METHODS FOR DIFFERENTIATION OF PANCREATIC EXOCRINE CELLS FROM HUMAN INDUCED PLURIPOTENT STEM CELLS
20240084262 ยท 2024-03-14
Assignee
Inventors
- Dhruv Sareen (Porter Ranch, CA)
- Stephen Pandol (Los Angeles, CA)
- Syairah Hanan Shaharuddin (Sun Valley, CA, US)
- Victoria Wang (San Diego, CA, US)
- Michael Edison P. Ramos (Perris, CA, US)
- Aurelia Lugea (Los Angeles, CA, US)
- Richard T. Waldron (Los Angeles, CA, US)
Cpc classification
C12N2501/385
CHEMISTRY; METALLURGY
C12N2501/119
CHEMISTRY; METALLURGY
C12N2506/45
CHEMISTRY; METALLURGY
C12N2500/90
CHEMISTRY; METALLURGY
C12N5/0677
CHEMISTRY; METALLURGY
C12N2501/16
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
C12N2501/41
CHEMISTRY; METALLURGY
C12N2501/155
CHEMISTRY; METALLURGY
International classification
C12N5/00
CHEMISTRY; METALLURGY
C12M3/06
CHEMISTRY; METALLURGY
C12M1/12
CHEMISTRY; METALLURGY
Abstract
The present invention provides for methods of differentiating induced pluripotent stem cells into pancreatic progenitor cells, pancreatic ductal cells, pancreatic endocrine cells, pancreatic acinar cells, and pancreatic organoids. Cells created by these methods are also provided. Further provided are disease models and methods of drug screening.
Claims
1. A method of differentiating induced pluripotent stem cells (iPSCs) into iPSC-derived pancreatic progenitor cells, comprising: seeding induced pluripotent stem cells (iPSCs) on a solid medium coated with solubilized basement membrane preparation in the presence of serum-free, stabilized cell culture medium, and optionally a ROCK inhibitor; culturing the cells in a first culture medium comprising a first base medium, Activin A, CHIR99021, and a ROCK Inhibitor; culturing the cells in a second culture medium comprising the first base medium and Activin A, and bFGF (FGF-2); culturing the cells in a third culture medium comprising the first base medium and FGF10, NOGGIN, and CHIRR99021; culturing the cells in a fourth culture medium comprising a second base medium and FGF10, NOGGIN, All-trans Retinoic Acid, and SANT1, wherein iPSC-derived pancreatic progenitor cells are produced.
2. The method of claim 1, wherein Activin A, CHIR99021, and the ROCK Inhibitor in the first culture medium is at a concentration of about 100 ng/ml Activin A, about 2 uM CHIR99021 and about 10 uM of the ROCK inhibitor, or wherein Activin A, and bFGF (FGF-2) in the second culture medium is at a concentration of about 100 ng/ml Activin A and about 5 ng/ml bFGF (FGF-2), or wherein FGF10, NOGGIN, and CHIRR99021 in the third culture medium is at a concentration of about 50 ng/ml FGF10, about 50 ng/ml NOGGIN and about 0.25 uM CHIRR99021, or wherein FGF10, NOGGIN, All-trans Retinoic Acid, and SANT1 in the fourth culture medium is at a concentration of about 50 ng/ml FGF10, about 50 ng/ml NOGGIN, about 2 uM All-trans Retinoic Acid, and about 0.25 uM SANT1, or any combination thereof.
3. (canceled)
4. (canceled)
5. (canceled)
6. The method of claim 1, wherein the cells are cultured in the first culture medium for about 1 day, or wherein the cells are cultured in the second culture medium for about 1 to 2 days, or wherein the cells are cultured in the third culture medium for about 1 to 2 days, or wherein the cells are cultured in the fourth culture medium for about 1 to 2 days, or any combination of the above.
7. (canceled)
8. (canceled)
9. (canceled)
10. A method of differentiating induced pluripotent stem cells (iPSCs) into induced pancreatic (iPan) ductal cells, comprising: performing the method of claim 1 or providing iPSC-derived pancreatic progenitor cells; seeding the iPSC-derived pancreatic progenitor cells on a solid medium coated with solubilized basement membrane preparation in the presence of a fifth culture medium comprising a second base medium and a ROCK inhibitor; and culturing the cells in a sixth culture medium comprising the second base medium and FGF10, EGF, and sDLL-1, wherein iPan ductal cells are produced.
11. The method of claim 10, further comprising dissociating the iPSC-derived pancreatic progenitor cells before seeding the iPSC-derived pancreatic progenitor cells on the solid medium.
12. The method of claim 10, wherein the ROCK inhibitor in the fifth culture medium is at a concentration of about 10 uM or wherein FGF10, EGF, and sDLL-1 in the sixth culture medium is at a concentration of about 25 ng/ml FGF10, about 50 ng/ml EGF, and about 50 ng/ml sDLL-1.
13. (canceled)
14. The method of claim 10, wherein the cells are cultured in the fifth culture medium for about 1 day, or wherein the cells are cultured in the sixth culture medium for about 16 days, or both.
15. (canceled)
16. A method of differentiating induced pluripotent stem cells (iPSCs) into induced pancreatic endocrine cells, comprising: performing the method of claim 1; continuing to culturing the cells in the fourth culture medium comprising a second base medium and FGF10, NOGGIN, All-trans Retinoic Acid, and SANT1, for at least 2 additional days; seeding the iPSC-derived pancreatic progenitor cells on a solid medium coated with solubilized basement membrane preparation in the presence of a fifth culture medium comprising a second base medium and a ROCK inhibitor; culturing the cells in a sixth culture medium comprising the second base medium and noggin, EGF, and nicotinamide, OR providing iPSC-derived pancreatic progenitor cells that have been cultured in the fourth culture medium comprising a second base medium and FGF10, NOGGIN, All-trans Retinoic Acid, and SANT1, for at least 2 additional days; seeding the iPSC-derived pancreatic progenitor cells on a solid medium coated with solubilized basement membrane preparation in the presence of a fifth culture medium comprising a second base medium and a ROCK inhibitor; culturing the cells in a sixth culture medium comprising the second base medium and noggin, EGF, and nicotinamide, wherein pancreatic endocrine cells are produced.
17. A method of producing pancreatic organoids comprising pancreatic ductal cells, comprising: performing the method of claim 1 and dissociated the iPSC-derived pancreatic progenitor cells, or providing dissociated iPSC-derived pancreatic progenitor cells; seeding the cells into a solubilized basement membrane preparation and plating the seeded cells onto a solid medium; and culturing the cells in a sixth culture medium comprising the second base medium and FGF10, EGF, and sDLL-1.
18. The method of claim 17, wherein the iPSC-derived pancreatic progenitor cells are resuspended in the solubilized basement membrane preparation at a density of about 2 million cells/ML.
19. The method of claim 17, wherein plating the seeded cells onto a solid medium comprises plating about 104, of cell suspension onto each solid medium, or wherein the cells are cultured in the sixth culture medium for at least 2 weeks and given the sixth culture medium about every 2-3 days, or wherein the solid medium is a U-bottom multi-well plate, or any combination thereof.
20. (canceled)
21. (canceled)
22. A method of differentiating induced pluripotent stem cells (iPSCs) into iPSC derived pancreatic acinar cells, comprising: performing the method of claim 1, or providing iPSC-derived pancreatic progenitor cells seeding the iPSC-derived pancreatic progenitor cells into a solubilized basement membrane preparation and plating the seeded cells onto a solid medium; culturing the cells in a seventh culture medium comprising a second base medium and XXI, FGF10, Noggin, Nicotinamide, and Murine Wnt3a, wherein iPSC derived pancreatic acinar cells are produced.
23. The method of claim 22, wherein XXI, FGF10, Noggin, Nicotinamide, and Murine Wnt3a in the seventh culture medium is at a concentration of about 20 ng/mL FGF10, about 25 ng/mL Wnt3a, about 1 uM XXI, about 50 ng/mL Noggin, about 10 mM Nicotinamide.
24. A method of producing organoids comprising pancreatic acinar cells, comprising: performing the method of claim 22 and dissociated the iPSC-derived pancreatic acinar cells, or providing dissociated iPSC-derived pancreatic acinar cells; seeding the iPSC-derived pancreatic acinar cells into a solubilized basement membrane preparation and plating the seeded cells onto a solid medium; culturing the cells in an eighth culture medium comprising a second base medium and FGF10, Noggin, Nicotinamide, and Murine Wnt3a.
25. The method of claim 24, wherein seeding the iPSC-derived pancreatic acinar cells comprises seeding at a concentration of about 1-310{circumflex over ()}6 cells per about 1040 L of the solubilized basement membrane preparation, or wherein plating the seeded cells onto a solid medium comprises plating in about 15 L bubbles and allowing the plated cells to sit for about 15 minutes prior to culturing the cells in the eighth culture medium, or wherein the cells are cultured in the eighth culture medium for about 44 days, and given the eighth culture medium about every other day, or wherein the solid medium is a round-bottom multi-well plate, or any combination thereof.
26. (canceled)
27. (canceled)
28. (canceled)
29. The method of claim 22, further comprising inducing PTF1A expression in the iPSC-derived pancreatic progenitor cells.
30. The method of claim 29, wherein inducing PTF1A expression in the iPSC-derived pancreatic progenitor cells comprises transducing the iPSC, pancreatic progenitor cells, or both with a lentivirus vector comprising a nucleic acid encoding PTF1A.
31. A method of claim 1, wherein the solubilized basement membrane preparation is extracted from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma, or is MATRIGEL matrix, or wherein the ROCK inhibitor is Y27632 ROCK Inhibitor, or wherein serum-free, stabilized cell culture medium is mTeSR plus medium, or any combination thereof.
32. (canceled)
33. (canceled)
34. (canceled)
35. A method of claim 1, wherein the first base medium comprises an agent from the group consisting of MCDB 131, Glutamax, Vitamin C, BSA, sodium bicarbonate, antibiotic, and combinations thereof, wherein the second base medium comprises an agent from the group consisting of DMEM, antibiotic, B27 without vitamin A, vitamin C and combination thereof.
36. A method of claim 1, wherein the first base medium comprises MCDB 131, Glutamax, Vitamin C, BSA, sodium bicarbonate, and antibiotic, or wherein the second base medium comprises DMEM, antibiotic, B27 without vitamin A, and vitamin C, or both.
37. The method of claim 35, wherein the Glutamax, Vitamin C, BSA, sodium bicarbonate, and antibiotic are at a concentration of about 1Glutamax, about 1Antibiotic, about 0.5% Bovine Serum Albumin, about 1.5 mg/ml Sodium Bicarbonate and about 250 uM Vitamin C.
38. (canceled)
39. A method of claim 35, wherein the second base medium comprises DMEM, antibiotic, B27 without vitamin A, and vitamin C.
40. The method of claim 35, wherein the antibiotic, B27 without vitamin A, and uM vitamin C are at a concentration of about 1antibiotic, about 1B27 without vitamin A, and about 250 uM vitamin C.
41. A method of claim 1, wherein the antibiotic is a Pen-Strep Antibiotic.
42. An induced pluripotent stem cell (iPSC) derived pancreatic progenitor cell made by a method of claim 1.
43. An induced pluripotent stem cell (iPSC) derived iPan ductal cell made by a method of claim 10.
44. An induced pluripotent stem cell (iPSC) derived organoid comprising pancreatic ductal cells made by a method of claim 17.
45. An induced pluripotent stem cell (iPSC) derived pancreatic acinar cell made by a method of claim 22.
46. An induced pluripotent stem cell (iPSC) derived organoid comprising pancreatic acinar cells made by a method of claim 24.
