the Macrogen sequencing center. Each marker was sequenced as sense and antisense strands, using the primers in Table 1. Sense and antisense sequences obtained from sequencing strain genetic markers were assembled using the Vector NTI program.

TABLE-US-00001 TABLE1 Sequencesofprimersusedtoamplifygenes involvedinmolecularcharacterizationof RGM2450andRGM2529strains. Composition Blank Primer ofthePrimer Gene References 27F AGAGTTTGATCMTGGCTCAG rRNA Weisburg 16S etal.,1990 1492R TACGGYTACCTTGTTACGACTT rpoBF GTTGGCTTCATGACTTGGGA rpoB Fanetal., 2017 rpoBR ACGTTCCATACCTAAACTTTG pyrEF AGACCGTTCTTCCATCCA pyrE Liuetal., 2013 pyrER CACCTATTACAAATCAAAGC

Analysis of the Identity and Phylogenesis of the Species.

[0091] The sequence of the RGM 2450 and RGM 2529 strain markers was compared to the species-type sequences of the bacterial groups to which they belong (Table 2). First, the identity of the RGM 2450 and 2529 strains was verified using the 16S rRNA genetic marker to determine the bacterial genus and group to which they belong, and subsequently using the specific markers pyrE and rpoB to corroborate the particular species of RGM 2450 and RGM 2529, respectively. Analysis of the 16S rRNA gene indicated that the RGM 2450 strain belongs to the group B. pmilus, while RGM 2529 belongs to the group B. amyloliquefaciens.

TABLE-US-00002 TABLE 2 Nucleotide identity between strains RGM 2450 and RGM 2529 with bacteria of species B. pumilus and B. amyloliquefaciens. In parentheses next to each species is their accession ID in the NCBI database. Identity Gaps Strain Name and Accession ID Locus (%) (%) RGM 2450/B. safensis FO-036b T(AF234854.2) 16S 99 0 RGM 2450/B. pumilus DSM 27.sup.T (KC346445.1) 99 0 RGM 2450/B. safensis FO-036b T(KC346688) pyrE 96 0 RGM 2450/B. pumilus DSM 27.sup.T (KC346746) 91 0 RGM 2529/B. siamensis KCTC 13613.sup.T 100 0 (Y79DRAFT_AJVF01000001_1.1) RGM 2529/B. velezensis KCTC 13012.sup.T 16S 99 0 (Ga0100777_104) RGM 2529/B. methylotrophicus KACC 13105.sup.T 99 0 (Ga0077492_1001) RGM 2529/B. amyloquefaciens DSM 7.sup.T 99 0 (NC_014551) RGM 2529/B. siamensis KCTC 13613.sup.T 99 0 (Y79DRAFT_AJVF01000001_1.1) RGM 2529/B. velezensis KCTC 13012.sup.T rpoB 98 0 (Ga0100777_104) RGM 2529/B. methylotrophicus KACC 13105.sup.T 98 0 (Ga0077492_1001) RGM 2529/B. amyloquefaciens DSM 7.sup.T 98 0 (NC_014551)

[0092] Phylogenetic analyses were then performed based on sequenced markers using MEGA 6.0.6 software. (FIGS. 1, 2 and 3). To do this, the RGM 2450 and RGM 2529 gene marker sequences were aligned with the reference strain sequences using the MUSCLE option. Subsequently, the evolutionary history was determined using a statistical method (Maximum Likehood/Neighbor-joining) and a nucleotide substitution model (Kimura-2-parameters/Tamura-Nei/Tamura-3-parameters model), considering a Gamma distribution to model differences in the rate of variation between sites. Phylogenetic relationships were hypothesized using 1000 bootstrap replicas. The phylogenetic trees clearly plot the results set forth in Table 2, indicating that the RGM 2450 strain shares a taxonomic Glade with the B. safensis FO-036b bacterial strain (100% bootstrap) (FIG. 2), while RGM 2529 is in the same Glade as with B. siamensis KCTC 13613.sup.T (99% bootstrap) (FIG. 3).

1.2 Solubilization of Phosphorus and Potassium and Nitrogen Binding Capacity

[0093] In the case of the evaluation of phosphate solubilization, strains RGM 2450 and RGM 2528 were grown in 5 mL of LB liquid medium for 16 h (30? C. and 200 rpm). 10 ?L of the culture was added to Pikovskaya agar medium (0.3 g/L NaCI; 0.3 g/L MgSO.sub.4-7H.sub.2O; 0.03 g/L MnSO.sub.4-4H.sub.2O; 0.3 g/L KCI; 0.5 g/L (NH.sub.4).sub.2SO.sub.4; 0.03 g/L FeSO.sub.4 7H.sub.2O; 2 g/L Ca.sub.3(PO4).sub.2; 10 g/L glucose; 0.5 g/L yeast extract; 15 g/L agar. Adjust to pH 7.0 (Vazquez et al., 2000). It was incubated for 7 days at 30? C. The appearance of a clear halo around the bacterial colony indicated the ability to solubilize phosphate. The assay was performed in triplicate.

[0094] For the evaluation of potassium solubilization, strains RGM 2450 and RGM 2528 were grown in 5 mL of LB liquid medium for 16 h (30? C. and 200 rpm). 10 ?L of the culture was added to modified Pikovskaya agar medium (0.3 g/L NaCI; 0.3 g/L MgSO.sub.4-7H.sub.2O; 0.03 g/L MnSO.sub.4-4H.sub.2O; 2 g/L KNO.sub.3; 0.5 g/L (NH.sub.4).sub.2SO.sub.4; 0.03 g/L FeSO.sub.4 7H.sub.2O; 0.5 g/L Ca.sub.3(PO4).sub.2; 10 g/L glucose; 0.5 g/L yeast extract; 15 g/L agar. Adjust to pH 7.0 (Vazquez et al., 2000). It was incubated for 14 days at 30? C. The appearance of a halo around the bacterial colony indicated the ability to solubilize potassium.

[0095] To determine nitrogen binding capacity, strains RGM 2450 and RGM 2528 were cultured in 5 mL of LB liquid medium for 16 h (30? C. and 200 rpm). It was centrifuged for 5 min at 3500 g and washed 3 times with sterile PBS buffer (8 g/L NaCI, 0.2 g/L KCI, 1.44 g/L Na.sub.2HPO.sub.4, 0.24 g/L KH.sub.2PO.sub.4, adjust to pH 7.4). Finally, 3 mL of PBS solution was resuspended and 10 ?L of the suspension was added to Ashby medium (10 g/L glucose; 0.2 g/L KH.sub.2PO.sub.4; 0.2 g/L MgSO.sub.4; 0.2 g/L NaCI; 0.2 g/L CaSO.sub.4; 5 g/L CaCO.sub.3) and incubated for 7 days at 30? C. (Rao, 1999; Vel?zquez-Gurrola and Ramos-Alegr?a, 2015). Strain growth indicated the ability to bind atmospheric nitrogen. The assay was performed in triplicate.

[0096] As for P solubilization, the RGM 2450 strain exhibits a similar ability as the commercial product strain including the Bacillus subtilis QST 713 strain, while RGM 2529 exhibits a halo with greater range, demonstrating its superior ability to perform this task (FIG. 4). On the other hand, it is observed that both strains have the ability to solubilize K in vitro due to the color change in the medium (FIG. 5).

