METHODS AND COMPOSITIONS FOR REDUCING INDEX HOPPING
20240093287 ยท 2024-03-21
Inventors
- Keith Robison (Andover, MA)
- Douglas G. Smith (Walnut Creek, CA, US)
- Adam J. Meyer (Boston, MA, US)
- Andrew J. Mitchell (Framingham, MA, US)
- Alex Plocik (Auburndale, MA, US)
- Thomas F. Knight (Belmont, MA, US)
Cpc classification
C12Q2549/10
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Q2549/10
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure relates to compositions and methods for reducing the concentration of extendable free and buried primers relative to amplification product in a sample. The disclosed methods and compositions can be used to reduce or eliminate index hopping in a next generation sequencing (NGS) platform.
Claims
1. A method for generating a sequencing sample comprising indexed sequencing templates, the method comprising subjecting a sample comprising indexed sequencing templates and extendable free or buried primers to a process that reduces the concentration of free or buried primers relative to the concentration of indexed sequencing templates to generate a sequencing sample that is less prone to index hopping when subjected to a next generation sequencing (NGS) assay.
2. The method of claim 1, wherein the indexed sequencing templates are indexed amplification products.
3. The method of claim 1, wherein the indexed sequencing templates comprise unique dual index (UDI) sequences.
4. The method of claim 1, wherein the indexed sequencing templates together comprise at least 100 unique barcode sequences.
5. The method of claim 1, wherein the method further comprises performing a next generation sequencing (NGS) assay on the sequencing sample.
6. The method of claim 1, wherein the process that reduces the relative concentration of extendable free or buried primers comprises performing high pressure liquid chromatography (HPLC).
7. The method of claim 6, wherein the HPLC is performed under denaturing conditions.
8. The method of claim 1, wherein the process that reduces the relative concentration of extendable free or buried primers comprises contacting the indexed sequencing template with terminal deoxy transferase (TdT) and dideoxynucleotide triphosphates (ddNTPs).
9. The method of claim 8, further comprising contacting the indexed sequencing template with a reagent that frees buried primers.
10. The method of claim 9, wherein the reagent that frees buried primers is a protein reagent.
11. The method of claim 10, wherein the protein that frees buried primers is single stranded binding protein (SSB), recA, or UvrB.
12. The method of claim 1, wherein the process that reduces the relative concentration of free or buried primers comprises contacting the indexed sequencing template with a killer oligonucleotide and a ligase, wherein the killer oligonucleotide comprises a region having a sequence complementary to that of a region of the primer, and wherein when the killer oligonucleotide is hybridized to the primer, the ligase is capable of ligating the killer oligonucleotide to the primer.
13. The method of claim 12, wherein the killer oligonucleotide comprises a 5 phosphate.
14. The method of claim 12, wherein the killer oligonucleotide comprises a 3 ddNTP.
15. The method of claim 12, wherein the ligase is TAQ ligase.
16. The method of claim 1, wherein the process that reduces the relative concentration of extendable free or buried primers comprises contacting the indexed sequencing template with a scavenger nucleic acid molecule, wherein the scavenger nucleic acid molecule comprises a region having a sequence complementary to that of a region of the primer.
17. The method of claim 16, wherein the scavenger nucleic acid molecule comprises a 3 ddNTP.
18. The method of claim 1, wherein the process that reduces the relative concentration of extendable free or buried primers comprises (i) performing an amplification reaction on the indexed sequencing template using primers comprising a capture moiety to produce a capture moiety-tagged amplification product, and (ii) purifying the capture moiety-tagged amplification product.
19. The method of claim 18, wherein the capture moiety comprises biotin.
20. A sequencing sample generated according to the method of claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
DETAILED DESCRIPTION
[0035] In certain aspects, provided are methods for reducing or eliminating index hopping in next generation sequencing (NGS) platforms, as well as compositions and kits used in the performance of such methods.
[0036] The present disclosure pertains to methods and compositions for reducing or eliminating the incidence of index hopping in next generation sequencing (NGS) applications. This disclosure is based, at least in part, on the discovery that performing certain processes that reduce the relative concentration of extendable free and/or buried primers in a sample comprising a indexed sequencing templates (e.g., an indexed amplification products) prior to sequencing reduces index hopping in NGS platforms. For example, this can be accomplished by reducing the total amount of free and/or buried primers and/or by neutralizing present free and/or buried primers such that they cannot be extended during the sequencing process. In certain embodiments, the processes provided herein can be used in combination to further reduce the relative concentration of extendable free and/or buried primers. Thus, in certain aspects, provided herein are methods for reducing the relative concentration of extendible free and/or buried primers that can be applied to an indexed sample prior to the performance of multiplex NGS in order to reduce or eliminate the incidence of index hopping.
[0037] Provided herein are various processes for reducing or eliminating index hopping in next generation sequencing (NGS) platforms, each of which can be performed alone or in combination with other index hopping reduction processes. Thus, in some embodiments, any step, reagent, or equipment in any method described can be combined with any other step, protocol, reagent, equipment, etc., of any other method described. In some embodiments, the present disclosure pertains to a method for reducing or eliminating index hopping during a NGS assay, wherein the method comprises any two or more step(s), protocol, reagent(s), equipment, etc., described for any method described.
[0038] In certain embodiments of the methods provided herein, pooled indexed samples are treated with a process for reducing index hopping provided herein and then assayed for the presence or absence of a nucleic acid molecule using a NGS assay. In one embodiment, the method of generating the indexed samples comprises performing a multiplex reverse transcription polymerase chain reaction (RT-PCR) with barcoded (e.g., DNA barcoded) primers.
[0039] In some embodiments, a process for reducing or eliminating index hopping in next generation sequencing (NGS) platforms provided herein can be used in combination with a method for detecting a nucleic acid molecule in a sample that comprises the steps of: collecting a sample from an individual or a pool of individuals; preparing the sample (e.g., extracting RNA from the sample); amplifying nucleic acids in the sample, using primers which are complementary to at least a portion of a target nucleic acid sequence or a control nucleic acid sequence and which comprise a unique DNA barcode (index); optionally, cleaning up the sample; optionally, combining products of the amplification of multiple samples; sequencing the amplified nucleic acids; deconvoluting the results using the DNA barcodes (indexes) to correlate results with individuals or pools of individuals; and communicating the results to the individuals or pools of individuals.
Samples
[0040] In certain embodiments, the methods provided herein are directed to processing indexed sequencing templates (e.g., indexed amplification products) generated by an amplification or primer extension reaction of a target nucleic acid in a sample. In some embodiments, the sample used to generate the indexed sequencing templates, is a biological sample that contains nucleic acid molecules. Non-limiting examples of the source of the sample include saliva, blood, plasma, serum, lymph fluid, nasal discharge, or aspirate, or a sample obtained for example by surgery or autopsy. In some embodiments, the sample is a saliva, blood, serum, plasma, urine, or a mucous sample, or a test sample derived from a saliva, blood, serum, plasma, urine, or a mucous sample. In some embodiments, the sample is a sample of saliva and/or a sample derived from saliva. In certain embodiments, the sample is a human sample (e.g., a patient sample).
[0041] In some embodiments, the sample is a pool sample (or pooled sample) collected from a plurality of individuals (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, or more individuals). In some embodiments, pool testing is effective for economically diagnostically testing groups of individuals, as the testing of pool samples consumes fewer reagents, less lab time, etc., than testing the corresponding individual samples. In some embodiments, a pooled sample is collected from a plurality of individuals who have each previously been tested to be negative in a diagnostic test. In some embodiments, once an individual in the pool is tested to be positive in a diagnostic test, the individual is removed from the pool. In some embodiments, if a pooled sample is tested to be positive, samples from each individual are separately tested to determine which individual(s) are positive.
[0042] In some embodiments, the sample is a derived from or comprises a cell culture. Methodologies for passaging existing cultures of adherent or suspension mammalian cells are known in the art and can be used to prepare or maintain samples for use in the assays described. Cells can be further propagated, frozen, or used towards other protocols. Such methods for propagating, freezing, or otherwise using cells are known in the art. In some embodiments, the cells are used as controls; for example, HEK293t cells can be used as a control cell that expresses a particular nucleic acid molecule.
[0043] In some embodiments, a patient sample is collected and/or prepared using any steps, protocols, reagents, equipment, etc., described and/or known in the art.
Amplification
[0044] In some embodiments, provided herein are methods of preparing a sequencing sample comprising indexed sequencing templates, wherein the indexed sequencing templates are amplification products. In certain embodiments, the methods further comprise the step of generating the indexed sequencing templates from sample nucleic acid molecules. In some embodiments, the nucleic acid molecule is amplified by PCR, including but not limited to RT-PCR. In some embodiments of the methods provided, following sample collection and preparation, and nucleic acid (e.g., DNA or RNA) extraction, the sample (or a portion thereof being tested for comprising a nucleic acid molecule) can be subjected to PCR with various primers to detect the target nucleic acid molecule. Protocols for PCR and RT-PCR are well-known. For example, with RT-PCR, an RNA or control nucleic acids can first be treated with reverse transcriptase and a primer (e.g., a primer with an index sequence provided) to create cDNA prior to detection, quantitation and/or amplification.
[0045] By amplification is meant any process of producing at least one copy of a nucleic acid, or producing multiple copies of a polynucleotide of interest. An amplification product can be RNA (e.g., viral RNA) or DNA (e.g., cDNA), and may include a complementary strand to the target sequence. DNA amplification products can be produced initially through reverse translation and then optionally from further amplification reactions. The amplification product may include all or a portion of a target sequence, and may optionally be labeled. A variety of amplification methods are suitable for use, including polymerase-based methods and ligation-based methods. Examples of amplification techniques include the polymerase chain reaction method (PCR), isothermal amplification, and the like.
[0046] Asymmetric amplification reactions may be used to preferentially amplify one strand representing the target sequence that is used for detection. In some cases, the presence and/or amount of the amplification product itself may be used to determine the expression level of a given target sequence. In other instances, the amplification product may be used to hybridize to an array or other substrate comprising sensor polynucleotides which are used to detect and/or quantitate target sequence expression.
[0047] The first cycle of amplification in polymerase-based methods typically forms a primer extension product complementary to the template strand. If the template is single-stranded RNA, a polymerase with reverse transcriptase activity is used in the first amplification to reverse transcribe the RNA to DNA, and additional amplification cycles can be performed to copy the primer extension products. The primers for a PCR must, of course, be designed to hybridize to regions in their corresponding template that can produce an amplifiable segment; thus, each primer must hybridize so that its 3 nucleotide is paired to a nucleotide in its complementary template strand that is located 3 from the 3 nucleotide of the primer used to replicate that complementary template strand in the PCR.
[0048] The target polynucleotide can be amplified by contacting one or more strands of the target polynucleotide with a primer and a polymerase having suitable activity to extend the primer and copy the target polynucleotide to produce a full-length complementary polynucleotide or a smaller portion thereof. Any enzyme having a polymerase activity that can copy the target polynucleotide can be used, including DNA polymerases, RNA polymerases, reverse transcriptases, enzymes having more than one type of polymerase or enzyme activity. The enzyme can be thermolabile or thermostable. Mixtures of enzymes can also be used.
[0049] Suitable reaction conditions are chosen to permit amplification of the target polynucleotide, including pH, buffer, ionic strength, presence and concentration of one or more salts, presence and concentration of reactants and cofactors such as nucleotides and magnesium and/or other metal ions (e.g., manganese), optional cosolvents, temperature, thermal cycling profile for amplification schemes comprising a polymerase chain reaction, and may depend in part on the polymerase being used as well as the nature of the sample. Cosolvents include formamide (typically at from about 2 to about 10%), glycerol (typically at from about 5 to about 10%), and DMSO (typically at from about 0.9 to about 10%). Techniques may be used in the amplification scheme in order to minimize the production of false positives or artifacts produced during amplification. These include touchdown PCR, hot-start techniques, use of nested primers, or designing PCR primers so that they form stem-loop structures in the event of primer-dimer formation and thus are not amplified. Techniques to accelerate PCR can be used, for example, centrifugal PCR, which allows for greater convection within the sample, and/or infrared heating steps for rapid heating and cooling of the sample. One or more cycles of amplification can be performed. An excess of one primer can be used to produce an excess of one primer extension product during PCR; preferably, the primer extension product produced in excess is the amplification product to be detected. A plurality of different primers may be used to amplify different target polynucleotides or different regions of a particular target polynucleotide within the sample.
[0050] An amplification reaction can be performed under conditions that allow an optionally labeled sensor polynucleotide to hybridize to the amplification product during at least part of an amplification cycle. When the assay is performed in this manner, real-time detection of this hybridization event can take place by monitoring for light emission or fluorescence during amplification, as known in the art.
[0051] In a non-limiting example of RT-PCR: RT-PCR reaction plate prep happens in parallel, which generates the barcodes and RT-PCR master mix in a 384 well plate (or a microwell array with even more wells, e.g., 1 1,000 well microwell array, a 5,000 well microwell array, a 10,000 well microwell array, a 25,000 well microwell array, a 50,000 well microwell array, a 100,000 well microwell array, a 250,000 well microwell array). In some embodiments, rearray compresses the eluate from RNA extraction into the RT-PCR plate. Once combined, it is sealed and centrifuged a second time, and sent to the post-PCR lab space across the elevated conveyor and through an airlock. Thermal cycling currently happens on a 70 thermal cycler bank. After thermal cycling, these plates are pooled based on a compression algorithm.
Primers
[0052] In various embodiments, primers are provided (e.g., for the preparation indexed sequencing templates processed according to methods provided herein).
[0053] In some embodiments, pairs of primers target (e.g., comprise sequences complementary to) specific targets, and within each pair of primers, at least one comprises a DNA barcode (i.e., an index sequence). In some embodiments, within a pair of primers, one is an i5 primer and one is an i7 primer. In some embodiments, within a pair of primers, one is a forward primer and one is a reverse primer.
[0054] In some embodiments, a method provided comprises a step of amplifying a (wild-type) nucleic acid molecule. In certain embodiments, amplification of these targets comprises use of primers that comprise sequences complementary to the sequence of a portion of the nucleic acid molecule of interest.
[0055] In some embodiments, a primer provided herein comprises or consists of the following parts: (1) P5 or P7this is the sequence that binds to the Illumina flowcell and is defined by Illumina, wherein forward/i5 primers use P5 and reverse/i7 primers use P7; (2) DNA barcode (e.g., index sequence); (3) Illumina priming sequence, TruSeq typedefined by Illumina, this is where primers bind; (4) diversity spacer0 to 3 bases to shift the register of the sequence downstream so that in any given cycle there is more diversity than if no spacer was employed, and any given barcode is assigned a specific spacer, as Illumina reportedly sequences in lockstep, first base 1 of all clusters, then base 2 and so forth; (5) the priming sequence, which corresponds to a nucleic acid sequence of interest or its complement.
[0056] In some embodiments, a primer includes (a) a block of 12 nucleotides corresponding to the appropriate DNA barcode and (b) a diversity spacer comprising 0 to 3 bases, wherein sequences (a) and (b) are both 5 to the targeting sequence, in order to increase the base diversity at each sequencing position and improve the quality of base calling; and each barcode is paired with a specific spacer length.
[0057] In some embodiments, a primer for use in a method of the disclosure has a structure corresponding to that of a universal primer, such as:
TABLE-US-00001 NEBnextUniversalprimer (SEQIDNO:1) 5-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC TCTTCCGATCT-3 UniversalPrimer[Tm75deg] (SEQIDNO:1) 5-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC TCTTCCGATCT-3
wherein, in a primer for use in a method of the disclosure, a unique DNA barcode is inserted in the middle, and the sequence complementary to the sequence of a nucleic acid molecule of interest is added at the 3 end.
[0058] For example, the S2 i5 primer designated S2-i5t0-TGTTCTTCGTAA (SEQ ID NO: 2) comprises a DNA bar code sequence which is 5-TGTTCTTCGTAA-3 (SEQ ID NO: 2) and no spacer (the spacer length is zero), and has a sequence of: 5-AATGATACGGCGACCACCGAGATCTACAC TGTTCTTCGTAA ACACTCTTTCCCTACACGACGCTCTTCCGATCT XXXXXXXXXXXXXXXXXXXX-3 (SEQ ID NO: 3), wherein the underlined (but not bold) portions correspond to overlapping portions of the universal primers, the bold, underlined portion represents the barcode, and the bold, not underlined portion represents a sequence complementary to that of the nucleic acid of interest (e.g., X can be any suitable nucleotide, and the region of XX . . . XX can be any suitable length).
[0059] Table 1 provides unique barcodes for i5 primers; to determine the sequence of a corresponding primer, the sequence 5-AATGATACGGCGACCACCGAGATCTACAC-3 (SEQ ID NO: 4) is added at the 5 end, and the sequence 5-ACACTCTTTCCCTACACGACGCTCTTCCGATCT XXXXXXXXXXXXXXXXXXXX-3 (SEQ ID NO: 5), is added at the 3 end, wherein X can be any suitable nucleotide, and the region of XX . . . XX has a sequence complementary to that of the nucleic acid of interest and can be any suitable length.
[0060] In some embodiments, the present disclosure pertains to any primer comprising a barcode sequence provided in Table 1. In some embodiments, the present disclosure pertains to any primer which is useful for a method of the present disclosure which comprises a barcode sequence provided in Table 1.