47. A model, comprising: a population of cells comprising cells selected from the group consisting of pancreatic progenitor cells derived from induced pluripotent stem cells (iPSCs), pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells, pancreatic acinar cells derived from iPSCs, pancreatic acinar cells derived from pancreatic progenitor cells, an organoid comprising pancreatic acinar cells derived from iPSCs, an organoid comprising pancreatic acinar cells derived from pancreatic progenitor cells, an organoid comprising pancreatic ductal cells derived from iPSCs, an organoid comprising pancreatic ductal cells derived from pancreatic progenitor cells, and combinations thereof; and a fluidic device, or a cell culture plate, or a multi-well culture plate, wherein the test agent and the population of cells are in contact in a fluidic device the cell culture plate, or the multi-well culture plate.
48. The model of claim 47, wherein the fluidic device, the cell culture plate, or the multi-well culture plate is a Transwell system, or wherein the fluidic device is a microfluidic device, or wherein the microfluidic device is an organ chip.
49. (canceled)
50. (canceled)
51. A device, comprising: a membrane comprising a top surface and a bottom surface; a first channel in fluidic communication with the top surface of the membrane; a second channel in fluidic communication with the bottom surface of the membrane, wherein the first and second channels each comprises a surface that is parallel to the membrane; a first population of cells selected from the group consisting of pancreatic progenitor cells derived from induced pluripotent stem cells (iPSCs), pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells, pancreatic acinar cells derived from iPSCs, and pancreatic acinar cells derived from pancreatic progenitor cells in the first channel or the second channel; and optionally, a second population of cells in the first channel or the second channel, wherein the first population of cells and the second population of cells are in different channels, and wherein the first population of cells and the second population of cells are not the same type of cells, optionally, wherein the second population of cells are selected from the group consisting of endocrine cells, stellate cells endothelial cells, pancreatic progenitor cells derived from induced pluripotent stem cells (iPSCs), pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells, pancreatic acinar cells derived from iPSCs, and pancreatic acinar cells derived from pancreatic progenitor cells.
52. (canceled)
53. A device of claim 51, further comprising: at least one inlet port adapted for fluid entering the at least one inlet port; and at least one outlet port adapted for fluid exiting the at least one outlet port.
54. A device, comprising: a top chamber; a bottom chamber; a membrane between the top chamber and the bottom chamber; a first channel fluidically coupled to the top chamber; a second channel fluidically coupled to the bottom chamber; a first population of cells selected from the group consisting of pancreatic progenitor cells derived from induced pluripotent stem cells (iPSCs), pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells, pancreatic acinar cells derived from iPSCs, and pancreatic acinar cells derived from pancreatic progenitor cells in the first channel or the second channel; and optionally, a second population of cells in the first channel or the second channel, wherein the first population of cells and second population of cells are in different channels, and wherein the first population of cells and the second population of cells are not the same type of cells, optionally, wherein the second population of cells are selected from the group consisting of endocrine cells, stellate cells endothelial cells, pancreatic progenitor cells derived from induced pluripotent stem cells (iPSCs), pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells, pancreatic acinar cells derived from iPSCs, and pancreatic acinar cells derived from pancreatic progenitor cells.
55. (canceled)
56. A device of claim 51, wherein the first and second channels comprise polydimethylciloxane or wherein the first channel and the second channel are microfluidic channels.
57. (canceled)
58. An organ chip device, comprising: a first population of cells selected from the group consisting of pancreatic progenitor cells derived from induced pluripotent stem cells (iPSCs), pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells, pancreatic acinar cells derived from iPSCs, and pancreatic acinar cells derived from pancreatic progenitor cells; optionally, a second population of cells; and a membrane separating the first population of cells and the second population of cells, wherein the first population of cells and the second population of cells are not the same type of cells, optionally, wherein the membrane comprises polydimethylciloxane.
59. (canceled)
60. A device of claim 51, further comprising one or more gels and the population of cells having been seeded on top of or into the one or more gels.
61. A device of claim 51, wherein the first population of cells, or the second population of cells or both are patient specific or wherein the first population of cells, or the second population of cells or both express a fluorescent reporter.
62. (canceled)
63. A method of assessing a test agent, comprising: contacting the test agent to a device of claim 51, wherein the device comprises a population of cells selected from the group consisting of pancreatic progenitor cells derived from induced pluripotent stem cells (iPSCs), pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells, pancreatic acinar cells derived from iPSCs, and pancreatic acinar cells derived from pancreatic progenitor cells, and optionally, a second population of cells; measuring a parameter; and assessing the test agent based on the measured parameter.
64. The method of claim 63, wherein measuring the parameter comprises measuring a phenotype of interest, expression level of a gene of interest, or expression level of a protein of interest, or combinations thereof, or wherein contacting the population of cells with the test agent comprises culturing the population of cells in the presence of culture media flowing through the device, or wherein the first population of cells or the second population of cells, or both are patient specific and the method models patient-specific parameters.
65. (canceled)
66. (canceled)
67. A method of producing a device of claim 58, comprising: seeding the first population of cells on one surface of the membrane in the device; and optionally, seeding second population of cells on the other surface of the membrane in the device; OR seeding the first population of cells in one chamber in the device; and optionally, seeding the second population of cells in the other chamber in the device.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0067] Exemplary embodiments are illustrated in referenced figures. It is intended that the embodiments and figures disclosed herein are to be considered illustrative rather than restrictive.
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
DESCRIPTION OF THE INVENTION
[0086] All references cited herein are incorporated by reference in their entirety as though fully set forth. Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0087] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described. For purposes of the present invention, the following terms are defined below.
[0088] As used herein the term about when used in connection with a referenced numeric indication means the referenced numeric indication plus or minus up to 5% of that referenced numeric indication, unless otherwise specifically provided for herein. For example, the language about 50% covers the range of 45% to 55%. In various embodiments, the term about when used in connection with a referenced numeric indication can mean the referenced numeric indication plus or minus up to 4%, 3%, 2%, 1%, 0.5%, or 0.25% of that referenced numeric indication, if specifically provided for in the claims.
[0089] As used herein the term organ chip (also referred to as organ on chip) refers to a microfluidic culture device are capable of recapitulating the microarchitecture and functions of living organs
[0090] Described herein, our invention presents a model of diseases and of the pancreas itself which offers the ability to observe real time changes. We can recapitulate in this in multiple formats which allow for live cell assays and for each patient in a chip format. This is difficult to model in animals since pancreatitis patients, for example, have a complex set of polygenic mutations. Using patient iPSC-derived pancreatic exocrine cells on a tissue-chip we can replay the disease process ex vivo and discover new class of drugs that can treat the disease early during progression. In addition, our model is not as time sensitive or resource-limited as primary cell culture, while still being a human cell model as opposed to an animal cell model. Finally, our use of iPSCs allows for patient-specific studies.
[0091] Our lab has successfully developed a process for differentiating mature and functional pancreatic ductal cells from iPSCs. The ductal differentiation protocol has been improved further with knowledge gained from the development of pancreatic islet differentiation protocols to better mimic embryonic development of pancreatic ductal epithelium. Terminally differentiated pancreatic endocrine and pancreatic acinar and ductal cells emerge at different points during transition through the pancreatic progenitor phase during embryonic pancreatic development. The tip further develops to acinar cells, while the trunk gives rise to pancreatic ductal and/or endocrine cells. Notch signaling promotes differentiation towards a ductal fate while Notch inhibition promotes pancreatic endocrine specification. Therefore, the terminal maturation phase includes supplementing the media with a soluble DLL1, which is a Notch receptor pathway modulating ligand.
[0092] We have shown that pancreatic progenitors can be frozen and thawed for reliable iPan Ductal differentiation across multiple 2D and 3D culture formatsplanar, organoid, Transwell and Tissue chips.
[0093] There is utility in establishing a differentiation protocol in multiple formats as each format has its own advantages in terms of applications. Therefore, this gives us the freedom to explore different approaches to investigations of ductal-differentiated cells in various pancreatic disease models. Our iPan Ductal cells can be used for multiple applications. The planar 2D format is ideal for studies requiring testing of numerous potential drugs and pathway regulators in a high-throughput screen. The effects of many treatments can be efficiently screened in 96-, 384-, 1536 well plates. By such an approach, we can test for thousands of compounds that can potentially remediate any loss of CFTR protein Nevertheless, static planar cultures may not always accurately recapitulate exocrine pancreatic disease pathophysiology, as they do not promote formation of three-dimensional structures and thus maybe inadequate for performing certain functional assays. We have successfully modeled growth of pancreatic exocrine cells in organoids, Transwells and a dynamic Tissue-chip system that allows cells to polarize and better mimic human ductal biology architecturally and functionally.
[0094] Forskolin-induced swelling has been previously used as an assay to measure the function of CFTR, an ion channel located in the apical membrane of pancreatic ductal epithelium cells. CFTR mediates the transport of water and chloride regulated via cAMP signaling, and organoids with a lumen swell when forskolin, an activator of adenylyl cyclase is introduced.
[0095] This phenomenon cannot not be visually observed in planar cultures due to the lack of polarization of the membrane since the cells do not aggregate to form a closed structure with a lumen.
[0096] Here, we demonstrated growth of organoids in 96-well plates with potential applicability for high throughput screening studies to screen potential CFTR correctors or other compounds. We have defined a new set of minimal conditions for bulk production of such organoid cultures, which we have also analyzed by other assays including immunocytochemistry of sectioned organoids. Most common CFTR mutations have been categorized into 6 classes and potential drugs have been used in trials to target each class. Our 3D model system would be an effective way to test whether these drugs improve CFTR function, as measured, e.g., by organoid swelling. Recently, Dekkers et al reported that in vitro swelling of organoids obtained from rectal epithelium of CP patients can be correlated to clinical biomarkers such as sweat chloride concentration measurements, which may help to identify subjects with CF who will respond well to CFTR-targeted drugs. Our procedure for reprogramming patient peripheral blood mononuclear cells to iPSCs and further specifying iPan Ductal cells may also enable us to select the most efficacious drugs for each CP patient.
[0097] The dynamic chip platform (tissue-chip (organ-on-chip) technologies) is especially useful tool to study CFTR function. By flushing media at a flow rate like that in the human pancreatic ducts, changes in pH levels and bicarbonate and chloride ions can be measured in the trans-epithelial conditioned media. In such a platform, which incorporates distinct chambers separated by semipermeable artificial membranes. These systems also allow for iPan ductal to be experimentally co-cultured together with other relevant cell types such as pancreatic acinar, endocrine, stellate, and/or endothelial cells, allowing close contact and providing for crucial interchanges of biochemical information between cell types. Kyu Shik et al isolated primary pancreatic ductal tissue by micro dissecting patient-derived human pancreatic ducts from pancreatic remnant cell pellets and then co-cultured pancreatic ductal epithelium (with mutated CFTR) with islets. However, given that CP is a complex disease and obtaining primary patent-derived ductal tissue from a range of patient genotypes is not a scalable approach, our iPSC platform described here allows us to circumvent some of these issues. Responses to other cells in the system can potentially be measured from secretions; and/or changes in gene expression in a particular cell type. We believe that some of the dynamic properties of in vivo systems may be possible to mimic using co-cultures that combine distinct cell types grown in separate compartments, thereby allowing experiments such as adding drug compounds or secretagogues to the apical side (top channel) and collecting effluent from the basal side (bottom channel) to measure iodide, pH, and bicarbonate levels.
[0098] Overall, we have delineated a simple and reliable method to differentiate iPSC-derived pancreatic ductal cells from start to finish that is applicable across different patient-derived iPSC lines and demonstrated their adaptation to multiple 2D and 3D cell culture platforms including planar cultures, organoids, Transwell and Tissue-chips. Our clean workflow of procedures incorporates steps for characterizing distinct stages and functional assays to test for ductal cell behaviors in healthy and disease settings. We have reprogrammed iPSCs from a range of chronic pancreatitis patients both with and without specific genetic alterations related to hereditary CP and expect to further explore the disease pathophysiology in future studies using these 2D and 3D cell formats developed here.