[0097] The RGM 2450 strain had the greatest effect on N.sub.2 binding, with even better growth in modified Ashby medium.

[0098] For the N.sub.2 binding assay (FIG. 6), it is observed that the RGM 2450 strain grew significantly better compared to the RGM 2529 and QST 713 strains after 24 hours of the experiment, demonstrating that its ability to bind this element is greater.

1.3 Phytohormone Production Capacity (IAA).

[0099] The ability of RGM 2450, RGM 2529 strains to produce indoleacetic acid phytohormone was determined. For this, strains RGM 2450, RGM 2529 and B. subtilis QST 713 were grown in 5 mL of LB medium at 30? C. and 200 rpm. After 16 h of incubation, the turbidity of the cultures was measured at ?600 and an aliquot ?600 turbidity=1.0-1.2) of each strain was inoculated in LB culture media supplemented with tryptophan 1000 ?g/mL (ALDRICH SIGMA). The relative IAA concentration in culture supernatants was determined by the Salkowski method (Patten and Glick, 2002; Yang et al., 2007). Samples of 1.5 mL were collected and centrifuged at 3000 g for 10 min. An aliquot of 1 mL of supernatant was taken and vigorously mixed with 4 mL of Salkowski reagent (150 mL of concentrated H2SO4, 250 mL of distilled H2O, 7.5 mL of 0.5 M FeCI3?6H2O) and incubated for 20 min at room temperature. The coloration formation indicated the presence of IAA, which was quantified by absorbance measurement at 535 nm. One calibration curve prepared with serial dilutions of IAA stock solution in LB medium was made at a concentration range of 0.7 and 12.5 pg/mL.

TABLE-US-00003 TABLE 3 Concentration of IAA in bacterial cultures RGM 2450, RGM 2529 and QST 713. The assay was performed on LB culture media containing tryptophan 1 mg/mL. Different letters represent significant differences between treatments (p-value < 0.05, ANOVA, Tukey). Absorbance Relative IAA Strain ? = 535 concentration [mg/mL] RGM 2450 0.21 ? 0.01 0.0079 ? 0.0006.sup.a RGM 2529 0.21 ? 0.01 0.008 ? 0.001.sup.a QST 713 0.24 ? 0.01 0.0105 ? 0.0009.sup.b

[0100] The results shown in Table 3 demonstrate that strains RGM 2450 and RGM 2529 are capable of producing IAA under the conditions delivered by the medium. There was no significant difference when comparing the concentrations produced by both strains. However, when compared to the commercial strain QST 713, both produced significantly less of this phytohormone: about 20% less after 48 hours of growth. It should be noted that high concentrations of IAA can result in inhibition of plant growth and deformation in plant tissue.

1.4 Pathogen Control Capability.

[0101] RGM 2450 and RGM 2529 strains were grown in LB culture medium for 16 h. A 100 pL aliquot of this culture was added to an LB agar plate and spread with the Drigalsky spatula over the entire surface of the agar. At the same time, a 6 mm diameter disc was removed from the edge of a culture of a resistant Botrytis strain, grown in PDA agar for 7 days. The disc was deposited in the center of a PDA agar plate, to evaluate the inhibition of phytopathogens by direct contact.

[0102] To determine inhibition by production of volatile compounds, the LB agar plate inoculated with a Bacillus strain was placed at the top of the plate inoculated with the phytopathogenic fungus. The bonded plates were sealed with 4 layers of Parafilm paper.

[0103] The same procedure was performed, using the phytopathogenic fungus Colletotrichum. It was left to incubate at room temperature for 7 days.

[0104] The percentage of inhibition of mycelium growth of pathogens tested by volatile and nonvolatile compounds was calculated according to the PGI formula:

PGI=((C?T)/C?100)

[0105] Where PGI=pathogen growth inhibition (%); C=pathogen diametrical growth (control); T=pathogen diametrical growth (treated).

[0106] According to the experimental design, ANDEVA analyses of variance were performed based on the F-test, with a p-value=0.05 comparator, to determine the effect of exposure of nematodes to recombinant protein extracts. Finally, significant statistical differences were determined by LSD testing, p-value=0.05.

TABLE-US-00004 TABLE 4 Quantitative evaluation of the effect caused by strains RGM 2450 and RGM 2529 on Botrytis sp. growth Values are expressed in percentages (%) of comparison in the pathogen growth halo measurement to the control group, along with their respective standard deviation. Direct contact Antibiosis Volatile compounds RGM RGM QST RGM RGM QST RGM RGM QST 2450 2529 713 2450 2529 713 2450 2529 713 79 ? 86 ? 90 ? 46 ? 62 ? 59 ? 79 ? 84 ? 62 ? 25 7 1 5 3 4 23 23 10

[0107] The results show that the antagonistic effect of the RGM 2450 strain against Botrytis sp. caused close to 79% inhibition upon direct contact with the pathogen, 46% by antibiosis, and 79% by volatile compound production; the RGM 2529 strain, in turn, exhibited 86%, 62%, and 84% inhibition upon exposure to the same fungus for direct contact, antibiosis, and volatile compound production assays, respectively (Table 4 and FIG. 7).

TABLE-US-00005 TABLE 5 Quantitative evaluation of the effect caused by strains RGM 2450 and RGM 2529 on Colletotrichum sp. growth Values are expressed in percentages (%) of comparison in the pathogen growth halo measurement to the control group, along with their respective standard deviation. Direct contact Antibiosis Volatile compounds RGM RGM QST RGM RGM QST RGM RGM QST 2450 2529 713 2450 2529 713 2450 2529 713 43 ? 78 ? 98 ? 53 ? 70 ? 84 ? N.D. N.D. N.D. 9 5 0 19 2 4

[0108] On the other hand, for Colletotrichum sp., the inhibition percentages observed for RGM 2450 were 43% and 53% for the direct contact and antibiosis assays, respectively; for RGM 2529, a decrease in the pathogen growth halo of 78% was observed by direct contact, and of 70% by antibiosis. No inhibitory effect was seen for volatile compounds in either strain (Table 5 and FIG. 8).

TABLE-US-00006 TABLE 6 Quantitative evaluation of the effect caused by strains RGM 2450 and RGM 2529 on Phytophthora sp. growth. Values are expressed in percentages (%) of comparison in the pathogen growth halo measurement to the control group, along with their respective standard deviation. Direct contact Antibiosis Volatile compounds RGM RGM QST RGM RGM QST RGM RGM QST 2450 2529 713 2450 2529 713 2450 2529 713 45 ? 80 ? 85 ? 41 ? 52 ? 75 ? 0 0 0 5 2 1 4 2 3

[0109] For testing against the pathogen Phytophthora sp., the RGM 2450 strain caused 45% inhibition by direct contact and a strong antibiosis effect of 41%. Meanwhile, the RGM 2529 strain showed an inhibition effect of 80% by direct contact and 52% when treated for antibiosis. No inhibition by volatile compound production was exhibited in any case (Table 6 and FIG. 9).

TABLE-US-00007 TABLE 7 Quantitative evaluation of the effect caused by strains RGM 2450 and RGM 2529 on Fusarium sp. growth. Values are expressed in percentages (%) of comparison in the pathogen growth halo measurement to the control group, along with their respective standard deviation. Direct contact Antibiosis Volatile compounds RGM RGM QST RGM RGM QST RGM RGM QST 2450 2529 713 2450 2529 713 2450 2529 713 24 ? 53 ? 83 ? 4 ? 41 ? 56 ? 0 0 0 2 2 7 3 8 2

[0110] Finally, for Fusarium sp., strains RGM 2450 and RGM 2529 caused growth inhibition of 24% and 4% by direct contact, and 53% and 41% by antibiotic assay, respectively. No inhibition by volatile compound production was exhibited for any of the strains (Table 7 and FIG. 10).

