METHOD FOR CULTURING CORD BLOOD-DERIVED NATURAL KILLER CELLS USING TRANSFORMED T-CELLS

20240084256 ยท 2024-03-14

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention pertains to a method for culturing cord blood-derived natural killer cells using transformed T-cells. The method for culturing natural killer cells using transformed T-cells according to the present invention can effectively propagate and produce natural killer cells from a small amount of raw cells. In addition, the method can also improve the cell-killing ability of natural killer cells. Thus, the method for culturing natural killer cells using transformed T-cells according to the present invention can be usefully used to commercialize cell therapeutic agents. Moreover, natural killer cells produced by the culturing method of the present invention can be usefully used as a cell therapeutic agent.

    Claims

    1. A method for culturing natural killer cells comprising a step for co-culturing transformed CD4+ T cells and seed cells.

    2. The method for culturing natural killer cells of claim 1, wherein the transformed CD4+ T cells express one or more of 4-1BBL, mbIL-21, OX40L, and mTNF-.

    3. The method for culturing natural killer cells of claim 2, wherein the 4-1BBL gene product comprises the amino acid sequence of SEQ ID NO: 1.

    4. (canceled)

    5. The method for culturing natural killer cells of claim 2, wherein the mbIL-21 gene product comprises the amino acid sequence of SEQ ID NO: 3.

    6. (canceled)

    7. The method for culturing natural killer cells of claim 2, wherein the OX40L gene product comprises the amino acid sequence of SEQ ID NO: 5.

    8. (canceled)

    9. The method for culturing natural killer cells of claim 2, wherein the mTNF- gene product comprises the amino acid sequence of SEQ ID NO: 8.

    10. (canceled)

    11. (canceled)

    12. The method for culturing natural killer cells of claim 1, wherein the CD4+ T cells express 4-1BBL or mbIL-21.

    13. The method for culturing natural killer cells of claim 1, wherein the CD4+ T cells express 4-1BBL and mbIL-21.

    14. The method for culturing natural killer cells of claim 1, wherein the CD4+ T cells express 4-1BBL, mbIL-21, and mTNF-.

    15. The method for culturing natural killer cells of claim 1, wherein the CD4+ T cells express 4-1BBL, mbIL-21, OX40L, and mTNF-.

    16. (canceled)

    17. The method for culturing natural killer cells of claim 1, wherein the seed cells are mononuclear cells derived from cord blood.

    18. The method for culturing natural killer cells of claim 1, wherein the seed cell is the cell from which CD3(+) cells have been removed.

    19. The method for culturing natural killer cells of claim 1, wherein the cultivation is performed by mixing the transformed CD4+ T cells and seed sells at a ratio of 0.1:1 to 50:1.

    20. The method for culturing natural killer cells of claim 1, wherein the seed cells are mixed once with the support cells and cultured for 5 to 60 days, or mixed with the support cells at least twice and cultured for at least 60 days.

    21. The method for culturing natural killer cells of claim 1, wherein the cultivation is performed in a medium containing an anti-CD3 antibody and interleukin protein.

    22. The method for culturing natural killer cells of claim 21, wherein the anti-CD3 antibody comprises any one selected from the group composed of OKT3, UCHT1, and HIT3a.

    23. The method for culturing natural killer cells of claim 21, wherein the interleukin protein comprises any one selected from the group composed of IL-2, IL-12, IL-15, IL-18, and IL-21.

    24. A natural killer cell produced by the method of culturing natural killer cells of claim 1.

    25. A composition for culturing natural killer cells comprising transformed CD4+ T cells as an active ingredient.

    26. The method for culturing natural killer cells of claim 25, wherein the transformed CD4+ T cells express one or more of 4-1BBL, mbIL-21, OX40L, and mTNF-.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0017] FIG. 1a is a diagram confirming the expression status of the gene in Hut78 cell line through FACS.

    [0018] FIG. 1b is a diagram confirming the expression status of a single gene introduced into Hut78 cell line through FACS.

    [0019] FIG. 1c is a diagram confirming the expression status of mTNF-/OX40L and mTNF-/4-1BBL dual genes introduced into Hut78 cell line through FACS.

    [0020] FIG. 1d is a diagram confirming the expression status of mbIL-21/OX40L and mbIL-21/4-1BBL dual genes introduced into Hut78 cell line through FACS.

    [0021] FIG. 1e is a diagram confirming the expression status of triple genes introduced into Hut78 cell line through FACS.

    [0022] FIG. 1f is a diagram confirming the expression status of quadruple genes introduced into Hut78 cell line through FACS.

    [0023] FIG. 2a is a diagram illustrating the proliferation rate of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells for each transgene.

    [0024] FIG. 2b is a diagram illustrating the proliferation rate of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells for each transgene.

    [0025] FIG. 2c is a diagram illustrating the proliferation rate of natural killer cells produced by co-culturing Jurkat cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells for each transgene.

    [0026] FIG. 2d is a diagram illustrating the proliferation rate of natural killer cells produced by co-culturing Peer cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells for each transgene.

    [0027] FIG. 2e is a diagram illustrating the proliferation rate of natural killer cells produced by restimulating at 14-day or 16-day interval when co-culturing Hut78 cell line into which the triple gene has been introduced and cord blood-derived CD3() mononuclear cells.

    [0028] FIG. 3a is a diagram illustrating the survival rate of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells for each transgene.

    [0029] FIG. 3b is a diagram illustrating the survival rate of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells for each transgene.

    [0030] FIG. 3c is a diagram illustrating the survival rate of natural killer cells produced by co-culturing Jurkat cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells for each transgene.

    [0031] FIG. 3d is a diagram illustrating the survival rate of natural killer cells produced by co-culturing Peer cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells for each transgene.

    [0032] FIG. 3e is a diagram illustrating the survival rate of natural killer cells produced by restimulating at 14-day or 16-day interval when co-culturing Hut78 cell line into which the triple gene has been introduced and cord blood-derived CD3() mononuclear cells.

    [0033] FIG. 4a is a diagram illustrating the purity (CD3CD56+) of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells for each transgene.

    [0034] FIG. 4b is a diagram illustrating the purity (CD3CD56+) of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells for each transgene.

    [0035] FIG. 4c is a diagram illustrating the purity (CD3CD56+) of natural killer cells produced by co-culturing Jurkat cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells for each transgene.

    [0036] FIG. 4d is a diagram illustrating the purity (CD3CD56+) of natural killer cells produced by co-culturing Peer cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells for each transgene.

    [0037] FIG. 4e is a diagram illustrating the purity (CD3CD56+) of natural killer cells produced by restimulating at 14-day or 16-day interval when co-culturing Hut78 cell line into which the triple gene has been introduced and cord blood-derived CD3() mononuclear cells.

    [0038] FIG. 5a is a diagram illustrating the activity (CD16+CD56+) of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells for each transgene.

    [0039] FIG. 5b is a diagram illustrating the expression level of the NKG2D phenotype marker of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0040] FIG. 5c is a diagram illustrating the expression level of the NKp30 phenotype marker of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0041] FIG. 5d is a diagram illustrating the expression level of the NKp44 phenotype marker of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0042] FIG. 5e is a diagram illustrating the expression level of the NKp46 phenotype marker of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0043] FIG. 5f is a diagram illustrating the expression level of the DNAM-1 phenotype marker of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0044] FIG. 5g is a diagram illustrating the expression level of the CXCR3 phenotype marker of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0045] FIG. 6a is a diagram illustrating the activity (CD16+CD56+) of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells for each transgene.

    [0046] FIG. 6b a diagram illustrating the expression level of the NKG2D phenotype marker of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0047] FIG. 6c is a diagram illustrating the expression level of the NKp30 phenotype marker of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0048] FIG. 6d is a diagram illustrating the expression level of the NKp44 phenotype marker of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0049] FIG. 6e is a diagram illustrating the expression level of the NKp46 phenotype marker of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0050] FIG. 6f is a diagram illustrating the expression level of the DNAM-1 phenotype marker of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0051] FIG. 6g is a diagram illustrating the expression level of the CXCR3 phenotype marker of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0052] FIG. 7a is a diagram illustrating the expression level of NKG2D phenotype marker and the activity (CD16+CD56+) of natural killer cells produced by restimulating at 14-day or 16-day intervals when co-culturing Hut78 cell line into which the triple gene has been introduced and cord blood-derived CD3() mononuclear cells.

    [0053] FIG. 7b is a diagram illustrating the expression level of NKp30, NKp44, NKp46, DNAM-1, and CXCR3 phenotype markers of natural killer cells produced by restimulating at 14-day or 16-day interval when co-culturing Hut78 cell line into which the triple gene has been introduced and cord blood-derived CD3() mononuclear cells.