[0099] Impacts of monogenic and polygenic genetic variants associated with pancreatitis patient-specific iPSC lines can be assessed by utilizing the described platform. Ultimately, the ductal disease of iPan Ductal cells can be rescued by high-throughput screening for identifying novel therapeutics.
[0100] Thus, this novel platform can be now applied to study pancreatic ductal diseases and to discover and develop novel treatments.
[0101] We have also developed novel protocols for production of acinar cells, which show functionality in both adherent and organoid formats.
[0102] We have determined that EGF, FGF (FGF10) and Notch signaling pathway modulation (specifically adding sDLL1) after formation of definitive endoderm and then pancreatic endoderm drives pancreatic ductal cell fate from hiPSCs. We have determined that Wnt (Wnt3a), FGF (FGF10) and Notch signaling pathway modulation (specifically blocking Notch signaling with XXI) after formation of definitive endoderm and then pancreatic endoderm drives pancreatic acinar cell fate from hiPSCs. Further, addition of Noggin and Nicotinamide (promotes cell survival and differentiation) increased efficiency of acinar differentiation.
[0103] These differentiated cells can be used to model these diseases, and test gene therapy and other forms of treatment. This allow the study of the pancreatic exocrine development mechanisms, as well as the drivers of the diseases and potential cures. iPSC-generated cells also can be used for generating patient-specific treatments, because cell lines can be made for each patient.
[0104] Pancreatic ductal and endocrine cells develop from a pool of bipotent trunk progenitors where the bifurcation is mediated by notch signaling. Notch signaling promotes differentiation towards ductal fate while EGF signaling induces proliferation of ductal epithelial cells. Day 8 of differentiation indicates an emergence of SOX9.sup.+PDX1.sup.+ bipotent trunk cell population, at which point, activating high notch signaling pushes it towards ductal cells. Determining the temporal window of notch activation is critical as activating it too late could result in a higher ratio of C-Peptide.sup.+ endocrine cells.
[0105] In the past, optimization of experiments is slow and arduous as it takes a month long to expand and differentiate iPSCs plus an additional week to characterize cells. Therefore, the present methods are efficient and allows us to bulk differentiate and cryopreserve pancreatic progenitors. This also removes the factor of batch-to-batch differentiation variability and provides the flexibility to seed progenitors for planar or organoid differentiation towards pancreatic endocrine or exocrine lineage.
[0106] At day 11, midway through phase 3, some groups were single cell dissociated and reseeded at 30% confluency. Dissociation shows a significant decrease in GATA4 expression, a pancreatic progenitor and acinar marker. Also, dissociated cells with exposure to EGF show increased levels of ductal KRT19, HNF1B, SOX9, and FOXA2 markers. Western blot data exhibit increased levels of CK19 and PDX1 in all conditions from iPSC, but do not show distinguishing levels between the groups. Conditions with Noggin and Nicotinamide were tested to promote further development towards NKX6.1.sup.+ population but before developing to NGN3.sup.+ endocrine specified population. Since there were no apparent differences in conditions with or without noggin and nicotinamide, those 2 reagents were excluded. Based on results, iPan Ductal protocol includes dissociation and EGF signaling.
[0107] Prior to seeding, organ chips were plasma activated and MATRIGEL coated. The following day, Day 11 cells were dissociated and reseeded into the top channel at a 5 million cells/mL density in Phase 3 media. The bottom channel was filled with only Phase 3 media. 48 hours later, media was replaced with Phase 4 media. Feeding was done every other day for the next 2 weeks.
[0108] Accordingly, the present invention is derived, in part, by these findings.
[0109] Various embodiments of the present invention provide for a method of differentiating induced pluripotent stem cells (iPSCs) into iPSC-derived pancreatic progenitor cells, comprising: seeding induced pluripotent stem cells (iPSCs) on a solid medium coated with solubilized basement membrane preparation in the presence of serum-free, stabilized cell culture medium, and optionally a ROCK inhibitor; culturing the cells in a first culture medium comprising a first base medium Activin A, CHIR99021, and a ROCK Inhibitor; culturing the cells in a second culture medium comprising the first base medium and Activin A, and bFGF (FGF-2); culturing the cells in a third culture medium comprising the first base medium and FGF10, NOGGIN, and CHIRR99021; culturing the cells in a fourth culture medium comprising a second base medium and FGF10, NOGGIN, All-trans Retinoic Acid, and SANT1, wherein iPSC-derived pancreatic progenitor cells are produced.
[0110] In various embodiments, Activin A, CHIR99021, and the ROCK Inhibitor in the first culture medium is at a concentration of about 100 ng/ml Activin A, about 2 uM CHIR99021 and about 10 uM of the ROCK inhibitor. In various embodiments, Activin A, and bFGF (FGF-2) in the second culture medium is at a concentration of about 100 ng/ml Activin A and about 5 ng/ml bFGF (FGF-2). In various embodiments, FGF10, NOGGIN, and CHIRR99021 in the third culture medium is at a concentration of about 50 ng/ml FGF10, about 50 ng/ml NOGGIN and about 0.25 uM CHIRR99021. In various embodiments, FGF10, NOGGIN, All-trans Retinoic Acid, and SANT1 in the fourth culture medium is at a concentration of about 50 ng/ml FGF10, about 50 ng/ml NOGGIN, about 2 uM All-trans Retinoic Acid, and about 0.25 uM SANT1.
[0111] In various embodiments, the cells are cultured in the first culture medium for about 1 day. In various embodiments, the cells are cultured in the second culture medium for about 1 to 2 days. In various embodiments, the cells are cultured in the third culture medium for about 1 to 2 days. In various embodiments, the cells are cultured in the fourth culture medium for about 1 day.
[0112] Various embodiments provide for a method of differentiating induced pluripotent stem cells (iPSCs) into induced pancreatic (iPan) ductal cells, comprising seeding induced pluripotent stem cells (iPSCs) on a solid medium coated with solubilized basement membrane preparation in the presence of serum-free, stabilized cell culture medium, and optionally a ROCK inhibitor; culturing the cells in a first culture medium comprising a first base medium Activin A, CHIR99021, and a ROCK Inhibitor; culturing the cells in a second culture medium comprising the first base medium and Activin A, and bFGF (FGF-2); culturing the cells in a third culture medium comprising the first base medium and FGF10, NOGGIN, and CHIRR99021; culturing the cells in a fourth culture medium comprising a second base medium and FGF10, NOGGIN, All-trans Retinoic Acid, and SANT1; seeding the iPSC-derived pancreatic progenitor cells on a solid medium coated with solubilized basement membrane preparation in the presence of a fifth culture medium comprising a second base medium and a ROCK inhibitor; culturing the cells in a sixth culture medium comprising the second base medium and FGF10, EGF, and sDLL-1, wherein iPan ductal cells are produced.
[0113] In various embodiments, the method further comprises dissociating the iPSC-derived pancreatic progenitor cells before seeding the iPSC-derived pancreatic progenitor cells on the solid medium.
[0114] In various embodiments, the ROCK inhibitor in the fifth culture medium is at a concentration of about 10 uM. In various embodiments, the ROCK inhibitor in the fifth culture medium is at a concentration of about 5-15 uM.
[0115] In various embodiments, FGF10, EGF, and sDLL-1 in the sixth culture medium is at a concentration of about 25 ng/ml FGF10, about 50 ng/ml EGF, and about 50 ng/ml sDLL-1. In various embodiments, FGF10, EGF, and sDLL-1 in the sixth culture medium is at a concentration of about 20-30 ng/ml FGF10, about 40-60 ng/ml EGF, and about 40-60 ng/ml sDLL-1.
[0116] In various embodiments, the cells are cultured in the fifth culture medium for about 1 day. In various embodiments, the cells are cultured in the fifth culture medium for about 1-2 days. In various embodiments, the cells are cultured in the sixth culture medium for about 16 days. In various embodiments, the cells are cultured in the sixth culture medium for about 14-18 days.
[0117] Various embodiments provide for a method of dedifferentiating induced pluripotent stem cells (iPSCs) into induced pancreatic endocrine cells, comprising seeding induced pluripotent stem cells (iPSCs) on a solid medium coated with solubilized basement membrane preparation in the presence of serum-free, stabilized cell culture medium, and optionally a ROCK inhibitor; culturing the cells in a first culture medium comprising a first base medium Activin A, CHIR99021, and a ROCK Inhibitor; culturing the cells in a second culture medium comprising the first base medium and Activin A, and bFGF (FGF-2); culturing the cells in a third culture medium comprising the first base medium and FGF10, NOGGIN, and CHIRR99021; culturing the cells in a fourth culture medium comprising a second base medium and FGF10, NOGGIN, All-trans Retinoic Acid, and SANT1; seeding the iPSC-derived pancreatic progenitor cells on a solid medium coated with solubilized basement membrane preparation in the presence of a fifth culture medium comprising a second base medium and a ROCK inhibitor; culturing the cells in a sixth culture medium comprising the second base medium and Noggin, EGF and nicotinamide, wherein pancreatic endocrine cells are produced.
[0118] In various embodiments, the method further comprises dissociating the iPSC-derived pancreatic progenitor cells before seeding the iPSC-derived pancreatic progenitor cells on the solid medium.
[0119] In various embodiments, the ROCK inhibitor in the fifth culture medium is at a concentration of about 10 uM. In various embodiments, the ROCK inhibitor in the fifth culture medium is at a concentration of about 5-15 uM.
[0120] In various embodiments, Noggin, EGF and nicotinamide in the sixth culture medium is at a concentration of about 50 ng/ml Noggin, about 100 ng/ml EGF, and about 10 mM nicotinamide. In various embodiments, Noggin, EGF and nicotinamide in the sixth culture medium is at a concentration of about 40-60 ng/ml Noggin, about 75-125 ng/ml EGF, and about 5-15 mM nicotinamide.
[0121] In various embodiments, the cells are cultured in the fifth culture medium for about 4 days. In various embodiments, the cells are cultured in the fifth culture medium for about 3-5 days. In various embodiments, the cells are cultured in the sixth culture medium for about 4 days. In various embodiments, the cells are cultured in the sixth culture medium for about 3-5 days.
[0122] Various embodiments provide for a method of producing organoids comprising pancreatic ductal cells, comprising: seeding induced pluripotent stem cells (iPSCs) on a solid medium coated with solubilized basement membrane preparation in the presence of serum-free, stabilized cell culture medium, and optionally a ROCK inhibitor; culturing the cells in a first culture medium comprising a first base medium Activin A, CHIR99021, and a ROCK Inhibitor; culturing the cells in a second culture medium comprising the first base medium and Activin A, and bFGF (FGF-2); culturing the cells in a third culture medium comprising the first base medium and FGF10, NOGGIN, and CHIRR99021; culturing the cells in a fourth culture medium comprising a second base medium and FGF10, NOGGIN, All-trans Retinoic Acid, and SANT1 to produce iPSC-derived pancreatic progenitor cells; dissociated the iPSC-derived pancreatic progenitor cells; seeding the iPSC-derived pancreatic progenitor cells into a solubilized basement membrane preparation and plating the seeded cells onto a solid medium; and culturing the cells in a sixth culture medium comprising the second base medium and FGF10, EGF, and sDLL-1.