Example 2. Preparation of Formulations Comprising RGM 2450 and RGM 2529 Strains with PGPR Activity for Different Presentation and Administration Formats

[0111] The formulation of the present invention may be presented and administered as a formulation of an extended-release tablet, as wettable powders, or as effervescent tablets.

[0112] 2.1 Formulation of Extended-Release Tablets.

[0113] Three formulations were made to generate extended-release tablets, in order to determine dosage in secretion and preservation of viability. The first formulation consisted of 28.6% wheat flour, 28.6% cornstarch and 42.8% bacterial culture. The second formulation consisted of 30.4% wheat flour, 30.4% cornstarch, 38.2% bacterial culture, and 1% of 13% gelatin (0.5? gelatin).

[0114] The third formulation consisted of 32.6% wheat flour, 32.6% cornstarch, 32.8% bacterial culture, and 2% of 13% gelatin (1? gelatin). For formulation, the starch was dry sterilized at 180? C. for 30 min and the gelatin was resuspended at a 1:8 ratio. The formulations were dosed in 0.62 g capsules with 1.4 cm diameter and 0.6 cm thickness. They were stored at 4? C. for 16 h, then dehydrated at 40? C. for 2 h. The tablets were deposited on 50 ?L of water in the Ashby, Pikovskaya and modified Pikovskaya culture media, and incubated at 25? C. for 14 days. Additionally, bacteria present in the formulations were counted by mashing and resuspending the formulation in 50 mL of sterile distilled water.

[0115] 2.2 Formulation of Wettable Powders.

[0116] For the formulation of wettable powder, 17% potato starch was mixed with 14.6% silicon dioxide and 68.4% bacterial culture. 1 g of the product was weighed and resuspended in 100 mL of sterile distilled water, 20 ?L of the suspension was added in the Ashby, Pikovskaya and modified Pikovskaya culture media, and incubated at 30? C. for 7 days. Additionally, bacteria present in the formulations were counted.

[0117] 2.3 Formulation of Effervescent Tablets.

[0118] For the formulation of the effervescent tablets, 30% citric acid was mixed with 66.6% bicarbonate and 3.4% bacterial culture, and as the culture was added, homogenization was achieved by mixing the components. The resulting mixture was arranged in circular molds of 35 mm diameter and 0.5 mm depth, generating six 4.7 g tablets. They were dissolved in 100 mL of sterile distilled water and 20 ?L of this solution were deposited in Ashby, Pikovskaya and modified Pikovskaya culture media, and incubated at 30? C. for 7 days. Additionally, bacteria present in the formulations were counted.

TABLE-US-00008 TABLE 8 Viable cell counts present in the different formulations. The data correspond to the values in colony forming units (CFU) per gram of average formulation, together with their respective standard deviation, when performing the assay in triplicate. Viable cells RGM RGM (CFU/g formulation) 2450 strain 2529 strain Gelatin-free tablet 1.0*10.sup.7 ? 2*10.sup.6 6*10.sup.6 ? 2*10.sup.6 Tablet with 0.5 ? gelatin 2.6*10.sup.7 ? 6*10.sup.6 7*10.sup.6 ? 3*10.sup.6 Tablet with 1 ? gelatin 8*10.sup.6 ? 1*10.sup.6 1.2*10.sup.7 ? 1*10.sup.6 Wettable powder 4*10.sup.8 ? 1*10.sup.8 4*10.sup.7 ? 3*10.sup.7 Effervescent tablet 5.3*10.sup.6 ? 6*10.sup.5 3.4*10.sup.6 ? 6*10.sup.6

[0119] According to Table 8, the number of viable cells for the five different formulations was between 3.4*10.sup.6-4*10.sup.8 CFU/g and was equal to or greater than the number of viable cells present in the commercial product Serenade? liquid (1.4*10.sup.7 CFU/g), which includes the QST 713 strain, previously used as a comparative control.

[0120] The formulations were also tested to evaluate whether they possess the same characteristics as previously tested for nitrogen binding and solubilization of phosphorus and potassium. In the case of RGM 2450 bacteria (FIG. 11), it maintains its ability to fix nitrogen but is unable to solubilize P when tested in extended-release tablets, while K solubilization is not clearly observed. The effect on nitrogen binding was not as easily noticeable for the other formulations, so it cannot be confirmed that the strain maintains its ability when incorporating it into a wettable powder or effervescent tablet.

[0121] On the other hand, strain RGM 2529 (FIG. 12) was able to grow in the case of extended-release pills, mainly due to the formulation's own effect on the medium rather than a particular biological activity of the bacteria. There was no effect on the solubilization of P or K. In the wettable powders and the effervescent tablet, the conditions exhibited were the same as that of the control, so it is confirmed that the solubilization capacity of the strain is at least maintained in these two formulations.

Example 3. Use of Formulations Comprising RGM 2450 and RGM 2529 Strains as Plant Biostimulants/Bioprotectants

[0122] 3.1 Study of Biostimulant Effect In Vitro.

[0123] Different treatments were applied to sterilized tomato seeds in the following bacterial resuspensions and emulsions: (i) resuspension of RGM 2450 strain, (ii) resuspension of RGM 2529 strain, (iii) mixture of both strains at a 1:1 ratio, (iv) emulsion of RGM 2450 strains, (v) emulsion of RGM 2529 strain, (vi) mixture of the strain emulsion at a 1:1 ratio.

[0124] To prepare for resuspension of bacteria in a NaCI solution, a colony of strains RGM 2450 and RGM 2529, each separate in 5 mL of LB medium, was inoculated to generate the pre-inoculums of the respective cultures. Pre-inoculums were incubated at 30? C. at 200 rpm, to a turbidity of 1.0 (?=600 nm). Flasks with LB medium were then inoculated with a 1% aliquot of pre-inoculum (i.e., 800 ?L pre-inoculum in 80 mL culture). RGM 2450 and RGM 2529 strains were grown for 20 h in LB medium at 30? C. A 25 mL aliquot of each culture was centrifuged at 2500 g for 10 minutes. Subsequently, the supernatant was removed and the cells were resuspended in an isotonic solution of 0.9% NaCI. Centrifugation, discard of the supernatant and resuspension in 0.9% NaCI solution was performed 3 times to remove residues from the culture medium. Finally, the cells were resuspended in a 0.9% NaCI solution supplemented with 0.01% Tween 20. The viable cell concentration of the resuspension of strains RGM 2450 and RGM 2529 in the isotonic NaCI solution was 4.7?10.sup.9 (?8?10.sup.8) and 1.8?10.sup.8 (?5?10.sup.7) CFU/mL, respectively. The cell concentration of the RGM 2529 strain is underestimated due to the formation of filamentous aggregates (Report 5), which prevent accurately determining the number of cells present, and the highest CFU/mL value that can be obtained per batch was used for these. The cell concentration used was based on the concentration of CFU/mL present in the commercial products registered in Chile as biostimulants: TRIBAC BIO (1?10.sup.9 CFU/mL, company ANASAC) and TIFI (2?10.sup.8 CFU/g, company Inpacta).