TABLE-US-00002 TABLE1 Exampleuniquebarcodes SEQ SEQ ID ID NO: NO: S2-i5t0-TGTTCTTCGTAA 2 S2 i5 TGTTCTTCGTAA 2 0 726 S2-i5t0-ATTGATTATTCG 6 S2 i5 ATTGATTATTCG 6 0 727 S2-i5t0-GCTCTGCCGGCT 7 S2 i5 GCTCTGCCGGCT 7 0 728 S2-i5t0-GATTCGTTAGCG 8 S2 i5 GATTCGTTAGCG 8 0 729 S2-i5t0- 9 S2 i5 TACAAGCGAGGT 9 0 TACAAGCGAGGT 730 S2-i5t0-TTCCAGGTCGCG 10 S2 i5 TTCCAGGTCGCG 10 0 731 S2-i5t0-AGTAACTAGTCG 11 S2 i5 AGTAACTAGTCG 11 0 732 S2-i5t0-AATCTCGAAGTC 12 S2 i5 AATCTCGAAGTC 12 0 733 S2-i5t0-CCGGGAATGTTA 13 S2 i5 CCGGGAATGTTA 13 0 734 S2-i5t0-CCGTTGGATTTG 14 S2 i5 CCGTTGGATTTG 14 0 735 S2-i5t0- 15 S2 i5 CCACGAGGTGAC 15 0 CCACGAGGTGAC 736 S2-i5t0-CGCGATCCATCT 16 S2 i5 CGCGATCCATCT 16 0 737 S2-i5t1-CTCCGTGGGAGT 17 S2 i5 CTCCGTGGGAGT 17 1 738 S2-i5t1- 18 S2 i5 GCAAGACCCAAT 18 1 GCAAGACCCAAT 739 S2-i5t1-TTGTGACCTTAC 19 S2 i5 TTGTGACCTTAC 19 1 740 S2-i5t1-ATACCGATAGTG 20 S2 i5 ATACCGATAGTG 20 1 741 S2-i5t1-TGATCAGCGATC 21 S2 i5 TGATCAGCGATC 21 1 742 S2-i5t1-CCCAGGCTTCTC 22 S2 i5 CCCAGGCTTCTC 22 1 743 S2-i5t1- 23 S2 i5 CCCAGCGCAATA 23 1 CCCAGCGCAATA 744 S2-i5t1-CTACTAGAAATA 24 S2 i5 CTACTAGAAATA 24 1 745 S2-i5t1- 25 S2 i5 CGGAAGGGCTAC 25 1 CGGAAGGGCTAC 746 S2-i5t1-TGGACGGCTGTG 26 S2 i5 TGGACGGCTGTG 26 1 747 S2-i5t1- 27 S2 i5 GTGCAAGGCACA 27 1 GTGCAAGGCACA 748 S2-i5t2-CGAGTCTTGACG 28 S2 i5 CGAGTCTTGACG 28 2 749 S2-i5t2-GATCGCGTTGAG 29 S2 i5 GATCGCGTTGAG 29 2 750 S2-i5t2- 30 S2 i5 TATGATGCAGGA 30 2 TATGATGCAGGA 751 S2-i5t2- 31 S2 i5 ACAGATAACCAT 31 2 ACAGATAACCAT 752 S2-i5t2-GTATGTCTGAAA 32 S2 i5 GTATGTCTGAAA 32 2 753 S2-i5t2-CTCAGCTTTAAA 33 S2 i5 CTCAGCTTTAAA 33 2 754 S2-i5t2-GAATTCTAGGTT 34 S2 i5 GAATTCTAGGTT 34 2 755 S2-i5t2-TGCGCGACCACT 35 S2 i5 TGCGCGACCACT 35 2 756 S2-i5t2-ACACCTTCCGCA 36 S2 i5 ACACCTTCCGCA 36 2 757 S2-i5t2-TATACTCAGGAT 37 S2 i5 TATACTCAGGAT 37 2 758 S2-i5t2-TCAATCCAAACG 38 S2 i5 TCAATCCAAACG 38 2 759 S2-i5t2-ATAGGTGAATGT 39 S2 i5 ATAGGTGAATGT 39 2 760 S2-i5t3-TCCAATTCGACG 40 S2 i5 TCCAATTCGACG 40 3 761 S2-i5t3-CATCGCTGATCA 41 S2 i5 CATCGCTGATCA 41 3 762 S2-i5t3-CGGGTAAATTGT 42 S2 i5 CGGGTAAATTGT 42 3 763 S2-i5t3-CTACTAACCCAG 43 S2 i5 CTACTAACCCAG 43 3 764 S2-i5t3- 44 S2 i5 GACATCCGAGGA 44 3 GACATCCGAGGA 765 S2-i5t3-CCACCTCCTTGT 45 S2 i5 CCACCTCCTTGT 45 3 766 S2-i5t3-ACTTGGAAGTTC 46 S2 i5 ACTTGGAAGTTC 46 3 767 S2-i5t3-TCCAAGCAGCTG 47 S2 i5 TCCAAGCAGCTG 47 3 768 S2-i5t3-ATTCACCTTCGC 48 S2 i5 ATTCACCTTCGC 48 3 769 S2-i5t3-CTCGTTTCCAAC 49 S2 i5 CTCGTTTCCAAC 49 3 770 S2-i5t3- 50 S2 i5 TCCGAGGGTACA 50 3 TCCGAGGGTACA 771 S2-i5t0-GTAATATAGCCT 51 S2 i5 GTAATATAGCCT 51 0 772 S2-i5t0-GTAATAGGTTAT 52 S2 i5 GTAATAGGTTAT 52 0 773 S2-i5t0-CGCATTGTATTT 53 S2 i5 CGCATTGTATTT 53 0 774 S2-i5t0-TCATGGATTACG 54 S2 i5 TCATGGATTACG 54 0 775 S2-i5t0-ACTCACGAAGCT 55 S2 i5 ACTCACGAAGCT 55 0 776 S2-i5t0-CAATTCGCCAAA 56 S2 i5 CAATTCGCCAAA 56 0 777 S2-i5t0-AACATTCTATAC 57 S2 i5 AACATTCTATAC 57 0 778 S2-i5t0- 58 S2 i5 CAACACTTGAAA 58 0 CAACACTTGAAA 779 S2-i5t0-AGAGAGTGTCTC 59 S2 i5 AGAGAGTGTCTC 59 0 780 S2-i5t0-TTCATTTGGCTC 60 S2 i5 TTCATTTGGCTC 60 0 781 S2-i5t1-GCGTTGGTACCG 61 S2 i5 GCGTTGGTACCG 61 1 782 S2-i5t1- 62 S2 i5 CACTGACGGTGA 62 1 CACTGACGGTGA 783 S2-i5t1-CGGTCACTGAAT 63 S2 i5 CGGTCACTGAAT 63 1 784 S2-i5t1-CCTCTGAGATAG 64 S2 i5 CCTCTGAGATAG 64 1 785 S2-i5t1-ATCGCATCATTG 65 S2 i5 ATCGCATCATTG 65 1 786 S2-i5t1-CAGTTTCAGCGC 66 S2 i5 CAGTTTCAGCGC 66 1 787 S2-i5t1-ATCGGTTATATT 67 S2 i5 ATCGGTTATATT 67 1 788 S2-i5t1- 68 S2 i5 TCGGGAGACGCT 68 1 TCGGGAGACGCT 789 S2-i5t1-GCTTCTTTATTT 69 S2 i5 GCTTCTTTATTT 69 1 790 S2-i5t1- 70 S2 i5 CAGCCCAAGAGC 70 1 CAGCCCAAGAGC 791 S2-i5t1-CGTATTTCCGAT 71 S2 i5 CGTATTTCCGAT 71 1 792 S2-i5t2-AGGAATGTCTGT 72 S2 i5 AGGAATGTCTGT 72 2 793 S2-i5t2-TTACGCTTGACT 73 S2 i5 TTACGCTTGACT 73 2 794 S2-i5t2- 74 S2 i5 CGAGAAAGGTGT 74 2 CGAGAAAGGTGT 795 S2-i5t2-TAATTCAAGCTG 75 S2 i5 TAATTCAAGCTG 75 2 796 S2-i5t2- 76 S2 i5 TGGACGGTCAAC 76 2 TGGACGGTCAAC 797 S2-i5t2- 77 S2 i5 GTAACGGTGGGT 77 2 GTAACGGTGGGT 798 S2-i5t2-ATCACGGCTGGC 78 S2 i5 ATCACGGCTGGC 78 2 799 S2-i5t2-TAACATTCGCGT 79 S2 i5 TAACATTCGCGT 79 2 800 S2-i5t2-ATCTGGTTATGC 80 S2 i5 ATCTGGTTATGC 80 2 801 S2-i5t2-GCGCTACCCAGC 81 S2 i5 GCGCTACCCAGC 81 2 802 S2-i5t2- 82 S2 i5 AGCGTGGGAGTT 82 2 AGCGTGGGAGTT 803 S2-i5t2- 83 S2 i5 TAGAAGGAGCTA 83 2 TAGAAGGAGCTA 804 S2-i5t3-TTCGTACAGCTC 84 S2 i5 TTCGTACAGCTC 84 3 805 S2-i5t3- 85 S2 i5 TTTAGGACGAGA 85 3 TTTAGGACGAGA 806 S2-i5t3- 86 S2 i5 TTGGCAGAACGA 86 3 TTGGCAGAACGA 807 S2-i5t3-ACATGACTCATT 87 S2 i5 ACATGACTCATT 87 3 808 S2-i5t3-CCAGTTCGATGA 88 S2 i5 CCAGTTCGATGA 88 3 809 S2-i5t3-TCCGTACGTCGA 89 S2 i5 TCCGTACGTCGA 89 3 810 S2-i5t3-TCGGCTGACATC 90 S2 i5 TCGGCTGACATC 90 3 811 S2-i5t3-CGTTGGGACTTT 91 S2 i5 CGTTGGGACTTT 91 3 812 S2-i5t3-TGCATCTGGATA 92 S2 i5 TGCATCTGGATA 92 3 813 S2-i5t3-TGGCCAAACCTT 93 S2 i5 TGGCCAAACCTT 93 3 814 S2-i5t3-TCTGCTGCCTTG 94 S2 i5 TCTGCTGCCTTG 94 3 815 S2-i5t3-CTCAGGATAACT 195 S2 i5 CTCAGGATAACT 95 3 816 S2-i5t0- 96 S2 i5 TGGCAAGGAAAG 96 0 TGGCAAGGAAAG 817 S2-i5t0-ACCCGAAGTTTA 197 S2 i5 ACCCGAAGTTTA 97 0 818 S2-i5t0-AGTAAACTGCTA 98 S2 i5 AGTAAACTGCTA 98 0 819 S2-i5t0-TTGCCCATAGGT 199 S2 i5 TTGCCCATAGGT 199 0 820 S2-i5t0-AGTGGTAGTTAG 100 S2 i5 AGTGGTAGTTAG 100 0 821 S2-i5t0- 101 S2 i5 CAATAAACGCCG 101 0 CAATAAACGCCG 822 S2-i5t0-TTGACCACGACG 102 S2 i5 TTGACCACGACG 102 0 823 S2-i5t0-GCACTCCTAAAT 103 S2 i5 GCACTCCTAAAT 103 0 824 S2-i5t0- 104 S2 i5 CCAGACATATGA 104 0 CCAGACATATGA 825 S2-i5t0-CATTACCCGTCA 105 S2 i5 CATTACCCGTCA 105 0 826 S2-i5t0- 106 S2 i5 ACGGTTGAGAAT 106 0 ACGGTTGAGAAT 827 S2-i5t1-CTACCTCAGAAT 107 S2 i5 CTACCTCAGAAT 107 1 828 S2-i5t1-TTTGTACACCGT 108 S2 i5 TTTGTACACCGT 108 1 829 S2-i5t1- 109 S2 i5 CCGAACAGGTAA 109 1 CCGAACAGGTAA 830 S2-i5t1-TGTCGGATTAAA 110 S2 i5 TGTCGGATTAAA 110 1 831 S2-i5t1-ACGGACCTCCTA 111 S2 i5 ACGGACCTCCTA 111 1 832 S2-i5t1- 112 S2 i5 TAGATAAGTCAG 112 1 TAGATAAGTCAG 833 S2-i5t1-AATTTCGGCTTA 113 S2 i5 AATTTCGGCTTA 113 1 834 S2-i5t1-AATTGTTTGAAG 114 S2 i5 AATTGTTTGAAG 114 1 835 S2-i5t1- 115 S2 i5 ATGGAGCTGAAG 115 1 ATGGAGCTGAAG 836 S2-i5t1-AGCTGTTACCAG 116 S2 i5 AGCTGTTACCAG 116 1 837 S2-i5t1-AGCACCCGATTC 117 S2 i5 AGCACCCGATTC 117 1 838 S2-i5t1-CCTAACCTCCCG 118 S2 i5 CCTAACCTCCCG 118 1 839 S2-i5t2-AGGGCTGTGCTG 119 S2 i5 AGGGCTGTGCTG 119 2 840 S2-i5t2-ACATGCTTTGCG 120 S2 i5 ACATGCTTTGCG 120 2 841 S2-i5t2-TACTGTTGATAT 121 S2 i5 TACTGTTGATAT 121 2 842 S2-i5t2-CGTGCGCACCTA 122 S2 i5 CGTGCGCACCTA 122 2 843 S2-i5t2-GAGATCTTTAGC 123 S2 i5 GAGATCTTTAGC 123 2 844 S2-i5t2- 124 S2 i5 AATGCAGCGCAA 124 2 AATGCAGCGCAA 845 S2-i5t2-TACAATGGTCAT 125 S2 i5 TACAATGGTCAT 125 2 846 S2-i5t2- 126 S2 i5 TAAGAGACTACA 126 2 TAAGAGACTACA 847 S2-i5t2-CTTAAGATGATC 127 S2 i5 CTTAAGATGATC 127 2 848 S2-i5t3-AATTTGCCCATT 128 S2 i5 AATTTGCCCATT 128 3 849 S2-i5t3-TTACTCTGATCA 129 S2 i5 TTACTCTGATCA 129 3 850 S2-i5t3-AGTTGTCTTGTT 130 S2 i5 AGTTGTCTTGTT 130 3 851 S2-i5t3- 131 S2 i5 GAGTGGAATGAC 131 3 GAGTGGAATGAC 852 S2-i5t3-GTCCGCTTGCAA 132 S2 i5 GTCCGCTTGCAA 132 3 853 S2-i5t3-GTTACGTGGTCT 133 S2 i5 GTTACGTGGTCT 133 3 854 S2-i5t3-GATCTGTGGCTT 134 S2 i5 GATCTGTGGCTT 134 3 855 S2-i5t3-CTAAAGTCTGTA 135 S2 i5 CTAAAGTCTGTA 135 3 856 S2-i5t3-TCGTACCGGTCT 136 S2 i5 TCGTACCGGTCT 136 3 857 S2-i5t3-GCCCACTCAGAC 137 S2 i5 GCCCACTCAGAC 137 3 858 S2-i5t3-AGGATAGTCATC 138 S2 i5 AGGATAGTCATC 138 3 859 S2-i5t0-ATTGCTCGGGCA 139 S2 i5 ATTGCTCGGGCA 139 0 860 S2-i5t0-CACAGACGTTAC 140 S2 i5 CACAGACGTTAC 140 0 861 S2-i5t0- 141 S2 i5 CCAGGGAATAAG 141 0 CCAGGGAATAAG 862 S2-i5t0-TTCCCGAACTAC 142 S2 i5 TTCCCGAACTAC 142 0 863 S2-i5t0-AACGAGCCATTT 143 S2 i5 AACGAGCCATTT 143 0 864 S2-i5t0-GCGCGTCCTTTC 144 S2 i5 GCGCGTCCTTTC 144 0 865 S2-i5t0-TCTATCGTGTTC 145 S2 i5 TCTATCGTGTTC 145 0 866 S2-i5t0- 146 S2 i5 AAACGCTAAGGA 146 0 AAACGCTAAGGA 867 S2-i5t0-TGACACAGATCT 147 S2 i5 TGACACAGATCT 147 0 868 S2-i5t0-CCCTACCTCTCA 148 S2 i5 CCCTACCTCTCA 148 0 869 S2-i5t0-TGCGGATCCGCA 149 S2 i5 TGCGGATCCGCA 149 0 870 S2-i5t0- 150 S2 i5 GTCAACAACGAC 150 0 GTCAACAACGAC 871 S2-i5t1- 151 S2 i5 AGGACCACCCAG 151 1 AGGACCACCCAG 872 S2-i5t1-CCAAGTACATTC 152 S2 i5 CCAAGTACATTC 152 1 873 S2-i5t1-GTGCTGTTTCCT 153 S2 i5 GTGCTGTTTCCT 153 1 874 S2-i5t1- 154 S2 i5 CAAATGCTAGAA 154 1 CAAATGCTAGAA 875 S2-i5t1- 155 S2 i5 ATCATACAAGGA 155 1 ATCATACAAGGA 876 S2-i5t1- 156 S2 i5 CATAGTAAGTAG 156 1 CATAGTAAGTAG 877 S2-i5t1- 157 S2 i5 CTTAATAAAGAG 157 1 CTTAATAAAGAG 878 S2-i5t1-GTACGCTCACCG 158 S2 i5 GTACGCTCACCG 158 1 879 S2-i5t1-CCCGATAAATGT 159 S2 i5 CCCGATAAATGT 159 1 880 S2-i5t1-ATCGCTTAATAC 160 S2 i5 ATCGCTTAATAC 160 1 881 S2-i5t1-TTGACGCATTAC 161 S2 i5 TTGACGCATTAC 161 1 882 S2-i5t1- 162 S2 i5 TTAGTAGGCGAG 162 1 TTAGTAGGCGAG 883 S2-i5t2-GTTCACTCACAA 163 S2 i5 GTTCACTCACAA 163 2 884 S2-i5t2-CATCGGGCCATG 164 S2 i5 CATCGGGCCATG 164 2 885 S2-i5t2-AATTACCCAGCT 165 S2 i5 AATTACCCAGCT 165 2 886 S2-i5t2-CGCATCAATTCG 166 S2 i5 CGCATCAATTCG 166 2 887 S2-i5t2-TCAACCCGTCAT 167 S2 i5 TCAACCCGTCAT 167 2 888 S2-i5t2-ACTAGTTCGAGT 168 S2 i5 ACTAGTTCGAGT 168 2 889 S2-i5t2- 169 S2 15 TACAGGACGCTG 169 2 TACAGGACGCTG 890 S2-i5t2-AATGGGCTCGAT 170 S2 i5 AATGGGCTCGAT 170 2 891 S2-i5t2-CACCTTGACAAC 171 S2 i5 CACCTTGACAAC 171 2 892 S2-i5t2-ACTCACCACTGC 172 S2 i5 ACTCACCACTGC 172 2 893 S2-i5t2-TAGTTCACACAG 173 S2 i5 TAGTTCACACAG 173 2 894 S2-i5t3-CTTGCGTTGAGT 174 S2 i5 CTTGCGTTGAGT 174 3 895 S2-i5t3-GCTGATCCCATC 175 S2 i5 GCTGATCCCATC 175 3 896 S2-i5t3-TGAGTTCTAGAT 176 S2 i5 TGAGTTCTAGAT 176 3 897 S2-i5t3-CAATCTCCATCT 177 S2 i5 CAATCTCCATCT 177 3 898 S2-i5t3- 178 S2 i5 AGGCAAAGCAGA 178 3 AGGCAAAGCAGA 899 S2-i5t3-CATGTTAACGCA 179 S2 i5 CATGTTAACGCA 179 3 900 S2-i5t3-TGCCGATTACCA 180 S2 i5 TGCCGATTACCA 180 3 901 S2-i5t3-GTGACCTATCCA 181 S2 i5 GTGACCTATCCA 181 3 902 S2-i5t3- 182 S2 i5 AGTGGTAAGTGC 182 3 AGTGGTAAGTGC 903 S2-i5t3- 183 S2 i5 AGGGAACATCGT 183 3 AGGGAACATCGT 904 S2-i5t0-CGCCATGACTTC 184 S2 i5 CGCCATGACTTC 184 0 905 S2-i5t0-ATCTCGCCAAAC 185 S2 i5 ATCTCGCCAAAC 185 0 906 S2-i5t0-CGCCTGGCCGTA 186 S2 i5 CGCCTGGCCGTA 186 0 907 S2-i5t0-AGGGTGCTGTCG 187 S2 i5 AGGGTGCTGTCG 187 0 908 S2-i5t0-AGCCTCCGCCCT 188 S2 i5 AGCCTCCGCCCT 188 0 909 S2-i5t0-GTTTAATCCAAG 189 S2 i5 GTTTAATCCAAG 189 0 910 S2-i5t0-CAGCTATGACCT 190 S2 i5 CAGCTATGACCT 190 0 911 S2-i5t0-ACGACTGGCACT 191 S2 i5 ACGACTGGCACT 191 0 912 S2-i5t0-GTCTCTCGTTGT 192 S2 i5 GTCTCTCGTTGT 192 0 913 S2-i5t0-TAAACGCGTTTG 193 S2 i5 TAAACGCGTTTG 193 0 914 S2-i5t0- 194 S2 i5 GTGCCACGAAAC 194 0 GTGCCACGAAAC 915 S2-i5t0-CAATTGCACCAT 195 S2 i5 CAATTGCACCAT 195 0 916 S2-i5t1- 196 S2 i5 CGGTACGGAGTC 196 1 CGGTACGGAGTC 917 S2-i5t1-TTCTCTAGGAAC 197 S2 i5 TTCTCTAGGAAC 197 1 918 S2-i5t1-AACGTCGAATTA 198 S2 i5 AACGTCGAATTA 198 1 919 S2-i5t1-TTGTCCGGAACT 199 S2 i5 TTGTCCGGAACT 199 1 920 S2-i5t1-ATGCCTGTCCAA 200 S2 i5 ATGCCTGTCCAA 200 1 921 S2-i5t1- 201 S2 i5 TGAAGCACCAAT 201 1 TGAAGCACCAAT 922 S2-i5t1-AAGGATCCTCTT 202 S2 i5 AAGGATCCTCTT 202 1 923 S2-i5t1-CTTCATGTTAAA 203 S2 i5 CTTCATGTTAAA 203 1 924 S2-i5t1-TTGAGCCACCTC 204 S2 i5 TTGAGCCACCTC 204 1 925 S2-i5t1-GCTTATGTTGAC 205 S2 i5 GCTTATGTTGAC 