    [0054] FIG. 8a is a diagram illustrating the tumor cell killing ability of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0055] FIG. 8b is a diagram illustrating the tumor cell killing ability of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0056] FIG. 8c is a diagram illustrating the tumor cell killing ability of natural killer cells produced by co-culturing Jurkat cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0057] FIG. 8d is a diagram illustrating the tumor cell killing ability of natural killer cells produced by co-culturing Peer cell line into which the gene has been introduced and cord blood-derived CD3() mononuclear cells by each transgene.

    [0058] FIG. 8e is a diagram illustrating the tumor cell killing ability of natural killer cells produced by restimulating at 14-day or 16-day interval when co-culturing Hut78 cell line into which the triple gene has been introduced and cord blood-derived CD3() mononuclear cells.

    [0059] FIG. 9a is a diagram illustrating an administration schedule for efficacy evaluation using the Raji mouse animal model.

    [0060] FIG. 9b is a diagram illustrating the result of measuring the survival rate for confirming the efficacy of NK cells, RTX, and co-administration in the Raji animal model.

    [0061] FIG. 10a is a diagram illustrating an administration schedule for efficacy evaluation using the Ramos mouse animal model.

    [0062] FIG. 10b is a diagram illustrating the result of measuring the survival rate for confirming the efficacy of NK cells, RTX, and co-administration in the Ramos animal model.

    BEST MODE FOR CARRYING OUT THE INVENTION

    [0063] Hereinafter, the present invention will be described in detail.

    [0064] One aspect of the present invention provides a method for culturing natural killer cells comprising a step for co-culturing transformed CD4+ T cells and seed cells.

    [0065] The transformed CD4+ T cells may express at least one gene selected from the group composed of 4-1BBL gene, mbIL-21 gene, OX40L gene, and mTNF- gene.

    [0066] Specifically, when one gene is introduced into the transformed CD4+ T cells, the gene may be 4-1BBL, mbIL-21, OX40L, or mTNF-. In addition, when two genes are introduced into the transformed CD4+ T cells, said gene combination may be mbIL-21/4-1BBL, 4-1BBL/OX40L, mTNF-/4-1BBL, mbIL-21/OX40L, mbIL-21/mTNF- or mTNF-/OX40L. In one embodiment of the present invention, genes of a combination of mbIL-21/4-1BBL, mTNF-/OX40L, mTNF-/4-1BBL and mbIL-21/OX40L were introduced into T cells.

    [0067] In addition, when three genes are introduced into the transformed CD4+ T cells, said gene combination may be 4-1BBL/mbIL-21/OX40L, mbIL-21/OX40L/mTNF-, mTNF-/ mbIL-21/4-1BBL or 4-1BBL/OX40L/mTNF-. In one embodiment of the present invention, genes of a combination of mTNF-/mbIL-21/4-1BBL were introduced into T cells.

    [0068] In addition, when four genes are introduced into the transformed CD4+ T cells, said gene combination may be mTNF-/mbIL-21/OX40L/4-1BBL. In one embodiment of the present invention, genes of a combination of mTNF-/mbIL-21/OX40L/4-1BBL were introduced into T cells.

    [0069] The term 4-1BBL used in the present invention is one of TNFSF (TNF superfamily) called CD137L and refers to a ligand that binds to the receptor 4-1BB by forming a trimer. The 4-1BB gene may be derived from humans.

    [0070] Specifically, the 4-1BBL gene may be NCBI Reference Sequence: NM_003811, but is not limited thereto. The 4-1BBL gene may be a base sequence coding the amino acid sequence represented by sequence No. 1. The base sequence coding the amino acid sequence represented by sequence No. 1 may be a base sequence represented by sequence No. 2.

    [0071] The term mbIL-21 used in the present invention may be IL-21 designed to be bound to a cell membrane. Here, mbIL-21 may be a fusion protein in which IL-21 and a transmembrane protein are combined. The transmembrane protein may be CD8. Specifically, it may be a transmembrane domain of CD8.

    [0072] Specifically, the IL-21 gene may be NCBI Reference Sequence: NM_021803.3, but is not limited thereto. In addition, the CD8 gene may be NCBI Reference Sequence: NM_001768, but is not limited thereto. The mbIL-21 is expressed in the form of IL-21 bound to the cell membrane. In addition, the mbIL-21 gene may be a base sequence coding the amino acid sequence represented by sequence No. 3. The base sequence coding the amino acid sequence represented by sequence No. 3 may be a base sequence represented by sequence No. 4.

    [0073] The term OX40L used in the present invention is also called TNFSF4, gp34, TXGP1, CD252, and CD134L, and refers to a ligand that binds to OX40. Specifically, the OX40L gene may be NCBI Reference Sequence: NM_003326, but is not limited thereto. The OX40L gene may be a base sequence coding the amino acid sequence represented by sequence No. 5. The base sequence coding the amino acid sequence represented by sequence No. 5 may be the base sequence represented by sequence No. 6.

    [0074] The term mTNF- used in the present invention refers to the gene in which Alanine-Valine, which is a TACE (tumor necrosis factor-alpha-converting enzyme) recognition site, has undergone a point mutation in DNA in the amino acid sequence of tumor necrosis factor-alpha to become Proline-Valine. Mutating alanine to proline was randomly chosen.

    [0075] Specifically, the mTNF- gene may be a base sequence coding the amino acid sequence represented by sequence No. 8. The base sequence coding the amino acid sequence represented by sequence No. 8 may be the base sequence represented by sequence No. 9.

    [0076] The 4-1BBL gene, mbIL-21 gene, OX40L gene, or mTNF- gene may be introduced through a recombinant lentivirus, but is not limited thereto.

    [0077] As a method for transducing the gene into a cell, a biochemical method, a physical method, or a virus mediated transduction method may be used. In addition, as a biochemical method, FuGene6 (Roche, USA), Lipofectamine (Lipofectamine 2000, Invitrogen, USA), or ExGen 500 (MBI Fermentas International Inc. CANADA) may be used. In addition, a lipid mediated method using lipofectamine may be used.

    [0078] The term vector used in the present invention is an expression vector capable of expressing a target gene in cells into which the vector has been introduced, refers to a gene construct comprising essential control elements operably connected so that the gene insert introduced into the vector can be expressed.

    [0079] In addition, as the expression vector comprising the gene, any expression vector that can be expressed in a CD4+ cell line can be used, and in a specific embodiment of the present invention, pCDH-CMV-MCS-EF1-Puro (SBI, CD510B-1) or pCDH-CMV-MCS-EF1-Neo (SBI, CD514B-1) lentiviral vector was used.

    [0080] The lentivirus refers to a virus of the retrovirus family characterized by a long incubation period. Lentiviruses can carry genetic information into the DNA of host cells. It is one of the most effective methods of gene transfer vectors capable of replicating in non-dividing cells.

    [0081] The CD4+ T cells may be CD4+ T cells isolated in vitro, CD4+ T cells expanded and cultured in vitro, or CD4+ cell lines (T lymphoma cell lines). In addition, the CD4+ T cells may be accessory T cells, and may be hybridomas obtained by fusing CD4+ T cells and cancer cells. Specifically, the CD4+ T cells may be any one selected from the group composed of Hut78, H9, Jurkat, Loucy, Molt-3, Molt-13, Peer, RPMI8402 and TALL-01 cells. Preferably, it may be Hut78, H9, Jurkat or Peer cells.

    [0082] The term feeder cell used in the present invention refers to a cell that is also called a culture support cell and does not proliferate but has the metabolic activity to help the proliferation of target cells by producing various metabolites. The feeder cells may be transformed CD4+ T cells expressing at least one gene selected from the group composed of 4-1BBL gene, mbIL-21 gene, OX40L gene, and mTNF- gene.

    [0083] The T cells used as the feeder cells may be inactivated cells in which divisional proliferation is inhibited or cells that have not been inactivated, and preferably, safety can be ensured by inactivation. As a method for inactivation, a common method known in the relevant industry may be used, and for example, a method for irradiating gamma-ray may be used. When using T cells that have not been inactivated, since most are tumor cells, they can be killed during culture by activated natural killer cells.

    [0084] The term seed cell used in the present invention refers to a cell capable of proliferating into natural killer cells through appropriate culture. Specifically, the seed cell may be cord blood-derived mononuclear cells, or cord blood-derived natural killer cells. This is not limited thereto, and preferably, the seed cells may be CD3() cells from which CD3(+) cells have been removed.

    [0085] As for the method for culturing natural killer cells, they may be cultured by mixing the feeder cells and the seed cells with a ratio of at least 0.1. Specifically, the ratio of the feeder cells and the seed cells may be 0.1:1 to 50:1. More specifically, it may be 0.5:1 to 40:1. Even more specifically, it may be 1:1 to 30:1. Most specifically, it may be 2:1 to 20:1. As a specific example, the ratio of the feeder cell and the seed cell may be 2.5:1, but is not particularly limited thereto. The ratio refers to a ratio based on the number of cells.