[0125] The bacterial emulsion described was prepared in two phases. In the first phase, 5.33 mL of oil and 0.22 mL of Tween 20 were added to a tube. The tube was stirred for 1 minute in the vortex. In the second phase, 0.47 mL of glycerol, 3.75 mL of Silwet and 5 mL of the bacterial suspension from the previous treatment were added with a concentration 20 times higher and stirred for 1 minute in the vortex. The contents of both tubes were then mixed and stirred for 1 minute. An aliquot of the homogenized mixture was taken and resuspended in 9 mL of sterile distilled water to obtain the diluted bacterial emulsion.

[0126] To apply the treatments, between 20 and 25 seeds were used per treatment including control. Seeds treated with bacterial resuspensions were incubated with bacterial cells for 45 min under gentle orbital agitation (100 rpm). The seeds that were treated with the bacterial emulsion were soaked for 5 min in the diluted emulsion. Seeds with the control treatment were treated with 0.9% NaCI.

[0127] The seeds of each treatment were sown in germination trays containing a mixture of 1:1 (v:v) autoclaved peat: vermiculite and incubated at 25? C.?2? C. with a photoperiod of 16 h light and 8 h dark (Mena-Violante and Olalde-Portugal, 2007; Vaikuntapu et al., 2014; Cordero et al., 2018). At 21 days of incubation, the following parameters were evaluated: wet biomass, dry biomass, root length, shoot length, tomato shoot length, and number of true leaves (Mena-Violante and Olalde-Portugal, 2007; Vaikuntapu et al., 2014; Cordero et al., 2018). To determine the dried biomass, the tomato seedlings were incubated at 80? C. for 48 h. After incubation they were brought to room temperature and their mass was determined. The results of the determination of the replicate growth parameters for each treatment are indicated in the supplementary tables present in the report appendix.

[0128] According to the experimental design, ANDEVA analyses of variance were performed based on the F-test, with a p-value=0.05 comparator, to determine the effect of experimental treatments compared to the control. Finally, significant statistical differences were determined by LSD test, p-value=0.05.

TABLE-US-00009 TABLE 9 Impact of the use of RGM 2450 and/or RGM 2529 strains on the development and growth of tomato seeds. Dry and wet biomass values are expressed in grams (g) while the length of shoots and roots are expressed in millimeters (mm). The standard deviation for each parameter is indicated in parentheses. Biomass Length No. of true Treatment Wet Dry Shoot Root leaves Control 0.07 0.004 77 43 1.8 (?0.02) (?0.001) (?14) (?7) (?0.4) Resuspension 0.11 0.006 76 41 2 RGM 2450 (?0.03) (?0.002) (?7) (?7) (?0.2) Emulsion RGM 0.08 0.007 73 50 1.9 2450 strain (?0.01) (?0.002) (?8) (?10) (?0.3) Resuspension RGM 0.10 0.007 74 61 2 2529 (?0.03) (?0.002) (?10) (?13) Emulsion RGM 0.10 0.005 75 49 1.9 2529 strain (?0.02) (?0.001) (?8) (?9) (?0.2) Resuspension 0.14 0.007 97 58 2.0 strain mixture (?0.03) (?0.001) (?10) (?9) (?0.3) Emulsion strain 0.11 0.006 89 49 2 mixture (?0.03) (?0.001) (?11) (?11)

TABLE-US-00010 TABLE 10 Percent comparison of the growth parameters of the tomato seeds. Values are expressed in percentages (%) difference between plants treated with different formulations of RGM 2450 and/or RGM 2529 versus the control group (untreated). Comparison between experimental treatment vs. control (%) Biomass Length No. of true Treatment Wet Shoot Root leaves Resuspension RGM 2450 55 ?1 ?5 7 Emulsion RGM 2450 strain 19 ?5 17 5 Resuspension RGM 2529 41 ?3 42 9 Emulsion RGM 2529 strain 36 ?2 14 6 Resuspension strain mixture 103 26 36 13 Emulsion strain mixture 62 16 15 9

[0129] Seedlings from seeds treated with bacterial resuspensions and emulsions after 21 days of growth showed a significant increase in wet and dry biomass compared to control treatment (Tables 9 and 10; FIGS. 13 and 14). The wet biomass of the experimental treatments showed an increase between 19% and 103%, while the evaluation of dry biomass indicated an increase between 19% and 63%. Regarding the length of the shoot, only the strain mixtures showed a significant increase, between 16% and 26%; the other treatments showed no significant differences compared to the control.

[0130] Seedlings inoculated with the experimental treatments, except for seed incubation treatment with the RGM 2450 strain suspension, had a significant increase in root length, between 15% and 42%, compared to the control. In the evaluation of the number of true leaves, the strain mixture treatments along with the resuspension treatment of the RGM 2529 strain had significant differences from the control.

[0131] It should be noted that the seeds inoculated with a mixture of the RGM 2450 and RGM 2529 strains in the NaCI solution (0.9%) showed the greatest increase in wet and dry biomass, shoot length, root length, and true leaves, obtaining 103%, 63%, 26%, 36%, and 13%, respectively, compared to the control treatment.

[0132] 3.2 Study of Bioprotectant Effect In Vitro.

[0133] 200 grape berries were washed with 0.1% detergent and after 15 minutes of washing, the water with detergent was discarded and the berries were disinfected with sodium hypochlorite (NaCIO.sub.3) at a final concentration of 0.5%. Berries were incubated with this disinfection solution for 3 minutes, then rinsed with sterile distilled water and deposited in an absorbent towel inside the laminar flow hood to remove excess water. After this, 4 berries per pile were used, where each pile corresponded to a repetition containing 4 experimental units (berries). Treatments consisted of inoculation of 2 ?L cell resuspension of B. safensis RGM 2450 (10.sup.10 CFU/mL), B. siamensis RGM 2529 (10.sup.6 CFU/mL), a mixture of both strains, commercial fungicide Serenade? (Bayer), and water. After 24 hours of inoculation with each treatment, 2 ?L spore resuspension of B. cinerea (10.sup.6 CFU/mL) was added. Inoculation was performed through a hole made in the berry with the tip of a syringe.

[0134] In a second trial, the same treatments were applied, but the commercial product's capacity was evaluated without the excipients contained in its formulation. For this, 1 mL of product was centrifuged at 5000 g for 10 minutes and the supernatant was discarded to obtain the active bacterial compound (B. subtillis QST 713 strain). The pellet was resuspended with 1 mL of distilled water to obtain cell suspension. Subsequently, 2 ?L of this solution was used to inoculate the corresponding experimental units.

[0135] After inoculation with B. cinerea, berries from both assays were incubated for 72 hours at 25? C. and high humidity, then the damage caused by the phytopathogen in the fruits was qualitatively assessed (FIG. 15 and Table 11).