205 1 926 S2-i5t1-CGACGATGGGTT 206 S2 i5 CGACGATGGGTT 206 1 927 S2-i5t1-CGTTCGCTATAT 207 S2 i5 CGTTCGCTATAT 207 1 928 S2-i5t2-CCAGTTGCTCAG 208 S2 i5 CCAGTTGCTCAG 208 2 929 S2-i5t2-CCCGGTCTCAAT 209 S2 i5 CCCGGTCTCAAT 209 2 930 S2-i5t2-GTTTGGATCACG 210 S2 i5 GTTTGGATCACG 210 2 931 S2-i5t2-TTGCCTTCGTAC 211 S2 i5 TTGCCTTCGTAC 211 2 932 S2-i5t2-AGTAGTGTCCAC 212 S2 i5 AGTAGTGTCCAC 212 2 933 S2-i5t2-AGAATTTATCCA 213 S2 i5 AGAATTTATCCA 213 2 934 S2-i5t2- 214 S2 i5 AATGGATGCACG 214 2 AATGGATGCACG 935 S2-i5t2-ATCCAAGGATTG 215 S2 i5 ATCCAAGGATTG 215 2 936 S2-i5t2-TAGTCGTTAGAT 216 S2 i5 TAGTCGTTAGAT 216 2 937 S2-i5t2-TGATACTGAGTA 217 S2 i5 TGATACTGAGTA 217 2 938 S2-i5t2- 218 S2 i5 GCCTAGTAAAGA 218 2 GCCTAGTAAAGA 939 S2-i5t3-GCCTACTTATAG 219 S2 i5 GCCTACTTATAG 219 3 940 S2-i5t3-CCTGCCTTGGCT 220 S2 i5 CCTGCCTTGGCT 220 3 941 S2-i5t3- 221 S2 i5 GATGGACACAGA 221 3 GATGGACACAGA 942 S2-i5t3- 222 S2 i5 CGCCGGGTTGGA 222 3 CGCCGGGTTGGA 943 S2-i5t3-GTCTCCAAGATG 223 S2 i5 GTCTCCAAGATG 223 3 944 S2-i5t3- 224 S2 i5 AAAGCGTATCAA 224 3 AAAGCGTATCAA 945 S2-i5t3- 225 S2 i5 GCACCGCAGCGT 225 3 GCACCGCAGCGT 946 S2-i5t3-TGCGCTGAATGC 226 S2 i5 TGCGCTGAATGC 226 3 947 S2-i5t3-TTGTTCAGAGTC 227 S2 i5 TTGTTCAGAGTC 227 3 948 S2-i5t3- 228 S2 i5 GAGAATGACTGA 228 3 GAGAATGACTGA 949 S2-i5t3- 229 S2 i5 AAGCGAAGCGAC 229 3 AAGCGAAGCGAC 950 S2-i5t3-AGCGTGTTGTAA 230 S2 i5 AGCGTGTTGTAA 230 3 951 S2-i5t0-CCACTATACCTT 231 S2 i5 CCACTATACCTT 231 0 952 S2-i5t0-TGTTAAACTCTG 232 S2 i5 TGTTAAACTCTG 232 0 953 S2-i5t0-ATTTGTAGGGCG 233 S2 i5 ATTTGTAGGGCG 233 0 954 S2-i5t0- 234 S2 i5 CAGGAATCATAG 234 0 CAGGAATCATAG 955 S2-i5t0-ACTGGATAGCAT 235 S2 i5 ACTGGATAGCAT 235 0 956 S2-i5t0- 236 S2 i5 GCACGTAACACG 236 0 GCACGTAACACG 957 S2-i5t0-AACTGCCACCTG 237 S2 i5 AACTGCCACCTG 237 0 958 S2-i5t0- 238 S2 i5 AGCAACCTAAGT 238 0 AGCAACCTAAGT 959 S2-i5t0- 239 S2 i5 GACTGCTAACAG 239 0 GACTGCTAACAG 960 S2-i5t0-TTATAGTTCGCT 240 S2 i5 TTATAGTTCGCT 240 0 961 S2-i5t0-TCGCCACACACA 241 S2 i5 TCGCCACACACA 241 0 962 S2-i5t1-ATAACCACCAGT 242 S2 i5 ATAACCACCAGT 242 1 963 S2-i5t1- 243 S2 i5 GAATGGGTCCGC 243 1 GAATGGGTCCGC 964 S2-i5t1-GTGACTATGGCT 244 S2 i5 GTGACTATGGCT 244 1 965 S2-i5t1-TATAGTCCTGAG 245 S2 i5 TATAGTCCTGAG 245 1 966 S2-i5t1-TGTACACATCAC 246 S2 i5 TGTACACATCAC 246 1 967 S2-i5t1-TACCTTAATGAC 247 S2 i5 TACCTTAATGAC 247 1 968 S2-i5t1- 248 S2 i5 GCCACAAATTAA 248 1 GCCACAAATTAA 969 S2-i5t1- 249 S2 i5 ACGTTCGGGACG 249 1 ACGTTCGGGACG 970 S2-i5t1-TTACCGAACCCA 250 S2 i5 TTACCGAACCCA 250 1 971 S2-i5t1-GTGTCATATTAA 251 S2 i5 GTGTCATATTAA 251 1 972 S2-i5t1- 252 S2 i5 TGAAGCGACGAG 252 1 TGAAGCGACGAG 973 S2-i5t1-ATGCCATGCCGC 253 S2 i5 ATGCCATGCCGC 253 1 974 S2-i5t2-TTGGCCTCGATT 254 S2 i5 TTGGCCTCGATT 254 2 975 S2-i5t2-ATCCTCACTTCA 255 S2 i5 ATCCTCACTTCA 255 2 976 S2-i5t2-AGATTACTTGGA 256 S2 i5 AGATTACTTGGA 256 2 977 S2-i5t2-TAATATACTGGT 257 S2 i5 TAATATACTGGT 257 2 978 S2-i5t2- 258 S2 i5 TCATGCGGAAAG 258 2 TCATGCGGAAAG 979 S2-i5t2- 259 S2 i5 GAAGGTCCGCAA 259 2 GAAGGTCCGCAA 980 S2-i5t2- 260 S2 i5 ACGGTGATGGAA 260 2 ACGGTGATGGAA 981 S2-i5t2-GACCTAACCGGT 261 S2 i5 GACCTAACCGGT 261 2 982 S2-i5t2-TTAGCGACAGCT 262 S2 i5 TTAGCGACAGCT 262 2 983 S2-i5t2-TTGCCACCAATT 263 S2 i5 TTGCCACCAATT 263 2 984 S2-i5t2-CTATCTTGAGAT 264 S2 i5 CTATCTTGAGAT 264 2 985 S2-i5t3-ATTTCATTCCTA 265 S2 i5 ATTTCATTCCTA 265 3 986 S2-i5t3-CGTGGCGCATCG 266 S2 i5 CGTGGCGCATCG 266 3 987 S2-i5t3-CCATTAATTGTC 267 S2 i5 CCATTAATTGTC 267 3 988 S2-i5t3-AAGTTTCTTCAT 268 S2 i5 AAGTTTCTTCAT 268 3 989 S2-i5t3- 269 S2 i5 TCGTAGAGAACA 269 3 TCGTAGAGAACA 990 S2-i5t3- 270 S2 i5 ACAAGGTTGATG 270 3 ACAAGGTTGATG 991 S2-i5t3-GTCTTTACATCT 271 S2 i5 GTCTTTACATCT 271 3 992 S2-i5t3-CTTCGCCGCGTG 272 S2 i5 CTTCGCCGCGTG 272 3 993 S2-i5t3- 273 S2 i5 TAAGACTACAAG 273 3 TAAGACTACAAG 994 S2-i5t0-CTGTCGAAGCCG 274 S2 i5 CTGTCGAAGCCG 274 0 995 S2-i5t0- 275 S2 i5 TAAGCCCAGGAA 275 0 TAAGCCCAGGAA 996 S2-i5t0-TATTGCCGTTTC 276 S2 i5 TATTGCCGTTTC 276 0 997 S2-i5t0-TACCGTCTCTAA 277 S2 i5 TACCGTCTCTAA 277 0 998 S2-i5t0- 278 S2 i5 GACCATTAGAGC 278 0 GACCATTAGAGC 999 S2-i5t0-CATCGACGCTCG 279 S2 i5 CATCGACGCTCG 279 0 1000 S2-i5t0-TTGCCCGACTCA 280 S2 i5 TTGCCCGACTCA 280 0 1001 S2-i5t0-ACGTACGCTAGT 281 S2 i5 ACGTACGCTAGT 281 0 1002 S2-i5t0-CATAGACAACTT 282 S2 i5 CATAGACAACTT 282 0 1003 S2-i5t0- 283 S2 i5 TGAAGATAGTCG 283 0 TGAAGATAGTCG 1004 S2-i5t0- 284 S2 i5 TAAGATAAGATG 284 0 TAAGATAAGATG 1005 S2-i5t0- 285 S2 i5 AATAGCGAGCTC 285 0 AATAGCGAGCTC 1006 S2-i5t1- 286 S2 i5 ACCGGCGATGGT 286 1 ACCGGCGATGGT 1007 S2-i5t1-AGTTCTGGCAAA 287 S2 i5 AGTTCTGGCAAA 287 1 1008 S2-i5t1-TCCCTGCGCGAC 288 S2 i5 TCCCTGCGCGAC 288 1 1009 S2-i5t1-AATATAGCCTCT 289 S2 i5 AATATAGCCTCT 289 1 1010 S2-i5t1-TTTCCGCTACAG 290 S2 i5 TTTCCGCTACAG 290 1 1011 S2-i5t1-GCTTAGATCCAT 291 S2 i5 GCTTAGATCCAT 291 1 1012 S2-i5t1-GCTCTCGAACGT 292 S2 i5 GCTCTCGAACGT 292 1 1013 S2-i5t1-GATACCGATTAC 293 S2 i5 GATACCGATTAC 293 1 1014 S2-i5t1-ACGAACTCCTGT 294 S2 i5 ACGAACTCCTGT 294 1 1015 S2-i5t1-ATAAACGTCGGT 295 S2 i5 ATAAACGTCGGT 295 1 1016 S2-i5t1-GACGTACTCCAA 296 S2 i5 GACGTACTCCAA 296 1 1017 S2-i5t1- 297 S2 i5 GCAAGCTCGAGA 297 1 GCAAGCTCGAGA 1018 S2-i5t2-TCGTGCTTCTTA 298 S2 i5 TCGTGCTTCTTA 298 2 1019 S2-i5t2- 299 S2 i5 ATCCGAACCAAG 299 2 ATCCGAACCAAG 1020 S2-i5t2-GAACATCATTGA 300 S2 i5 GAACATCATTGA 300 2 1021 S2-i5t2-TAAGCCCTAGTT 301 S2 i5 TAAGCCCTAGTT 301 2 1022 S2-i5t2-TGACCACGGTTC 302 S2 i5 TGACCACGGTTC 302 2 1023 S2-i5t2- 303 S2 i5 CCAATGGAGAAG 303 2 CCAATGGAGAAG 1024 S2-i5t2- 304 S2 i5 GTTGGGCCAGCA 304 2 GTTGGGCCAGCA 1025 S2-i5t2-ACTCGATTTACG 305 S2 i5 ACTCGATTTACG 305 2 1026 S2-i5t2-AGCCGTTGCTGT 306 S2 i5 AGCCGTTGCTGT 306 2 1027 S2-i5t2-GTCTTCGAAAGA 307 S2 i5 GTCTTCGAAAGA 307 2 1028 S2-i5t2-ACGTCTGGTGAT 308 S2 i5 ACGTCTGGTGAT 308 2 1029 S2-i5t2- 309 S2 i5 GAATGGCAAACT 309 2 GAATGGCAAACT 1030 S2-i5t3-TATGAGAGTTCG 310 S2 i5 TATGAGAGTTCG 310 3 1031 S2-i5t3-CATCTGGAGCTG 311 S2 i5 CATCTGGAGCTG 311 3 1032 S2-i5t3-CCAGCGACTTCT 312 S2 i5 CCAGCGACTTCT 312 3 1033 S2-i5t3-ACTCAATCGACT 313 S2 i5 ACTCAATCGACT 313 3 1034 S2-i5t3-TCCAGCTAACCT 314 S2 i5 TCCAGCTAACCT 314 3 1035 S2-i5t3- 315 S2 i5 ACTTAACGGGAG 315 3 ACTTAACGGGAG 1036 S2-i5t3-GAGCTTCTGGCA 316 S2 i5 GAGCTTCTGGCA 316 3 1037 S2-i5t3-TCATACACGTTC 317 S2 i5 TCATACACGTTC 317 3 1038 S2-i5t3-CCTGTGATTCCA 318 S2 i5 CCTGTGATTCCA 318 3 1039 S2-i5t0-GCTCTTGATGTC 319 S2 i5 GCTCTTGATGTC 319 0 1040 S2-i5t0-CTGATTCCCGGA 320 S2 i5 CTGATTCCCGGA 320 0 1041 S2-i5t0- 321 S2 i5 AATCATAGCAAC 321 0 AATCATAGCAAC 1042 S2-i5t0- 322 S2 i5 AAGCGTAAACCG 322 0 AAGCGTAAACCG 1043 S2-i5t0-CTCTTGAAACCT 323 S2 i5 CTCTTGAAACCT 323 0 1044 S2-i5t0-CTATCAGGCCCA 324 S2 i5 CTATCAGGCCCA 324 0 1045 S2-i5t0- 325 S2 i5 AAGTGTAACAAC 325 0 AAGTGTAACAAC 1046 S2-i5t0-ACATTACTACTG 326 S2 i5 ACATTACTACTG 326 0 1047 S2-i5t0-TCAAGTTTATGC 327 S2 i5 TCAAGTTTATGC 327 0 1048 S2-i5t0-TCGTGTACACAC 328 S2 i5 TCGTGTACACAC 328 0 1049 S2-i5t0-GATAGCTCTGGA 329 S2 i5 GATAGCTCTGGA 329 0 1050 S2-i5t0- 330 S2 i5 CAAAGTTAAAGC 330 0 CAAAGTTAAAGC 1051 S2-i5t1-TGTATACTGAAC 331 S2 i5 TGTATACTGAAC 331 1 1052 S2-i5t1- 332 S2 i5 AACAAACGGTCT 332 1 AACAAACGGTCT 1053 S2-i5t1-TCCGTGCAGGTT 333 S2 i5 TCCGTGCAGGTT 333 1 1054 S2-i5t1- 334 S2 i5 AGCAAGTTAGGC 334 1 AGCAAGTTAGGC 1055 S2-i5t1-CTAGTGAACTAT 335 S2 i5 CTAGTGAACTAT 335 1 1056 S2-i5t1- 336 S2 i5 ATGTGAATGACA 336 1 ATGTGAATGACA 1057 S2-i5t1- 337 S2 i5 ACGACGCGCGTA 337 1 ACGACGCGCGTA 1058 S2-i5t1- 338 S2 i5 ACGTGCAGGCGA 338 1 ACGTGCAGGCGA 1059 S2-i5t1-CAAGTATGCAAT 339 S2 i5 CAAGTATGCAAT 339 1 1060 S2-i5t1-GTACTCCCGTTA 340 S2 i5 GTACTCCCGTTA 340 1 1061 S2-i5t1-AATACAACCTTC 341 S2 i5 AATACAACCTTC 341 1 1062 S2-i5t1-ACCCATTCCCGC 342 S2 i5 ACCCATTCCCGC 342 1 1063 S2-i5t2-TTAGCTAACAAC 343 S2 i5 TTAGCTAACAAC 343 2 1064 S2-i5t2-TGCCGCTTGGAC 344 S2 i5 TGCCGCTTGGAC 344 2 1065 S2-i5t2-TGATAACGTAGT 345 S2 i5 TGATAACGTAGT 345 2 1066 S2-i5t2-TGCCTCGCCTAA 346 S2 i5 TGCCTCGCCTAA 346 2 1067 S2-i5t2-TACTTGCGGCTC 347 S2 i5 TACTTGCGGCTC 347 2 1068 S2-i5t2-TCGTTGTCAGGA 348 S2 i5 TCGTTGTCAGGA 348 2 1069 S2-i5t2-ATCTCAAGCGTT 349 S2 i5 ATCTCAAGCGTT 349 2 1070 S2-i5t2-CCACCTGGTCTT 350 S2 i5 CCACCTGGTCTT 350 2 1071 S2-i5t3- 351 S2 i5 ACTAAACCACAC 351 3 ACTAAACCACAC 1072 S2-i5t3-TTCGGGCTCGAG 352 S2 i5 TTCGGGCTCGAG 352 3 1073 S2-i5t3-AACTCCCTTCGT 353 S2 i5 AACTCCCTTCGT 353 3 1074 S2-i5t3-GTTAATAGAGGT 354 S2 i5 GTTAATAGAGGT 354 3 1075 S2-i5t3-TCGGACTTATAA 355 S2 i5 TCGGACTTATAA 355 3 1076 S2-i5t3-CCGTAAGTATGT 356 S2 i5 CCGTAAGTATGT 356 3 1077 S2-i5t3-CACCCAGAGTTA 357 S2 i5 CACCCAGAGTTA 357 3 1078 S2-i5t3-CTATCCTAGGAC 358 S2 i5 CTATCCTAGGAC 358 3 1079 S2-i5t3-TCTTGCTCGGTG 359 S2 i5 TCTTGCTCGGTG 359 3 1080 S2-i5t3-GCGGAGCTTTGC 360 S2 i5 GCGGAGCTTTGC 360 3
[0061] In some embodiments, a primer for use in a method of the disclosure has a structure corresponding to that of a primer, such as:
TABLE-US-00003 NEBnextIndexedprimer 5-CAAGCAGAAGACGGCATACGAGAT... GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3,(SEQIDNOS 361-362,respectively,inorderofappearance),
wherein, in a primer for use in a method of the disclosure, . . . is replaced with a unique barcode, and a target nucleic acid sequence 5-XXXXXXXXXX-3 is added at the 3 end, wherein X can be any suitable nucleotide, and the region of XX . . . XX has a sequence complementary to that of the nucleic acid of interest and can be any suitable length. For example, the S2 i7 primer designated S2-i7t0-AATGCTTCTTGT (SEQ ID NO: 363) comprises a DNA barcode sequence which is 5-AATGCTTCTTGT-3 (SEQ ID NO: 363) and no spacer (the spacer length is zero), and has a sequence of 5-CAAGCAGAAGACGGCATACGAGAT AATGCTTCTTGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT XXXXXXXXXXXXXXXXXXXX-3 (SEQ ID NO: 364), wherein the underlined (but not bold) portions correspond to portions of the universal primers, the bold, underlined portion represents the barcode, and the bold, not underlined portion represents a sequence complementary to the sequence of the nucleic acid of interest, wherein X can be any suitable nucleotide, and the region of XX . . . XX has a sequence complementary to that of the nucleic acid of interest and can be any suitable length.
[0062] Table 2 provides unique barcodes for i7 primers; to determine the sequence of a corresponding primer, the sequence 5-CAAGCAGAAGACGGCATACGAGAT-3 (SEQ ID NO: 361) is added at the 5 end, and the sequence 5-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT XXXXXXXXXXXXXXXXXXXX-3 (SEQ ID NO: 365) is added at the 3 end, wherein X can be any suitable nucleotide, and the region of XX . . . XX has a sequence complementary to that of the nucleic acid of interest and can be any suitable length.
[0063] In some embodiments, the present disclosure pertains to any primer comprising a barcode sequence provided in Table 2. In some embodiments, the present disclosure pertains to any primer which is useful for a method of the present disclosure which comprises a barcode sequence provided in Table 2.