    [0086] In the method for culturing natural killer cells, the seed cells may be mixed once with the feeder cells and cultured for 5 to 60 days, or mixed with the feeders cells at least twice and cultured for at least 60 days. Preferably, the seed cells may be mixed once with the feeder cells and cultured for 14 to 21 days, but it is not limited thereto.

    [0087] In the method for culturing natural killer cells, natural killer cells and T lymphoma cell lines are co-cultured in a conventional animal cell culture medium, such as AIM-V media, RPMI1640, CellGro SCGM, X-VIVO20, IMDM, and DMEM. When co-cultured, interleukins and antibodies that have low affinity to T cells and stimulate T cells may be added for culture, but it is not limited thereto.

    [0088] The term antibody that has low affinity to T cells and stimulates T cells used in the present invention refers to a protein that specifically reacts to the CD3 antigen, which is a group of molecules that meets with the T cell receptor (TCR) to form an antigen recognition complex. Compared to TCR, the CD3 molecule has a longer intracellular region and plays a role of transmitting antigen recognition signals into the cell.

    [0089] Preferably, an antibody, which has a low affinity to T cells and stimulates T cells, that can be used in the present invention may be an anti-CD3 antibody. Specifically, the anti-CD3 antibody may be OKT-3, UCHT1, or HIT3a.

    [0090] The term interleukin (IL) used in the present invention refers to a group of cytokines, and refers to a proteinaceous biological active substance produced by immune cells, such as lymphocytes, monocytes, and macrophages. The interleukin may be IL-2, IL-15, IL-12, IL-18, or IL-21.

    [0091] In an embodiment of the present invention, it was cultured by adding OKT-3 antibody and IL-2. The concentration of the OKT-3 antibody added may be 0.1 ng/ml to 1,000 ng/ml. Preferably, the concentration of the OKT-3 antibody may be 10 ng/l. The concentration of IL-2 may be 10 U/ml to 2,000 U/ml. Preferably, the concentration of IL-2 may be 1,000 U/ml. In addition, it may be cultured by adding additional growth factors that support the proliferation of serum or plasma and lymphocytes. The type of serum or plasma to be added to the medium is not particularly limited, and commercially available serum or plasma derived from various animals may be used. Preferably, human-derived serum or plasma derived from the person themselves may be used.

    [0092] The term culture of the present invention refers to a method for growing cells in an environmental condition that has been appropriately artificially controlled. The method for culturing the transformed CD4+ T cells may be performed using a method well known in the relevant industry. Specifically, said culture may be carried out in a continuous manner in a batch process, a fed batch, or a repeated fed batch process.

    [0093] In addition, precursors suitable for the culture medium may be used. The raw materials described above may be added in a batch, fed batch, or continuous manner to the culture during the cultivation process, but it is not particularly limited thereto. Basic compounds, such as sodium hydroxide, potassium hydroxide, and ammonia, or acidic compounds, such as phosphoric acid or sulfuric acid, can be used in an appropriate manner to adjust the pH of the culture.

    [0094] The culture method using T cells as feeder cells selectively induces culture of natural killer cells in seed cells, and it can be cultured stably without differences depending on the donor when proliferating natural killer cells compared to when using the donor's PBMC feeder cells. In addition, in vitro culture of cord blood seed cells is difficult when the donor's MNC is used as feeder cells. Therefore, the culture method using T cells as feeder cells can efficiently and stably secure a large amount of therapeutic natural killer cell agents for treatment.

    [0095] Another aspect of the present invention provides natural killer cells produced by said method for culturing natural killer cells.

    [0096] Natural killer cells cultured according to said method for culturing natural killer cells can be frozen and the function of the cells does not get damaged even when they are thawed again. In addition, since the expression of an activating receptor, such as NKp46, is high, the killing ability and secretion of cytokines against tumor cell lines are increased, and therefore, an excellent anticancer effect can be expected. Therefore, it is possible to manufacture a cell therapy product effective for tumor treatment using a large amount of clinically applicable activated natural killer cells.

    [0097] In addition, natural killer cells produced by the method for culturing natural killer cells may be comprised in an amount of 10 to 95 wt % based on the total weight of the composition for preventing or treating infectious diseases included as an active ingredient. In addition, the composition for preventing or treating infectious diseases or of the present invention may further comprise at least one type of active ingredients exhibiting the same or similar function in addition to said active ingredient.

    [0098] The pharmaceutical composition for preventing or treating infectious diseases may be prepared into a pharmaceutical composition by comprising at least one type of pharmaceutically acceptable carriers in addition to the active ingredient described above for administration.

    [0099] The dosage of the pharmaceutical composition for preventing or treating infectious diseases may be adjusted according to various factors including type of disease, severity of disease, type and content of active ingredients and other ingredients comprised in the composition, type of formulation, patient's age, weight, general health condition, gender, and diet, administration time, administration route, secretion rate of the composition, duration of treatment, and concurrently used drugs. However, for a desirable effect, the dost of natural killer cells according to the present invention may be 0.0110.sup.7 cells/kg to 1.010.sup.9 cells/kg, and may be 0.510.sup.7 cells/kg to 1.010.sup.8 cells/kg. In this case, the administration may be carried out once a day, or may be divided into several administrations.

    [0100] In addition, the pharmaceutical composition for preventing or treating infectious diseases may be administered to an individual by various methods known in the relevant industry. The administration route may be appropriately selected by a PHOSITA in consideration of the method of administration, volume of body fluid, viscosity, etc.

    [0101] Another aspect of the present invention provides a composition for culturing natural killer cells comprising transformed CD4+ T cells as an active ingredient. Since the CD4+ T cells used in the present invention and the genes introduced into said cells have already been described above, the corresponding descriptions will be omitted to avoid excessive duplication.

    MODE FOR CARRYING OUT THE INVENTION

    [0102] Hereinafter, the present invention will be described in detail by embodiments. However, the following embodiments are intended only for illustrating the present invention, and the present invention is not limited to the following embodiments.

    Embodiment 1. Production of Recombinant Lentivirus

    Embodiment 1.1. Production of Recombinant Lentiviral Vector

    [0103] For the lentiviral vector, pCDH-CMV-MCS-EF1-Puro (SBI, CD510B-1) or pCDH-CMV-MCS-EF1-Neo (SBI, CD514B-1) was used. For genes, 4-1BBL (TNF superfamily member 9, TNFSF9), mbIL-21 (membrane bound IL-21), OX40L (TNF superfamily member 4(TNFSF4) transcript variant 1), and mTNF- (membrane bound TNF alpha) were used as transgenes.

    [0104] Specifically, a 4-1BBL gene expression vector (Origene, RC211160) was used for the 4-1BBL gene (sequence No. 2). For the mbIL-21 gene (sequence No. 4), a pcDNA3.1 vector (Genscript, US) into which the codon-optimized mbIL-21 gene sequence has been inserted was used. The OX40L gene (sequence No. 6) was requested to be synthesized by Bioneer.

    [0105] For mTNF- gene (sequence No. 9), RNA was extracted from peripheral blood mononuclear cell (PBMC), and then CDS was obtained by RT(Reverse transcriptase)-PCR. TNF- is cut by TACE (tumor necrosis factor-alpha-converting enzyme) to be secreted, and A-V (Alanine-Valine), which is a TACE recognition site, has undergone a point mutation in DNA in the TNF- amino acid sequence to become P-V (Proline-Valine), thereby maintaining the state of being attached to the cell membrane. The point mutation was performed by substituting guanine, the 226.sup.th base, with cytosine, and adenine, the 228.sup.th base, with guanine in the human mTNF- gene represented by sequence No. 7.

    [0106] Using primers suitable for each transgene, CDS (Coding Sequence) of the transgene was amplified through PCR (Table 1).

    TABLE-US-00001 TABLE1 Sequence Gene Primer Sequenceinformation(5.fwdarw.3) number 4-1BBL 4-1BBL TCTAGAGCTAGCGAATTCGCCACCATG Sequence Forward GAATACGCCTCTGACGCTT number10 4-1BBL TTCGCGGCCGCGGATCCTTATTCCGACC Sequence Reverse TCGGTGAAGG number11 mbIL-21 mbIL-21 TAGAGCTAGCGAATTCGCCACCGCCAC Sequence Forward CATGGCTCTGCCC number12 mbIL-21 TCGCGGCCGCGGATCCTCAATACAGGG Sequence Reverse TGATGACC number13 OX40L OX40L TAGAGCTAGCGAATTCGCCACCATGGA Sequence Forward ACGGGTGCAAC number14 OX40L TCGCGGCCGCGGATCCTCACAAGACAC Sequence Reverse AGAACTCCCC number15 mTNF- mTNF- TAGAGCTAGCGAATTCGCCACCGCCAC Sequence Forward CATGGCTCTGCCC number16 mTNF- TCGCGGCCGCGGATCCTCACAGGGCAA Sequence Reverse TGATCCC number17

    [0107] Table 1 shows the primers used in the experiment. The transgene and lentiviral vector were treated with EcoRI and BamHI restriction enzymes. Then, it was ligated using In-Fusion HD cloning kit (Clontech, 639649). The ligated lentiviral vector was transformed in DH5a soluble cells (competent cells) and cultured. Plasmid DNA was obtained from the transformed DH5 soluble cells using a plasmid mini-prep kit (MACHEREY-NAGEL/740422.50). A request for sequencing was made to an external company and it was confirmed that all plasmid DNA matches the DNA sequence. In addition, the desired transgene was inserted into cLV-CMV-MCS-IRES-Puro (puromycin) or cLV-CMV-MCS-IRES-Neo (neomycin), cLV-CMV-MCS-IRES-Bsd (blasticidin) by an outsourced manufacturer by the same method as the one described above.