TABLE-US-00011 TABLE 11 Evaluation of the antagonistic activity of PGPR strains against B. cinerea in grape berries. Diameters are expressed as the average lesion diameter, along with their standard deviation, for the results obtained from repeating the assay in quadruplicate. Lesion/Growth Inhibition percentage of Treatment Diameter (mm) B. cinerea (%) B. cinerea 8 ? 4 N.A. RGM 2450 1 ? 0.3 N.A. RGM 2529 2.3 ? 0.8 N.A. Strain mixture 2.6 ? 0.6 N.A. QST 713 0.8 ? 0.5 N.A. RGM 2450 vs. 4 ? 1 50 B. cinerea RGM 2529 vs. 4 ? 2 50 B. cinerea Strain mixture 50 5 ? 2 vs. B. cinerea QST 713 vs. B. 0 8 ? 3 cinerea

[0136] The assays show significantly greater inhibition of phytopathogen growth by the RGM 2450 and RGM 2529 strains, compared to the commercial product devoid of its coformulants (Bacillus subitillis QST 713 bacteria only), achieving a 50% inhibition percentage by using each RGM strain separately, and by applying a mixture of both.

Example 4. Field Test of PGPR Activity in Strains Bacillus safensis RGM 2450 and Bacillus siamensis RGM 2529: Greenhouse Tomato Culture

[0137] The objective of this application example is to evaluate the effect of inoculating the strains Bacillus safensis RGM 2450 and Bacillus siamensis RGM 2529, separately and together, on productive parameters in tomato plants under greenhouse conditions.

[0138] In particular, the effect of formulations in the wettable powder, effervescent tablet and extended-release tablet delivery formats on strains RGM 2450 and RGM 2529 is evaluated.

[0139] For the initial preparation of bacterial cultures of B. safensis RGM 2450 and B. siamensis RGM 2529, fermentation was carried out per batch fed in stirred tank bioreactors (Applikon (Applikon Biotechnology ?) up to 5 L of operation.

[0140] The obtained microbial concentrates were harvested and stored at 4? C. in sterile 2 L pyrex (Duran?) bottles. The concentrates were sampled monthly for 5 months maintaining their average viability at 10.sup.9 CFU/mL. These concentrates were used to inoculate seeds and prepare the different formulations: Extended-Release Tablet (ERT), Effervescent Tablet (ET) and Wettable Powder (WP). In addition, the different formulations were used in conjunction with different concentrations of extended-release fertilizers to determine the effect of bacteria on the tomato crop.

[0141] To facilitate understanding, the stages of the assay are presented sequentially, divided into the following phases: seed inoculation and transplant (4.1), differentiated fertilization (4.2), formulation preparation (5.3), application of formulations to plants (4.4), design of experiments (4.5), plant management (4.6), and determination of parameters of productive interest in tomato crops: determination of length, weight and tomatoes, and determination of chlorophyll (4.7). Finally, the results of the assay will be presented in point 4.8.

4.1. Seed Inoculation and Transplant.

[0142] The seeds used in this assay were of the Roma VF (Vita?) variety. Prior to inoculation, these were disinfected with 2% sodium hypochlorite for 3 mM, and then washed 5 times with sterile distilled water to remove the disinfectant. All treatments were inoculated with bacteria from seed (with the exception of the control). The bacteria were washed of the coadjuvants that may exist in the culture medium in which they grew that could interact with the plant and produce altered results due to the presence of nutrients. Washes were performed 3 times with sterile PBS buffer (137 mM NaCI, 2.7 mM KCI, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH=7.2) together with subsequent centrifugation at 5000 rpm?5 mM, discarding the supernatant after each centrifugation. The pellets were resuspended in PBS buffer with both strains remaining at a concentration of 10.sup.9 CFU/mL.

[0143] Subsequently, the seeds were soaked in buffer with the bacteria for 40 min stirred at 200 rpm. For the commercial control, the seeds were put into solution at the same concentration as the strains of interest, 10.sup.9 CFU/mL. After inoculation, the seeds were superficially sown into a composition substrate of 2:1:1 peat, perlite and compost, respectively, in trays 110 mm deep and with 5?5 cm surface area in the greenhouse. Subsequently, the resulting seedlings were transplanted into 5 L pots. The assay was performed in a 8?9 m (width?length) biosafety greenhouse with automatic irrigation and controlled temperature of 25? C.?5.

4.2 Differentiated Fertilization.

[0144] The assays used ANASAC Multicote Agri? fertilizer (12 m). It was added and homogenized with the substrate (described above). In addition, the fertilizer was added at different concentrations described in Table 12, to quantify the response (weight and caliber) of the fertilization-microorganism interaction.

TABLE-US-00012 TABLE 12 Different fertilization percentages used for each plant. 100% fertilization corresponds to the application dose as indicated by the manufacturer. % Grams of Multicote Fertilization Agri? (12 m)/Plant 0 0 33 13.2 66 26.4 100 40

4.3 Formulation Preparation

[0145] The formulations were made according to Table 13, showing the ingredients and concentrations used for the preparation of the different proposed bacterial formulations. To determine masses and volumes, the density of the bacteria in the liquid culture medium (microbial broth) was considered to be equal to 1 g/mL. To reach the indicated CFU/g concentration of product, it was necessary to dilute or concentrate the bacteria, as required. This was done in proportion to its ingredients, so that every 100 g of formula had a concentration of 2*10.sup.10 CFU.

[0146] Wettable powder (WP), extended-release tablet (ERT) and effervescent tablet (ET) formulations were prepared.

TABLE-US-00013 TABLE 13 Ingredients and concentrations for the preparation of the different proposed bacterial formulations. mg/g CFU/g of Product Ingredients product product Wettable powder Silicon dioxide 150 10.sup.8 (WP) Potato starch 170 bacteria 680 Extended-release Wheat Flour 280 tablet (ERT) Corn starch 280 gelatin 18 Hot water (gelatin) 140 bacteria 280 Effervescent Citric acid 300 tablet (ET) Sodium bicarbonate 660 bacteria 33

4.4 Application of Formulations to Plants

[0147] The application of the bacteria was carried out in the formulation formats already described: ERT, ET and WP. Applications were made at the base of the plant stem in the 5 L pot.

[0148] The ET and WP formulations were dissolved in water to apply no more than 10 mL per pot, equivalent to 10.sup.8 CFU/plant (also for commercial control). The ERT was introduced into the substrate at the base of the plant, between the stem and automatic irrigation dropper, and its concentration was also equivalent to 10.sup.8 CFU/plant. Formulations were applied at 60 d from the start of culture.

4.5 Design of Experiments

[0149] The experiment was designed with the formulations ERT, ET and WP, plus a commercial control and witness together with 4 doses of differentiated fertilization (Table 13), resulting in a total of 44 treatments (Table 14), with 3 replicates each, resulting in 132 pots in total. A single evaluation was performed at its production stage at the end of the culture. The assessments were the accumulated tomato weight at the seventh week of cultivation along with its caliber and the chlorophyll in the foliage.