TABLE-US-00004 TABLE2 Exampleuniquebarcodes SEQ SEQ ID ID NO: NO: 1081 S2-i7t0-AATGCTTCTTGT 363 S2 i7 AATGCTTCTTGT 363 0 1082 S2-i7t0-GCTTATTAGTTA 366 S2 i7 GCTTATTAGTTA 366 0 1083 S2-i7t0-TCGGCCGTCTCG 367 S2 i7 TCGGCCGTCTCG 367 0 1084 S2-i7t0-GCGATTGCTTAG 368 S2 i7 GCGATTGCTTAG 368 0 1085 S2-i7t0-TGGAGCGAACAT 369 S2 i7 TGGAGCGAACAT 369 0 1086 S2-i7t0-GCGCTGGACCTT 370 S2 i7 GCGCTGGACCTT 370 0 1087 S2-i7t0-GCTGATCAATGA 371 S2 i7 GCTGATCAATGA 371 0 1088 S2-i7t0-CTGAAGCTCTAA 372 S2 i7 CTGAAGCTCTAA 372 0 1089 S2-i7t0-ATTGTAAGGGCC 373 S2 i7 ATTGTAAGGGCC 373 0 1090 S2-i7t0-GTTTAGGTTGCC 374 S2 i7 GTTTAGGTTGCC 374 0 1091 S2-i7t0-CAGTGGAGCACC 375 S2 i7 CAGTGGAGCACC 375 0 1092 S2-i7t0-TCTACCTAGCGC 376 S2 i7 TCTACCTAGCGC 376 0 1093 S2-i7t0-GTAGCAAGTATG 377 S2 i7 GTAGCAAGTATG 377 0 1094 S2-i7t0-TGAGGGTGCCTC 378 S2 i7 TGAGGGTGCCTC 378 0 1095 S2-i7t0-TAACCCAGAACG 379 S2 i7 TAACCCAGAACG 379 0 1096 S2-i7t0-CATTCCAGTGTT 380 S2 i7 CATTCCAGTGTT 380 0 1097 S2-i7t0-GTGATAGCCATA 381 S2 i7 GTGATAGCCATA 381 0 1098 S2-i7t0-CTAGCGACTAGT 382 S2 i7 CTAGCGACTAGT 382 0 1099 S2-i7t0-CTCTTCGGACCC 383 S2 i7 CTCTTCGGACCC 383 0 1100 S2-i7t0-ATAACGCGACCC 384 S2 i7 ATAACGCGACCC 384 0 1101 S2-i7t0-ATAAAGATCATC 385 S2 i7 ATAAAGATCATC 385 0 1102 S2-i7t0-CATCGGGAAGGC 386 S2 i7 CATCGGGAAGGC 386 0 1103 S2-i7t0-GTGTCGGCAGGT 387 S2 i7 GTGTCGGCAGGT 387 0 1104 S2-i7t0-ACACGGAACGTG 388 S2 i7 ACACGGAACGTG 388 0 1105 S2-i7t0-GCAGTTCTGAGC 389 S2 i7 GCAGTTCTGAGC 389 0 1106 S2-i7t0-GAGTTGCGCTAG 390 S2 i7 GAGTTGCGCTAG 390 0 1107 S2-i7t0-AGGACGTAGTAT 391 S2 i7 AGGACGTAGTAT 391 0 1108 S2-i7t0-TACCAATAGACA 392 S2 i7 TACCAATAGACA 392 0 1109 S2-i7t0-AAAGTCTGTATG 393 S2 i7 AAAGTCTGTATG 393 0 1110 S2-i7t0-AAATTTCGACTC 394 S2 i7 AAATTTCGACTC 394 0 1111 S2-i7t0-TTGGATCTTAAG 395 S2 i7 TTGGATCTTAAG 395 0 1112 S2-i7t0-TCACCAGCGCGT 396 S2 i7 TCACCAGCGCGT 396 0 1113 S2-i7t0-ACGCCTTCCACA 397 S2 i7 ACGCCTTCCACA 397 0 1114 S2-i7t0-TAGGACTCATAT 398 S2 i7 TAGGACTCATAT 398 0 1115 S2-i7t0-GCAAACCTAACT 399 S2 i7 GCAAACCTAACT 399 0 1116 S2-i7t0-TGTAAGTGGATA 400 S2 i7 TGTAAGTGGATA 400 0 1117 S2-i7t0-GCAGCTTAACCT 401 S2 i7 GCAGCTTAACCT 401 0 1118 S2-i7t0-ACTAGTCGCTAC 402 S2 i7 ACTAGTCGCTAC 402 0 1119 S2-i7t0-TGTTAAATGGGC 403 S2 i7 TGTTAAATGGGC 403 0 1120 S2-i7t0-GACCCAATCATC 404 S2 i7 GACCCAATCATC 404 0 1121 S2-i7t0-AGGAGCCTACAG 405 S2 i7 AGGAGCCTACAG 405 0 1122 S2-i7t0-GCTAGGGAGACG 406 S2 i7 GCTAGGGAGACG 406 0 1123 S2-i7t0-TGTTCCTCCACC 407 S2 i7 TGTTCCTCCACC 407 0 1124 S2-i7t0-CTTGAAGGTTCA 408 S2 i7 CTTGAAGGTTCA 408 0 1125 S2-i7t0-GTCGACGAACCT 409 S2 i7 GTCGACGAACCT 409 0 1126 S2-i7t0-CGCTTCCACTTA 410 S2 i7 CGCTTCCACTTA 410 0 1127 S2-i7t0-CAACCTTTGCTC 411 S2 i7 CAACCTTTGCTC 411 0 1128 S2-i7t0-ACATGGGAGCCT 412 S2 i7 ACATGGGAGCCT 412 0 1129 S2-i7t0-TCCGATATAATG 413 S2 i7 TCCGATATAATG 413 0 1130 S2-i7t0-TATTGGATAATG 414 S2 i7 TATTGGATAATG 414 0 1131 S2-i7t0-GTATTCACGGGT 415 S2 i7 GTATTCACGGGT 415 0 1132 S2-i7t0-TTTATGTTACGC 416 S2 i7 TTTATGTTACGC 416 0 1133 S2-i7t0-AGTGATAGATCC 4i7 S2 i7 AGTGATAGATCC 417 0 1134 S2-i7t0-GCATTAGGTACT 418 S2 i7 GCATTAGGTACT 418 0 1135 S2-i7t0-TCGAAGCACTCA 419 S2 i7 TCGAAGCACTCA 419 0 1136 S2-i7t0-AAACCGCTTAAC 420 S2 i7 AAACCGCTTAAC 420 0 1137 S2-i7t0-CATATCTTACAA 421 S2 i7 CATATCTTACAA 421 0 1138 S2-i7t0-AAAGTTCACAAC 422 S2 i7 AAAGTTCACAAC 422 0 1139 S2-i7t0-CTCTGTGAGAGA 423 S2 i7 CTCTGTGAGAGA 423 0 1140 S2-i7t0-CTCGGTTTACTT 424 S2 i7 CTCGGTTTACTT 424 0 1141 S2-i7t0-GCCATGGTTGCG 425 S2 i7 GCCATGGTTGCG 425 0 1142 S2-i7t0-AGTGGCAGTCAC 426 S2 i7 AGTGGCAGTCAC 426 0 1143 S2-i7t0-TAAGTCACTGGC 427 S2 i7 TAAGTCACTGGC 427 0 1144 S2-i7t0-GATAGAGTCTCC 428 S2 i7 GATAGAGTCTCC 428 0 1145 S2-i7t0-GTTACTACGCTA 429 S2 i7 GTTACTACGCTA 429 0 1146 S2-i7t0-CGCGACTTTGAC 430 S2 i7 CGCGACTTTGAC 430 0 1147 S2-i7t0-TTATATTGGCTA 431 S2 i7 TTATATTGGCTA 431 0 1148 S2-i7t0-ACTATTACGTGT 432 S2 i7 ACTATTACGTGT 432 0 1149 S2-i7t0-TCGCAGAGGGCT 433 S2 i7 TCGCAGAGGGCT 433 0 1150 S2-i7t0-TTTATTTCTTCG 434 S2 i7 TTTATTTCTTCG 434 0 1151 S2-i7t0-TAGCCTTTATGC 435 S2 i7 TAGCCTTTATGC 435 0 1152 S2-i7t0-TGTCTGTAAGGA 436 S2 i7 TGTCTGTAAGGA 436 0 1153 S2-i7t0-TCAGTTCGCATT 437 S2 i7 TCAGTTCGCATT 437 0 1154 S2-i7t0-TGTGGAAAGAGC 438 S2 i7 TGTGGAAAGAGC 438 0 1155 S2-i7t0-GTCGAACTTAAT 439 S2 i7 GTCGAACTTAAT 439 0 1156 S2-i7t0-CAACTGGCAGGT 440 S2 i7 CAACTGGCAGGT 440 0 1157 S2-i7t0-TGGGTGGCAATG 441 S2 i7 TGGGTGGCAATG 441 0 1158 S2-i7t0-CGGTCGGCACTA 442 S2 i7 CGGTCGGCACTA 442 0 1159 S2-i7t0-TGCGCTTACAAT 443 S2 i7 TGCGCTTACAAT 443 0 1160 S2-i7t0-CGTATTGGTCTA 444 S2 i7 CGTATTGGTCTA 444 0 1161 S2-i7t0-CGACCCATCGCG 445 S2 i7 CGACCCATCGCG 445 0 1162 S2-i7t0-TTGAGGGTGCGA 446 S2 i7 TTGAGGGTGCGA 446 0 1163 S2-i7t0-ATCGAGGAAGAT 447 S2 i7 ATCGAGGAAGAT 447 0 1164 S2-i7t0-CTCGACATGCTT 448 S2 i7 CTCGACATGCTT 448 0 1165 S2-i7t0-AGAGCAGGATTT 449 S2 i7 AGAGCAGGATTT 449 0 1166 S2-i7t0-AGCAAGACGGTT 450 S2 i7 AGCAAGACGGTT 450 0 1167 S2-i7t0-TTACTCAGTACA 451 S2 i7 TTACTCAGTACA 451 0 1168 S2-i7t0-AGTAGCTTGACC 452 S2 i7 AGTAGCTTGACC 452 0 1169 S2-i7t0-AGCTGCATGCCT 453 S2 i7 AGCTGCATGCCT 453 0 1170 S2-i7t0-CTACAGTCGGCT 454 S2 i7 CTACAGTCGGCT 454 0 1171 S2-i7t0-TTTCAGGGTTGC 455 S2 i7 TTTCAGGGTTGC 455 0 1172 S2-i7t0-ATAGGTCTACGT 456 S2 i7 ATAGGTCTACGT 456 0 1173 S2-i7t0-TTCCAAACCGGT 457 S2 i7 TTCCAAACCGGT 457 0 1174 S2-i7t0-GTTCCGTCGTCT 458 S2 i7 GTTCCGTCGTCT 458 0 1175 S2-i7t0-TCAATAGGACTC 459 S2 i7 TCAATAGGACTC 459 0 1176 S2-i7t0-ATTTGAAGCCCA 460 S2 i7 ATTTGAAGCCCA 460 0 1177 S2-i7t0-ATCGTCAAATGA 461 S2 i7 ATCGTCAAATGA 161 0 1178 S2-i7t0-TGGATACCCGTT 462 S2 i7 TGGATACCCGTT 462 0 1179 S2-i7t0-GATTGATGGTGA 463 S2 i7 GATTGATGGTGA 463 0 1180 S2-i7t0-GCCGCAAATAAC 464 S2 i7 GCCGCAAATAAC 464 0 1181 S2-i7t0-TAAATCCTCACG 465 S2 i7 TAAATCCTCACG 465 0 1182 S2-i7t0-AGTATACAGACC 466 S2 i7 AGTATACAGACC 466 0 1183 S2-i7t0-TCGGATCATGAA 467 S2 i7 TCGGATCATGAA 467 0 1184 S2-i7t0-ACTGCCCATTAC 468 S2 i7 ACTGCCCATTAC 468 0 1185 S2-i7t0-TAAGAGTTGGCA 469 S2 i7 TAAGAGTTGGCA 469 0 1186 S2-i7t0-TAAGACTCCATC 470 S2 i7 TAAGACTCCATC 470 0 1187 S2-i7t0-TGCCACATGTTT 471 S2 i7 TGCCACATGTTT 471 0 1188 S2-i7t0-AATGGACAAGCC 472 S2 i7 AATGGACAAGCC 472 0 1189 S2-i7t0-ATCCTCCAGGCA 473 S2 i7 ATCCTCCAGGCA 473 0 1190 S2-i7t0-GACTGAATAGAT 474 S2 i7 GACTGAATAGAT 474 0 1191 S2-i7t0-ATTCGGCTTTAA 475 S2 i7 ATTCGGCTTTAA 475 0 1192 S2-i7t0-GAAGTTTGTTAA 476 S2 i7 GAAGTTTGTTAA 476 0 1193 S2-i7t0-GAAGTCGAGGTA 477 S2 i7 GAAGTCGAGGTA 477 0 1194 S2-i7t0-GACCATTGTCGA 478 S2 i7 GACCATTGTCGA 478 0 1195 S2-i7t0-GCCCTCCAATCC 479 S2 i7 GCCCTCCAATCC 479 0 1196 S2-i7t0-GTCGTGTCGGGA 480 S2 i7 GTCGTGTCGGGA 480 0 1197 S2-i7t0-GCGTTTCGTACA 481 S2 i7 GCGTTTCGTACA 481 0 1198 S2-i7t0-TATAGTTGTCAT 482 S2 i7 TATAGTTGTCAT 482 0 1199 S2-i7t0-ATCCACGCGTGC 483 S2 i7 ATCCACGCGTGC 483 0 1200 S2-i7t0-CGATTTCTAGAG 484 S2 i7 CGATTTCTAGAG 484 0 1201 S2-i7t0-AACGCGACGTAA 485 S2 i7 AACGCGACGTAA 485 0 1202 S2-i7t0-GCTCAACCGACC 486 S2 i7 GCTCAACCGACC 486 0 1203 S2-i7t0-TACTGGTAACAT 487 S2 i7 TACTGGTAACAT 487 0 1204 S2-i7t0-ACATCAGAGAAT 488 S2 i7 ACATCAGAGAAT 488 0 1205 S2-i7t0-CTAGTAGAATTC 489 S2 i7 CTAGTAGAATTC 489 0 1206 S2-i7t0-AGCGCGGTACTG 490 S2 i7 AGCGCGGTACTG 490 0 1207 S2-i7t0-TTGAGATATGCA 491 S2 i7 TTGAGATATGCA 491 0 1208 S2-i7t0-TTACCCGTTTAA 492 S2 i7 TTACCCGTTTAA 492 0 1209 S2-i7t0-ACTAGTCTCATT 493 S2 i7 ACTAGTCTCATT 493 0 1210 S2-i7t0-TTGTTCTGTTGA 494 S2 i7 TTGTTCTGTTGA 494 0 1211 S2-i7t0-CAGTAAGGTGAG 495 S2 i7 CAGTAAGGTGAG 495 0 1212 S2-i7t0-AACGTTCGCCTG 496 S2 i7 AACGTTCGCCTG 496 0 1213 S2-i7t0-TCTGGTGCATTG 497 S2 i7 TCTGGTGCATTG 497 0 1214 S2-i7t0-TTCGGTGTCTAG 498 S2 i7 TTCGGTGTCTAG 498 0 1215 S2-i7t0-ATGTCTGAAATC 499 S2 i7 ATGTCTGAAATC 499 0 1216 S2-i7t0-TCTGGCCATGCT 500 S2 i7 TCTGGCCATGCT 500 0 1217 S2-i7t0-TAATGTCTTGAG 501 S2 i7 TAATGTCTTGAG 501 0 1218 S2-i7t0-CAGACTCACCCG 502 S2 i7 CAGACTCACCCG 502 0 1219 S2-i7t0-CTACTGATAGGA 503 S2 i7 CTACTGATAGGA 503 0 1220 S2-i7t0-ACGGGCTCGTTA 504 S2 i7 ACGGGCTCGTTA 504 0 1221 S2-i7t0-CATTGCAGACAC 505 S2 i7 CATTGCAGACAC 505 0 1222 S2-i7t0-GAATAAGGGACC 506 S2 i7 GAATAAGGGACC 506 0 1223 S2-i7t0-CATCAAGCCCTT 507 S2 i7 CATCAAGCCCTT 507 0 1224 S2-i7t0-TTTACCGAGCAA 508 S2 i7 TTTACCGAGCAA 508 0 1225 S2-i7t0-CTTTCCTGCGCG 509 S2 i7 CTTTCCTGCGCG 509 0 1226 S2-i7t0-CTTGTGCTATCT 510 S2 i7 CTTGTGCTATCT 510 0 1227 S2-i7t0-AGGAATCGCAAA 511 S2 i7 AGGAATCGCAAA 511 0 1228 S2-i7t0-TCTAGACACAGT 512 S2 i7 TCTAGACACAGT 512 0 1229 S2-i7t0-ACTCTCCATCCC 513 S2 i7 ACTCTCCATCCC 513 0 1230 S2-i7t0-ACGCCTAGGCGT 514 S2 i7 ACGCCTAGGCGT 514 0 1231 S2-i7t0-CAGCAACAACTG 515 S2 i7 CAGCAACAACTG 515 0 1232 S2-i7t0-CTTACATGAACC 516 S2 i7 CTTACATGAACC 516 0 1233 S2-i7t0-TCCTTTGTCGTG 517 S2 i7 TCCTTTGTCGTG 517 0 1234 S2-i7t0-AAGATCGTAAAC 518 S2 i7 AAGATCGTAAAC 518 0 1235 S2-i7t0-AGGAACATACTA 519 S2 i7 AGGAACATACTA 519 0 1236 S2-i7t0-GATGAATGATAC 520 S2 i7 GATGAATGATAC 520 0 1237 S2-i7t0-GAGAAATAATTC 521 S2 i7 GAGAAATAATTC 521 0 1238 S2-i7t0-GCCACTCGCATG 522 S2 i7 GCCACTCGCATG 522 0 1239 S2-i7t0-TGTAAATAGCCC 523 S2 i7 TGTAAATAGCCC 523 0 1240 S2-i7t0-CATAATTCGCTA 524 S2 i7 CATAATTCGCTA 524 0 1241 S2-i7t0-CATTACGCAGTT 525 S2 i7 CATTACGCAGTT 525 0 1242 S2-i7t0-GAGCGGATGATT 526 S2 i7 GAGCGGATGATT 526 0 1243 S2-i7t0-GTACATCGCCGC 527 S2 i7 GTACATCGCCGC 527 0 1244 S2-i7t0-AACACTCACTTG 528 S2 i7 AACACTCACTTG 528 0 1245 S2-i7t0-GTACCGGGCTAC 529 S2 i7 GTACCGGGCTAC 529 0 1246 S2-i7t0-TCGACCCATTAA 530 S2 i7 TCGACCCATTAA 530 0 1247 S2-i7t0-GCTTAACTACGC 531 S2 i7 GCTTAACTACGC 531 0 1248 S2-i7t0-TACTGCCCAACT 532 S2 i7 TACTGCCCAACT 532 0 1249 S2-i7t0-TGAGCTTGATCA 533 S2 i7 TGAGCTTGATCA 533 0 1250 S2-i7t0-GTCGCAGGACAT 534 S2 i7 GTCGCAGGACAT 534 0 1251 S2-i7t0-TAGCTCGGGTAA 535 S2 i7 TAGCTCGGGTAA 535 0 1252 S2-i7t0-CAACAGTTCCAC 536 S2 i7 CAACAGTTCCAC 536 0 1253 S2-i7t0-CGTCACCACTCA 537 S2 i7 CGTCACCACTCA 537 0 1254 S2-i7t0-GACACACTTGAT 538 S2 i7 GACACACTTGAT 538 0 1255 S2-i7t0-TGAGTTGCGTTC 539 S2 i7 TGAGTTGCGTTC 539 0 1256 S2-i7t0-CTACCCTAGTCG 540 S2 i7 CTACCCTAGTCG 540 0 1257 S2-i7t0-TAGATCTTGAGT 541 S2 i7 TAGATCTTGAGT 541 0 1258 S2-i7t0-TCTACCTCTAAC 542 S2 i7 TCTACCTCTAAC 542 0 1259 S2-i7t0-AGACGAAACGGA 543 S2 i7 AGACGAAACGGA 543 0 1260 S2-i7t0-CAAGGGCTTCCC 544 S2 i7 CAAGGGCTTCCC 544 0 1261 S2-i7t0-ACGCAATTGTAC 545 S2 i7 ACGCAATTGTAC 545 0 1262 S2-i7t0-AAATAAACTCGC 546 S2 i7 AAATAAACTCGC 546 0 1263 S2-i7t0-ACCATTAGCCGT 547 S2 i7 ACCATTAGCCGT 547 0 1264 S2-i7t0-ACCTATCCAGTG 548 S2 i7 ACCTATCCAGTG 548 0 1265 S2-i7t0-CGTGAATGGTGA 549 S2 i7 CGTGAATGGTGA 549 0 1266 S2-i7t0-TGCTACAAGGGA 550 S2 i7 TGCTACAAGGGA 550 0 1267 S2-i7t0-CTTCAGTACCGC 551 S2 i7 CTTCAGTACCGC 551 0 1268 S2-i7t0-CAAACCGCTCTA 