    Embodiment 1.2. Production of Concentrated Lentivirus

    [0108] In order to produce recombinant lentivirus, the 293T cell line was inoculated into a 75T flask (Nunc, 156499) with 1.510.sup.6 to 210.sup.6 cells 2 days before transfection, and cultured in an incubator at a temperature condition of 5% CO.sub.2, 37 C. When the cell saturation of the 293T cells reached about 80% to 90%, the medium was replaced with 6 ml OPTI-MEM (Gibco, 31985-088) and incubated for 30 minutes at a temperature of 37 C. and under the condition of 5% CO.sub.2. A DNA mixture and a lipofectamine (lipofectamine 2000, Life technologies, 11668500) mixture were prepared (Table 2).

    TABLE-US-00002 TABLE 2 Category Ingredients DNA mixture 6 g target DNA, 6 g Gag, 6 g REV, 3 g VSVG, 1 mcustom-character OPTI-MEM Lipofectamine mixture 36 custom-character lipofectamine 2000, 1 mcustom-character OPTI-MEM

    [0109] Table 2 shows the DNA mixture and the lipofectamine (lipofectamine 2000, Life technologies, 11668500) mixture. Each of the components of the mixtures was mixed well using a vortexer and left at room temperature for 3 minutes. Then, the two mixtures were mixed and left at room temperature for at least 20 minutes. 2 mcustom-character of a mixed solution of DNA and lipofectamine was treated with 293T cells being cultured in 6 mcustom-character OPTI-MEM. After 4 hours, it was replaced with DMEM (Gibco, 11995073) medium to which 10% (v/v) FBS has been added, and was cultured at a temperature of 37 C. for 48 hours under the condition of 5% CO.sub.2. 8 mcustom-character of the culture solution of 293T cells cultured for 48 hours was collected and filtered through a 0.45 m filter (Millipore, SLHP033RS). The filtered culture solution was concentrated to 250 l or less using an Amicon Ultra-15 Centrifugal Filter Unit with Ultracel-100 membrane (Merckmillipore, UFC910096). The concentrated virus was divided into an appropriate amount and stored at a temperature of 80 C.

    Embodiment 2. Production of Transgenic T Cells

    Embodiment 2.1. Lentivirus infection

    [0110] 0.510.sup.6 cell lines being cultured, 1 mcustom-character OPTI-MEM, 50 custom-character lentivirus thawing solution, and 10 g/mcustom-character polybrene (Santa Cruz, C2013) were mixed and placed in a 6-well plate (Nunc, 140675), and spinoculation was performed for 90 minutes under 1800g and at a temperature of 32 C. Then, after culturing in an incubator under a temperature condition of 5% CO.sub.2, 37 C., it was replaced with an existing culture medium and cultured for 48 hours.

    [0111] Hut78 cell line (ATCC, TIB-161) was cultured in IMDM (ATCC, 30-2005) medium containing 20% (v/v) FBS. During subculture, the cell concentration was maintained at 1.510.sup.5 cells/mcustom-character to 2.010.sup.5 cells/mcustom-character. H9 cell line (ATCC, HTB-176) and Jurkat cell line (ATCC, TIB-152) were cultured in RPMI1640 (ATCC, 30-2001) medium containing 10% (v/v) FBS. During subculture, cell concentrations were maintained at 1.010.sup.5 cells/mcustom-character to 1.510.sup.5 cells/mcustom-character and 0.510.sup.5 cells/mcustom-character to 1.010.sup.5 cells/mcustom-character, respectively Peer cell line was cultured in RPMI1640 medium containing 20% (v/v) FBS. During subculture, the cell concentration was maintained at 3.010.sup.5 to 5.010.sup.5 cells/mcustom-character. The subculture of all cell lines was performed at intervals of 2 to 3 days. A 75T flask was used as the culture vessel, and the amount of medium was maintained between 15 mcustom-character to 20 mcustom-character.

    [0112] Cell lines infected with the recombinant lentivirus were selected using antibiotics (Table 3).

    TABLE-US-00003 TABLE 3 Transgenic Antibiotic usage combination Vector used Cell line concentration Single gene mTNF-ambIL-21 pCDH(System Hut78 0.5 g/mcustom-character puromycin expression Biosciences, (Life technologies. SBI) A1113802) OX40L4-1BBL pCDH(System Hut78 1 mg/mcustom-character G148(Sigma Biosciences, Aldrich, A1720-5G) SBI) Double gene mTNF-a/OX40L pCDH(System Hut78 0.5 g/mcustom-character expression mbIL-21/OX40L Biosciences, puromycin1 mg/mcustom-character mTNF-a/4-1BBL SBI) G418 mbIL-21/4-1BBL cLV (Sirion) Hut78H9 6 g/mcustom-character JurkatPeer Blasticidin(Invitrogen, R210-01)1 mg/mcustom-character G148 Triple gene mTNF-a/mbIL-21/ cLV (Sirion) Hut78H9 0.5 g/mcustom-character expression 4-1BBL Jurkat puromycin6 g/mcustom-character Blasticidin1 mg/mcustom-character G418 Quadruple mTNF-a/mbIL-21/ mTNF-a/mbIL-21/ Hut78 0.5 g/mcustom-character gene OX40L/ 4-1BBL; puromycin6 g/mcustom-character expression 4-1BBL cLVOx40L; Blasticidin1 mg/mcustom-character pCDH G418

    [0113] Table 3 above shows the antibiotics used in cell lines into which the gene was introduced.

    Embodiment 2.2. Confirmation of Transgene Expression

    [0114] In order to confirm the expression of the transgene through flow cytometry, the cell lines subcultured in embodiment 2.1. were collected and centrifuged at 1,200 rpm for 5 minutes. Then, the culture solution was removed by suction. FACS buffer was created by adding 2 %(v/v) FBS to PBS. The number of cells was measured by diluting with 1 mcustom-character of FACS buffer, and it was diluted with FACS buffer to a concentration of 510.sup.6 cells/mcustom-character. 100 custom-character of diluted cell solution was added to each of 5 mcustom-character FACS tubes (Falcon, 352052). After staining with anti-human TNF-a(membrane)-PE (R&D systems, FAB210P), anti-human OX40L-PE (BD, 558184), anti-human 4-1BBL-PE (BD, 559446), anti-human IL-21-PE (eBioscience, 12-7219-42), 7-AAD (Beckman coulter, IM3630c), PE mouse IgG1 isotype control (BD Pharmingen, 555749), and PerCP-Cy5.5 mouse IgG1 isotype control (BD, 550795), the expression rate of each gene was analyzed using FACS equipment (FIGS. 1a to 1f).

    [0115] In addition, in order to confirm the expression of the transgene through RT-qPCR (Real time qPCR), the cell lines subcultured in embodiment 2.1. were collected and centrifuged at 1,200 rpm for 5 minutes. Then, the culture solution was removed by suction. The number of cells was measured by diluting with PBS, and RNA was isolated and quantified for 110.sup.6 cells using an RNA prep kit. In addition, cDNA was synthesized using a cDNA synthesis kit. RT-qPCR was performed using the synthesized cDNA. Primers used in RT-qPCR are as shown in Table 4 below.

    TABLE-US-00004 TABLE4 Primer Sequenceinformation(5.fwdarw.3) Sequencenumber 4.1BBL Forward TCTGAGACAGGGCATGTT Sequence primer TG number18 Reverse CCACCAGTTCTTTGGTGTC Sequence primer C number19 mTNF- Forward AACCTCCTCTCTGCCATCA Sequence primer A number20 Reverse ATAGTCGGGCCGATTGAT Sequence primer CT number21 mbIL-21 Forward TGGAAACAATGAGCGAAT Sequence primer CA number22 Reverse AACCGCTCCAGGAACTCT Sequence primer TT number23 hTOP1 Forward CCAGACGGAAGCTCGGAA Sequence primer AC number24 Reverse GTCCAGGAGGCTCTATCT Sequence primer TGAA number25

    [0116] Table 4 shows the primers used in the RT-qPCR experiment. The expression level of the transgenes in the cell lines is shown in Table 5 below.