[0123] Various embodiments provide for a method of producing organoids comprising pancreatic ductal cells, comprising: providing dissociated iPSC-derived pancreatic progenitor cells; seeding the cells into a solubilized basement membrane preparation and plating the seeded cells onto a solid medium; and culturing the cells in a sixth culture medium comprising the second base medium and FGF10, EGF, and sDLL-1. In various embodiments the concentrations are: about 20-30 ng/ml FGF10, about 40-60 ng/ml EGF, and about 40-60 ng/ml sDLL-1. Various embodiments provide for a method of producing organoids comprising pancreatic ductal cells, comprising: providing dissociated iPSC-derived pancreatic progenitor cells; seeding the cells into a solubilized basement membrane preparation and plating the seeded cells onto a solid medium; and culturing the cells in a sixth culture medium comprising the second base medium and FGF10, EGF, and sDLL-1. In various embodiments the concentrations are: about 25 ng/ml FGF10, about 50 ng/ml EGF, and about 50 ng/ml sDLL-1. In various embodiments, the cells are fed with the sixth culture medium every 1-4 days for at least 2 weeks. In various embodiments, the cells are fed with the sixth culture medium every 2-3 days for at least 2 weeks. In various embodiments, the cells are cultured for about 2 weeks, about 2.5 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks or about 8 weeks.
[0124] In various embodiments, the iPSC-derived pancreatic progenitor cells are resuspended in the solubilized basement membrane preparation at a density of about 2 million cells/mL. In various embodiments, the density is about 1-3 million cells/mL. In various embodiments, the plating the seeded cells onto a solid medium comprises plating about 10 L of cell suspension onto each solid medium. In various embodiments, the plating the seeded cells onto a solid medium comprises plating about 5-15 L of cell suspension onto each solid medium. In various embodiments, the solid medium is a U-bottom multi-well plate. In various embodiments, once the Matrigel dome is solidified, Phase III medium with Rho kinase Inhibitor was added for 24 h, then the medium was switched to Phase IV media and cultured for 2 weeks or longer, whilst feeding every 2 days.
[0125] For the second method of organoid culture, pancreatic progenitors (day 7) were single cell dissociated and resuspended in Matrigel at a density of 2 million cells/mL. 10 uL of cell suspension was seeded in each well of a 96 U-bottom plate then incubated at 37 C for 15 minutes flipped. Then cells were fed with 100 ul of ductal media with FGF10, EGF and sDLL1 every 2-3 days for at least 2 weeks. The second method of organoid culture favor more ductal organoids Concentrations are: 25 ng/ml FGF10, about 50 ng/ml EGF, and about 50 ng/ml sDLL-1. In various embodiments, cells were fed with about 50-150 ul of ductal media with FGF10, EGF and sDLL1 every 2-3 days for at least 2 weeks; and the second method of organoid culture favor more ductal organoids Concentrations are: about 20-30 ng/ml FGF10, about 40-60 ng/ml EGF, and about 40-60 ng/ml sDLL-1.
[0126] Various embodiments of the present invention provide for a method of differentiating induced pluripotent stem cells (iPSCs) into iPSC derived pancreatic acinar cells, comprising: seeding induced pluripotent stem cells (iPSCs) on a solid medium coated with solubilized basement membrane preparation in the presence of serum-free, stabilized cell culture medium, and optionally a ROCK inhibitor; culturing the cells in a first culture medium comprising a first base medium Activin A, CHIR99021, and a ROCK Inhibitor; culturing the cells in a second culture medium comprising the first base medium and Activin A, and bFGF (FGF-2); culturing the cells in a third culture medium comprising the first base medium and FGF10, NOGGIN, and CHIRR99021; culturing the cells in a fourth culture medium comprising a second base medium and FGF10, NOGGIN, All-trans Retinoic Acid, and SANT1 to produce iPSC-derived pancreatic progenitor cells; seeding the iPSC-derived pancreatic progenitor cells into a solubilized basement membrane preparation and plating the seeded cells onto a solid medium; culturing the cells in a seventh culture medium comprising a second base medium and XXI, FGF10, Noggin, Nicotinamide, and Murine Wnt3a, wherein iPSC derived pancreatic acinar cells are produced.
[0127] In various embodiments, XXI, FGF10, Noggin, Nicotinamide, and Murine Wnt3a in the seventh culture medium is at a concentration of about 20 ng/mL FGF10, 25 ng/mL Wnt3a, 1 uM XXI, 50 ng/mL Noggin, and 10 mM Nicotinamide. In various embodiments, XXI, FGF10, Noggin, Nicotinamide, and Murine Wnt3a in the seventh culture medium is at a concentration of about 15-25 ng/mL FGF10, 20-30 ng/mL Wnt3a, 0.1-1.5 uM XXI, 40-60 ng/mL Noggin, and 5-15 mM Nicotinamide.
[0128] In various embodiments, differentiating induced pluripotent stem cells (iPSCs) into iPSC derived pancreatic acinar cells further comprises inducing overexpression of acinar specific genes in the iPSC-derived pancreatic progenitor cells. In various embodiments, the acinar specific genes are selected from PTF1A, XBP1, RBPJL, MIST1, GATA4, and combinations thereof. In various embodiments, inducing overexpression of acinar specific genes in the iPSC-derived pancreatic progenitor cells can comprise inducing the expression when the cells were iPSCs. In various embodiments, inducing overexpression of acinar specific genes in the iPSC-derived pancreatic progenitor cells can comprise inducing the expression when the cells are pancreatic progenitor cells (e.g., bipotent trunk progenitors).
[0129] In various embodiments, inducing overexpression of acinar specific genes in the iPSC-derived pancreatic progenitor cells comprises transducing the iPSCs derived pancreatic progenitor cells with a vector comprising a nucleic acid encoding the acinar specific genes. In various embodiments, inducing overexpression of acinar specific genes in the iPSC-derived pancreatic progenitor cells comprise transducing the iPSCs derived pancreatic progenitor cells with a vector comprising a nucleic acid encoding the acinar specific genes. In various embodiment, both can be done. In various embodiments, the vector is a lentivirus.
[0130] In various embodiments, differentiating induced pluripotent stem cells (iPSCs) into iPSC derived pancreatic acinar cells further comprises inducing PTF1A expression in the iPSC-derived pancreatic progenitor cells. In various embodiments, inducing PTF1A expression in the iPSC-derived pancreatic progenitor cells can comprise inducing the expression when the cells were iPSCs. In various embodiments, inducing PTF1A expression in the iPSC-derived pancreatic progenitor can comprise inducing the expression when the cells are pancreatic progenitor cells. In various embodiment, both can be done.
[0131] In various embodiments, inducing PTF1A expression in the iPSC-derived pancreatic progenitor cells comprises transducing the iPSCs derived pancreatic progenitor cells with a vector comprising a nucleic acid encoding PTF1A. In various embodiment, both can be done. In various embodiments, inducing PTF1A expression in the iPSC-derived pancreatic progenitor cells comprise transducing the iPSCs derived pancreatic progenitor cells with a vector comprising a nucleic acid encoding PTF1A. In various embodiment, both can be done.
[0132] In various embodiments, inducing PTF1A expression in the iPSC-derived pancreatic progenitor cells comprises transducing the iPSCs with a lentivirus vector comprising a nucleic acid encoding PTF1A. In various embodiments, inducing PTF1A expression in the iPSC-derived pancreatic progenitor cells comprise transducing the iPSCs derived pancreatic progenitor cells with a lentivirus vector comprising a nucleic acid encoding PTF1A. In various embodiment, both can be done.
[0133] Various embodiments provide for a method of producing organoids comprising pancreatic acinar cells, comprising: seeding induced pluripotent stem cells (iPSCs) on a solid medium coated with solubilized basement membrane preparation in the presence of serum-free, stabilized cell culture medium, and optionally a ROCK inhibitor; culturing the cells in a first culture medium comprising a first base medium Activin A, CHIR99021, and a ROCK Inhibitor; culturing the cells in a second culture medium comprising the first base medium and Activin A, and bFGF (FGF-2); culturing the cells in a third culture medium comprising the first base medium and FGF10, NOGGIN, and CHIRR99021; culturing the cells in a fourth culture medium comprising a second base medium and FGF10, NOGGIN, All-trans Retinoic Acid, and SANT1 to produce iPSC-derived pancreatic progenitor cells; culturing the cells in a seventh culture medium comprising a second base medium and XXI, FGF10, Noggin, Nicotinamide, and Murine Wnt3a, wherein iPSC derived pancreatic acinar cells are produced; dissociating the iPSC derived pancreatic acinar cells; seeding the iPSC-derived pancreatic acinar cells into a solubilized basement membrane preparation and plating the seeded cells onto a solid medium; and culturing the cells in an eighth culture medium comprising a second base medium and FGF10, Noggin, Nicotinamide, and Murine Wnt3a.
[0134] Various embodiments provide for a method of producing organoids comprising pancreatic acinar cells, comprising: providing dissociated iPSC derived pancreatic acinar cells; seeding the iPSC-derived pancreatic acinar cells into a solubilized basement membrane preparation and plating the seeded cells onto a solid medium; and culturing the cells in an eighth culture medium comprising a second base medium and FGF10, Noggin, Nicotinamide, and Murine Wnt3a.
[0135] In various embodiments, seeding the iPSC-derived pancreatic acinar cells comprises seeding at a concentration of about 1-310{circumflex over ()}6 cells/about 1040 L of the solubilized basement membrane preparation (e.g., MATRIGEL). The solubilized basement membrane preparation-cell mix is then aliquoted as about 15 L/well of 96 well plate. In various embodiments, plating the seeded cells onto a solid medium comprises plating in about 10-20 L bubbles and allowing the plated cells to sit for about 10-20 minutes prior to culturing the cells in the eighth culture medium. In various embodiments, plating the seeded cells onto a solid medium comprises plating in about 15 L bubbles and allowing the plated cells to sit for about 15 minutes prior to culturing the cells in the eighth culture medium. In various embodiments, the cells are cultured in the eighth culture medium for about 40-48 days, and given the eighth culture medium about every day, every other day or every three days. In various embodiments, the cells are cultured in the eighth culture medium for about 44 days and given the eighth culture medium about every other day. In various embodiments, the solid medium is a round-bottom multi-well plate.
[0136] In various embodiments of these methods, the designation of first culture medium, second culture medium, third culture medium, fourth culture medium, fifth culture medium, sixth culture medium, seventh culture medium, either culture medium, or ninth culture medium does not denote the order of the culture media, or that certain methods must have all the culture media, or that certain methods must have a sequential number of culture media. This is merely used to easily identify and refer back to the different culture media. Similarly, the designation of a first base medium and a second base medium does not denote the order of the base media used in the methods. This is also merely used to easily identify and refer back to the different base media.
[0137] In various embodiments of these methods, the solubilized basement membrane preparation is extracted from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma. In various embodiments, solubilized basement membrane preparation is MATRIGEL matrix.
[0138] In various embodiments of these methods, the ROCK inhibitor is Y27632 ROCK Inhibitor.
[0139] In various embodiments of these methods, the serum-free, stabilized cell culture medium is mTeSR plus medium.