552 S2 i7 CAAACCGCTCTA 552 0 1269 S2-i7t0-ATGCCGGTCCGC 553 S2 i7 ATGCCGGTCCGC 553 0 1270 S2-i7t0-GCTGTCGTGGGA 554 S2 i7 GCTGTCGTGGGA 554 0 1271 S2-i7t0-TCCCGCCTCCGA 555 S2 i7 TCCCGCCTCCGA 555 0 1272 S2-i7t0-GAACCTAATTTG 556 S2 i7 GAACCTAATTTG 556 0 1273 S2-i7t0-TCCAGTATCGAC 557 S2 i7 TCCAGTATCGAC 557 0 1274 S2-i7t0-TCACGGTCAGCA 558 S2 i7 TCACGGTCAGCA 558 0 1275 S2-i7t0-TGTTGCTCTCTG 559 S2 i7 TGTTGCTCTCTG 559 0 1276 S2-i7t0-GTTTGCGCAAAT 560 S2 i7 GTTTGCGCAAAT 560 0 1277 S2-i7t0-CAAAGCACCGTG 561 S2 i7 CAAAGCACCGTG 561 0 1278 S2-i7t0-CTGAGGCATGGC 562 S2 i7 CTGAGGCATGGC 562 0 1279 S2-i7t0-CAAGGATCTCTT 563 S2 i7 CAAGGATCTCTT 563 0 1280 S2-i7t0-TCAAGGCCTGTT 564 S2 i7 TCAAGGCCTGTT 564 0 1281 S2-i7t0-AACCTGTCCGTA 565 S2 i7 AACCTGTCCGTA 565 0 1282 S2-i7t0-TAACCACGAAGT 566 S2 i7 TAACCACGAAGT 566 0 1283 S2-i7t0-TTCTCCTAGGAA 567 S2 i7 TTCTCCTAGGAA 567 0 1284 S2-i7t0-AAATTGTACTTC 568 S2 i7 AAATTGTACTTC 568 0 1285 S2-i7t0-CTCCACCGAGTT 569 S2 i7 CTCCACCGAGTT 569 0 1286 S2-i7t0-CAGTTGTATTCG 570 S2 i7 CAGTTGTATTCG 570 0 1287 S2-i7t0-TTGGGTAGCAGC 571 S2 i7 TTGGGTAGCAGC 571 0 1288 S2-i7t0-TATATCGCTTGC 572 S2 i7 TATATCGCTTGC 572 0 1289 S2-i7t0-GACTCGTTGACC 573 S2 i7 GACTCGTTGACC 573 0 1290 S2-i7t0-TAACTCTGGCCC 574 S2 i7 TAACTCTGGCCC 574 0 1291 S2-i7t0-GCACTAGGTTTG 575 S2 i7 GCACTAGGTTTG 575 0 1292 S2-i7t0-CATGCTTCCGTT 576 S2 i7 CATGCTTCCGTT 576 0 1293 S2-i7t0-CACCTGTGATGA 577 S2 i7 CACCTGTGATGA 577 0 1294 S2-i7t0-ACCTATTTAAGA 578 S2 i7 ACCTATTTAAGA 578 0 1295 S2-i7t0-GCACGTAGGTAA 579 S2 i7 GCACGTAGGTAA 579 0 1296 S2-i7t0-CAGTACTGTTCC 580 S2 i7 CAGTACTGTTCC 580 0 1297 S2-i7t0-GTTAGGAACCTA 581 S2 i7 GTTAGGAACCTA 581 0 1298 S2-i7t0-TAGATTGCTGAT 582 S2 i7 TAGATTGCTGAT 582 0 1299 S2-i7t0-ATGAGTCATAGT 583 S2 i7 ATGAGTCATAGT 583 0 1300 S2-i7t0-AGAAATGATCCG 584 S2 i7 AGAAATGATCCG 584 0 1301 S2-i7t0-GATATTCATCCG 585 S2 i7 GATATTCATCCG 585 0 1302 S2-i7t0-TCGGTTCCGTCC 586 S2 i7 TCGGTTCCGTCC 586 0 1303 S2-i7t0-AGACACAGGTAG 587 S2 i7 AGACACAGGTAG 587 0 1304 S2-i7t0-AGGTTGGGCCGC 588 S2 i7 AGGTTGGGCCGC 588 0 1305 S2-i7t0-GTAGAACCTCTG 589 S2 i7 GTAGAACCTCTG 589 0 1306 S2-i7t0-AACTATGCGAAA 590 S2 i7 AACTATGCGAAA 590 0 1307 S2-i7t0-TGCGACGCCACG 591 S2 i7 TGCGACGCCACG 591 0 1308 S2-i7t0-CGTAAGTCGCGT 592 S2 i7 CGTAAGTCGCGT 592 0 1309 S2-i7t0-CTGAGACTTGTT 593 S2 i7 CTGAGACTTGTT 593 0 1310 S2-i7t0-AGTCAGTAAGAG 594 S2 i7 AGTCAGTAAGAG 594 0 1311 S2-i7t0-CAGCGAAGCGAA 595 S2 i7 CAGCGAAGCGAA 595 0 1312 S2-i7t0-AATGTTGTGCGA 596 S2 i7 AATGTTGTGCGA 596 0 1313 S2-i7t0-TTCCATATCACC 597 S2 i7 TTCCATATCACC 597 0 1314 S2-i7t0-GTCTCAAATTGT 598 S2 i7 GTCTCAAATTGT 598 0 1315 S2-i7t0-GCGGGATGTTTA 599 S2 i7 GCGGGATGTTTA 599 0 1316 S2-i7t0-GATACTAAGGAC 600 S2 i7 GATACTAAGGAC 600 0 1317 S2-i7t0-CGAAACATTAAT 601 S2 i7 CGAAACATTAAT 601 0 1318 S2-i7t0-TACGATAGGTCA 602 S2 i7 TACGATAGGTCA 602 0 1319 S2-i7t0-GCACAATGCACG 603 S2 i7 GCACAATGCACG 603 0 1320 S2-i7t0-GTCCACCGTCAA 604 S2 i7 GTCCACCGTCAA 604 0 1321 S2-i7t0-TGAATCCAACGA 605 S2 i7 TGAATCCAACGA 605 0 1322 S2-i7t0-GACAATCGTCAG 606 S2 i7 GACAATCGTCAG 606 0 1323 S2-i7t0-TCGCTTGATATT 607 S2 i7 TCGCTTGATATT 607 0 1324 S2-i7t0-ACACACACCGCT 608 S2 i7 ACACACACCGCT 608 0 1325 S2-i7t0-TGACCACCAATA 609 S2 i7 TGACCACCAATA 609 0 1326 S2-i7t0-CGCCTGGGTAAG 610 S2 i7 CGCCTGGGTAAG 610 0 1327 S2-i7t0-TCGGTATCAGTG 611 S2 i7 TCGGTATCAGTG 611 0 1328 S2-i7t0-GAGTCCTGATAT 612 S2 i7 GAGTCCTGATAT 612 0 1329 S2-i7t0-CACTACACATGT 613 S2 i7 CACTACACATGT 613 0 1330 S2-i7t0-CAGTAATTCCAT 614 S2 i7 CAGTAATTCCAT 614 0 1331 S2-i7t0-AATTAAACACCG 615 S2 i7 AATTAAACACCG 615 0 1332 S2-i7t0-GCAGGGCTTGCA 616 S2 i7 GCAGGGCTTGCA 616 0 1333 S2-i7t0-ACCCAAGCCATT 617 S2 i7 ACCCAAGCCATT 617 0 1334 S2-i7t0-AATTATACTGTG 618 S2 i7 AATTATACTGTG 618 0 1335 S2-i7t0-GAGCAGCGAAGT 619 S2 i7 GAGCAGCGAAGT 619 0 1336 S2-i7t0-CGCCGTACCGTA 620 S2 i7 CGCCGTACCGTA 620 0 1337 S2-i7t0-TTAGCTCCGGTT 621 S2 i7 TTAGCTCCGGTT 621 0 1338 S2-i7t0-GATACGTAGATC 622 S2 i7 GATACGTAGATC 622 0 1339 S2-i7t0-ACTTCACTCCTA 623 S2 i7 ACTTCACTCCTA 623 0 1340 S2-i7t0-AGGTTCATTAGA 624 S2 i7 AGGTTCATTAGA 624 0 1341 S2-i7t0-TGGTCATATAAT 625 S2 i7 TGGTCATATAAT 625 0 1342 S2-i7t0-GAAAGGCGTACT 626 S2 i7 GAAAGGCGTACT 626 0 1343 S2-i7t0-AACGCCTGGAAG 627 S2 i7 AACGCCTGGAAG 627 0 1344 S2-i7t0-AAGGTAGTGGCA 628 S2 i7 AAGGTAGTGGCA 628 0 1345 S2-i7t0-TGGCCAATCCAG 629 S2 i7 TGGCCAATCCAG 629 0 1346 S2-i7t0-TCGACAGCGATT 630 S2 i7 TCGACAGCGATT 630 0 1347 S2-i7t0-TTAACCACCGTT 631 S2 i7 TTAACCACCGTT 631 0 1348 S2-i7t0-TAGAGTTCTATC 632 S2 i7 TAGAGTTCTATC 632 0 1349 S2-i7t0-ACCAGATTGGAG 633 S2 i7 ACCAGATTGGAG 633 0 1350 S2-i7t0-ATCCTTACTTTA 634 S2 i7 ATCCTTACTTTA 634 0 1351 S2-i7t0-GCTACGCGGTGC 635 S2 i7 GCTACGCGGTGC 635 0 1352 S2-i7t0-TACTTCTTTGAA 636 S2 i7 TACTTCTTTGAA 636 0 1353 S2-i7t0-ACAAGAGATGCT 637 S2 i7 ACAAGAGATGCT 637 0 1354 S2-i7t0-ACCCAGGATGCC 638 S2 i7 ACCCAGGATGCC 638 0 1355 S2-i7t0-GTAGTTGGAACA 639 S2 i7 GTAGTTGGAACA 639 0 1356 S2-i7t0-TCTACATTTCTG 640 S2 i7 TCTACATTTCTG 640 0 1357 S2-i7t0-GTGCGCCGCTTC 641 S2 i7 GTGCGCCGCTTC 641 0 1358 S2-i7t0-GAACATCAGAAT 642 S2 i7 GAACATCAGAAT 642 0 1359 S2-i7t0-GCCGAAGCTGTC 643 S2 i7 GCCGAAGCTGTC 643 0 1360 S2-i7t0-AAGGACCCGAAT 644 S2 i7 AAGGACCCGAAT 644 0 1361 S2-i7t0-CTTTGCCGTTAT 645 S2 i7 CTTTGCCGTTAT 645 0 1362 S2-i7t0-AATCTCTGCCAT 646 S2 i7 AATCTCTGCCAT 646 0 1363 S2-i7t0-CGAGATTACCAG 647 S2 i7 CGAGATTACCAG 647 0 1364 S2-i7t0-GCTCGCAGCTAC 648 S2 i7 GCTCGCAGCTAC 648 0 1365 S2-i7t0-ACTCAGCCCGTT 649 S2 i7 ACTCAGCCCGTT 649 0 1366 S2-i7t0-TGATCGCATGCA 650 S2 i7 TGATCGCATGCA 650 0 1367 S2-i7t0-TTCAACAGATAC 651 S2 i7 TTCAACAGATAC 651 0 1368 S2-i7t0-GCTGATAGAAGT 652 S2 i7 GCTGATAGAAGT 652 0 1369 S2-i7t0-GTAGAATAGAAT 653 S2 i7 GTAGAATAGAAT 653 0 1370 S2-i7t0-CTCGAGCGATAA 654 S2 i7 CTCGAGCGATAA 654 0 1371 S2-i7t0-TGGTAGCGGCCA 655 S2 i7 TGGTAGCGGCCA 655 0 1372 S2-i7t0-AAACGGTCTTGA 656 S2 i7 AAACGGTCTTGA 656 0 1373 S2-i7t0-CAGCGCGTCCCT 657 S2 i7 CAGCGCGTCCCT 657 0 1374 S2-i7t0-TCTCCGATATAA 658 S2 i7 TCTCCGATATAA 658 0 1375 S2-i7t0-GACATCGCCTTT 659 S2 i7 GACATCGCCTTT 659 0 1376 S2-i7t0-TACCTAGATTCG 660 S2 i7 TACCTAGATTCG 660 0 1377 S2-i7t0-TGCAAGCTCTCG 661 S2 i7 TGCAAGCTCTCG 661 0 1378 S2-i7t0-CATTAGCCATAG 662 S2 i7 CATTAGCCATAG 662 0 1379 S2-i7t0-TGTCCTCAAGCA 663 S2 i7 TGTCCTCAAGCA 663 0 1380 S2-i7t0-TGGCTGCAAATA 664 S2 i7 TGGCTGCAAATA 664 0 1381 S2-i7t0-AACCTCATGCAG 665 S2 i7 AACCTCATGCAG 665 0 1382 S2-i7t0-AGAGCTCGAACG 666 S2 i7 AGAGCTCGAACG 666 0 1383 S2-i7t0-ATTCTTCGTGCT 667 S2 i7 ATTCTTCGTGCT 667 0 1384 S2-i7t0-GAACCAAGCCTA 668 S2 i7 GAACCAAGCCTA 668 0 1385 S2-i7t0-AGTTACTACAAG 669 S2 i7 AGTTACTACAAG 669 0 1386 S2-i7t0-TTGATCCCGAAT 670 S2 i7 TTGATCCCGAAT 670 0 1387 S2-i7t0-CTTGGCACCAGT 671 S2 i7 CTTGGCACCAGT 671 0 1388 S2-i7t0-GAAGAGGTAACC 672 S2 i7 GAAGAGGTAACC 672 0 1389 S2-i7t0-ACGACCGGGTTG 673 S2 i7 ACGACCGGGTTG 673 0 1390 S2-i7t0-GCATTTAGCTCA 674 S2 i7 GCATTTAGCTCA 674 0 1391 S2-i7t0-TGTCGTTGCCGA 675 S2 i7 TGTCGTTGCCGA 675 0 1392 S2-i7t0-AGAAAGCTTCTG 676 S2 i7 AGAAAGCTTCTG 676 0 1393 S2-i7t0-TAGTGGTCTGCA 677 S2 i7 TAGTGGTCTGCA 677 0 1394 S2-i7t0-GTCGAGGTCTAC 678 S2 i7 GTCGAGGTCTAC 678 0 1395 S2-i7t0-TCTTCAGCGACC 679 S2 i7 TCTTCAGCGACC 679 0 1396 S2-i7t0-TCAGCTAACTCA 680 S2 i7 TCAGCTAACTCA 680 0 1397 S2-i7t0-TCCAATCGACCT 681 S2 i7 TCCAATCGACCT 681 0 1398 S2-i7t0-CGGTCTGATATA 682 S2 i7 CGGTCTGATATA 682 0 1399 S2-i7t0-GAGGGCAATTCA 683 S2 i7 GAGGGCAATTCA 683 0 1400 S2-i7t0-ACGGTCTTCGAG 684 S2 i7 ACGGTCTTCGAG 684 0 1401 S2-i7t0-ACCGAGTTGTCT 685 S2 i7 ACCGAGTTGTCT 685 0 1402 S2-i7t0-TGCGAGCGTCCC 686 S2 i7 TGCGAGCGTCCC 686 0 1403 S2-i7t0-CTTGCACATACT 687 S2 i7 CTTGCACATACT 687 0 1404 S2-i7t0-ACCTTAGTGTCC 688 S2 i7 ACCTTAGTGTCC 688 0 1405 S2-i7t0-CTGTAGTTCTCG 689 S2 i7 CTGTAGTTCTCG 689 0 1406 S2-i7t0-AGGCCCTTAGTC 690 S2 i7 AGGCCCTTAGTC 690 0 1407 S2-i7t0-CAACGATACTAA 691 S2 i7 CAACGATACTAA 691 0 1408 S2-i7t0-GCCAAATGCGAA 692 S2 i7 GCCAAATGCGAA 692 0 1409 S2-i7t0-TCCAAAGTTCTC 693 S2 i7 TCCAAAGTTCTC 693 0 1410 S2-i7t0-ACCCGGACTATC 694 S2 i7 ACCCGGACTATC 694 0 1411 S2-i7t0-CAACAATGTGAA 695 S2 i7 CAACAATGTGAA 695 0 1412 S2-i7t0-GTCATCATTACA 696 S2 i7 GTCATCATTACA 696 0 1413 S2-i7t0-CGTATTTGAACT 697 S2 i7 CGTATTTGAACT 697 0 1414 S2-i7t0-CACACATGTGCT 698 S2 i7 CACACATGTGCT 698 0 1415 S2-i7t0-AGGTCTCGATAG 699 S2 i7 AGGTCTCGATAG 699 0 1416 S2-i7t0-CGAAATTGAAAC 700 S2 i7 CGAAATTGAAAC 700 0 1417 S2-i7t0-TCTGGCAAACAA 701 S2 i7 TCTGGCAAACAA 701 0 1418 S2-i7t0-CGGATTGAACGA 702 S2 i7 CGGATTGAACGA 702 0 1419 S2-i7t0-TATCAAGTGATC 703 S2 i7 TATCAAGTGATC 703 0 1420 S2-i7t0-ACAGTAAGTGTA 704 S2 i7 ACAGTAAGTGTA 704 0 1421 S2-i7t0-ATGCGCGCAGCA 705 S2 i7 ATGCGCGCAGCA 705 0 1422 S2-i7t0-AGCGGACGTGCA 706 S2 i7 AGCGGACGTGCA 706 0 1423 S2-i7t0-TAACGTATGAAC 707 S2 i7 TAACGTATGAAC 707 0 1424 S2-i7t0-ATTGCCCTCATG 708 S2 i7 ATTGCCCTCATG 708 0 1425 S2-i7t0-CTTCCAACATAA 709 S2 i7 CTTCCAACATAA 709 0 1426 S2-i7t0-CGCCCTTACCCA 710 S2 i7 CGCCCTTACCCA 710 0 1427 S2-i7t0-CAACAATCGATT 711 S2 i7 CAACAATCGATT 711 0 1428 S2-i7t0-CAGGTTCGCCGT 712 S2 i7 CAGGTTCGCCGT 712 0 1429 S2-i7t0-TGATGCAATAGT 713 S2 i7 TGATGCAATAGT 713 0 1430 S2-i7t0-AATCCGCTCCGT 714 S2 i7 AATCCGCTCCGT 714 0 1431 S2-i7t0-CTCGGCGTTCAT 715 S2 i7 CTCGGCGTTCAT 715 0 1432 S2-i7t0-TGTTCAGGTCCC 716 S2 i7 TGTTCAGGTCCC 716 0 1433 S2-i7t0-CATCCTTAAGTC 717 S2 i7 CATCCTTAAGTC 717 0 1434 S2-i7t0-AGGACTGTTGCT 718 S2 i7 AGGACTGTTGCT 718 0 1435 S2-i7t0-TTGCGAACTCTA 719 S2 i7 TTGCGAACTCTA 719 0 1436 S2-i7t0-GTTCTGGATTTA 720 S2 i7 GTTCTGGATTTA 720 0 1437 S2-i7t0-TTCTGGTCCACC 721 S2 i7 TTCTGGTCCACC 721 0 1438 S2-i7t0-CACACCAAATCA 722 S2 i7 CACACCAAATCA 722 0 1439 S2-i7t0-AGCGAACTGGGC 723 S2 i7 AGCGAACTGGGC 723 0 1440 S2-i7t0-GAGCTCGGGCTT 724 S2 i7 GAGCTCGGGCTT 724 0 1441 S2-i7t0-GCTCCTGTCGGT 725 S2 i7 GCTCCTGTCGGT 725 0 1442 S2-i7t0-TGCTTCCCTCAA 726 S2 i7 TGCTTCCCTCAA 726 0 1443 S2-i7t0-TGGAGATAATTG 727 S2 i7 TGGAGATAATTG 727 0 1444 S2-i7t0-AATATTCAGGCT 728 S2 i7 AATATTCAGGCT 728 0 1445 S2-i7t0-TGTATGAATGCC 729 S2 i7 TGTATGAATGCC 729 0 1446 S2-i7t0-ATTGAGACCCAC 730 S2 i7 ATTGAGACCCAC 730 0 1447 S2-i7t0-CAGGATCCTATC 731 S2 i7 CAGGATCCTATC 731 0 1448 S2-i7t0-GTGGCTCGTTCT 732 S2 i7 GTGGCTCGTTCT 732 0 1449 S2-i7t0-CGTTTCGAGGCG 733 S2 i7 CGTTTCGAGGCG 733 0
[0064] In some embodiments, a primer includes (a) a block of 12 nucleotides corresponding to the appropriate sequencing barcode, and (b) a 0-3 nucleotides diversity spacer, where (a) and (b) are 5 to (c) the targeting sequence that increase the base diversity at each sequencing position to improve the quality of base calling; each barcode is paired with a specific spacer length.