    TABLE-US-00005 TABLE 5 Ct value TOP1 mTNF- mbIL-21 4.1BBL H9 20.3 21.5 n.d n.d H9-mbIL-21-4.1BBL 20.0 22.2 19.5 19.4 H9-mTNF--mbIL-21-4.1BBL 19.9 18.2 18.1 18.2 Jurkat 20.1 30.7 n.d n.d Jurkat-mbIL-21-4.1BBL 27.4 37.0 36.4 34.1 Jurkal-mTNF-- 20.4 19.8 19.2 19.8 mbIL-21-4.1BBL Peer 21.4 26.2 34.2 34.9 Peer-mbIL-21-4.1BBL 26.8 33.8 29.0 25.6 * n.d: not detected

    [0117] As shown in Table 5, it was confirmed that the expression level of the genes introduced into the cell lines was increased.

    Embodiment 3. Co-Cultivation of CD3() PBMC and Transgenic T Cells

    Embodiment 3.1. Preparation of Cord Blood-Derived CD3() PBMC Seed Cells

    [0118] Cord blood for research was placed in a 50 mcustom-character tube and centrifuged for 10 minutes at 1,500 rpm. Plasma of the upper layer was removed and PBS (phosphate buffered saline, LONZA, 17-516Q) was added in a 1:1 ratio. Then, after separating cord blood mononuclear cells (MNC) through Ficoll (Ficoll-Paque Plus, GE Healthcare, 17-1440-03) density gradient centrifugation method, the number of cells was measured using the ADAM cell counter system (Nano Entek).

    [0119] In order to obtain seed cells from which CD3(+) cells have been removed, 510.sup.7 cord blood mononuclear cells were moved to a new 50 mcustom-character tube, and then centrifuged at 1,200 rpm and a temperature of 4 C. for 5 minutes. A MACS running buffer containing 2% (v/v) FBS and EDTA with a concentration of 2 mM in PBS was prepared. After the centrifugation, 400 custom-character of MACS running buffer and 100 custom-character of CD3 magnetic beads (Miltenyi biotech, 130-050-101) were added to the pellet and reacted at a temperature of 4 C. for 20 minutes. After washing by adding 10 mcustom-character MACS running buffer, it was centrifuged at 13,500 rpm and a temperature of 4 C. for 8 minutes and suspended in 0.5 mcustom-character of MACS running buffer.

    [0120] Cells were separated by mounting a CS column (Miltenyi Biotech, 130-041-305) on VarioMACS (Miltenyi Biotech). Cells were recovered by washing the column until finally reaching 20 mcustom-character. The recovered cells were placed in a new 50 mcustom-character tube, centrifuged at 1,200 rpm and a temperature of 4 C. for 5 minutes, and suspended in a frozen medium. The number of cells was measured using the ADAM cell counter system to freeze 510.sup.6 cells per vial in liquid nitrogen.

    [0121] One vial of frozen CD3() cord blood mononuclear cells was thawed in a water bath at a temperature of 37 C. and moved to a 50 mcustom-character tube, suspended in PBS containing 0.6% (v/v) ACD (Citrate-dextrose solution, Sigma-Aldrich, C3821), 0.2% (v/v) FBS (Fetal serum bovine), and 2 mM EDTA, and centrifuged at 1,500 rpm and a temperature of 4 C. for 10 minutes. CD3() cord blood mononuclear cells were suspended in CellGro medium (Cellgenix, 20802-0500), and the number of cells was measured using the ADAM cell counter system. CD3() cord blood mononuclear cells were suspended in CellGro medium at a concentration of 110.sup.6 cells/mcustom-character.

    Embodiment 3.2. Co-Cultivation of CD3() Cord Blood Mononuclear Cells and Transgenic T Cells

    [0122] The transgenic T cells prepared in embodiment 2 were recovered from the culture flask and centrifuged at 1,200 rpm and a temperature of 4 C. for 5 minutes. Then, it was suspended in CellGro medium, and the number of cells was measured using the ADAM cell counter system. The transgenic T cells were suspended in CellGro medium at a concentration of 2.510.sup.6 cells/mcustom-character, and then prepared by inactivating it with irradiation at 20,000 cGy in a gamma-ray irradiator.

    [0123] When culturing natural killer cells, 1,000 IU of IL-2 (Proleukin Injection, Novartis Korea) and 10 ng/mcustom-character of OKT-3 (eBioscience, 16-0037-85) were placed in a culture plastic plate. On day 0 of cultivation, 0.25 mcustom-character of each of CD3() cord blood mononuclear cells and transgenic T cells was added at a ratio of 1:2.5, 0.25 mcustom-character of CellGro medium containing 2% (v/v) human plasma was added, and stationary culture was carried out for 4 days in an incubator at a temperature condition of 37 C.

    [0124] On the fourth day of cultivation, the same amount of CellGro medium containing 1% (v/v) human plasma and 1,000 IU/mcustom-character of IL-2 was added, and then stationary culture was performed again. Then, the number of cells was measured at intervals of 2 to 3 days, and suspension culture was carried out until the 21.sup.st day while adding CellGro medium containing 1% (v/v) human plasma and 1,000 IU/mcustom-character of IL-2 to reach a concentration of 110.sup.6 cells/mcustom-character. Proliferated natural killer cells were obtained by performing suspension culture until the 21.sup.st day. In this case, if the Jurkat cell lines or the Peer cell lines were used as feeder cells, the suspension culture was performed until the 11.sup.th day. If genes were introduced into H9 and Hut78 and used as feeder cells, the suspension culture was performed until the 21.sup.st day.

    [0125] The result of comparing the proliferation rate of cultured natural killer cells showed that, based on the total number of cells (Total nucleated cells, TNC), when co-cultured with the Hut78 cell lines to which the gene was not introduced, it proliferated 93 times. It was confirmed that the proliferation rate of natural killer cells was significantly increased when co-cultured with the Hut78 cell lines into which one or more genes (mTNF-, mbIL-21, 4-1BBL) were introduced. In particular, when co-cultured with the Hut78 cell lines into which the gene of mbIL-21/4-1BBL was introduced, it proliferated 957 times. In addition, when co-cultured with the Hut78 cell lines into which mTNF-/mbIL-21/4-1BBL was introduced, it proliferated 1,138 times (Table 6, FIG. 2a).

    TABLE-US-00006 TABLE 6 HuT78/Transgene Average STDEV HuT78 parental 92.7 90.4 mTNF- 112.3 67.2 mbIL-21 448.1 251.4 OX40L 50.5 30.7 4.1BBL 274.9 189.6 mTNF- + OX40L 204.5 123.2 mTNF- + 4.1BBL 389.1 352.1 mbIL-21 + OX40L 372.0 189.2 mbIL-21 + 4.1BBL 957.0 537.4 mTNF- + mbIL21 + 4.1BBL 1138.5 192.0 mTNF- + OX40L + mbIL21 + 4.1BBL 823.1 330.0

    [0126] In addition, when co-cultured with the H9 cell lines into which the gene was not introduced, it proliferated 13 times, but when co-cultured with the H9 cell lines into which mbIL-21/4-1BBL or mTNF-/mbIL-21/4-1BBL was introduced, it proliferated 367 times and 979 times, respectively (Table 7 and FIG. 2b).

    TABLE-US-00007 TABLE 7 H9 + Transgene Average STDEV H9 parental 12.6 4.3 mbIL21 + 4.1BBL 367.4 80.1 mTNF- + mbIL21 + 4.1BBL 978.8 287.7

    [0127] When co-cultured with other cell lines, such as Jurkat cell lines or Peer cell lines, cultivation was possible until the 11.sup.th day of culture. A relatively high proliferation rate was displayed in cell lines into which the mbIL-21/4.1BBL gene was introduced or cell lines into which the mTNF-/mbIL-21/4-1BBL gene was introduced (Table 8 and Table 9, FIG. 2c and FIG. 2b).

    TABLE-US-00008 TABLE 8 Jurkat + Transgene Average (11-day culture) STDEV Jurkat Parental 0.9 0.7 mbIL21 + 4.1BBL 36.3 4.8 mTNF- + mbIL21 + 4.1BBL 43.6 6.6

    TABLE-US-00009 TABLE 9 Peer + Transgene Average (11-day culture) STDEV Peer Parental 1.6 0.7 mbIL21 + 4.1BBL 14.3 4.1

    [0128] The results described above showed that it is possible to culture natural killer cells by culturing CD3() cells isolated from cord blood mononuclear cells for 21 days with feeder cells into which the gene was introduced, and exhibited a higher proliferation that the non-transduced feeder cells.