TABLE-US-00014 TABLE 14 Treatment table. Percentages correspond to fertilizations of Multicote Agri in combination with formulations (ERT, ET and WP) and bacteria RGM 2529 and RGM 2450, and their Mixture (1:1). No. Treatment 1 Control 0% 2 Control 33% 3 Control 66% 4 Control 100% 5 Commercial 0% 6 Commercial 33% 7 Commercial 66% 8 Commercial 100% 9 Mix ERT 0% 10 Mix ERT 33% 11 Mix ERT 66% 12 Mix ERT 100% 13 Mix ET 0% 14 Mix ET 33% 15 Mix ET 66% 16 Mix ET 100% 17 Mix WP 0% 18 Mix WP 33% 19 Mix WP 66% 20 Mix WP 100% 21 2529 ERT 0% 22 2529 ERT 33% 23 2529 ERT 66% 24 2529 ERT 100% 25 2529 ET 0% 26 2529 ET 33% 27 2529 ET 66% 28 2529 ET 100% 29 2529 WP 0% 30 2529 WP 33% 31 2529 WP 66% 32 2529 WP 100% 33 2450 ERT 0% 34 2450 ERT 33% 35 2450 ERT 66% 36 2450 ERT 100% 37 2450 ET 0% 38 2450 ET 33% 39 2450 ET 66% 40 2450 ET 100% 41 2450 WP 0% 42 2450 WP 33% 43 2450 WP 66% 44 2450 WP 100%

4.6 Plant Management

[0150] The plants were managed by performing the following applications and techniques: [0151] 1. Calcium application: due to the nutritional calcium requirements of the variety used. In total, 4 Ultrasol? Calcium applications were performed, adding 0.8 g/plant in each application. [0152] 2. Apical cutting: at 100 days the apex of all plants was cut in order to slow vegetative growth and begin the development and maturation of fruits. [0153] 3. Debudding: All plants were debudded as these were detected. 4. Stripping: after 120 days of cultivation, all the leaves below the first bunch were cut with scissors, leaving only 1 leaf (the closest one) below it. This helps air flow between plants and improves fruit caliber.

4.7 Determination of Parameters of Productive Interest in Crops

[0154] Two general parameters of productive interest were determined or defined: 1. length, weight and tomatoes (number), and 2. concentration of chlorophyll. The protocols for each case are described below:

[0155] 1. Determination of Length, Weight and Tomatoes (Number)

[0156] Tomatoes were evaluated by measuring their wet weight immediately after harvesting on a digital scale. The caliber was measured with a caliper at the longitudinal and equatorial diameter. The values were recorded on worksheets that were subsequently transferred to the database of cumulative weights and average diameters (equatorial and longitudinal). The results were tabulated and plotted as a surface response in Excel (Office 365) and statistically analyzed with the LSD test (a=0.05) in the program Statgraphic Centurion XVI (Statgraphics Technologies, Inc., USA).

[0157] 2. Determination of Chlorophyll

[0158] Chlorophyll was measured by removing the first three true leaves below the apex of each plant. From these, a segment was removed from the center of the leaf, attached to the central rib, not counting the latter, to complete 80 mg of leaves according to the methodology proposed by Wellburn (1994). For quantification of chlorophyll A and B: the collected leaves were frozen and stored at ?20? C., then for each quantification, 0.5 mL of dimethyl sulfoxide (DMSO, EMSURE?) was added to 80 mg of leaves sprayed with liquid nitrogen in a microtube covered with aluminum foil. The solution was homogenized with a vortex. An additional 0.5 mL of DMSO was then added, and the mixture was incubated in a water bath at 65? C. for two hours, followed by incubation at room temperature for 20 minutes. Finally, the content was centrifuged to avoid interference from suspended solids, and absorbance was measured using a spectrophotometer (Bioware WPA). The chlorophyll content was calculated using the following formulas (Wellburn 1994): Formula 1: Chlorophyll a (?g mL?1)=12.47*A665.1?3.62*A649.1 Formula 2: Chlorophyll b (?g mL?1)=25.06*A649.1?6.5*A665.1

4.8 Assay Results

[0159] Treatments generally showed qualitative and quantitative effects.

[0160] Qualitatively, for the different treatments of the bacterial mixture, a robust pattern was observed with abundant leaf mass and smaller plant size. Fresh weight, dry weight and plant length were not evaluated in this assay because all treatments were debudded, stripped, and the main apex was removed to stop their apical growth and promote fruit maturation.

[0161] As for the caliber of the tomatoes, through the seventh week of harvest, calibers have no statistically significant difference between most treatments, differing only in some extreme treatments, e. g., Control vs Mixture. The average gauge is between 40 and 50 mm.

[0162] The parameter of cumulative tomato weight per treatment had statistically significant differences between most treatments through the seventh week of harvest. The treatment that had a statistically significant difference response compared to all other treatments was the Mix WP 66% fertilization, with a peak exceeding 900 g, far exceeding the control and commercial treatments (FIG. 16).

[0163] Finally, when the concentration of chlorophyll (?g/mL) was determined at the seventh week of harvest, significant statistical differences were observed between most treatments. The treatment that had a statistically significant response different from all other treatments was the Mix ERT 100% fertilization, exceeding 250 ?g/mL chlorophyll (FIG. 17).

Example 5. Study to Predict Antimicrobial Compounds and Enzymes of Bacillus safensis RGM 2450 and Bacillus siamensis RGM 2529

[0164] The genomes of Bacillus safensis RGM 2450 and Bacillus siamensis RGM 2529 were sequenced, assembled and analyzed.

[0165] Bioinformatics analysis identified and predicted genes involved in the synthesis of different ribosomal and non-ribosomal peptides.

[0166] Table 15 presents the results obtained for B. safensis RGM 2450 regarding antimicrobial compounds that would be secreted by B. and potential white phytopathogens. Table 16 describes the potential enzymes it would secrete.

[0167] B. safensis RGM 2450 has the ability to produce antimicrobial compounds as microkines.

[0168] According to the analysis, when comparing the gene cluster of the RGM 2450 strain to the gene cluster of the B. pumilus ATCC 7061 and B. venelenzis FZB42 strains that are involved in the synthesis of plantazolicin, it is possible to determine that the RGM 2450 strain has 11 of the 12 genes of the pzn gene cluster that are involved in the synthesis and transport of the microkine plantazolicin (FIG. 18). This microkine has been described as having antibacterial activity against bacteria such as Brevibacillus brevis, Bacillus cereus, Bacillus licheniformis, other Bacillus species, Micrococcus luteus, and Paenibacillus granivorans (Table 15).

[0169] B. safensis RGM 2450 has the ability to produce the non-ribosomal peptide bacillibactin. According to the analysis of the RGM 2450 genome, the DhbACEBF gene cluster (FIG. 19A) was predicted to be involved in the synthesis and assembly of the bacillibactin siderophore along with genes involved in the transport (FeuABC-YusV) and hydrolysis of the siderophore for the release of Fe+3 (FIG. 19B). Bacillibactine has previously been recognized for its inhibitory activity against the fungus F. oxysporum f sp. capsici (Table 15).

[0170] The analysis also predicted the potential production of cyclolipopeptide. Particularly, a 46673 bp gene cluster consisting of 5 biosynthetic genes encoding modular proteins that make up a non-ribosomal peptide synthetase was predicted (FIG. 20A). Based on the bioinformatics prediction, the ribosomal peptide synthetase is encoded by 5 genes, of which gene 1 (10707 bp) encodes a multimodular protein that would be involved in the synthesis of a three amino acid peptide (leucine-leucine-glutamine), gene 2 (10701 bp) encodes the synthesis of a second module involved in the synthesis of a three amino acid peptide (leucine-aspartic acid-X (unable to predict)), gene 3 is involved in the addition of the amino acid isoleucine, gene 4 presents two modules that would allow the addition of the amino acid valine and an acetyl-CoA molecule, which could be involved in peptide cycling. Gene 5 presents two modules that are involved in the addition of another amino acid (X) and a fatty acid (FIGS. 20B and 20C), a background that suggests that the potential structure that could be formed is a cyclolipopeptide.