[0065] In some embodiments, unified primers are used. These primers have all of the components required for every step of amplifying the target and performing in an Illumina flowcell. Previous amplicon designs are highly compact, using custom sequencing primers to read the i5 (on NextSeq; NovaSeq chemistry does not use this), i7 and diagnostic sequence. They can be schematized to comprise three parts: (a) an Illumina flowcell binding sequence; (b) a sequencing index; and (c) a specific region that is used for targeting and binding all of the necessary sequencing primers. The previous design has the advantage of less expensive synthesis, but because some amplified sequence is used for binding of the sequencing primers it cannot sequence any PCR artifacts, which it is believed leads to a number of performance problems on Illumina sequencers.
[0066] In some embodiments, the primers have been redesigned to typical Illumina schemes, though such unified primers are not in common use. Referring to
[0067] In some embodiments, the index sequence of a primer is 10 or more base pairs (e.g., 12 base pairs) that allow certain computational properties such that they cannot be confused with each other without a defined number of errors, and they lack long runs of the same nucleotide (homopolymers).
Processing of Indexed Sequencing Template
Index Hopping
[0068] In some embodiments of the methods provided herein, samples comprising indexed sequencing templates (e.g., indexed amplification products) are subjected to a clean-up treatment and/or a processing step prior to sequencing. For example, in certain embodiments it is desirable to reduce the concentration of free and/or buried index primers present in the library of indexed sequencing templates prior to sequencing. When certain sequencing processes are used, such primers can increase index hopping and decrease data quality. The term free primers refers to unextended primers remaining free in the sample following completion of the amplification reaction used to produce indexed sequencing templates (illustrated in
[0069] Index hopping refers to extension products that comprise one or more improper index sequences resulting from the presence of free or buried primers. One way to determine the prevalence of index hopping is to look at how many reads contain forbidden index pairs. For example, in an indexing process that includes 1536 index pairs (i.e., 1536 forward indices, each paired with a specific reverse index), there would be 1536 valid index pairs (i.e., having a forward index matched with the correct reverse index) and 2,357,760 forbidden index pairs (i.e., an incorrect pairing of a forward index and a reverse index. If index hopping did not exist, these no sequencing reads would include forbidden index pairs. Moreover, the greater the frequency of index hopping, the greater the percentage of reads that will have forbidden index pairs.
[0070] Referring to the left histogram of
[0071] The right histogram of
[0072] In certain aspects of the assays provided herein, a subject sample is mixed with a unique (indexed) forward primer and a unique (indexed) reverse primer. Thus, in the absence of index hopping, amplification products having the A1 indexed primer set corresponds to subject A1 (
[0073] However, during the amplification step of a sequencing modality prone to index hopping, such as the NovaSeq sequencing process, there is opportunity for an indexed primer from subject B2 to extend, using the S Amplicon from subject A1 as the template, making a B1 chimera (
[0074] In some cases, however, another primer from subject B2 can extend in the other direction using the B1 chimera as a template. The double hop product now has the index from subject B2 on both sides, resulting in a false read indistinguishable from true reads for subject B2 (
[0075] The NextSeq platform uses a bridge amplification technique to generate amplicons for sequencing (
[0076] As provided herein, the frequency of index hopping can be reduced when performing index hopping-prone sequencing platforms, such as the NovaSeq platform, by reducing the concentration of free and/or buried primers in the indexed amplification product prior to initiating the sequencing process. Thus, in certain embodiments, strategies are provided herein for reducing and/or eliminating index hopping centered around removing or neutralizing free and/or buried primers so that they cannot extend or are extended to include an irrelevant sequence, thereby reducing their ability to participate in index hopping during sequencing (for example, on the NovaSeq platform). In certain embodiments, a combination of the index hopping reduction methods are performed prior to sequencing (i.e., a combination of 2, 3, 4, or more of the index processing methods provided herein are performed).
[0077] Primers residing inside or otherwise associated with larger complexes are less susceptible to inactivation using methods to inactivate free primers due to being buried. Thus, the methods described herein can comprise assays to remove or inactivate free primers, buried primers, or both. Thus, the methods can be combinations of more than one strategy for eliminating contaminating primers.
High Performance Liquid Chromatography
[0078] In some embodiments, a sample comprising an indexed sequencing template is purified using a High Performance Liquid Chromatography (HPLC) process prior to sequencing in order to reduce the concentration of free primers in the sample. For example, in some embodiments, the library of indexed sequencing templates is purified on an HPLC column such as HPLC purification of DNA oligonucleotides using Ion Exchange or Ion-Pairing Reverse Phase (IP-RP) chromatography. This technique separates DNA oligonucleotides based on size and allows isolation of longer PCR products from contaminating primers of shorter length. In some embodiments, prior to HPLC purification, a sample comprising indexed sequencing templates is treated by any process or reagent described herein to free buried primers.
[0079] In some embodiments, the sample is further treated with FAB (Free Adapter Blocking) reagent (Illumina, San Diego, CA) before and/or after HPLC purification.
[0080] After purification (mostly) single-stranded amplicons remain. However, HPLC alone may not be sufficient to remove all free or buried primers. Thus, in some circumstances, index hopping occurs when only HPLC is used as a treatment. In some embodiments, HPLC purification can precede an enzymatic treatment to remove those primers not removed during the HPLC purification. In some embodiments, the enzymatic treatment includes the FAB reagent. Thus, in some embodiments, FAB reagent and/or HPLC fractionation are used to block excess free adapter, remove free index primers from the library, and to reduce index hopping and enhance data quality.
[0081] In certain cases, buried primers may be present that are resistant to size-based separation techniques due to their binding to longer amplicons. Thus, in certain embodiments, HPLC purification is performed under denaturing conditions. Denaturing conditions for use in HPLC purification processes can be generated by adjusting the pH of the sample (e.g., to a pH of at least about 12) and/or by adjusting the temperature of the sample (e.g., to a temperature of at least about 85? C.).
[0082] In some embodiments, the patient sample is treated with FAB reagent prior to sequencing. In some embodiments, the patient sample is treated with FAB reagent prior to sequencing (e.g., running on NovaSeq). In some embodiments, the patient sample is purified via HPLC prior to sequencing (e.g., running on NovaSeq).
[0083] In some embodiments, clean-up treatment improves the results of sequencing on the NovaSeq platform, with improved NextSeq concordance at the lower end of the assay. Experimental evidence showed that clean-up treatment using HPLC and FAB reagent treatment improved the results obtained in sequencing with NovaSeq, and improved NextSeq concordance at the lower end of the assay, compared to the use of FAB reagent alone or no treatment. In some embodiments, an Illumina library is fractionated by HPLC. Terminal Deoxy Transferase (TdT) and Dideoxynucleotide Triphosphates (ddNTPs)
[0084] In certain embodiments, the relative concentration of extendable free and/or buried primers is reduced using terminal deoxy transferase (TdT) to add dideoxynucleotide triphosphates (ddNTPs) to the 3 end of the free and/or buried primers (and incidentally the amplification product itself), thereby preventing further elongation of the primers and preventing index hopping.
[0085] TdT adds ddNTPs to the ends of free primers, preventing their elongation. However, TdT works best at 37? C., which means it is ineffective under most denaturing conditions. Thus in certain embodiments, the TdT reaction is performed in the presence of a reagent that is capable of freeing buried primers (e.g., a protein that is capable of freeing buried primers). Examples of proteins that can be used to free buried primers include, but are not limited to, single-strand binding protein (SSB), recA, and UvrD. In certain embodiments, such reagents free buried primers, facilitating the addition of ddNTPs to their 3 end by TdT.
[0086] Thus, in some embodiments, the relative concentration of extendable free and buried primers can be reduced by incubating the amplification product with TdTs, ddNTPs, and a reagent that can free buried primers under conditions amenable to TdT activity.
Scavenger Nucleic Acid Molecules
[0087] In certain embodiments provided herein, index hopping is prevented by adding scavenger nucleic acid molecules to the sample comprising indexed sequencing template prior to sequencing. As used herein, a scavenger nucleic acid molecule or scavenger nucleic acid refers to a nucleic acid molecule that comprises: (A) a primer targeting region, which has a nucleic acid sequence complementary to a nucleic acid sequence at the 3 region of a primer; and (B) a region having an irrelevant sequence that will not base-pair with the primer or an indexed sequencing template, wherein the region (B) is positioned 5 to the region (A). In some embodiments, a scavenger nucleic acid molecule is single-stranded.
[0088] Thus, prior to or after loading the sample onto the sequencer, the scavenger nucleic acid molecules will hybridize to free primers and a DNA polymerase (e.g., Taq DNA polymerase) will extend the primer using a scavenger nucleic acid molecule template, resulting in extended primers that can no longer extend off normal templates due to the presence of the irrelevant sequence (
[0089] The extension does not cause downstream data analysis problems as the irrelevant sequence signals can be later filtered out of the data set. Moreover, thermal cycling-based amplification can be used to release buried primers and extend them on the scavenger nucleic acid molecule template.
[0090] In some embodiments, a DNA polymerase can be used to extend the primer with ddNTPs, thereby further contributing to the neutralization of free primers. Because Taq DNA polymerase is compatible with thermocycling, this process can be used to inactivate buried primers (thermal cycling allows for buried primers to be re-annealed as primer:template complexes) (
Killer Oligonucleotides
[0091] In certain embodiments provided herein, index hopping is prevented by ligating free and/or buried primers to an oligonucleotide that prevents its further extension (a killer oligonucleotide).
[0092] In certain embodiments, a killer oligonucleotide comprises a region having a sequence capable of hybridizing to the 3 end of a primer, and when the primer is hybridized to the killer oligonucleotide, the primer can be ligated to the killer oligonucleotide. In certain embodiments, killer oligonucleotides are designed to have a structure that comprises a stem/loop region that has a sequence that forms a stem/loop structure positioned 5 of a primer targeting region that has a sequence capable of hybridizing to the 3 end of a primer (non-limiting examples are illustrated in
[0093] In certain embodiments, a ligase is capable of ligating the 3 terminus of the primer to the phosphorylated 5 terminus of the killer oligonucleotide. In certain embodiments, the ligase is a thermostable ligase, such as Taq ligase. Thus, in certain embodiments, the sample comprising the amplification product is heated (e.g., to at least 85? C.) in the presence of killer oligonucleotides to release buried primers. The sample is then cooled to allow the free and previously buried primers to hybridize and ligate to the killer oligonucleotides, thereby neutralizing them. In some embodiments, the structure of the killer oligonucleotide can comprise the structure and/or sequence of any one of the killer oligonucleotides illustrated in
Biotinylated Primers
[0094] In certain embodiments, other techniques can be used to separate indexed sequencing template from free and buried primers. For example, in certain embodiments, biotinylated primers are used to perform an additional amplification reaction on the indexed sequencing template to generate a biotinylated amplification product. For instance, as illustrated in
Sequencing, Determining Results, and Communicating Results
[0095] In certain embodiments, the methods and compositions disclosed are compatible with multiple sequencing platforms. One of ordinary skill in the art will know how to modify a primer, template, or reaction conditions to be compatible with other sequencing methodologies or those methodologies that come online in the future. For example, the sequencing component of the diagnostic assays disclosed can be performed using commercially available platforms such an Illumina or IonTorrent platform. Other platforms are contemplated as well.
[0096] In some embodiments, the NGS Modality is any of the following: SwabSeq, 1 Amplicon, 384 well plate, 96 Nextera barcode set, UDI's, NextSeq; SwabSeq1 Amplicon, 384 well plate, 384 Truseq UDI barcode set, using NextSeq; or SwabSeq1 Amplicon, 384 well plate, 4000 UDI Truseq barcode set, NovaSeq. SwabSeqMultiplex, 384 well plate, CDI barcode set, NovaSeq.
[0097] For example, samples can be run on both NextSeq and NovaSeq. In certain embodiments, evaluation of the quality of the sequence data generated include analyzing the read counts and the fraction of reads that are used from the assay; the latter is a proxy for the load of non-productive artifactual products such as primer-dimers. In some instances, PCR artifacts can be index-specific, and the data analysis can identify those DNA barcodes that consistently perform badly, or at least worse than other DNA barcodes.
[0098] In some embodiments, the methods and compositions disclosed are designed to overcome other issues that can undermine a sequencing-based diagnostic assay. For example, Index hopping is another concern in NGS platforms (e.g., Illumina platforms such as NovaSeq), wherein reads are generated that have incorrect DNA barcodes relative to the true sample origin. The major cause of index hopping is believed to be free primers carried over from PCR during cluster generation. The exclusion amplification (ExAmp) technology used with patterned flowcells on the Illumina NovaSeq (as well as several other models) is particularly prone to index hopping events. ExAmp is a form of Recombinase Polymerase Amplification; instead of thermocycling, a combination of proteins enables primers to invade duplexes and be amplified by a strand-displacing DNA polymerase.
[0099] The ExAmp reagent is highly viscous. In some embodiments, the DNA library pool is denatured prior to mixing with ExAmp reagent, and is then added to the flowcell. The seeding of a nanowell on the patterned flowcell with a single library molecule will initiate an isothermal amplification process that rapidly consumes all of the surface-bound primers within that nanowell. Hence, if arrival of library molecules to the nanowells is an infrequent process, then each well will be taken over by the first library molecule to arrive before a second library molecule can enter.
[0100] If a stray primer binds to the library primer prior to entering a nanowell, that primer can be extended by the ExAmp reagents and generate a copy which replaces one original index sequence on the molecule with the stray primer's index sequence. This process can potentially be repeated due by the ExAmp reagents being capable of allowing primers to invade duplexes and be extended. If fragments from such grafting seed a well, then clusters (and hence reads) will result with index swaps.
[0101] Reductions in index hopping enhance limit-of-detection and robustness. In some embodiments, index hopping reduction can be accomplished by purifying the library mixture prior to loading on the sequencer. A proprietary Illumina enzymatic reagent, Free Adapter Blocking Reagent (FAB) and/or high-performance liquid chromatography (HPLC) can be used to purify samples or libraries of samples.
[0102] In some embodiments of the present disclosure, a unique dual indexing (UDI) strategy is employed, wherein the primers are used in pairs and the primers comprise unique, non-redundant indices (e.g., barcodes). This strategy reduces but does not eliminate the possibility of index hopping, a variety of index misassignment that results in incorrect assignment of libraries from the expected index to a different index in the pool. The mechanism of index hopping is believed to be largely driven by indexing primers or unified primers. This issue is a major cause of increases in index misassignment observed in sequencing using patterned flow cells. Index hopping at a minimum wastes data, as with a UDI scheme a single hopping event will create an illegal DNA barcode combination that does not correspond to any sample, wherein illegal barcode combinations are disregarded. Most dual hopping events should also create illegal combinations, though the possibility of a dual hop creating a legal code (both hops for the same sample in the UDI scheme) is not impossible. In some embodiments, a dual hop creating a legal code which corresponds to any particular patient's sample can produce a false positive, and this incorrect result can then be unfortunately communicated to the patient. In some embodiments, while using a unique dual indexing strategy (as opposed to, for example, using only a single indexing strategy) can reduce index, even a small amount of index hopping can result in false positives and/or false negatives. Various processes and compositions are described herein for further reduction of index hopping, even when unique dual indexing is used.
[0103] In some embodiments, the amplicons generated during a method provided are sufficiently long such that there is a substantial size difference between the true amplicons and the most likely types of PCR artifacts. In some embodiments, the size difference allows for better separation by both solid phase reversible immobilization (SPRI) and HPLC, enabling a higher fraction of assay reads by depleting PCR artifacts. In some embodiments, an aggressive SPRI purification is used, which reduces the load of free primers and hence index hopping.
[0104] In certain embodiments, processing of the sequencing data comprises demultiplexing the sequencing reads, processing the reads to remove systematic errors, low quality regions, and adapter sequences, and generating alignments and read counts. The NGS pipeline then runs to consolidate sample identifiers, properties, and analysis read counts into an output file (
Reagents and Equipment
[0105] As is understood by one of ordinary skill in the art, various different reagents and pieces of equipment can be readily obtained from various vendors and can be readily substituted in any method provided herein.