    Embodiment 3.3. Restimulation of Natural Killer Cell Culture Using Hut78 Cells Into Which the mTNF-/mbIL-21/4-1BBL Gene was Introduced

    [0129] The transgenic T cells prepared in embodiment 2 were recovered from the culture flask and centrifuged for 5 minutes at 1,200 rpm and a temperature of 4 C. Then, it was suspended in CellGro medium, and the number of cells was measured using the ADAM cell counter system. After suspending the transgenic T cells in CellGro medium at a concentration of 2.510.sup.6 cells/me, it was prepared by inactivating it with irradiation at 20,000 cGy in a gamma-ray irradiator.

    [0130] When culturing natural killer cells, 1,000 IU of IL-2 and 10 ng/mcustom-character of OKT-3 were placed in a culture plastic plate. On day 0 of cultivation, 0.25 mcustom-character to 1 mcustom-character of each of CD3() cord blood mononuclear cells and transgenic T cells were added at a ratio of 1:2.5, 0.25 mcustom-character to 1 mcustom-character of CellGro medium containing 2% (v/v) human plasma was added, and stationary culture was carried out for 4 days in an incubator at a temperature condition of 37 C.

    [0131] On the fourth day of cultivation, the same amount of CellGro medium containing 1% (v/v) human plasma and 1,000 IU/mcustom-character of IL-2 was added, and then stationary culture was performed again. Then, the number of cells was measured at intervals of 2 to 3 days, and cultivation was carried out while adding CellGro medium containing 1% (v/v) human plasma and 1,000 IU/mcustom-character of IL-2 to reach a concentration of 110.sup.6 cells/mcustom-character.

    [0132] For restimulation, on day 0 of cultivation, HuT78 cells into which the mTNF-/mbIL-21/4-1BBL was introduced were used at the same ratio. On the sixteenth day of cultivation, the first restimulation was given. First, the number of natural killer cells in cultivation was measured using the ADAM cell counter system, they were diluted with CellGro medium to become 1.510.sup.6 cells/me, and 0.25 mcustom-character was prepared on a culture plastic plate. HuT78 cells into which the mTNF-/mbIL-21/4-1BBL was introduced were suspended in CellGro medium to become 2.510.sup.6 cells/me, and then prepared by inactivating it with irradiation at 10,000 cGy in a gamma-ray irradiator.

    [0133] 0.25 mcustom-character HuT78 cells into which the inactivated mTNF-/mbIL-21/4-1BBL gene was introduced were added to a culture plastic. 1,000 IU/mcustom-character of IL-2 and 10 ng/mcustom-character of OKT-3, and 1 %(v/v) human plasma were placed in a culture plastic plate, and stationary culture was carried out for 3 days in an incubator at a temperature of 37 C. Then, the number of cells was measured at intervals of 2 to 3 days, and cultivation was performed while adding CellGro medium containing 1% (v/v) human plasma and 1,000 IU/mcustom-character of IL-2 to reach a concentration of 110.sup.6 cells/mcustom-character. After the first restimulation, restimulation through feeder cells was performed on the 32.sup.nd, 46.sup.th, and 60.sup.th day of culture in the name manner, and culture was continued until the 70.sup.th day.

    [0134] As a result, the proliferation rate of natural killer cells on the 32.sup.nd day of cultivation after the first restimulation was 6.910.sup.4 times, 3.710.sup.6 times after the second restimulation, 2.310.sup.8 times on the 60.sup.th day of cultivation after the third restimulation, and 5.910.sup.9 times on the 70.sup.th day of cultivation after the fourth restimulation, maintaining sustained proliferation and showing a high proliferation rate (Table 10, FIG. 2e).

    TABLE-US-00010 TABLE 10 Culturing day Average STDEV Day 32 6.9 10.sup.4 3.2 10.sup.3 Day 46 3.7 10.sup.6 3.1 10.sup.5 Day 60 2.3 10.sup.8 1.4 10.sup.8 Day 70 5.9 10.sup.9 1.1 10.sup.8

    [0135] Through this, it was confirmed that when a periodic restimulation was provided to HuT78 cell lines into which the mTNF-/mbIL-21/4-1BBL was introduced, the proliferation rate continued to increase, making it an excellent feeder cell to be used.

    Experimental Example 1. Confirmation of Cell Viability of Natural Killer Cells According to Transgenes

    [0136] In order to compare and evaluate the in-vitro cell viability, an ADAM cell counter system, which is one of the cell counters using PI staining solution capable of binding with the intracellular nucleus, was used. After calculating the number of viable cells by subtracting the number of dead cells from the measured total number of cells, cell viability was calculated using Equation I below.


    Cell viability (%)=(viable cell count/total cell count)100 [Equation I]

    [0137] In the case of natural killer cells co-cultured with HuT78 cell lines into which the gene was introduced, it exhibited viability of around 90% regardless of whether the gene was introduced (Table 11, FIG. 3a).

    TABLE-US-00011 TABLE 11 HuT78 + Transgene Average STDEV Parental 91 2.6 mTNF- 92.8 2.1 mbIL-21 92.8 1.5 OX40L 90.3 1.3 4.1BBL 91.3 1.3 mTNF- + OX40L 93.5 1.7 mTNF- + 4.1BBL 92.5 1.7 mbIL-21 + OX40L 89 2.4 mbIL-21 + 4.1BBL 89.8 2.6 mTNF- + mbIL-21 + 4.1BBL 89 3.4 QD 88.5 3.4

    [0138] In the case of other H9, Jurkat, or Peer cell lines, the viability of natural killer cells cultured in the cell line into which the mbIL-21/4-1BBL gene was introduced and the cell line into which the mTNF-/mbIL-21/4-1BBL gene was introduced exhibited viability of at least 90% when cultured for 21 days (H9) and cultured for 11 days (Jurkat, Peer) (Tables 12 to 14, FIGS. 3b to 3d).

    TABLE-US-00012 TABLE 12 H9 + Transgene Average STDEV Parental 86 6.1 mbIL21 + 44.1BBL 91 3.1 mTNF- + mbIL21 + 4.1BBL 94 0.6

    TABLE-US-00013 TABLE 13 Jurkat + Transgene Average STDEV Parental 80 6.1 mbIL21 + 4.1BBL 91 0.6 mTNF- + mbIL21 + 4.1BBL 92 2.0

    TABLE-US-00014 TABLE 14 Peer + Transgene Average STDEV Parental 83.5 6.1 mbIL21 + 4.1BBL 91 0.6

    [0139] In addition, as a result of culturing while increasing the number of restimulations with HuT78 into which the mTNF-/mbIL-21/4-1BBL gene was introduced, the viability of natural killer cells shows high viability of about 90% or higher even when the number of restimulations was increased (Table 15, FIG. 3e).

    TABLE-US-00015 TABLE 15 Culturing day Day 32 Day 42 Day 60 Day 70 Average 96.0 93.5 97.5 91.5 STDEV 1.4 0.7 0.7 4.9

    [0140] Through this, it was confirmed that since the natural killer cells maintain high viability even if the cultivation is continued for a long period of time, the expanded cultivation of natural killer cells is possible for a long period of time.

    Experimental Example 2. Confirmation of Purity of Natural Killer Cells

    [0141] Natural killer cells cultured for 21 days or natural killer cells cultured by repeated restimulation were collected, centrifuged at 1,200 rpm for 5 minutes, and the culture solution was removed by suction. The number of cells was measured by diluting with 1 mcustom-character of FACS buffer, and was diluted with FACS butter to be 510.sup.6 cells/mcustom-character. 100 custom-character of the diluted cell solution was added to each of 5 mcustom-character FACS tubes (Falcon, 352052), and the phenotype was analyzed with the following antibodies: [0142] Tube 1: Anti-human CD3-FITC (BD Pharmingen, 555332), anti-human CD16-PE (BD Pharmingen, 555407), anti-human CD56-BV421 (BD Pharmingen, 562751) [0143] Tube 2: Anti-human CD14-FITC (BD Pharmingen, 555397), anti-human CD19-PE (BD Pharmingen, 555413), anti-human CD3-BV421 (BD Pharmingen, 562438) [0144] Tube 3: Anti-human CD3-FITC, anti-human NKG2D-PE (R&D system, FAB139P), anti-human CD56-BV421 [0145] Tube 4: Anti-human CD3-FITC, anti-human NKp30-PE (BD Pharmingen, 558407), anti-human CD56-BV421 [0146] Tube 5: Anti-human CD3-FITC, anti-human NKp44-PE (BD Pharmingen, 558563), anti-human CD56-BV421 [0147] Tube 6: Anti-human CD3-FITC, anti-human NKp46-PE (BD Pharmingen, 557991), anti-human CD56-BV421 [0148] Tube 7: Anti-human CD3-FITC, anti-human DNAM-1-PE (BD Pharmingen, 559789), anti-human CD56-BV421 [0149] Tube 8: Anti-human CD3-FITC, anti-human CXCR3-PE (BD Pharmingen, 557185), anti-human CD56-BV421 [0150] Tube 9: Anti-human CD3-FITC, PE mouse IgG1 isotype control (BD Pharmingen, 555749), anti-human CD56-BV421 [0151] Tube 10: FITC mouse IgG1 isotype control (BD Pharmingen, 555748), PE mouse IgG1 isotype control, BV421 mouse IgG1 isotype control (BD Pharmingen, 562438)

    [0152] In tube 1 described above, the anti-human CD56 was carried out by selecting one of three fluorescence, and accordingly, the same fluorescence was selected for CD3 of tube 2, CD56 of tubes 3 to 9, and isotype control of tube 10.