[0140] In various embodiments of these methods, the first base medium comprises an agent from the group consisting of MCDB 131, Glutamax, Vitamin C, BSA, sodium bicarbonate, antibiotic, and combinations thereof. In various embodiments of these methods, the first base medium comprises an agent from the group consisting of MCDB 131, Glutamax, Vitamin C, BSA, sodium bicarbonate, antibiotic (e.g., PSA), and combinations thereof. In various embodiments, the first base medium comprises 2, 3, 4, 5, or 6 agents from the group consisting of MCDB 131, Glutamax, Vitamin C, BSA, sodium bicarbonate, antibiotic, and combinations thereof. In various embodiments, the first base medium comprises MCDB 131, Glutamax, Vitamin C, BSA, sodium bicarbonate, and antibiotic (e.g., PSA). In various embodiments, the first base medium comprises 5-6 agents from the group consisting of MCDB 131, Glutamax, Vitamin C, BSA, sodium bicarbonate, antibiotic (e.g., PSA), and combinations thereof. In various embodiments, the first base medium comprises MCDB 131, Glutamax, Vitamin C, BSA, sodium bicarbonate, and antibiotic (e.g., PSA). In various embodiments, the first base medium comprises 7 agents from the group consisting of MCDB 131, Glutamax, PSA, Vitamin C, BSA, sodium bicarbonate, antibiotic, and combinations thereof. In various embodiments, the first base medium comprises 6 agents from the group consisting of MCDB 131, Glutamax, Vitamin C, BSA, sodium bicarbonate, antibiotic, and combinations thereof. In various embodiments, the first base medium comprises MCDB 131, Glutamax, PSA, Vitamin C, BSA, sodium bicarbonate, and antibiotic. In various embodiments, the first base medium comprises MCDB 131, Glutamax, Vitamin C, BSA, sodium bicarbonate, and antibiotic.
[0141] In various embodiments of these methods, the Glutamax, PSA, Vitamin C, BSA, sodium bicarbonate, and antibiotic are at a concentration of about 1Glutamax, about 1Antibiotic, about 0.5% Bovine Serum Albumin, about 1.5 mg/ml Sodium Bicarbonate and about 250 uM Vitamin C. In various embodiments of these methods, the Glutamax, PSA, Vitamin C, BSA, sodium bicarbonate, and antibiotic are at a concentration of about 1Glutamax, about 1Antibiotic, about 0.25-0.75% Bovine Serum Albumin, about 1.0-2.0 mg/ml Sodium Bicarbonate and about 200-300 uM Vitamin C.
[0142] In various embodiments of these methods, the second base medium comprises an agent from the group consisting of DMEM, antibiotic, B27 without vitamin A, vitamin C and combination thereof. In various embodiments, the second base medium comprises 2, 3, or 4 agents from the group consisting of DMEM, antibiotic, B27 without vitamin A, vitamin C and combination thereof. In various embodiments, the second base medium comprises 2-3 agents from the group consisting of DMEM, antibiotic, B27 without vitamin A, vitamin C and combination thereof. In various embodiments, the second base medium comprises 4 agents from the group consisting of DMEM, antibiotic, B27 without vitamin A, vitamin C and combination thereof. In various embodiments, the second base medium comprises an agent from the group consisting of DMEM, antibiotic, B27 without vitamin A, and vitamin C.
[0143] In various embodiments of these methods, the antibiotic, B27 without vitamin A, and uM vitamin C are at a concentration of about 1X antibiotic, about 1X B27 without vitamin A, and about 250 uM vitamin C. In various embodiments of these methods, the antibiotic, B27 without vitamin A, and uM vitamin C are at a concentration of about 0.5-1.5antibiotic, about 0.5-1.5B27 without vitamin A, and about 200-300 uM vitamin C.
[0144] In various embodiments of these methods, the antibiotic is a Pen-Strep Antibiotic.
[0145] Various embodiments provide for an induced pluripotent stem cell (iPSC) derived pancreatic progenitor cell made by a method of the present invention.
[0146] Various embodiments provide for an induced pluripotent stem cell (iPSC) derived iPan ductal cell made by a method of the present invention.
[0147] Various embodiments provide for an induced pluripotent stem cell (iPSC) derived acinar cell made by a method of the present invention.
[0148] Various embodiments provide for an induced pluripotent stem cell (iPSC) derived pancreatic organoid comprising pancreatic acinar cells made by a method of the present invention.
[0149] Various embodiments provide for an induced pluripotent stem cell (iPSC) derived pancreatic organoid comprising pancreatic ductal cells made by a method of the present invention.
Cell, Organoid and Organ Chip Models and Methods of Uses
[0150] Various embodiments of the present invention provide for a model, comprising a population of cells comprising cells selected from the group consisting of pancreatic progenitor cells derived from induced pluripotent stem cells (iPSCs), pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells, pancreatic acinar cells derived from iPSCs, pancreatic acinar cells derived from pancreatic progenitor cells, an organoid comprising pancreatic acinar cells derived from iPSCs, an organoid comprising pancreatic acinar cells derived from pancreatic progenitor cells, an organoid comprising pancreatic ductal cells derived from iPSCs, an organoid comprising pancreatic ductal cells derived from pancreatic progenitor cells, and combinations thereof; and a fluidic device, or a cell culture plate, or a multi-well culture plate, wherein the test agent and the population of cells are in contact in a fluidic device the cell culture plate, or the multi-well culture plate.
[0151] In various embodiments, the fluidic device, the cell culture plate, or the multi-well culture plate is a Transwell system. In various embodiments, the fluidic device is a microfluidic device. In various embodiments, the microfluidic device is an organ chip.
[0152] Various embodiments provide for a device, comprising: a membrane comprising a top surface and a bottom surface; a first channel in fluidic communication with the top surface of the membrane; a second channel in fluidic communication with the bottom surface of the membrane, wherein the first and second channels each comprises a surface that is parallel to the membrane; a first population of cells selected from the group consisting of pancreatic progenitor cells derived from induced pluripotent stem cells (iPSCs), pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells, pancreatic acinar cells derived from iPSCs, and pancreatic acinar cells derived from pancreatic progenitor cells in the first channel or the second channel; and optionally, a second population of cells in the first channel or the second channel, wherein the first population of cells and the second population of cells are in different channels, and wherein the first population of cells and the second population of cells are not the same type of cells. In various embodiments, the device comprises the second population of cells.
[0153] In various embodiments, wherein the device has the second population of cells, the second population of cells are selected from the group consisting of endocrine cells, stellate cells endothelial cells, pancreatic progenitor cells derived from induced pluripotent stem cells (iPSCs), pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells, pancreatic acinar cells derived from iPSCs, and pancreatic acinar cells derived from pancreatic progenitor cells.
[0154] In various embodiments, the device further comprises at least one inlet port adapted for fluid entering the at least one inlet port; and at least one outlet port adapted for fluid exiting the at least one outlet port.
[0155] In various embodiments, the first and second channels comprise polydimethylciloxane. In various embodiments, the first channel and the second channel are microfluidic channels.
[0156] In various embodiments, the device further comprises one or more gels and the population of cells having been seeded on top of or into the one or more gels.
[0157] In various embodiments, the first population of cells, or the second population of cells or both are patient specific. In various embodiments, the first population of cells, or the second population of cells or both express a fluorescent reporter.
[0158] Various embodiments provide for a device, comprising: a top chamber; a bottom chamber; a membrane between the top chamber and the bottom chamber; a first channel fluidically coupled to the top chamber; a second channel fluidically coupled to the bottom chamber; a first population of cells selected from the group consisting of pancreatic progenitor cells derived from induced pluripotent stem cells (iPSCs), pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells, pancreatic acinar cells derived from iPSCs, and pancreatic acinar cells derived from pancreatic progenitor cells in the first channel or the second channel; and optionally, a second population of cells in the first channel or the second channel, wherein the first population of cells and second population of cells are in different channels, and wherein the first population of cells and the second population of cells are not the same type of cells. In various embodiments, the device comprises the second population of cells.
[0159] In embodiments wherein the device comprises the second population of cells, the second population of cells are selected from the group consisting of endocrine cells, stellate cells endothelial cells, pancreatic progenitor cells derived from induced pluripotent stem cells (iPSCs), pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells, pancreatic acinar cells derived from iPSCs, and pancreatic acinar cells derived from pancreatic progenitor cells.
[0160] In various embodiments, the first and second channels comprise polydimethylciloxane. In various embodiments, the first channel and the second channel are microfluidic channels.
[0161] In various embodiments, the device further comprises one or more gels and the population of cells having been seeded on top of or into the one or more gels.
[0162] In various embodiments, the first population of cells, or the second population of cells or both are patient specific. In various embodiments, the first population of cells, or the second population of cells or both express a fluorescent reporter.
[0163] Various embodiments of the invention provide for an organ chip device, comprising: a first population of cells selected from the group consisting of pancreatic progenitor cells derived from induced pluripotent stem cells (iPSCs), pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells, pancreatic acinar cells derived from iPSCs, and pancreatic acinar cells derived from pancreatic progenitor cells; optionally, a second population of cells; and a membrane separating the first population of cells and the second population of cells, wherein the first population of cells and the second population of cells are not the same type of cells. In various embodiments, the organ chip device comprises the second population of cells.
[0164] In various embodiments, the membrane comprises polydimethylciloxane.
[0165] In various embodiments, the organ chip device further comprises one or more gels and the population of cells having been seeded on top of or into the one or more gels.
[0166] In various embodiments, the first population of cells, or the second population of cells or both are patient specific. In various embodiments, the first population of cells, or the second population of cells or both express a fluorescent reporter.
[0167] Various embodiments of the present invention provide for a method of assessing a test agent, comprising: contacting the test agent to a device of the present invention as described herein, wherein the device comprises a population of cells selected from the group consisting of pancreatic progenitor cells derived from induced pluripotent stem cells (iPSCs), pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells, pancreatic acinar cells derived from iPSCs, and pancreatic acinar cells derived from pancreatic progenitor cells, and optionally, a second population of cells; measuring a parameter; and assessing the test agent based on the measured parameter.
[0168] In various embodiments, the device further comprises features as described herein; for example, a membrane comprising a top surface and a bottom surface, a first channel in fluidic communication with the top surface of the membrane, a second channel in fluidic communication with the bottom surface of the membrane, wherein the first and second channels each comprises a surface that is parallel to the membrane; or a top chamber, a bottom chamber, a membrane between the top chamber and the bottom chamber, a first channel fluidically coupled to the top chamber; a second channel fluidically coupled to the bottom chamber; or a membrane separating the first population of cells and the second population of cells,
[0169] In various embodiments, the first population of cells, or the second population of cells or both are patient specific. In various embodiments, the first population of cells, or the second population of cells or both express a fluorescent reporter.
[0170] In various embodiments, the test agent is a potential drug. In various embodiments, the test agent is a potential pathway regulator. In various embodiments, the test agent is a compound that can potentially improve CFTR function; for example, when tested with iPan Ductal cells from Chronic Pancreatitis patients with CFTR mutations. In various embodiments, the test agent is a chemotherapeutic agent. In various embodiments, the test agent is an infectious agent.
[0171] In various embodiments, measuring the parameter comprises measuring a phenotype of interest, expression level of a gene of interest, or expression level of a protein of interest, or combinations thereof. In various embodiments, measuring the parameter comprises measuring fluorescence. In various embodiments, measuring the parameter comprises measuring cell viability. In various embodiments, the parameter that is measured is iodide, pH levels and or bicarbonate levels.
[0172] In various embodiments, contacting the population of cells with the test agent comprises culturing the population of cells in the presence of culture media flowing through the device.
[0173] In various embodiments, the first population of cells or the second population of cells, or both are patient specific and the method models patient-specific parameters.
[0174] Various embodiments of the present invention provide for a method of assessing a test agent, comprising: contacting the test agent to a population of cells selected from the group consisting of pancreatic progenitor cells derived from induced pluripotent stem cells (iPSCs), pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells, pancreatic acinar cells derived from iPSCs, and pancreatic acinar cells derived from pancreatic progenitor cells, and assessing the test agent based on the measured parameter.
[0175] Various embodiments of the present invention provide for a method of assessing a test agent, comprising: contacting the test agent to a population of cells selected from the group consisting of pancreatic ductal cells derived from iPSCs, pancreatic ductal cells derived from pancreatic progenitor cells that were previously derived from induced pluripotent stem cells (iPSCs), pancreatic acinar cells derived from iPSCs, and pancreatic acinar cells derived from pancreatic progenitor cells that were previously derived from induced pluripotent stem cells (iPSCs), and assessing the test agent based on the measured parameter.