[0171] Then, to define which molecules could correspond to this potential cyclolipopeptide that the RGM 2450 strain would produce, the search and comparison of the gene cluster in other sequenced strains was performed, observing a high degree of conservation (synthenia) in species B. safensis and B. pumilus, suggesting that it plays an important role in secondary metabolism (FIG. 21A). However, a portion of the genes shows homology with the cluster involved in the synthesis of the surfactant lichenysin, described in B. licheniformis DSM 13 (FIG. 21B).

[0172] When predicting the synthesis of the antibiotic bacilysin by bioinformatic analysis, the genes that were part of the bacABCDE gene cluster involved in its synthesis were identified (FIG. 22A). This compound is a dipeptide antibiotic consisting of an L-alanine residue that is bound to a non-proteinogenic amino acid, L-anticapsin (FIG. 22B). The gene cluster that participates in the synthesis of bacilysin as its gene neighborhood are highly conserved in Bacillus and phylogenetically close to B. safensis (FIG. 22C).

[0173] In addition, B. safensis RGM 2450 can potentially secrete various enzymes such as proteases, metalloproteases and lipases, among others (Table 16).

TABLE-US-00015 TABLE 15 Compounds that would be secreted by B. safensis RGM 2450 and potential white phytopathogens. Compound Antibacterial activity Antifungal activity Reference Plantazolicin Brevibacillus brevis, Scholz et al., 2011 (microkine) Bacillus cereus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus sphaericus, B. subtilis, Micrococcus luteus, Paenibacillus granivorans. Bacillibactin F. oxysporum f sp. Yu et al., 2011 (siderophore) capsici Bacilysin Clavibacte Candida albicans, Kenig et al., 1976; Kenig and (dipeptide) michiganense subsp. Microcystis aeruginosa, Abraham, 1976; Loeffler et sepedonicum, Erwinia Phytophthora infestans, al., 1986; Zuber et al., 1993; amylovora, Escherichia S. cerevisiae, Aspergillus Steinborn et al., 2005; Chen coli, Salmonella typhi, fumigatus, Candida et al., 2009; Wu et al., 2014; Staphylococcus aureus, albicans Wu et al., 2015a; Caulier et Streptococcus pyogenes al., 2018

TABLE-US-00016 TABLE 16 Potential enzymes that would be secreted by B. safensis RGM 2450. Extracellular enzymes Protease, alkaline protease 2 proteases, subtilisin type E Protease, Bacillopeptidase F (EC 3.4.21.-) Protease, metalloprotease Protease, Serine protease AprX Lipase, lipase (EC 3.1.1.3) Lactonase, YtnP Lactonase

[0174] For its part, B. siamensis RGM 2529 would secrete bacteriocins such as amylocyclicin. Based on the genome analysis of the RGM 2529 strain, the 4170 bp acnABCDEF gene cluster that would be involved in the synthesis, maturation and self-protection of the antimicrobial peptide (bacteriocin) amylocyclicin was predicted (FIG. 23A). The acnABCDEF gene cluster encoding aminocyclin has been found in strains of the species Bacillus amyloliquefaciens and B. velezensis, which has been widely described for its PGPR activity (FIG. 23B). Amylocyclicin has been described in the literature as having antibacterial activity against Brevibacillus brevis, Bacillus cereus, Bacillus licheniformis, Bacillus megaterium, B. pumilus, Bacillus sphaericus, B. subtilis, Clavibacter michiganensis, Micrococcus luteus, Paenibacillus granivorans, and Paenibacillus polymyxa (Table 17)

[0175] From the analyses, it is demonstrated that B. siamensis RGM 2529 presents the DhbACEBF gene cluster that is involved in the synthesis of bacillibactin (FIG. 24), a siderophore with antifungal activity against F. oxysporum f sp. capsici (Table 17). It also presents the 4 genes (surfAA, surfAB, surfAC, and surfAD) that are involved in the biosynthesis and assembly of the amino acids that make up surfactin (FIG. 25A). Based on the analysis of the surfactin gene cluster in strains phylogenetically close to the RGM 2529 strain (FIG. 25B), comparing the surfAB homolog of B. velezensis ZB42 with that of RGM 2529 yields 94.95% identity and 73% coverage. Meanwhile, the surfAC gene encodes a ribosomal peptide synthetase consisting of one module involved in leucine assembly. Comparing the surfAC homolog of B. amyloliquefaciens ZB42 to that of RGM 2529 yields 94.95% identity and 100% coverage. Finally, the surfAD gene encodes a thioesterase. Comparing the surfAD homolog of B. velezensis ZB42 with that of RGM 2529 yields 95.36% identity and 100% coverage.

[0176] For fengycin, a compound previously described as antifungal, a 49465 bp gene cluster was also predicted to be involved in the synthesis of this lipopeptide. This gene cluster is made up of 5 genes (fenA, fenB, fenC, fenD, and fenF) that encode the non-ribosomal peptide synthetases that assemble this cyclolipopeptide along with other genes involved in its structural modification (FIG. 25A). This gene cluster has been found in strains belonging to the species B. amyloliquefaciens, B. velezensis and B. siamensis (FIG. 25B). The assembly of amino acids by synthetases gives rise to a cyclodecapeptide that, together with the action of the fatty acid enzyme ligase (long chain fatty acid CoA ligase), form a cyclolipopeptide (FIG. 26C).

[0177] Adjacent to the gene cluster involved in the synthesis of fengycin, the operon bamABCD involved in the synthesis of another lipopeptide, bacillomycin D, was found (FIG. 27A). This operon covers 37696 bp and has been described in species B. amyloliquefaciens, B. velezensis and B. siamensis (FIG. 27B).

[0178] It has been described that bacillomycin D can remove fungi from different genus and species, including Alternaria alternata, Alternaria solani, Botrytis cinerea, Aspergillus flavus' Botryosphaerica ribis, C. albicans, Cryphonectria parasitica, Colletotrichum acutatum, Colletotrichum gloesporioides, Didymella bryoniae, Fusarium graminearum, Fusarium sambucinum, Fusarium oxysporum, Podosphaera fusca, Pythium sulcatum, Pythium ultimum, Rhizoctonia solani, Rhizopus sp., Sclerotinia sclerotiorum, Ustilago maydis, Monilinia fructicola, Penicillium expansum, Phomopsis gossypii, Phytophthora capsici, Pyricularia grisea, R. solani, Sclerotium rollsii, and Sclerotinia sclerofiorum (Table 17).

[0179] A 72346 bp gene cluster (FIG. 28A) encoding a hybrid between a polyketide synthase and a non-ribosomal peptide synthetase (PKS-NRPS) involved in the production of the antibiotic bacillaene, an inhibitor of prokaryotic protein synthesis, was also predicted. The bacillaene synthase of the RGM 2529 strain consists of 13 PKS modules and 3 NRPS modules, as described in velezensis FZB42 and Bacillus subtilis 168 (FIG. 28B).

[0180] Therefore, B. siamensis RGM 2529 can potentially produce the antibacterial and antifungal compound bacillaene, for which it has been described as having potential for action against bacteria such as B. thuringiensis, E. coli, Klebsiella pneumoniae, M xanthus, P. vulgaris, Serratia marcescens, and S. aureusy. In the case of fungi, it has been described that bacillaene has inhibitory activity against Coriolopsis spp., Fusarium sp, Pseudoxylaria sp., Trichoderma sp., and Umbelopsis sp. (Table 17).