    [0153] The tubes were stained at refrigeration temperature for 30 minutes. Then, 2 mcustom-character of FACS buffer was added to the stained cells, and centrifuged at 1,500 rpm for 3 minutes. The supernatant was removed, 2 mcustom-character of FACS buffer was added again, and it was centrifuged at 2,000 rpm for 3 minutes. The supernatant was removed again, 200 custom-character of cytofix buffer (fixation buffer, BD, 554655) was added and suspension was performed, and then FACS LSRII Fortessa (BD Biosciences) was used for confirmation of cells and investigation of purity and various phenotypes.

    [0154] After co-culturing CD3() cells isolated from cord blood mononuclear cells with HuT78 cell lines into which the gene was introduced, natural killer cells were checked and purity was analyzed, and the result confirmed a high content of natural killer cells (CD3CD56+) of 90% or higher in all conditions regardless of whether or not the gene was introduced (Table 16, FIG. 4a).

    TABLE-US-00016 TABLE 16 HuT78 + Transgene Average STDEV Parental 92.4 9.6 mTNF- 96.8 2.5 mbIL-21 98.6 0.9 OX40L 95.7 3.6 4.1BBL 98 1.8 mTNF- + OX40L 97.2 2.5 mTNF- + 4.1BBL 98.6 1 mbIL-21 + OX40L 98.4 1.3 mbIL-21 + 4.1BBL 98.5 0.9 mTNF- + mbIL-21 + 44.1BBL 98.7 0.9 QD 99.3 0.5

    [0155] In the case of other H9, Jurkat, or Peer cell lines, the natural killer cells co-cultured with the cell line into which the mbIL-21/4-1BBL gene or mTNF-/mbIL-21/4-1BBL gene was introduced was confirmed and it was confirmed that its purity was maintained to be higher compared to the condition in which the gene is not introduced (Tables 17 to 19, FIGS. 4b to 4d).

    TABLE-US-00017 TABLE 17 H9 + Transgene Average STDEV Parental 91.5 4.1 mbIL21 + 4.1BBL 98.5 0.7 mTNF- + mbIL21 + 44.1BBL 99 0.3

    TABLE-US-00018 TABLE 18 Jurkat + Transgene Average STDEV Parental 88.6 6.9 mbIL21 + 4.1BBL 97.6 1.3 mTNF- + mbIL21 + 44.1BBL 97.5 0.8

    TABLE-US-00019 TABLE 19 Peer + Transgene Average STDEV Parental 79.2 14.6 mbIL21 + 4.1BBL 94.9 2.1

    [0156] In addition, for the natural killer cells cultured by increasing the number of restimulations with the cell line into which three genes, mTNF-/mbIL-21/4-1BBL, were introduced, a high content of natural killer cells (CD3CD56+) of 90% or higher up to 60 days of cultivation was confirmed (Table 20, FIG. 4e).

    TABLE-US-00020 TABLE 20 Culturing day Day 32 Day 60 Average 99.7 97.8 STDEV 0.1 0.8

    Experimental Example 3. Analysis of Active Markers of Natural Killer Cells

    [0157] In addition, after co-culturing CD3() cells isolated from cord blood mononuclear cells with feeder cells into which the gene was introduced for 21 days, receptor expression of representative natural killer cells was analyzed.

    [0158] When co-cultured with HuT78 cell lines, all CD16 was highly expressed, and all of them were highly expressed without any variation between donors under the condition of double transgenic feeder cells compared to the condition in which NKG2D, NKp30, NKp44, NKp46, and DNAM-1, which are active markers, were not introduced or the condition of single transgenic feeder cells (FIGS. 5a to 5g).

    [0159] In addition, when co-cultured with H9 cell lines, it was confirmed that the expression levels of CD16 and NKG2D, DNAM-1, CXCR3 were higher when co-cultured with feeder cells into which the mbIL-21/4-1BBL gene and three genes, mTNF-/mbIL-21/4-1BBL, were introduced compared to the condition in which the gene was not introduced. The expression of other active markers, NKp30, NKp44, and NKp46, was highly expressed without variations between donors. Therefore, it was confirmed that the double and triple transgene feeder cells are useful feeder cells capable of increasing the activity of NK cells and tumor targeting (FIGS. 6a to 6g).

    [0160] In addition, as a result of confirming the phenotype of co-cultured natural killer cells by restimulation using the Hut78 cell lines into which the three genes, mTNF-/mbIL-21/4-1BBL, were introduced, the expression of active markers, such as NKG2D, NKp44, NKp46, DNAM-1, and CXCR3, showed a tendency to decrease when cultured under the condition of being restimulated 4 times rather than 1 time. Through this, it was confirmed that as the number of restimulation increases, the culture period lengthens and may affect the expression level of some active markers (FIGS. 7a to 7b).

    Experimental Example 4. Confirmation of Cell Killing Ability of Natural Killer Cells According to the Transgene and Co-Culture of T Cells

    [0161] 110.sup.6 K562 cancer cell lines were placed in a 15 mcustom-character tube and centrifuged. The cell pellet was suspended in RPMI1640 medium to which 1 mcustom-character of 10% (v/v) FBS was added. Then, 30 custom-character of 1 mM Calcein-AM (Molecular probe, C34852) was added, and then the light was blocked with foil, and it was stained for an hour in an incubator at a temperature condition of 37 C.

    [0162] Tumor cell lines after Calcein-AM staining were washed by adding 10 mcustom-character to 15 mcustom-character of RPMI1640 medium to which 10% (v/v) FBS was added and centrifuged, and then the pellet was suspended in 10 mcustom-character of RPMI1640 medium to which 10 %(v/v) FBS was added to reach a concentration of 110.sup.5 cells/mcustom-character. For natural killer cells, 110.sup.6 cells were placed in a 15 mcustom-character tube and centrifuged, and the pellet was suspended in RPMI1640 medium to which 10% (v/v) FBS was added at the desired ratio (1:1) compared to the K562 cancer cell line. 100 custom-character of each of the prepared K562 cancer cell line and the natural killer cell line were mixed and divided into a round-bottom 96-well plate (96-well U-bottom plate, Nunc, 163320), and each well was prepared in triplicate to obtain an average value.

    [0163] 100 custom-character of the stained K562 cancer cell line was added to each Spon (Spontaneous release) well and 100 custom-character of RPMI1640 medium to which 10% (v/v) FBS was added was inserted to each. 100 custom-character of the stained K562 cancer cell lines was added to each Max (Maximum release) well and 100 custom-character of triple distilled water to which 2% (v/v) Triton-X 100 was added was inserted to each.

    [0164] In order to correct auto-fluorescence present in RPMI1640 medium to which 10% (v/v) FBS was added and RPMI1640 medium to which 2% (v/v) Triton-X 100 was added, a medium value was prepared by adding 200 custom-character of RPMI1640 medium to which 10% (v/v) FBS was added, and 100 custom-character of RPMI1640 medium to which 2% (v/v) Triton-X 100 was added was added to 100 custom-character of RPMI1640 medium to which 10% (v/v) FBS was added to prepare the value of the mixture of the two solutions. The auto-fluorescence value was corrected by adding the difference (A) obtained by subtracting the value of the mixture from the medium value to the Max (Maximum release) value.

    [0165] After blocking the light and reacting for 4 hours in an incubator at a temperature condition of 37 C., the plate was centrifuged at 2,000 rpm for 3 minutes. The supernatant was divided into 100 custom-character on a 96-well black plate (Nunc, 237108). The fluorescence value (OD.sub.480/535 nm) was measured using a fluorescent plate reader (Perkin Elmer, VICTOR X3), and the tumor cell killing ability of natural killer cells was calculated using Equation II below.


    % of killing=(Sample well average fluorescence valueSpon well average fluorescence value)/{(Max well average fluorescence value+A)Spon well average fluorescence value}100 [Equation II]

    [0166] Natural killer cells cultured with various feeder cells were reacted with K562 cancer cell lines to measure the direct cell killing ability. As a result, for all feeder cells, the cell killing ability of natural killer cells cultured under the conditions in which the mbIL-21/4-1BBL gene and the mTNF-/mbIL-21/4-1BBL gene were introduced was increased compared to the condition in which the gene was not introduced (FIGS. 8a to 8d).