[0176] In various embodiment, the population of cells are arranged in a planar configuration. In various embodiments, the population of cells are arranged as an organoid. In various embodiments, the population of cells are in a Transwell system. In various embodiments, the population of cells are in a multiwall plate.
[0177] Various embodiments of the present invention provide for a method of producing a device of the present invention, comprising: seeding the first population of cells on one surface of the membrane in the device; and optionally, seeding second population of cells on the other surface of the membrane in the device.
[0178] Various embodiments of the present invention provide for a method of producing a device of the present invention, comprising: seeding the first population of cells in one chamber in the device; and optionally, seeding the second population of cells in the other chamber in the device.
[0179] In various embodiments, prior to seeding, chips were plasma activated and Matrigel coated. The following day, Day 7 cells were dissociated and reseeded into the top channel at a density of about 10 million cells/mL in Phase III media plus about 10 M Rho kinase Inhibitor. The bottom channel was filled with only Phase III media plus about 10 Rho kinase Inhibitor. 24 hours later, media was replaced with Phase IV media. For Chips in dynamic system, Chips were placed in ZOE and a flow rate of about 30 l/hr was initiated 48 hours post-seeding. Feeding was done every other day for the next 2 weeks.
[0180] In various embodiments, when organoids are seeded to Transwells or planar, organoids were incubated in Cell Recovery Solution (Corning) for an hour in 4 to remove Matrigel, then washed 3 with PBS. Organoids were then single cell dissociated in TrypLE for about 3-6 minutes and triturated until cells become fully dissociated. Cell suspension was then filtered with about 40 m mesh size strainer, before plated to planar at about 33% confluency (9.510.sup.4 cells/cm.sup.2). For OTT cultures, about 510.sup.5 cells were seeded in a 24-w plate Transwells insert (Corning, 3470). Different sizes of Transwells insert can be used as well.
EXAMPLES
[0181] The following examples are provided to better illustrate the claimed invention and are not to be interpreted as limiting the scope of the invention. To the extent that specific materials are mentioned, it is merely for purposes of illustration and is not intended to limit the invention. One skilled in the art may develop equivalent means or reactants without the exercise of inventive capacity and without departing from the scope of the invention.
Example 1
Efficient Differentiation of Human iPSC-derived Pancreatic Ductal Cells for Planar, Organoid and Tissue Chip Applications
Ethics Statement
[0182] Human cell lines and tissues were obtained or created at Cedars-Sinai under the auspices of the Cedars-Sinai Medical Center Institutional Review Board (IRB) approved protocols. Specifically, the iPSC cell lines and differentiation protocols in the present study were carried out in accordance with the guidelines approved by Stem Cell Research Oversight committee (SCRO) and IRB, under the auspices of IRB-SCRO Protocols Pro00032834 (iPSC Core Repository and Stem Cell Program) and Pro00036896 (Sareen Stem Cell Program). In vitro studies using human cell lines were conducted from participants that provided written informed consent for research studies. Remaining studies were conducted with post-mortem human specimens with appropriate IRB approvals.
Induced Pluripotent Stem Cell Maintenance
[0183] CS07iCTR, CS03iCTR and EDi028-A iPSC lines were reprogrammed by the iPSC Core at Cedars- Sinai Medical Center from peripheral blood mononuclear cells obtained from 60-, 34- and 79-year-old male individuals. Extensive characterization was performed including pluripotency assays with flow cytometry, qRT-PCR and immunocytochemistry, G-band karyotyping, scorecard assay to assess differentiation potential, and confirmation of the absence of episomal plasmid genes. Cells were maintained and expanded at a 1:6 ratio using passaging reagent ReLeSR and cultured in mTeSR Plus Medium (both from Stem Cell Technologies, Vancouver, British Columbia, Canada) on Matrigel (Corning) coated plates.
Pancreatic Progenitor Differentiation
[0184] iPSCs were single-cell dissociated using TrypLE (Gibco, 12604013), neutralized with base media, washed, resuspended after cell count, and plated onto Matrigel-coated plates at a density of 3.110.sup.5 cells/cm.sup.2 using mTeSR+ and 10 M Rho kinase Inhibitor (STEMCELL). The following day, cells were directed into Definitive Endoderm (DE) using Phase I medium, composed of base medium MCDB 131 (Fisher Sci) supplemented with 100 ng/ml Activin A (R&D), 2 M CHIR99021 (Reprocell), and 10 M Rho kinase Inhibitor (Cayman) for 1 day. For the next two days, the same base medium was used, but supplemented instead with 100 ng/mL Activin A and 5 ng/mL FGF2 (Peprotech). Following this phase, cells were directed to form Posterior Foregut (PFG) using Phase II medium, which was composed of the same base medium as Phase I but supplemented with 50 ng/mL FGF10 (Peprotech), 0.25 M CHIR99021 and 50 ng/ml Noggin (Peprotech) for 2 days. To reach a Pancreatic Progenitor (PP) stage, cells were fed with Phase III medium, composed of DMEM base (Gibco), 1Pen-Strep, 1B27 without Vitamin A (Thermo Fisher), and Vitamin C (250 M), supplemented with small compounds 50 ng/mL Noggin (Peprotech), 50 ng/mL FGF10 (Peprotech), 2 M Retinoic Acid (Sigma), and 0.25 M SANT1 (Sigma) for 2 days.
iPan Ductal Specification
[0185] After 1 day of Phase III, on Day 7, cells were single cell dissociated with TrypLE for 3-6 minutes, washed and seeded at 33% confluency (9.510.sup.4 cells/cm.sup.2) in Phase III media plus 10 M Rho kinase Inhibitor. On Day 8 onwards, cells were treated with Phase IV mediaaddition of FGF10 (25 ng/ml), EGF (50 ng/ml), and sDLL-1 (25 ng/ml, Peprotech). The base media for phase III and IV consists of DMEM, lx Pen-Strep, 1B27 without Vitamin A (Thermo Fisher), and Vitamin C (250 M).
Pancreatic Endocrine Specification
[0186] Cells were fed with the same Phase III media stated above for 4 days instead of the shortened version of 2 days for iPan Ductal differentiation. Phase IV for Pancreatic Endocrine consists of the same base media, but supplemented with a different combination of small compoundsNoggin (50 ng/ml), EGF (100 ng/ml, PeproTech) and Nicotinamide (10 mM, Sigma) for 4 days.
iPan Ductal Organoids
[0187] Day 7 cells were single cell dissociated with TrypLE for 3-6 minutes, washed and resuspended in Matrigel at a density of 2.85 million cells/mL. 10 L of cell suspension was seeded in each well of a 96-well U-bottom plate, or 40 L seeded in each well of a 12-well plate, then incubated at 37 C. with the plate flipped upside-down for 30 min. Once the Matrigel dome is solidified, Phase III medium with Rho kinase Inhibitor was added for 24 h, then the medium was switched to Phase IV media and cultured for 2 weeks or longer, whilst feeding every 2 days.
iPan Ductal on Tissue-Chips
[0188] Prior to seeding, emulate chips were plasma activated and Matrigel coated. The following day, Day 7 cells were dissociated and reseeded into the top channel at a density of 10 million cells/mL in Phase III media plus 10 M Rho kinase Inhibitor. The bottom channel was filled with only Phase III media plus 10 M Rho kinase Inhibitor. 24 hours later, media was replaced with Phase IV media. For Chips in dynamic system, Chips were placed in ZOE and a flow rate of 30 l/hr was initiated 48 hours post-seeding. Feeding was done every other day for the next 2 weeks.
Organoids Seeded to Transwells and Planar
[0189] Organoids were incubated in Cell Recovery Solution (Corning) for an hour in 4 to remove Matrigel, then washed 3 with PBS. Organoids were then single cell dissociated in TrypLE for 3-6 minutes and triturated until cells become fully dissociated. Cell suspension was then filtered with 40 m mesh size strainer, before plated to planar at 33% confluency (9.510.sup.4 cells/cm.sup.2). For OTT cultures, 510.sup.5 cells were seeded in a 24-w plate Transwells insert (Corning, 3470).
Cryopreservation
[0190] Day 7 planar cells or Day 21+ organoids were single cell dissociated with TryPLE for 3-6 minutes, washed then resuspended in 50% CryoStor (Stem Cell Technologies) and 50% Phase III/IV base media, with 210.sup.6 cells per vial. When thawed, cells were washed and resuspended in culture media supplemented with 10 M Rho kinase Inhibitor. Cells could be plated on planar at 33% confluency (9.510.sup.4 cells/cm.sup.2), resuspended in Matrigel at 2.8510.sup.6 cells/mL for organoids, seeded on chips at 110.sup.7 million cells/mL or 510.sup.5 cells could be seeded on 24-w Transwells.
RNA extraction and qPCR
[0191] For organoids, Cell Recovery Solution (Corning) was added for an hour in 4 to remove Matrigel then washed 3 with PBS. Total RNA was isolated with RLT buffer (Qiagen), syringed with 23 G needle, then extracted with RNeasy Micro Kit (Qiagen) according to the manufacturer's instructions. The concentration and the purity of RNA was determined with NanoDrop. 1-2 g RNA was reverse transcribed to cDNA High-Capacity cDNA Reverse Transcription kit (Thermo Fisher). Real-time qPCR was performed (technical replicates, n=3-4) using SYBR Master Mix (Applied Biosystems, #4472952) and specific primer sequences to each gene (Table 1), on a CFX384 Real Time system (Bio-Rad). Human RPL13 was used as the reference gene and relative expression was determined using 2- Ct method.
Cryosectioning
[0192] Organoids were incubated in Cell Recovery Solution (Corning) for an hour in 4. Organoid solution was transferred to 15-ml conical tube and centrifuged at 300 rpm for 1 minute. Pellet was resuspended in PBS and centrifuged again. Then organoids were fixed in 4% PFA for 15 minutes, washed with PBS then stored in 30% sucrose solution until organoids sank. Organoids were then embedded in OCT and sectioned at 10 M on a cryostat. Sections were mounted onto slides and left to dry overnight.
Immunofluorescence
[0193] Planar cultures were fixed with 4% PFA for 15 minutes, washed with PBS and then blocked overnight at 4 C. with 10% donkey serum containing 0.1% Triton-X100. After overnight incubation with primary antibodies at 4 C., cells were washed with 0.1% TWEEN-20 3 for 5 min, incubated with secondary antibodies for an hour at RT, and finally incubated with Hoechst 33342 (1:2000 dilution) for 15 minutes for nuclear counterstaining. Cryosectioned samples were similarly blocked and stained, but instead of adding Hoechst, ProLong Gold Antifade Mountant with DAPI (Fisher Scientific, P36931) was added onto the sections before sealing with a cover slip.
[0194] For whole mount organoid staining without removing the Matrigel, organoids were fixed with 4% PFA for 30 minutes at RT, washed with PBS 3 for 5 min on a shaker, and then permeabilized with 0.1% Saponin in PBS for 15 minutes at RT. After washing with PBS on a shaker, blocking buffer (10% NDS, 0.1% Triton X-100) was added overnight at 4 C. Organoids were then incubated overnight at 4 C. with primary antibodies, washed with PBS 3 for 5 min on shaker, and secondary antibodies added (1:200) for 2 hours at RT. After washing with PBS 3 for 5 min on a shaker, organoids were incubated in Cell Recovery Solution (Corning) for an hour in 4 C., resuspended in Matrigel and then seeded to an optical 96-well plate for imaging.