[0181] Finally, B. siamensis RGM 2529 would also be able to secrete protease, lipase, lactonase, and cellulase enzymes (Table 18).

TABLE-US-00017 TABLE 17 Compounds that would be secreted by B. siamensis RGM 2529 and potential white phytopathogens. Compound Antibacterial activity Antifungal activity Reference Amylocyclicin Brevibacillus brevis, Bacillus Scholz et al., 2014 (bacteriocin) cereus, Bacillus licheniformis, Bacillus megaterium, B. pumilus, Bacillus sphaericus, B. subtilis, Clavibacter michiganensis, Micrococcus luteus, Paenibacillus granivorans, Paenibacillus polymyxa Fengycin Alternaria solani, Cawoy et al., 2014; (lipopeptide) Botrytis cinerea, Ongena et al., 2005; Fusarium Ramarathnam et al., graminearum, 2007; Romero et al., Fusarium 2007; Guo et al., 2014; sambucinum, Wise et al., 2014; Zhao Fusarium et al., 2014 oxysporum, Podosphaera fusca, Pythium sulcatum, Pythium ultimum, Rhizoctonia solani, Rhizopus sp., Sclerotinia sclerotiorum Bacillomycin D Alternaria alternata, Moyne et al. 2001; (lipopeptide) A. solani, Gong et al., 2014; Aspergillus flavus, Zhao et al., 2010; Yuan Botryosphaerica et al., 2012; Tanaka et ribis, C. albicans, al., 2014 Cryphonectria parasitica, Colletotrichum acutatum, Colletotrichum gloesporioides, Didymella bryoniae, F. graminearum, F. oxysporum, Ustilago maydis, Monilinia fructicola, Penicillium expansum, Phomopsis gossypii, Phytophthora capsici, Pyricularia grisea, R. solani, Sclerotium rolfsii, S. sclerotiorum Surfactin L. pneumophila, L. A. niger, B. cinerea, Bais et al., 2004; (lipopeptide) monocytogenes, P. syringae, F. oxysporum, F. Cawoy et al., 2014; R. solanacearum, S. aureus, solani, Monilia Preecha et al., 2010; Xanthomonas axonopodis pv. fructigena, Gao L. et al., 2017; glycines Pennicilium Romano et al., 2013; expansum, P. Sabat? and Audisio, italicum, R. solani 2013; Kwon and Kim, 2014; Loiseau et al., 2015; Luo et al., 2014 Bacillibactin F. oxysporum f. sp. Yu et al., 2011 (siderophore) capsici Bacillaene B. thuringiensis, E. coli, Choriolopsis spp., Patel et al., 1995; Um (polyene) Klebsiella pneumoniae, M. Fusarium sp, et al., xanthus, P. vulgaris, Serratia Pseudoxylaria sp., 2013; Muller et al., marcescens, S. aureus Trichoderma sp., 2014 Umbelopsis sp. Aurantinin S. aureus ATCC 25923, M. Couler et al., 2019 luteus CMCC 28001, B. pumilus CMCC 63202, B. cereus ATCC 14579, B. subtilis ATCC 168, Listeria monocytogenes CICC 21662, Enterococcus faecalis ATCC 29212, and P. fluorescens ATCC 49642

TABLE-US-00018 TABLE 18 Potential enzymes that would be secreted by B. siamensis RGM 2529. Extracellular enzymes Protease, Serine protease AprX Protease, Subtilisin E (EC 3.4.21.62) Protease, Bacillopeptidase F (EC 3.4.21.-) Protease, Bacillolysin, Metalloprotease (EC 3.4.24.28) Lipase, Lipase (EC 3.1.1.3) Lactonase, YtnP Lactonase Cellulase, beta-1,4-glucanase (EC 3.2.1.4)

LITERATURE

[0182] Mayak S., Tirosh T., Glick B. R. 2004. Plant growth promoting bacteria that confer resistance to water stress in tomato and pepper. Plant Sci. 166; 525-530. [0183] Criollo P, Obando M, Sanchez L, Bonilla R. (2012) Effect of plant growth-promoting rhizobacteria (PGPR) associated to Pennisetum clandestinum in the highlands of Cundiboyacense. Slurry Corpoica, Vol. Agriculture Technology 13 No. 2 [0184] Altier N, Beyhaut E, Dalla M, Rivas F. (2012). Environmental Sustainability: Platform for bio-inputs for agricultural use based on beneficial microorganisms. INIA Uruguay Magazine No. 29, 47-50. [0185] Hayat R, Ali S, Amara U, Khalid R, Ahmed I (2010) Soil beneficial bacteria and their role in plant growth promotion: a review. Ann Microbiol 60(4), 579-598. [0186] Etesami H, Emami S, Alikhani HA. (2017). Potassium solubilizing bacteria (KSB): Mechanisms, promotion of plant growth, and future prospectsA review. Journal of soil science and plant nutrition, 17: 897-911 [0187] Yadav S., Kaushik R, Saxena A. K. & Arora D. K. 2011. Genetic and functional diversity of Bacillus strains in the soils longterm irrigated with paper and pulp mill effluent. J. Gen. Appl. Microbiol. 57: 183-195. [0188] Chakraborty U., Chakraborty B. N., Chakraborty A. P. & Dey P. L. 2013. Water stress amelioration and plant growth promotion in wheat plants by osmotic stress tolerant bacteria. World J. Microbiol Biotechnol. 29: 789-803. [0189] Kavamura V. N., Santos S. N., Silva J. L., Parma M. M., Avila L. A., Visconti A., Zucchi T. D., Taketani R. G., Andreote F. D. & Melo I. S. 2013. Screening of Brazilian cacti rhizobacteria for plant growth promotion under drought. Microbiol. Res. 168: 183-191 [0190] Sun H., He Y., Xiao Q., Ye R. & Tian Y. 2013. Isolation, characterization, and antimicrobial activity of endophytic bacteria from Polygonum cuspidatum. Mr. J. Microbiol. Res. 7 1496-1504 [0191] Jeong H, Jeong D E, Kim S H, Song G C, Park SY, Ryu C M, Park S H, Choi S K. 2012.Draft Genome Sequence of the Plant Growth-Promoting Bacterium Bacillus siamensis KCTC 13613. J Bacteriol. 194:4148-4149. doi: 10.1128/JB.00805-12. [0192] Wu, L., Wu, H. J., Qiao, J., Gao, X., and Borriss, R. (2015). Novel routes for improving biocontrol activity of Bacillus based bioinoculants. Front. Microbiol. 6:1395. [0193] Haeyoung Jeong, Da-Eun Jeong, Sun Hong Kim, Geun Cheol Song, Soo-Young Park, Choong-Min Ryu, Seung-Hwan Parkand Soo-Keun Choi (2012). Draft Genome Sequence of the Plant Growth-Promoting Bacterium Bacillus siamensis KCTC 13613. J Bacteriol. 194(15): 4148-4149. [0194] Borriss, R. (2011). Use of plant-associated Bacillus strains as biofertilizers and biocontrol agents, in Bacteria in Agrobiology: Plant Growth Response, ed D. K. Maheshwari (Heidelberg: Springer), 41-76. [0195] Agbaje Lateef, Isiaka Adedayo Adelere and Evariste Bosco Gueguim-Kana. (2015). The biology and potential biotechnological applications of Bacillus safensis. Biology 70/4: 411-419, 2015 Section Cellular and Molecular Biology.