    [0167] The cell killing ability of natural killer cells according to the number of restimulations of HuT78 cell lines into which the mTNF-/mbIL-21/4-1BBL gene was introduced exhibited a high killing ability up to 60 days of culture without significant difference (FIG. 8e).

    [0168] Through this, it was confirmed that compared to feeder cells without genes introduced, feeder cells into which the mbIL-21/4-1BBL gene or mTNF-/mbIL-21/4-1BBL gene was introduced can be used usefully for in vitro expansion culture of high-purity natural killer cells having high activity as well as excellent cell killing ability.

    Embodiment 4. Animal Experiment

    Embodiment 4.1. Culture of Natural Killer Cells Using Transgenic T Feeder Cells

    [0169] When culturing natural killer cells, 500 or 1000 IU/mL of IL-2 (2 (Proleukin Injection, Novartis Korea) and 10 ng/mL of OKT-3 (eBioscience, 16-0037-85) were placed in a culture plastic plate, and on day 0 of cultivation, CD3() cord blood mononuclear cells or peripheral blood mononuclear cells and transgenic T cells were added at a ratio of 1:2.5, CellGro medium containing 2% (v/v) human plasma was added, and stationary culture was carried out for 4 days in an incubator at 37 C. 1000 IU/mL of IL-2 was used for cord blood mononuclear cells and 500 IU/mL for peripheral blood mononuclear cells.

    [0170] Thereafter, the cultivation of cord blood-derived natural killer cells was carried out by the following procedure: On the 4.sup.th day of cultivation, after adding the same amount of CellGro medium containing 1 v/v % human plasma and 1000 IU/mL of IL-2, stationary culture was carried out again. Then, the number of cells was measured at intervals of 2 to 3 days, CellGro medium containing 1 V/V % human plasma and 1000 IU/mL of IL-2 was added to reach 110.sup.6 cells/mL, and it was cultured until the 14.sup.th day. On the 14.sup.th day of cultivation, transgenic T feeder cells were restimulated at a ratio of 1:2.5 and cultured in CellGro medium containing 1 V/V % human plasma, OKT3, and IL-2. Then, the number of cells was measured at intervals of 2 to 3 days, CellGro medium containing 1 V/V % human plasma and 1000 IU/mL of IL-2 was added to reach 110.sup.6 cells/mL, and it was additionally cultured for 14 days, culturing cells for a total of 28 days.

    [0171] Thereafter, the cultivation of peripheral blood-derived natural killer cells is as follows: On the 4.sup.th day of cultivation, after adding the same amount of CellGro medium containing 1 V/V % human plasma and 500 IU/mL of IL-2, stationary culture was carried out again. Then, the number of cells was measured at intervals of 2 to 3 days, CellGro medium containing 1 V/V % human plasma and 500 IU/mL of IL-2 was added to reach 110.sup.6 cells/mL, and it was cultured until the 11.sup.th day. On the 11.sup.th day of cultivation, transgenic T feeder cells were restimulated at a ratio of 1:2.5 and cultured in CellGro medium containing 1 V/V % human plasma, OKT3, and IL-2. Then, the number of cells was measured at intervals of 2 to 3 days, CellGro medium containing 1 V/V % human plasma and 1000 IU/mL of IL-2 was added to reach 110.sup.6 cells/mL, and it was additionally cultured for 8 to 10 days, culturing cells for a total of 19 to 21 days.

    [0172] The cultured cells are suspended in a freezing medium to reach 110.sup.6 cells/mL, frozen using a temperature-controlled cell freezer, and stored in liquid nitrogen.

    [0173] As a result of comparing the proliferation rate of cultured natural killer cells, CB-enFeeder proliferated approximately 80,000 times and PBMC-enFeeder proliferated 50,000 times, showing no significant difference (Table 21).

    TABLE-US-00021 TABLE 21 Average STDEV CB-enFeeder 79288.3 37381.0 PBMC-enFeeder 53649.3 16827.9

    Embodiment 4.2. Efficacy Evaluation of the Raji Animal Model

    [0174] For the Raji-luci cell lines, cancer cells were collected on the last day of culture, the cell concentration was adjusted to 510.sup.5 cells/mL using PBS, and then 0.2 mL (110.sup.5 cells/mouse) per mouse was injected into the tail vein. Natural killer cells were injected into the tail vein at 210.sup.7 cells/200 L, and Rituxan (hereinafter RTX, Mabthera Injection, Roche Korea) was diluted to a concentration of 0.01 g/100 L using PBS and 100 L was injected under the skin of the weakened area between the scapular region and the chest wall of the mouse. NK cells were administered a total of 6 times to the tail vein using a fixator the day after cancer cell transplantation, and RTX was administered once under the skin (Table 22, FIG. 9a).

    TABLE-US-00022 TABLE 22 Number of Group Average Administration Volume (l) animals 1 Frozen culture medium + IgG 0.01 g/head i.v + s.c 200 + 100 10 2 RTX 0.01 g/head s.c 100 10 3 PBMC-enFeeder NK 2 10.sup.7 cells/head i.v 200 10 4 CB-eFeeder NK 2 10.sup.7 cells/head i.v 200 10 5 PB-eFeeder NK + RTX i.v + s.c 200 + 100 10 6 CB-eFeeder NK + RTX i.v + s.c 200 + 100 10

    [0175] The observation of all animals was carried out twice a day and general symptoms and dead animals were observed, and after observing the death status, the median survival time of the frozen medium control group, natural killer cells, and RTX-treated group was calculated to evaluate the effect of prolonging the viability. After transplantation of the Raji-luci cell line, dead animals were observed over 26 to 122 days in two types of groups, natural killer cells and RTX alone and co-administration, and the median survival time until the last day (day 122) was 48.5 days, 43 days, and 47 days in the group administered with RTX, PBMC-enFeeder, and CB-enFeeder alone compared to 30 days for the frozen medium control group. The median survival time in the PBMC-enFeeder+RTX and CB-enFeeder+RTX co-administration group was shown to be at least 55 days and 75.5 days (Table 23, FIG. 9b).

    TABLE-US-00023 TABLE 23 Raji- Frozen RTX + RTX + luci culture PBMC- CB- PBMC- CB- model medium RTX enFeeder enFeeder enFeeder enFeeder Average 29.5 48.5 43 47 55 75.5 survival rate

    Embodiment 4.3. Efficacy Evaluation of the Ramos Animal Model

    [0176] For the Ramos cell lines, cancer cells were collected on the last day of cultivation, the cell concentration was adjusted to 510.sup.6 cells/mL using PBS, and then 0.2 mL (110.sup.6 cells/mouse) per mouse was injected into the tail vein. Natural killer cells were injected into the tail vein at 210.sup.7 cells/200 L, and RTX was diluted to a concentration of 0.03 g/100 L using PBS and 100 L was injected under the skin of the weakened area between the scapular region and the chest wall of the mouse. Natural killer cells were administered a total of 6 times to the tail vein using a fixator from the fourth day of cancer cell transplantation, and RTX was administered 6 times to the tail vein from the third day of cancer cell transplantation (Table 24, FIG. 10a).

    TABLE-US-00024 TABLE 24 Number of Group Amount Administration Volume (l) animals 1 Frozen culture medium + IgG 0.3 g/head i.v + i.v 200 + 100 10 2 RTX 0.3 g/head i.v 100 10 3 PBMC-enFeeder NK 2 10.sup.7 cells/head i.v 200 10 4 CB-eFeeder NK 2 10.sup.7 cells/head i.v 200 10 5 PB-eFeeder NK + RTX i.v + i.v 200 + 100 10 6 CB-eFeeder NK + RTX i.v + i.v 200 + 100 10

    [0177] The observation of all animals was carried out twice a day and general symptoms and dead animals were observed, and after observing the death status, the median survival time of the frozen medium control group, natural killer cells, and RTX-treated group was calculated to evaluate the effect of prolonging the viability. After transplantation of the Ramos cell line, dead animals were observed over 34 to 110 days in two types of groups, natural killer cells and RTX alone and co-administration, and the median survival time until the last day (day 124) was 49.5 days, 42 days, and 42.5 days in the group administered with RTX, PBMC-enFeeder, and CB-enFeeder alone compared to 31 days for the frozen medium control group. The median survival time in the PBMC-enFeeder+RTX and CB-enFeeder+RTX co-administration group was shown to be at least 63.5 days and 87.5 days (Table 25, FIG. 10b).

    TABLE-US-00025 TABLE 25 Frozen RTX + RTX + Ramos culture PBMC- CB- PBMC- CB- model medium RTX enFeeder enFeeder enFeeder enFeeder Average 31 49.5 42 42.5 63.5 87.5 survival rate

    [0178] As described above, specific parts of the present invention have been described in detail, and it is obvious to a PHOSITA that these specific technologies are only preferred embodiments, and the scope of the present invention is not limited thereto. Accordingly, it will be considered that the substantial scope of the present invention is defined by the appended claims and their equivalents.