[0195] The following antibodies were used: SOX9 (1:250, Abcam AB5535), CK19 (1:100, Fisher Scientific AB7755), HNF1B (1:100, R&D AF3330-SP), CFTR (1:100, R&D MAB25031), eNac (1:100, R&D PA1920A), eCad (1:100, R&D AF648), ZO1 (1:50, Fisher Scientific 33-9100), OCT4 (1:250, Stemgent 09-0023), SSEA4 (1:100, Abcam ab16287), SOX17 (1:250, Fisher Scientific PAS-23382), FOXA2 (1:100, Abcam ab60721), NKX6.1 (1:25, DSHB F55A10), C-Peptide (1:25, DSHB GN-ID4), Donkey anti-Mouse IgG Alexa Fluor 488 (1:1000, Fisher Scientific A21206), Donkey anti-Mouse IgG Alexa Fluor 568 (1:1000, Fisher Scientific A11057), Donkey anti-Mouse IgG Alexa Fluor 647 (1:1000, Fisher Scientific A-31571).
Imaging
[0196] Immunofluorescence images of planar cells were captured using ImageXpress Micro XLS (Molecular Devices). Meanwhile, immunofluorescence images of CHIPS, Transwells, sectioned and whole mount organoids were capture with Nikon Eclipse Ti Confocal microscope. Brightfield images of organoids were taken with EVOS XL Core (Fisher Scientific) then analyzed with ImageJ software. Image quantification was performed using CellProfiler Software (v3.1.9).
Western Blot
[0197] Cells were lysed in RIPA buffer containing 50 mmol/L Tris (pH 7.4), 150 mmol/L NaCl, 1% deoxycholic acid, 1% Triton X-100, 0.1% SDS and a mix of protease and phosphatase inhibitors (Roche Applied Science, Basel, Switzerland). Protein extracts were resolved by SDS-PAGE for immunoblot analysis and membranes probed with primary and horseradish peroxidase (HRP)-conjugated secondary antibodies. Immunoreactive bands were visualized by chemiluminescence (ThermoFisher Scientific) and digital images captured using the PXi 6 Touch Imaging System (Syngene). To estimate protein levels, optical density values in each blot were expressed relative to those of the loading control (ERK, -actin or GAPDH). The following antibodies were used: phospho-CREB (Ser133; #9198), CREB (48H2; # 9197), HMGB1 (# 6893), SOX9 (#82630) and corresponding HRP-linked secondary antibodies were from Cell Signaling Technology (Danvers, MA); CFTR antibody (#MAB25031) was purchased from R&D Systems, Inc (Minneapolis, MN), and CA2 (#sc-133111) from Santa Cruz Biotechnology (Dallas, TX). All primary antibodies were used at a 1:1000 dilution; secondary antibodies were used at a 1:10000 dilution.
Iodide Efflux Assay
[0198] Assay was performed according to previous papers with some modifications. After removing culture media, planar cultures grown in 12- or 24-well plates were washed three times with 500 L efflux buffer (136 mM NaNO3, 137 mM NaCl, 4.5 mM KH2PO4, 1 mM CaCl2, 1 mM MgCl2, 10 mM glucose, 5 mM HEPES, pH 7.2), and then loaded for 1 h at 37 C. with 600 L NaI buffer (similar composition than the efflux buffer with NaI 136 mM replacing NaNO3). Extracellular NaI was then washed 4 times with 500 L efflux buffer and cells incubated at 37 C. with 600 L efflux buffer for 5 min to establish a stable baseline. Then, cells were left untreated or treated with 10 M Forskolin (FSK) to promote CFTR-induced iodide efflux, and aliquots of media (60 L each) collected at time 0 and at 1 min intervals for 8-10 min. For iPan Ductal on chips, supernatant was collected after 3 minutes of 136 mM NaNO3 then after 8 minutes of 136 mM NaNO3 containing 10 M FSK. Iodide concentration was calculated using a Thermo Orion ion plus Iodide combination Electrode (#9653BNWP; Thermo Scientific) filled with iodide-sensitive electrolyte solution (#900063; Thermo Scientific). The electrode was immersed in 5-10 mL of 100 mM NaNO3 and voltage change measured by adding each aliquot serially. Standard curves were obtained using 10 M, 100 M, 1 mM Nal and 10 mM Nal solutions.
Carbonic Anhydrase Assay
[0199] Pellets were lysed with buffer consisting of 150 mM NaCl, 10 mM Tris, 1% Triton X-100, pH=7.2. Bradford assay was used to measure protein concentration. Carbonic Anhydrase Activity Assay Kit (Biovision, #K472) was performed on lysates according to the manufacturer's instructions. Values were then normalized to protein concentration.
Statistical Analyses
[0200] Data are presented as mean standard error of the mean (SEM). Statistical significance between groups was determined by One-way ANOVA. P values<0.05 were considered statistically significant. Statistical analyses and graphs were generated using GraphPad Prism 7 for Windows Software (GraphPad Software).
TABLE-US-00001 TABLE1 ListofPrimers SEQ SEQ ID ID Gene Forward5-3 NO: Reverse5-3 NO: PDX1 CCAGTGGGCAGGCGG 1 AGGAACTCCTTCTCCAGCTC 2 T GATA4 CGTGTCCCAGACGTTCTCAG 3 CCTTGTGGGGAGAGCTTCAG 4 SOX9 GCTCTGGAGACTTCTGAACG 5 CCGTTCTTCACCGACTTCCT 6 A KRT19 GTTCACCAGCCGGACTGAA 7 GCAGGTCAGTAACCTCGGAC 8 CA2 TCAGGACAAAGCAGTGCTCA 9 TGTCCATCAAGTGAACCCCA 10 A G HNF1B GCACCCCTATGAAGACCCAG 11 GGACTGTCTGGTTGAATTGT 12 CG FOXA2 GGGAGCGGTGAAGATGGA 13 TCATGTTGCTCACGGAGGAG 14 TA GATA6 AGAAGCGCGTGCCTTCATC 15 TTTCTGCGCCATAAGGTGGT 16 SCNN1A GTTTCACCAAGTGCCGGAAG 17 CCCATTCCTGGGATGTCACC 18 SCNN1B GAACCTGCTCCCTCCCAGTC 19 GTGCATAGTGGCACCTGCT 20 SLC4A4 GAACGCATCCGATTCATCTT 21 CTTGATCCACCTGGCTGTTT 22 SLC26A6 ACTGCAAGATGATGCAGGTG 23 ATGAGGCTGTGGAAGTCTGG 24 CFTR TGACCTTCTGCCTCTTACCA 25 CACTATCACTGGCACTGTTG 26 C RLP13 GGCTAAACAGGTACTGCTGG 27 AGGAAAGCCAGGTACTTCAA 28 G CTT
TABLE-US-00002 TABLE 2 Base Media Formulation Component Company Final Phase I-II Base MCDB 131 Fisher Scientific Glutamax Fisher Scientific 2 mM Pen/Strep Sigma Aldrich 1% Vitamin C Sigma Aldrich 250 M BSA VWR 0.50% Sodium Bicarbonate Sigma Aldrich 1.5 g/L Phase III-IV Base DMEM Fisher Scientific Pen/Strep Sigma Aldrich 1% B27 w/out Vitamin A Fisher Scientific 1% Vitamin C Sigma Aldrich 250 M
TABLE-US-00003 TABLE 3 iPan Ductal Specification Media Formulation Base Phase Day Media Factors I 1 Phase Activin A 338-AC-05 100 ng/ml I-II CHIR99021 040004 2 M Rhok Inh 10005583 10 M 2 to 3 Phase Activin A 338-AC-05 100 ng/ml I-II Basic FGF 100-18B 5 ng/ml (FGF2) II 1 to 2 Phase FGF 10 100-26 50 ng/ml I-II CHIR99021 040004 0.25 M Noggin 120-10C 50 ng/ml III 1 to 2 Phase FGF 10 100-26 50 ng/ml III-IV RA R2625-100MG 2 M Noggin 120-10C 50 ng/ml SANT1 S4572-5MG 0.25 M IV 1 to 21+ Phase EGF AF-100-15 50 ng/ml III-IV FGF 10 100-26 25 ng/ml sDLL-1 140-08 25 ng/ml
Results
[0201] Notch signaling directs bipotent trunk progenitors toward a ductal lineage Pancreatic ductal and endocrine cells develop from a pool of bipotent trunk progenitors (BTP), and the bifurcation towards ductal lineage is mediated by Notch signaling. We found that 8 days of differentiation from iPSCs to be the best time to modulate Notch pathway as cells express BTP genes SOX9, HNF1B, KRT19 and FOXA2 at this time (
[0202] iPSCs differentiated stepwise to definitive endoderm, then posterior foregut can subsequently be directed to pancreatic progenitors (
[0203] To confirm that Phase III should be shortened, we tested ductal differentiation protocol with either 2 or 4 days of Phase III treatment, followed by ductal specification in Phase IV, which entailed addition of EGF, FGF10 and sDLL1 to the cultures. After 2 days of Phase III treatment, we found increased levels of ductal markers, whereas a 4-day Phase III treatment was associated with increased levels of the pancreatic endocrine NKX6.1 (
Cryopreserved iPSC-Derived Pancreatic Progenitor Cells Provide Versatility in Different Applications
[0204] Optimization of these types of experiments is slow and arduous as expansion, differentiation and cellular characterization of each iPSC line typically requires about five weeks to accomplish. Therefore, we established a more efficient and scalable method that allowed us to differentiate and cryopreserve large batches of pancreatic progenitors with less batch-to-batch differentiation variability. We have confirmed that thawed and fresh cells have equal differentiation efficiency.
[0205] The cryopreserved pancreatic progenitors also thawed and then differentiated to iPan Ductal planar, organoids and Tissue-chip formats show reliable expression of SOX9.sup.30 CK19.sup.+ cells (
iPan Ductal Maturation Requires Cells to be Passaged and Cultured in Presence of EGF Without Noggin and Nicotinamide
[0206] To optimize the ductal maturation phase, the effect of dissociating pancreatic progenitors on Day 7 and adding growth factor EGF and the Notch activating ligand sDLL-1 to the cultures was explored. FGF10 was also added at this time to increase proliferation of pancreatic cells. Based on our results, we incorporated a dissociation step prior to initiating EGF and Notch signaling in our defined iPan Ductal protocol (
[0207] On Day 7, midway through Phase III, some cell cultures were dissociated into single cell suspension and reseeded. Dissociation was associated with a significant decrease in expression of the pancreatic progenitor and acinar marker GATA4 (
[0208] Noggin and Nicotinamide have been often included in pancreatic endocrine and exocrine differentiation protocols derived from hESCs. Conditions with Noggin and Nicotinamide (No Ni) were included to test whether these additives could promote further development towards a ductal fate without a population of endocrine specified NGN3.sup.+ cells arising. Since there were no apparent differences observed to result from the conditions containing Noggin and Nicotinamide, these 2 reagents were subsequently excluded. Conditions with EGF and without No Ni show a significant increase in KRT19 in the dissociated condition in comparison to that of the non-dissociated condition (
Bipotent Trunk progenitors thrive in multiple 2D and 3D cell culture formats
[0209] The ability to dissociate iPan Ductal cells without disrupting their viability and differentiation efficiency provides an additional ability to dissociate and reseed iPan Ductal into multiple 2D and 3D cell culture formats for an extended period. As depicted schematically in the diagram shown in
[0210]
Planar iPan Ductal Cultures are Functionally Mature
[0211] By Day 21, iPan Ductal cells showed upregulation of ductal transcription factors HNF1B, SOX9, cytoskeletal KRT19, transporters/channel proteins CFTR, SLC26A6, SLC4A4 and enzyme CA2 relative to iPSCs (
[0212] Iodide efflux assays were performed to measure the function of CFTR in these iPan Ductal cultures. Forskolin (FSK) is a cAMP-inducing agent that induces opening of the CFTR channels and allows the expulsion of chloride and iodide into the media. cAMP stimulates the protein kinase A-mediated phosphorylation of CREB at Ser133 and ATF-1 at Ser63. FSK was added to Day 21 iPan Ductal cells, the media was collected, and iodide levels were measured with an iodide electrode.