[0106] Non-limiting examples of various reagents and equipment suitable for use in a method of the present disclosure include but are not limited to: [0107] Binding Solution (catalog number: A42359) [0108] Wash Buffer (catalog number: A42360) [0109] Elution Solution (catalog number: A42364) [0110] Proteinase K Solution (catalog number: A42363) [0111] Binding Beads (catalog number: A42362) [0112] P20 LTS Tips, Rainin: part number: 17014399 [0113] P200 LTS Tips, Rainin, part number: 17014402 [0114] P1000 LTS Tips, Rainin, part number: 17007081 [0115] P1000 Pipettor [0116] P10 multi-channel pipettor [0117] 250 mL Centrifuge Tube, Corning, part number 430776 [0118] 10 mL Reservoir, Integra, part number [0119] 25 mL Reservoir, Integra, part number: 4352 [0120] 100 mL Reagent Reservoir, VWR: part number 1346-1010 [0121] 80% Ethanol, americanBio, part number: AB04091-01000 [0122] 2 mL Deep Well 96-Well Microplate, Costar, part number: [0123] Deep Well 96-Well Microplate, Eppenorf, part number: 951033006 [0124] Deep Well 24-Well Plate, Axygen, part number: 14222350 [0125] UltraPure DNase/RNase-Free Distilled Water: Invitrogen, part number: 10977015 [0126] Platemax Clear Plate Seals, Axygen: part number: PCR-TS-900 [0127] 96 Deepwell HTS Reservoir, Thomas Scientific: 1171H96 [0128] j FP, Eppendorf: model 5385 [0129] Magnet Plate, Alpaqua: part number A001322 [0130] P-200 Liquidator, Rainin: part number LIQ-96-200 [0131] Proteinase K, 20 g/L stock solution (Thermo, PN: 25530049) [0132] 1,4-dithiothreitol (DTT) powder (Sigma Aldrich, PN: 43819) [0133] Water for Proteinase K/DTT solution (Invitrogen 10977015) [0134] Binding Solution (ThermoFisher Scientific A42359) [0135] Binding Beads (ThermoFisher Scientific A42362) [0136] Proteinase K Solution (ThermoFisher Scientific A42363) [0137] Wash Buffer (ThermoFisher Scientific A42360) [0138] 80% ethanol (americanBio AB04091-01000) [0139] Elution Solution (ThermoFisher Scientific A42364) [0140] Nuclease-free water for RNA elution (Invitrogen 10977015) [0141] Hamilton Starplus for Sample consolidation
[0142] Non-limiting examples of various instruments which can be or have been used in a method of the disclosure include: [0143] The Concentric by Ginkgo SARS-CoV-2 NGS assay can be used with an RNA extraction procedure using the MagMAX? Viral/Pathogen Nucleic Acid Isolation Kit (Applied Biosystems/ThermoFisher Scientific). [0144] RT-PCR can be performed using a Labcyte Echo 525 liquid handler for reagent transfer and an Eppendorf Mastercycler x50t for thermocycling. [0145] Library pools can be purified using AMPure XP reagent (Beckman Coulter), quantified by a KAPA Library Quantification Kit using a Roche LightCycler? 480 II and Quant-iT? dsDNA Assay Kit, broad range (Invitrogen) using a BioTek Neo 2 Synergy Plate Reader, and visualized using an Agilent 2100 Bioanalyzer. [0146] The purified library pools can be sequenced using an Illumina NextSeq 500 (software version 2.2.0).
[0147] Non-limiting examples of software which can be or have been used in a method of the disclosure include: [0148] Base calls are converted to sequence reads and demultiplexed using bcl-convert (version v00.000.000.3.5.3-80-gdb27fdd9).
[0149] The sequence reads can be trimmed using Trimmomatic v0.36. Trimming is performed with the following settings and their impact described: [0150] MINLEN: 16any read less than 16 bases is discarded. [0151] HEADCROP: 3the first 3 bases of each read are removed. This removes any diversity spacers from the read. [0152] ILLUMINACLIP: adapters.fa: 2:30:10Illumina sequencing adapters to be removed. 2 indicates that a mismatch of 2 bases will be allowed between an adapter and a sequence for a match; 30 only applies to paired end reads and has no impact here; and 10 is the minimum threshold for alignment between the read and an adapter sequence. [0153] LEADING: 30any bases with a quality score below 30 at the beginning of the read will be trimmed. [0154] TRAILING: 30any bases with a quality score below 30 at the end of the read will be trimmed. [0155] SLIDINGWINDOW: 4:20from left to right, taking the average quality score of 4 bases, if that score drops below 20, the bases following that position are removed.
[0156] Following trimming, reads can be aligned to target reference sequences using Bowtie2 (version 2.4.1) with the parameters: [0157] D 20The number of attempts to perform an extension of a matching seed sequence before failing. This controls how thoroughly bowtie2 attempts to find an optimal alignment [0158] L 7the length of the seed for alignment to the reference sequences [0159] i S,1,0.50this guides how the seed sequences are generated from a read
[0160] Alignments can then be filtered using samtools (version 1.9) to remove any alignments with a mapping quality below 20, and alignments that do not fully span a required region (including 5 of the 6 bases of the spike in sequences and the previous 7 bases) are excluded using bedtools (v 0.25.0). Three reference sequences can be used for alignment: 1) SARS-CoV-2 S gene, 2) S spike-in internal control, and 3) human RPP30 gene sequences. The S gene reference sequence is derived from the NC_045512.2 genome. Alignment to the SARS-CoV-2 S reference sequence with these parameters ensures that the aligned sequence reads correspond specifically to the SARS-CoV-2 genome. Transcript counts can be generated by running the samtools (version 1.9) idxstats command to generate the read counts per transcript.
EXAMPLES
Example 1: Index Hopping Treatment Efficacy
[0161] Multiple approaches are provided herein for reducing the prevalence of index hopping, which can result in improperly indexed sequencing reads and produce false results and therefore contaminate data and reduce the power of the assay. Five different approaches to reduce index hopping were evaluated. Referring to
[0162] Such a scavenger nucleic acid molecule-based method is fast, easy, and compatible with other methods, allowing multiple treatment approaches to be combined with improved results. For example, NovaSeq reactions subjected to a HPLC purification process described herein in combination with FAB treatment and scavenger nucleic acid molecule treatment exhibited a more pronounced left shift and less area under the curve compared to scavenger nucleic acid molecule treatment alone (middle right panel) The bottom left panel illustrates the results of treatment with TdT and ddNTPs in the presence of SSB in combination with a scavenger nucleic acid molecule. Finally, the bottom right panel illustrates the results of treatment with a killer oligonucleotide and Taq ligase in combination with a scavenger nucleic acid molecule.
Example 2: HPLC+FAB
[0163] High Performance Liquid Chromatography (HPLC) purification of was performed using Ion-Pairing Reverse Phase (IP-RP) chromatography. This technique separates DNA oligonucleotides based on size, allowing isolation of longer PCR products from contaminating primers of shorter length. HPLC purification was followed with Illumina's FAB reagent treatment. Referring to
Example 3: Taq+ddNTP
[0164] Index hopping was compared between untreated samples (DX-071) and samples treated with Taq DNA polymerase and ddNTPs (DX-105). Referring to
Example 4: Reducing Primer Concentration
[0165] Reducing primer concentration was examined as a potential means of reducing free primers carried over from amplification that may result in index hopping. HPLC under denaturing conditions was used to separate amplicon single-strand DNA (ssDNA) from primer ssDNA. The denaturing conditions included pH=12 (long method) Ion-Exchange chromatography (
[0166] A method employing HPLC under denaturing conditions (pH=12) using ion exchange chromatography columns with a shortened run time. This method essentially condensed the numerous peaks observed in
[0167] HPLC using denaturing conditions (85? C.) and ion-pairing reverse phase chromatography was also assessed for the ability to separate amplicon ssDNA from primer ssDNA. These HPLC conditions give more of a true size-based separation of nucleic acids. An ion-pairing reagent (triethylammonium acetate in this case) neutralizes the charge of the nucleic acid fragments, which allows the fragments to engage in hydrophobic interactions with the column for a more traditional reverse phase HPLC approach. As shown in
Example 5: Primer Concentrations
[0168] To determine if primer concentration affect index hopping, varying concentrations of primers were used in.
Example 6: Various Protocols
[0169] One of ordinary skill will understand the method of the disclosure can be performed using various steps, protocols, reagents, equipment, etc., described and/or known in the art. This example describes various non-limiting examples of various protocols that can be used in a method of the disclosure.
Example 6A. A Method for Detecting a SARS-CoV-2 Nucleic Acid Molecule in a Sample
[0170] The following non-limiting examples of protocols were and can be used in a method of detecting a SARS-CoV-2 nucleic acid molecule in a sample.
[0171] A method was performed with the following parameters, including controls: 90 ?L of 1) pooled treated saliva, 2) pooled untreated saliva, or 3) water was mixed with 10 ?L of diluted heat-inactivated SARS-CoV-2 (ATCC? VR-1986HK?). RNA extraction was conducted following 1) an automated procedure utilizing SPEEDBEADS? magnetic carboxylate modified particles, sold by MilliporeSigma, St. Louis, MO; or 2) MagMax RNA extraction kit. N1 primer/probe mix and TaqPath? 1-Step RT-qPCR Master Mix, CG (A15299) were used to set up reaction in 20 ?L final volume. 5?L of RNA extracted samples were stamped to Roche 384-well white plate. Synthetic SARS-CoV-2 RNA Control 1 from Twist (LOCATION) and ATCC Heat-inactivated SARS-CoV-2 were used for calibration curve. RT-qPCR reaction was conducted using LightCycler480 (DEFINE, COMPANY, LOCATION) following protocol (RT55? C./10 minutes; denature95? C./1 minute; denature95? C./10 seconds and extension60? C. 30 seconds with plate read40 cycles). Samples were then analyzed with NGS (next generation sequencing), using either NextSeq or NovaSeq.
[0172] Untreated saliva samples extracted through automation led to very low sensitivity (dropouts could suggest pipettability issues). Manual RNA extraction using MagMax kit showed consistent results without dropouts across RNA matrices conditions up to 800 copies/mL. All controls are valid. Extractions using MagMax kit resulted in a greater number of positive samples at lower viral-RNA concentrations compared to Ginkgo automated extraction method.
[0173] The following results were obtained from extraction method tests: [0174] General LoD (>95% of samples classified as positive) [0175] MagMax manual extraction>1,600 copies/mL [0176] Automated extraction>>25,600 copies/mL [0177] ATCC virus outperforms spike-in calibration line (as expected from non-synthetic RNA) [0178] Experiment specific observations for one experiment (Automated extraction method): [0179] Pooled saliva samples (untreated) had lower log-s-ratio especially in higher end of viral RNA concentrations. [0180] A given sample performed comparably in both NextSeq and NovaSeq platforms when the samples were close to or over the positive classification threshold. [0181] Experiment specific observations for one experiment (MagMax extraction method): A given sample performed comparably in both NextSeq and NovaSeq platforms when the samples were close to or over the positive classification threshold.
Example 6B. Preparation of Sample, Including RNA Extraction
[0182] Provided below is a non-limiting example of a protocol for preparation of a sample, including RNA extraction. [0183] 1. Prepare sampleAliquot 100 ?L of Saliva in MTM treated with DTT and proteinase K into each well of a Costar 3798 round bottom plate (e.g., done by hand prior to loading onto Hamilton). [0184] 2. Mix the bottle of 1?GE beads to fully resuspend the beads. To prepare 1?GE beads mix 12.5 mL beads (Sera-Mag Speedbeads by GE65152105050350) in 500 mL of buffer (Pura Buffer by americanBioCU06300-00500).
[0185] Start of automated protocol on Hamilton: [0186] 3. Add 100 ?L of beads to the samples in a Costar 3798 round bottom plate and pipette mix 15 times with a mix volume of 150 ?L. Incubate samples at room temperature (15-30? C.) for 10 minutes. [0187] 4. Place the processing plate on the Magnet Plate (Alpaqua A001322) and incubate at room temperature for 5 minutes to allow beads to separate. [0188] 5. Fully remove supernatant from the processing plate and discard. This step must be performed while the processing plate is situated on the magnet. [0189] 6. Leave the processing plate on the magnet and wash by adding 150 ?L of 70% ethanol to the sample. Allow samples to sit with ethanol for 1 minute. [0190] 7. Completely remove supernatant from the processing plate and discard. This step must be performed while the plate is situated on the magnet. Do not disturb the ring of separated magnetic beads. [0191] 8. Repeat steps 6-7 for a total of 2 washes. [0192] 9. After final wash, replace any remaining 300 uL tips with 50 uL tips and remove any remaining liquid using 50 ?L FTR tips. [0193] a. A dialog box will appear before the first 50 uL transfer reminding the user to place the correct tips in the FTR carrier. [0194] 10. Allow magnetic beads to dry for 5 minutes at room temperature (15-30? C.). Beads do not need to be completely dry, but the traces of liquid should be gone (i.e., droplets or puddles). [0195] 11. Remove the processing plate from the magnet. Elute nucleic acid by adding 50 ?L of nuclease-free water and pipette mixing 10 times. [0196] 12. Return the plate to the magnet for 2 minutes and carefully transfer 45 ?L of eluted nucleic acid away from the beads and into a fresh 96-well PCR plate for storage.
[0197] In the protocol of Example 6A, or in another method for preparation of the sample, including RNA extraction, the following parameters are used: [0198] Equipment: Hamilton STAR Plus [0199] Capacity: 4 96-well plates per run [0200] Time to completion: ?1 hr for 4 plates [0201] Reagents: Sera-Mag Speedbeads (GE, 65152105050350), Pura Buffer (AmericanBio, CU06300-00500), 80% ethanol (AmericanBio), Nuclease free water [0202] Consumables: [0203] Plates: [0204] Costar 3798 round bottom plates, Eppendorf 96-well PCR plates, Alpaqua ring magnet plates (A001322) [0205] Tips: [0206] 300 uL FTRs with filter, 50 uL FTRs with filter [0207] Troughs: [0208] Automation Reservoirs (Thermo, 1064 May 6)
Example 6C. An Alternative Method for Preparation of the Sample, Including RNA Extraction
[0209] Provided below is a non-limiting example of a protocol for preparation of a sample, including RNA extraction, wherein the protocol involves the use of the MagMAX? Viral/Pathogen Nucleic Acid Isolation Kit.
[0210] This protocol is derived from MagMAX extraction protocol (Pub. No. MAN0018072 Rev. B.0), as sets.thermofisher.com/TFS-Assets/LS G/manuals/MAN0018072_MagMAXViralPathoNuclAcidIsolatKit_Manually_UG. pdf
[0211] In some embodiments of this protocol, steps 1.a and 1.b are omitted or replaced by different steps.
[0212] Perform Total Nucleic Acid Purification Using 200-400 ?L: [0213] 1. Digest with Proteinase K: [0214] a. Add 10 ?L of Proteinase K to each well of a Deep-well 96-well plate. This plate is the Sample Plate. [0215] b. Add 200-400 ?L of each sample to wells with Proteinase K in the Sample Plate. Use of up to 200 ?L input for whole blood is recommended. [0216] c. Invert Binding Bead Mix gently to mix, then add 550 ?L to each sample in the Sample Plate. Remix the Binding Bead Mix by inversion frequently during pipetting to insure even distribution of beads to all samples or wells. The mixture containing the Binding Beads is viscous. Therefore, pipet slowly to ensure that the correct amount is added. Use of a repeat pipet to add to the samples as the high viscosity will cause variations in volume added and is not recommended. [0217] d. Seal the plate with MicroAmp? Clear Adhesive Film, then shake the sealed plate at 1,050 rpm for 2 minutes. [0218] e. Incubate the sealed plate at 65? C. for 5 minutes (ensure the bottom of the plate is uncovered), then shake the plate at 1,050 rpm for 5 minutes. [0219] f. Place the sealed plate on the magnetic stand for 10 minutes, or until all of the beads have collected. [0220] 2. Wash the beads: [0221] a. Keeping the plate on the magnet, carefully remove the cover, then discard the supernatant from each well. Avoid disturbing the beads. [0222] b. Remove the plate from the magnetic stand, then add 1 mL of Wash buffer to each sample. [0223] c. Reseal the plate, then shake at 1,050 rpm for 1 minute. [0224] d. Place the plate back on the magnetic stand for 2 minutes, or until all the beads have collected. [0225] e. Keeping the plate on the magnet, carefully remove the cover, then discard the supernatant from each well. Avoid disturbing the beads. [0226] f. Repeat step 2b to step 2e using 1 mL of 80% Ethanol. [0227] g. Repeat step 2b to step 2e using 500 ?L of 80% Ethanol. [0228] h. Dry the beads by shaking the plate (uncovered) at 1,050 rpm for 2 minutes. [0229] 3. Elute the nucleic acids: [0230] a. Add 50-100 ?L of Elution Solution to each sample, then seal the plate with MicroAmp? Clear Adhesive Film. [0231] b. Shake the sealed plate at 1,050 rpm for 5 minutes. [0232] c. Place the plate in an incubator at 65? C. for 10 minutes. [0233] d. Remove the plate from the incubator, then shake the plate at 1,050 rpm for 5 minutes. [0234] e. Place the sealed plate on the magnetic stand for 3 minutes or until clear to collect the beads against the magnets.
[0235] f. Keeping the plate on the magnet, carefully remove the seal, then transfer the eluates to a fresh standard (not deep-well) plate. To prevent evaporation, seal the plate containing the eluate immediately after the transfers are complete. The purified nucleic acid is ready for immediate use. Alternatively, store the plate at ?20? C. for long-term storage.
Example 6D. Sequencing
[0236] While different sequencing platforms exist, this example provides a general protocol that one skilled in the art can use to obtain quality results. First, the samples are subjected to a PCR amplification reaction. Subject samples and control samples are plated on a 384-well plate. The plate is spun at 4000 RPM for 3 min to collect each sample at the bottom of their respective wells. To these wells the following are added: 75 nL 80 ?M S2 i7 primer (for a final concentration of 400 nM in the PCR reaction); 75 nL 80 ?M S2 i5 primer (for a final concentration of 400 nM in the PCR reaction); 25 nL 30 ?M RPP30 i5 primer (for a final concentration of 50 nM in the PCR reaction); and 25 nL 30 ?M RPP30 i7 primer (for a final concentration of 50 nM in the PCR reaction). The PCR plate is centrifuged at 4,680 RPM for 1 minute.
[0237] In a 5 mL tube, a master mix is prepared by adding S2 spike-in RNA at a concentration of 1?104 copies/?L, and TaqPath 1-Step RT-qPCR Master Mix, CG. Using the plate map as a guide, add Master Mix solution to each well containing a patient sample or control. The total reaction volume per well should be 15 ?L. Note: Wells G23, 123, K23, M23, and O23 are not used and do not require Master Mix or sample. The plate is centrifuged at 4680 RPM for 1 min before removing the plate seal. 10 ?L of master mix is added to each well containing primer. Using the plate map as a guide, the following templates are added: 4.8 ?L of the patient samples (wells A1-H11) from the sample plate to their corresponding RT-PCR wells, which should already contain Master Mix and Primer; 4.8 ?L of Positive control: high concentration (2000 copies Twist Control 1 /?L) to well A23; 4.8 ?L of Positive control: low concentration (20 copies Twist Control 1/?L) to well C23; 4.8 ?L of nuclease-free water to well E23. The plate is then sealed and centrifuged.
[0238] To create pooled samples, 5 ?L of each sample is transferred from a 384-well plate (post RT-PCR) to a reservoir for pooling. The pooled libraries are well mixed before removing an aliquot for purification. 200 ?L of the library pool is transferred to a 1.5 mL tube and label the tube. The remaining unused library pool is transferred to a 2 mL tube, label, and store at 4? C. The AMpure XP vial is vortexed thoroughly, then 160 ?L of well-resuspended room temperature AMpure XP beads is added to the tube, incubated, and mixed at room temperature using the Hula for 10 minutes.
[0239] After mixing, the tube is briefly centrifuged for 3 seconds to collect the liquid to the bottom of the tube. The tube is placed on a magnetic stand for 5 mins to separate the beads from the solution. DNA larger than the desired size will bind to the beads. 340 ?L of the supernatant is carefully transferred into a new 1.5 mL tube. The supernatant contains DNA that will be further processed for sequencing. 40 ?L of AmpureXP beads is added to the new tube. DNA smaller than the desired size will remain in solution. This is incubated and mixed at room temperature using the Hula for 10 minutes.
[0240] After mixing, the tube is briefly centrifuged for 3 seconds to collect the liquid to the bottom of the tube. The tube is placed on the magnetic stand for 5 mins. DNA with the desired size is bound to the beads. The supernatant is removed and discarded. 200 ?L of 80% EtOH is added and incubated at room temperature for 30 seconds (1st wash). The supernatant is removed and discarded. 200 ?L of 80% EtOH is added and incubated at room temperature for 30 seconds (2nd wash). The supernatant is removed and discarded.
[0241] Any residual EtOH is carefully removed with a p20 pipette. Residual EtOH can inhibit downstream application. The beads are air-dried for 30 sec. Over-drying the beads will reduce DNA recovery. The tube is removed from the magnetic stand and 42 ?L of Nuclease-free water is added and pipetted to resuspend. The beads are incubated at room temperature for 3 minutes (off the magnetic stand) and then placed on the magnetic stand for 3 minutes to separate the beads from the solution. 40 ?L of the purified library is carefully transfer into a new 1.5 mL tube. The pooled library may be kept for up to 3 months at 20? C.
[0242] After pooling is completed, samples are amplified by RT-PCR using an Eppendorf Mastercycler x50t using the following steps: UDG decontamination: 25? C. for 2 minutes; Reverse transcription: 53? C. for 15 minutes; PCR enzyme activation: 95? C. for 2 minutes; 40 cycles of PCR: 95? C. for 15 seconds; 64? C. for 60 seconds; Hold at 10? C. indefinitely.
[0243] The RT-PCR plate may be kept in the thermocycler for up to 24 hours at 10? C.
[0244] After RT-PCR is completed, PicoGreen quantification is performed. A BR working stock is prepared by making a 1:200 dilution of Quant-iT dsDNA BR reagent in Quant-iT dsDNA BR buffer. 15 ?L QuantiT dsDNA BR reagent+2985 ?L Quant-iT dsDNA BR buffer i is prepared. A 1:10 dilution of the library pool in DNase/RNAse-Free Distilled Water for quantification is prepared. Both the undiluted and the 1:10 dilution will be used for quantification.
[0245] For each standard and to both the diluted and undiluted library, 98 ?L of BR working stock is added per library and standards (24 wells for 8 standards each run in triplicate). Both the neat pool and the 1:10 dilution of the pool are quantified, and the value that falls within the range of standards (0-100 ng/?L) is used for downstream molarity calculation.
[0246] To each well containing BR working stock, 2 ?L library or standard is added and the plate is sealed, shaken, and spun briefly. The seal is removed and read on plate reader using PicoGreen assay protocol. The raw fluorescence data is used to convert into dsDNA concentration (ng/?L).
[0247] For each standard, the 3 replicates included on the plate are averaged, and the slope and y-intercept calculated using the raw fluorescence data and known concentration value for the standards, and use this linear equation to calculate the concentration of the pool. The concentration of the library pool is recorded in ng/?L. The R{circumflex over ()}2 value is recorded, and must be greater than 0.98 to pass. If the R{circumflex over ()}2 value does not pass, the procedure is repeated.
Example 6E. Bioanalyzer Visualization Instructions
[0248] Obtain a Bioanalyzer 7500 kit and incubate at room temperature for 30 minutes at RT. If the Bioanalyzer is unavailable, contact the TS for instructions on using the TapeStation D1000 as an alternative.
[0249] Place the 7500 DNA chip onto the chip holding/pressurizing platform.
[0250] Reagents must equilibrate to room temperature for 30 minutes before preparation. To prepare the gel dye mix, vortex the DNA dye concentrate for 10 seconds and spin down. Pipette 25 ?L of the DNA dye concentrate into a tube of DNA gel matrix. Cap the gel matrix tube, vortex for 10 seconds, and transfer the full volume into the top compartment of a spin filter. Centrifuge for 10 minutes at 4,000 RPM. Discard the filter.
[0251] Add 9 ?L of Gel-Dye mix to the priming well. Use a back filling pipetting method to ensure there are no bubbles. Remove any bubbles that are present.
[0252] Lock the syringe into place and ensure the silver mechanism at the top is in the top slot.
[0253] Press down until the clip holds the syringe in place.
[0254] Allow the chip to prime for 30 seconds and then release the syringe.
[0255] Wait 5 seconds for the syringe to depressurize.
[0256] Gently pull back until 1 mL.
[0257] Add 9 ?L of gel-dye mix to the other gel wells (marked with G) using the back filling pipetting method.
[0258] Add 5 ?L of marker to the ladder well and all sample wells.
[0259] Add 1 ?L of Ladder to the ladder well.
[0260] Add 1 ?L of the diluted library to sample well 1.
[0261] Add 1 ?L of the neat library to sample well 2.
[0262] Vortex the samples using the chip vortexer to shake for 1 minute at 2400 rpm.
[0263] Make sure there are no bubbles in the wells. If bubbles are present, shake again or remove with a pipette tip.
[0264] While the vortexer is running, add water to the wash chip and place in the Bioanalyzer for ?30 seconds.
[0265] Remove the wash chip and allow probes to dry for ?5-10 seconds.
[0266] Add the DNA chip with samples to the Bioanalyzer.
[0267] Select the DNA 7500 assay.
[0268] After program finishes running, perform a smear analysis on samples:
[0269] On the right hand side, select Global and advanced from the drop down.
[0270] Scroll to Smear Analysis and double-click.
[0271] Click Add region.
[0272] Define a region with a start at 100 bp and an end at 1100 bp.
[0273] Click OK.
[0274] Record the average insert size for this region.
Example 6F. qPCR Quantification
[0275] Use the worksheet to perform calculations, record completed steps, record reagent lot numbers, and instrument identifiers, as above.
[0276] If opening a new kit, make sure to add the full volume from the primer tube into the larger master mix vial before use. Aliquot standards into a set of strip tubes or a 96-well plate in numerical order with standard 1 in row A and standard 6 in row F.
[0277] Make qPCR master mix [960 ?L of KAPA Sybr Fast qPCR Master Mix (2?) and 320 ?L of H2O] and then transfer 16 ?L of qPCR master mix into following wells:
[0278] A1-A6 b. C1-C6 c. E1-E6 d. G1-G3 e. I1-I3 f. K1-K3
[0279] In a 96-well plate or a 0.2 mL tube strip, add 98 ?L of H.sub.2O to well A1 (for each batch, you will want to set up a row with 98 ?L in the first position (b1, c1, etc.) and then the remaining wells as described below).
[0280] Add 90 ?L of H.sub.2O to wells A2 through A7.
[0281] In a 96-well plate or a 0.2 mL tube strip, add 2 ?L of library pool to well A1. Pipet to mix with 50% of the volume. This makes a 1:50 dilution of the sample.
[0282] Transfer 10 ?L from well A1 to well A2. Pipet to mix 10 times with 50% of the volume. This makes a 1:500 dilution of the sample.
[0283] Transfer 10 ?L from well A2 to well A3. Pipet to mix 10 times with 50% of the volume. This makes a 1:5,000 dilution.
[0284] Transfer 10 ?L from well A3 to well A4. Pipet to mix 10 times with 50% of the volume. This makes a 1:50,000 dilution.
[0285] Transfer 10 ?L from well A4 to well A5. Pipet to mix 10 times with 50% of the volume. This makes a 1:500,000 dilution.
[0286] Transfer 10 ?L from well A5 to well A6. Pipet to mix 10 times with 50% of the volume. This makes a 1:5,000,000 dilution.
[0287] Transfer 10 ?L from well A6 to well A7. Pipet to mix 10 times with 50% of the volume. This makes a 1:50,000,000 dilution.
[0288] Pipet 4 ?L of Standard in triplicate into wells of qPCR plate. Pipet to mix
[0289] Standard 1: A1-A3 b. Standard 2: C1-C3 c. Standard 3: E1-E3 d. Standard 4: G1-G3 e. Standard 5: I1-I3 f. Standard 6: K1-K3
[0290] Pipet 4 ?L of diluted sample in triplicate into wells of qPCR plate. Pipet to mix
[0291] 1:500,000 dilution into wells A4-A6 b. 1:5,000,000 dilution into wells C4-C6 c. 1:50,000,000 dilution into wells E4-E6.
[0292] Seal qPCR plate with permanent optical seal. Make sure there are no bubbles in the wells.
[0293] Spin down at 4,680 RPM for 1 minute to remove bubbles.
[0294] Load qPCR plate into Roche Lightcycler 480.
[0295] In the Lightcycler software, click Create New Experiment from Template
[0296] Select the template called NGS_workflow_qPCR and name the qPCR run with the appropriate workflow ID from organick.
[0297] The LightCycler will run for about 35 minutes.
[0298] After the program completes, select Analysis, Abs quant/fit points, then highlight the table produced, click Calculate. This will calculate the Cp values for all of the wells. Right click on the table, export the data and save as w #.txt.
[0299] Paste the values from the qPCR data into the R1 cell the upper right hand corner of a PandA batching template Excel file configured to parse the data.
[0300] Correct the standards, intercept, slope and check efficiency coefficient based on the standard curve generated.
[0301] Record the R{circumflex over ()}2 value.
[0302] The R{circumflex over ()}2 must be greater than 0.98 to pass. If the R{circumflex over ()}2 value does not pass, repeat the procedure.
[0303] Safe Stop. The quantified library may be kept for up to three months at 20? C. Libraries that have been stored for more than one (1) week, quantification should be repeated prior to sequencing; use the new values for loading the sequencer.
[0304] After quantification is completed, begin the sequencing portion of the workflow by obtaining the reagents defined in the 4. Sequencing Sheet of WKS-GBCL-0001.
Example 6G. Sequencing Procedure
[0305] Obtain a NextSeq High Output Reagent Kit from ?20? C. and thaw in the prepared water bath.
[0306] Obtain a NextSeq High Output Flow Cell from 4? C. and incubate at room temperature for 30 minutes.
[0307] Thaw the HT1 buffer from the kit in the prepared water bath.
[0308] Obtain a NextSeq Buffer Cartridge.
[0309] Obtain a 2 N NaOH solution.
[0310] Prepare a 0.2 N NaOH solution by adding 90 ?L of H.sub.2O and 10 ?L of 2 N NaOH to a 1.5 mL Microcentrifuge tube.
[0311] Normalize the library to 4 nM with water according to the calculations on the Loading Calculations tab.
[0312] In a 1.5 mL tube, add 5 ?L of 4 nM library and 5 ?L of 0.2 N NaOH. Vortex, spin down and allow to incubate at room temperature for 5 minutes.
[0313] Add 990 ?L of HT1 buffer. Vortex and spin down. This makes a 20 pM library.
[0314] Transfer 117 ?L of the 20 pM library to a new 1.5 mL tube.
[0315] Add 1183 ?L of HT1 to the new tube with the 117 ?L of 20 pM library. Vortex and spin down. This will make a 1.8 pM library.
[0316] Prepare 1.8 pM PhiX. In a 1.5 mL tube, add 2 ?L 10 nM PhiX+3 ?L 10 mM Tris-HCl+0.1% Tween 20.
[0317] Add 5 ?L 0.2N NaOH. Vortex, spin down, and allow to incubate at room temperature for 5 minutes.
[0318] Add 990 ?L of HT1 buffer. Vortex and spin down. This makes 20 a pM PhiX.
[0319] Transfer 117 ?L of the 20 pM PhiX to a new 1.5 mL tube.
[0320] Add 1183 ?L of HT1 to the new tube with the 117 ?L of 20 pM PhiX. Vortex and spin down. This will make it a 1.8 pM PhiX.
[0321] Prepare a 1.8 pM library with 10% 1.8 pM PhiX: 130 ?L 1.8 pM PhiX+1170 ?L 1.8 pM library.
[0322] Load the entire 1.3 mL of 1.8 pM library+10% PhiX into the NextSeq cartridge.
[0323] At the NextSeq, select Sequence, and load the flow cell once the stage opens.
[0324] Select next then load the buffer cartridge into the Nextseq. Empty the waste bin.
[0325] Select next then load the reagent cartridge into the NextSeq.
[0326] Select load.
[0327] Fill out the Workflow information.
[0328] Skip Library ID
[0329] The Flow Cell should say NextSeq High Output
[0330] Select Single End
[0331] Input the following read cycle lengths: Read1: 36 Read2: 0
[0332] Input the following index cycle lengths: Index1: 8, Index2: 8
[0333] Select Next to begin the pre-run system checks.
[0334] Select Start once the pre-run system checks have completed. If the sequencer does not pass the pre-sequencing checks, contact the TS.
Example 6H. Loading the NovaSeq
[0335] Set a sous vide to warm a water bath to 70? F.
[0336] Obtain a NovaSeq 100 Cycle Reagent Kit from ?20? C. and leave it to thaw in the prepared water bath.
[0337] Obtain a NovaSeq Cluster Kit from ?20? C. and leave it to thaw in the prepared water bath. By default, the sous vide will start a 4 hour times, but the kit will usually thaw completely in about 2 hours.
[0338] Obtain a NovaSeq SP Flow Cell from 4? C. and incubate for 30 minutes at room temperature.
[0339] Obtain a NovaSeq SP/S1/S2 Buffer Cartridge.
[0340] Obtain 1 M Tris-HCl, pH 8.5.
[0341] Obtain a stock of DNase/RNase-Free Distilled Water.
[0342] Dilute 1 M Tris-HCl, pH 8.5 to 400 mM: 2 mL Tris-HCl+3 mL DNase/RNase-Free Distilled Water
[0343] Normalize the library to 2.5 nM with water according to the calculations on Loading Calculations tab.
[0344] Obtain 10 nM PhiX.
[0345] Obtain a stock of 2 N NaOH.
[0346] Prepare a 0.2 N NaOH solution by adding 90 ?L of water to 10 ?L of 2 N NaOH.
[0347] In a new 1.5 mL microcentrifuge tube, dilute the 10 nM PhiX to 2.5 nM PhiX: 2.5 ?L 10 nM PhiX+7.5 ?L water.
[0348] Add 90 ?L 2.5 nM normalized library to the 1.5 mL microcentrifuge tube containing 10 ?L of 2.5 nM PhiX. This results in a 2.5 nM library with 10% PhiX.
[0349] Add 25 ?L of freshly prepared 0.2 N NaOH.
[0350] Vortex, spin down, and incubate for 8 minutes at room temperature.
[0351] Add 25 ?L 400 mM Tris-HCl. Vortex and spin down briefly. Add full 150 ?L volume into a NovaSeq library tube.
[0352] On Instrument pick either side of Sequencer to run (A or B) and click sequence
[0353] Log into BaseSpace to set up the run.
[0354] Enter WF and information regarding Read length, Barcode length, etc.
[0355] Make sure to empty out old reagents from the NovaSeq and load new buffer, sbs cartridge, and cluster kit to commence.
[0356] Empty out filled waste containers and check the button on NovaSeq to confirm.
[0357] Start run and make sure all pre-run checks pass and the run starts on the instrument before you can leave the area.
Example 61. Index Hopping Treatments
High Performance Liquid Chromatography
[0358] Ion exchange HPLC uses solvents composed of 25 mM sodium hydroxide in 20 mM Tris.Math.HCl buffer (roughly pH 12.0) with and without 2 M sodium chloride. Samples are run on an Agilent 1260 Infinity Series HPLC equipped with a Thermo Fisher DNAPac PA200 4?50 mm column kept at 30? C. After samples were injected onto the column, the target oligonucleotides are eluted using a gradient from 0.5 M to 1.1 M sodium chloride over 35 minutes (Long run method) or from 0.8 M to 1 M sodium chloride over 15 minutes (short run method). The eluted material was collected throughout. Detection of eluted material was accomplished using a multiple wavelength detector set to 260 nm and 280 nm.
[0359] Ion-Pairing Reverse Phase HPLC uses solvents composed of 100 mM triethylammonium acetate pH 7.0 buffer with and without 25% acetonitrile and is run utilizing a Thermo Fisher Vanquish Flex UHPLC equipped with a Thermo Fisher DNAPac-RP column kept at 100? C. After samples are injected onto the column, the target oligonucleotides are eluted using a gradient from 0% acetonitrile to 25% acetonitrile over a period of 10-15 minutes, and the eluting material is collected throughout. Detection of material is accomplished using a multiple wavelength detector set to 260 nm and 280 nm.
SPRI
[0360] For the library purification, a Double SPRI AMPure magnetic bead clean-up is performed on the pooled libraries. This is a 0.6? clean-up followed by a 0.2? clean-up that allows for a size selection of a library with an average insert size close to 452 bp. 500 ?l of each pooled library is transferred, by batch, to an Eppendorf DNA Lo-Bind 2 mL Microcentrifuge tube. The beads are brought to room temperature (30 min to equilibrate) and vortexed thoroughly. 300 ?l of room temperature AMPure XP beads are added to the 500 ?l aliquots of pooled libraries. And mixed by pipetting 10 times.
[0361] DNA and beads are incubated for 10 minutes on the Hula Mixer, during which time DNA will bind to the beads. Tubes are placed on a magnet for 5 minutes to allow for the DNA bound to beads to separate from the supernatant. 720 ?l of supernatant is transferred to a new 2 ml Eppendorf DNA Lo-Bind Microcentrifuge tube, and 144 ?l of AMPure beads are added to these new tubes. Pipette up and down 10? to mix (this is the 0.2? bead clean-up), incubated on hula mixer for 10 minutes, and placed on a magnet for 5 minutes. The supernatant is removed with a P1000 pipette and discarded. 1 ml of 80% ethanol is added to wash the beads and incubated for 60 seconds on the magnet. The ethanol is then removed and discarded. An additional 1 ml of 80% ethanol is added to wash the beads. The beads are incubated again for 60 seconds on the magnet, and the ethanol is removed and discarded. The beads are dried for about 2-3 minutes. Beads that are over-dried will exhibit excessive cracking. A P20 pipette is used to remove any excess ethanol that remains while the sample dries.
[0362] The sample is eluted in 105 ?l of H.sub.2O by pipetting up and down 15 times while the tube is off the magnet. The sample is eluted for about 5 minutes off the magnet, and then moved to the magnet. The beads are then separated for 2 minutes. 100 ?l of eluted sample is transferred to a new microcentrifuge tube.
FAB Treatment
[0363] Fab reagent is thawed at RT and then put on ice. When ready to use, the FAB reagent is mixed by inversion and centrifuged at 600?g for 5 seconds. 200 ?l of library sample pool is added to a PCR tube, and 200 ?l of FAB reagent is added to each PCR tube and mixed thoroughly by pipetting up and down. The tubes are centrifuged briefly to make sure all contents are on the bottom of the tube and then incubated on a thermal cycler running the FAB program: 38? C. for 20 m; 60? C. for 20 m; and hold at 4? C.
2.5?SPRI
[0364] 100 ?l of each pooled library is transferred, by batch, to an Eppendorf DNA Lo-Bind 2 mL Microcentrifuge tube. The beads are brought to room temperature (30 min to equilibrate) and vortexed thoroughly. 250 ?l of room temperature AMPure XP beads is added to the 100 ?l aliquots of pooled libraries and mixed 10 times by pipetting. DNA and beads are incubated for 10 minutes on the Hula Mixer to allow binding. The tube is placed on a magnet for 5 minutes, which allows the DNA bound to beads to separate from the supernatant. The supernatant is removed with P1000 pipette and discarded. 500 ?l of 80% ethanol is added to wash the beads and incubated for 60 seconds on the magnet. The ethanol is removed and discarded. An additional 500 ?l of 80% ethanol is added to further wash the beads and incubated for 60 seconds on the magnet. The ethanol is removed and discarded. The beads are dried for about 2-3 minutes. The beads are closely watched to ensure they are not excessively cracking, which is an indication of over-drying. A P20 pipette is used to remove any excess ethanol that remains while the sample dries. The sample is eluted in 50 ?l of H.sub.2O by pipetting up and down 15 times while the tube is off the magnet. The sample is eluted for about 5 minutes off the magnet and then moved back to the magnet to allow the beads to separate for 2 minutes. 50 ?l of eluted sample is then transferred to a new microcentrifuge tube.
QC and Loading with Scavenger
[0365] Scavenger nucleic acid molecules are stored as 100 ?M stocks and mixed in equal parts. 4 ?l mixed scavenger nucleic acid molecules are mixed with the purified library and loaded as normal.
EQUIVALENTS
[0366] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the disclosure described. Such equivalents are intended to be encompassed by the following claims.
INCORPORATION BY REFERENCE
[0367] All publications patent applications mentioned are hereby incorporated by reference in their entirety as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions, will control.