[0213] Cells were lysed after 2 rounds of 15-min FSK treatments, introduced at 24 h prior to and just before collection. Lysates were probed for ductal markers (SOX9, CK19, CA2, CFTR) to confirm ductal identity and probed for phosphorylated CREB and ATF-1 associated with cAMP signaling pathway induced when FSK was introduced to open the CFTR channels. Our data indicated that both planar and OTP cultures exhibited CFTR activation, i.e., functional evidence of ductal identity and concomitant increases in p-CREB and p-ATF1 upon FSK stimulation (
[0214]
[0215] Whole mount organoids show SOX9 and CK19. Z=0 plane shows hollow lumen in the center and ductal cells on the periphery (FIG. 5Bii).
[0216] Since forskolin-induced swelling is known to be CFTR-dependent in different organoid-based systems by coupling ion transport to fluid transport, we assessed functional maturation of iPan Ductal organoids upon forskolin (FSK) treatment. FSK treated organoids show significant increase in fluid secretion and swelling compared to baseline of the organoids when not stimulated (
iPan Ductal Cells are Functional After Adapting to Microfluidic Tissue-Chip and Transwell Systems
[0217] Seeding cells on microfluidic Tissue-chips and Transwell systems allows us to better emulate the dynamic flow of the in vivo environment and more closely approximate a polarized ductal epithelium in which CFTR normally localizes to the apical membrane. Therefore, we dissociated BTP cells and seeded them into the top channel of microfluidic chips. Dynamic flow was introduced 48 hours later by changing extracellular medium with a flow rate of 30 l/hr (
[0218] We next established a Transwell system by a process like that for OTP cultures. Day 21 organoids were dissociated and seeded on Transwells for up to Day 29 or longer (
Example 2
Reliable Generation of Functional Human iPSC-Derived Pancreatic Acinar Cells in Adherent and Organoid Cultures
[0219] Human iPSC Culture into Pancreatic Progenitors
[0220] All iPSC lines used were obtained from the iPSC Core at Cedars-Sinai. Cells were cultured on MATRIGEL (Corning Life Sciences) and fed with mTeSR Plus with mTeSR Plus supplement (Stem Cell Technologies) every other day. Passaging was done weekly and consisted of cells being dissociated with ReleaSR (Stem Cell Technologies) and then seeded at lower density with a split ratio of 1:5. To begin differentiation, cells were single-cell dissociated via accutase (Stem Cell Technologies) and then seeded onto MATRIGEL coated plates at 300,000 cells/cm.sup.2. The day following seeding was considered Day 1. From this point, cells were fed daily. On Day 1, cells were fed with a base medium of MCDB 131 (Fisher Sci) supplemented with 2 mM Glutamax, 1% PSA, 250 uM Vitamin C, 0.50% BSA and 1.5g/L sodium bicarbonate. To this media, 100 ng/ml Activin A, 2 uM CHIR99021, and 10 uM Rho kinase Inhibitor was added. The following two days the cells were given the same base media but supplemented with 100 ng/mL Activin A and 5 ng/mL FGF2 to bring the cells to the definitive endoderm stage. This was followed with two more days of the same base media but supplemented with 50 ng/mL FGF10, 0.25 uM CHIR99021, and 50 ng/mL Noggin. At this time point of five days, cells had a posterior foregut identity.
[0221] The differentiation to pancreatic progenitors was performed with a different base medium of DMEM supplemented with 1% PSA, 1% B27 without Vitamin A, and 250uM Vitamin C. For four days, cells were given this DMEM base with 50 ng/mL Noggin, 50ng/mL FGF10, 2uM Retinoic Acid, and 0.25uM SANT1.
Differentiation of iPSC-derived acini
[0222] Using the same DMEM base media, cells were then treated daily for seven days with XXI, FGF10, Noggin, Nicotinamide, and Murine Wnt3a (Peprotech). By the end of this stage, cell clustering could be seen.
Production of Pancreatic Organoids
[0223] For the first method of organoid culture favoring more acinar organoids, at the end of the acinar stage (day 16), cells were mechanically dissociated into clumps using a cell scraper followed by gentle trituration. Cells were seeded into Matrigel at a concentration of 16well/1040 uL Matrigel, and plated in 15 uL bubbles into 96 well round bottom plates. Cells were allowed to sit for 15 minutes at 37 C before being given 100 uL DMEM base media with FGF10, Noggin, Nicotinamide, and Murine Wnt3a every other day for 44 days.
[0224] For the second method of organoid culture, pancreatic progenitors (day 7) were single cell dissociated and resuspended in Matrigel at a density of 2 million cells/mL. 10 uL of cell suspension was seeded in each well of a 96 U-bottom plate then incubated at 37C for 15 minutes flipped. Then cells were fed with 100 ul of ductal media with FGF10, EGF and sDLL1 every 2-3 days for at least 2 weeks. The second method of organoid culture favor more ductal organoids Concentrations are: 25 ng/ml FGF10, about 50 ng/ml EGF, and about 50 ng/ml sDLL-1.
Cryosectioning
[0225] Organoids were fixed for 15 minutes in 4% paraformaldehyde in PBS. Following this, they were washed and sunk in a 30% sucrose solution. Organoids were embedded in OCT before being sectioned in 10-14 um slices and placed onto slides.
ICC
[0226] Planar fixed samples were fixed with 4% paraformaldehyde in PBS for 15 minutes. Following this, they were washed three times with PBS and then incubated with 10% donkey serum with 0.1% Triton-X for one hour. Primary antibodies diluted in the 10% blocking serum were added, and the samples were let incubate for three hours at room temperature or overnight at 4 C. From here, the samples were washed three times for five minutes each with 0.1% TWEEN in PBS. Secondary antibodies diluted at 1:1000 in the blocking serum were added and the samples were allowed to sit one hour at room temperature. Three rounds of five-minute washes with PBS were performed before Hoechst was added at a 1:2000 dilution in PBS. After a 15-minute room temperature incubation, samples were washed with PBS three times before being imaged.
[0227] For the cryosectioned samples mounted onto slides, a similar procedure was used, with the exception that the samples were washed three times for five minutes each in PBS before beginning blocking. The blocking serum was also a 5% donkey serum with 0.25% Triton-X. Each subsequent wash step occurred for 10 minutes. Instead of using Hoechst, ProLong Gold Antifade Mountant with DAPI (company) was used.
qPCR
[0228] RNA was extracted using a Zymogen RNA Isolation kit. DNA was removed using the RQ1 Promega RNAse free DNAse kit (M6101), and cDNA synthesized with the Life Tech High Capacity cDNA kit (#4368814). qPCR was performed with the SYBR-Green based detection system and sample amplification was done in triplicates on the BioRad-CFX. Results
[0229] We adapted Memon et al. 2018 protocol for the generation of human pluripotent stem cells into pancreatic progenitors with important modifications. Memon et al. 2018 protocol only describe how to reliably get to pancreatic progenitor stage from hPSCs. All the papers previously were geared towards deriving pancreatic endocrine cells (islets) from those pancreatic progenitor cells. Memon et al. does not make pancreatic exocrine cells from the pancreatic progenitors.
[0230] The new developments and invention described here show how to turn those pancreatic progenitor cells into pancreatic exocrine (Acinar and Ductal) cells by modulating different signaling pathways described I this invention and the timing of induction of ductal and acinar cell fates from pancreatic progenitor cells derived from pluripotent stem cells.
[0231] qPCR showed that several acinar markers (Mist1, Rbpj, Gata4, Ptf1a) were all expressed after four days of stage three media treatment, and pancreatic non-acinar markers (Ngn3, Pdx1, Sox9) downregulated after one day of stage 4 media treatment. From this it was decided that stage three would be 4 days.
[0232] Four days of stage three results in differentiation up to the pancreatic progenitor stage with decent efficiency. Quantification of ICC images or flow cytometry shows PDX1 expression in a percentage of cells and SOX9 a percentage of cells.
[0233] As a starting point a general pancreatic endoderm differentiation media was developed based on various previous protocols (Hohwieler et al., 2016; Takizawa-Shirasawa et al., 2013; Delaspre et al., 2013). There is disagreement between these prior protocols about the role of FGF and Notch signaling in acinar specific fate. We made an important decision to keep FGF10 and XXI as critical components of the acinar differentiation media, as we believed Notch signaling is important in the trunk versus tip fate assignmentthough duct requires notch signaling.
[0234] We performed an experiment comparing the use of notch inhibitor XXI vs notch activator sDLL-1 with FGF10. Notch inhibition reduces PDX1 expression and increases islands of amylase positive cells. With the knowledge that FGF10 activates PDX1, we tested the importance of FGF10 concentration in concentrations of 0 ng/mL, 2.5 ng/mL, 20 ng/mL, and 50 ng/mL and found that the 20 ng showed the most CTRC and amylase positive cell expression. We added Wnt3a as it is important. We tested addition of noggin (BMP signaling agonist) and nicotinamide (amide form of Vitamin B3) and found that noggin nicotinamide addition decreases PDX1 expression and increases amylase and CTRC expression.
[0235] We developed a protocol for organoid generation by scraping and triturating to manually dissociate pancreatic progenitors at Day 9, and then seeding into 15 uL MATRIGEL bubbles plated into 96 well round bottom plates. The cells were fed with acinar media.
[0236] Organoids show lumen formation within one week after seeding into MATRIGEL bubbles. We have grown by day 57 and are starting to fuse. ICCs show that organoids express both acinar and ductal markers and do not express endocrine pancreatic markers. Organoids additionally show adhesion and polarization
[0237] Various embodiments of the invention are described above in the Detailed Description. While these descriptions directly describe the above embodiments, it is understood that those skilled in the art may conceive modifications and/or variations to the specific embodiments shown and described herein. Any such modifications or variations that fall within the purview of this description are intended to be included therein as well. Unless specifically noted, it is the intention of the inventors that the words and phrases in the specification and claims be given the ordinary and accustomed meanings to those of ordinary skill in the applicable art(s).
[0238] The foregoing description of various embodiments of the invention known to the applicant at this time of filing the application has been presented and is intended for the purposes of illustration and description. The present description is not intended to be exhaustive nor limit the invention to the precise form disclosed and many modifications and variations are possible in the light of the above teachings. The embodiments described serve to explain the principles of the invention and its practical application and to enable others skilled in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated. Therefore, it is intended that the invention not be limited to the particular embodiments disclosed for carrying out the invention.
[0239] While particular embodiments of the present invention have been shown and described, it will be obvious to those skilled in the art that, based upon the teachings herein, changes and modifications may be made without departing from this invention and its broader aspects and, therefore, the appended claims are to encompass within their scope all such changes and modifications as are within the true spirit and scope of this invention. It will be understood by those within the art that, in general, terms used herein are generally intended as open terms (e.g., the term including should be interpreted as including but not limited to, the term having should be interpreted as having at least, the term includes should be interpreted as includes but is not limited to, etc.). As used herein the term comprising or comprises is used in reference to compositions, methods, and respective component(s) thereof, that are useful to an embodiment, yet open to the inclusion of unspecified elements, whether useful or not. Although the open-ended term comprising, as a synonym of terms such as including, containing, or having, is used herein to describe and claim the invention, the present invention, or embodiments thereof, may alternatively be described using alternative terms such as consisting ofor consisting essentially of.