FUSOBACTERIUM NUCLEATUM AMYLOID-LIKE FADA FOR DIAGNOSIS AND TREATMENT OF FN-MEDIATED PATHOGENESIS
20240083985 ยท 2024-03-14
Inventors
Cpc classification
C07K2317/24
CHEMISTRY; METALLURGY
International classification
Abstract
Anti-Fn amyloid-like FadA antibodies and compositions are provided and methods of treating cancers, including pancreatic and colorectal, and periodontal diseases. Methods include preventing, reducing development, or treating disease in a subject in a subject in need thereof comprising administering to the subject a therapeutically effective amount of an agent which inhibits or blocks an amyloid-like FadA secreted from Fusobacterium nucleatum (Fn).
Claims
1. An antibody which binds Fusobacterium nucleatum amyloid-like adhesin A (Fn amyloid-like FadA), or an Fn amyloid-like FadA-binding fragment thereof, or a Fn amyloid-like FadA-binding fusion protein, comprising: a heavy chain comprising: CDR1 having the sequence GYTFTTYW (SEQ ID NO:1); CDR2 having the sequence INPNTDYT (SEQ ID NO:2); CDR3 having the sequence ARSGYFGSRYYFDY (SEQ ID NO:3); and either a light chain comprising: CDR1 having the sequence QSLANSYGNTY (SEQ ID NO:4); CDR2 having the sequence GIS (SEQ ID NO:5); CDR3 having the sequence LQGTHQPPT (SEQ ID NO:6); or a light chain comprising: CDR1 having the sequence QDINKY (SEQ ID NO:7); CDR2 having the sequence YTS (SEQ ID NO:8); CDR3 having the sequence LQYDYLLH (SEQ ID NO:9).
2. The antibody, Fn amyloid-like FadA-binding fragment thereof, or Fn amyloid-like FadA-binding fusion protein of claim 1, wherein the light chain comprises: CDR1 having the sequence QSLANSYGNTY (SEQ ID NO:4); CDR2 having the sequence GIS (SEQ ID NO:5); and CDR3 having the sequence LQGTHQPPT (SEQ ID NO:6.
3. (canceled)
4. The antibody, Fn amyloid-like FadA-binding fragment, or Fn amyloid-like FadA-binding fusion protein of claim 1, comprising framework regions of a light chain and/or a heavy chain which are human framework regions or have 85% or more sequence identity therewith.
5. The antibody of claim 1, wherein the antibody is a humanized antibody.
6. The antibody or Fn amyloid-like FadA-binding fragment of claim 1, wherein the antibody or antigen-binding fragment thereof has a human sequence Fc region or has 85% or more sequence identity therewith.
7. The antibody or Fn amyloid-like FadA-binding fragment of claim 1, wherein the antibody or fragment thereof is chimeric.
8. The antibody or Fn amyloid-like FadA-binding fragment of claim 1, wherein the antibody is a monospecific antibody comprising two heavy chains of identical sequence and two light chains of identical sequence.
9. The antibody of claim 1.
10. The antibody of claim 1, which is a monoclonal antibody.
11. The antibody of claim 1, wherein the antibody is an IgG1() or an IgG2() or an IgG4.
12. The Fn amyloid-like FadA-binding fragment of an antibody of claim 1.
13. The Fn amyloid-like FadA-binding fragment of claim 1, which is an Fab fragment, an Fab fragment, or an F(ab) fragment.
14. The Fn amyloid-like FadA-binding fusion protein of claim 1, which is a single chain variable fragment (scFv).
15. A pharmaceutical composition comprising an antibody which binds Fn amyloid-like FadA, or a Fn amyloid-like FadA-binding fragment thereof, or a Fn amyloid-like FadA-binding fusion protein, of claim 1 and a carrier.
16-58. (canceled)
59. An antibody which binds Fusobacterium nucleatum amyloid-like adhesin A (Fn amyloid-like FadA), or an Fn amyloid-like FadA-binding fragment thereof, or a Fn amyloid-like FadA-binding fusion protein, comprising complementary-determining regions CDR1 through CDR6, wherein one or more of CDR1 through CDR6 has 85% or greater identity with, but not 100% identity with, the CDR1 through CDR6 sequences set forth as follows: a heavy chain comprising: CDR1 having the sequence GYTFTTYW (SEQ ID NO:1); CDR2 having the sequence INPNTDYT (SEQ ID NO:2); CDR3 having the sequence ARSGYFGSRYYFDY (SEQ ID NO:3); and either a light chain comprising: CDR4 having the sequence QSLANSYGNTY (SEQ ID NO:4); CDR5 having the sequence GIS (SEQ ID NO:5); CDR6 having the sequence LQGTHQPPT (SEQ ID NO:6); or a light chain comprising: CDR4 having the sequence QDINKY (SEQ ID NO:7); CDR5 having the sequence YTS (SEQ ID NO:8); CDR6 having the sequence LQYDYLLH (SEQ ID NO:9).
60. A nucleic acid encoding a heavy chain as set forth in claim 1.
61. A nucleic acid encoding a light chain as set forth in claim 2.
62-68. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
DETAILED DESCRIPTION
[0086] An antibody which binds Fusobacterium nucleatum amyloid-like adhesin A (Fn amyloid-like FadA), or an Fn amyloid-like FadA-binding fragment thereof, or a Fn amyloid-like FadA-binding fusion protein, comprising: [0087] a heavy chain comprising: [0088] CDR1 having the sequence GYTFTTYW (SEQ ID NO: 1); [0089] CDR2 having the sequence INPNTDYT (SEQ ID NO:2); [0090] CDR3 having the sequence ARSGYFGSRYYFDY (SEQ ID NO:3); [0091] and either [0092] a light chain comprising: [0093] CDR1 having the sequence QSLANSYGNTY (SEQ ID NO:4); [0094] CDR2 having the sequence GIS (SEQ ID NO:5); [0095] CDR3 having the sequence LQGTHQPPT (SEQ ID NO:6); [0096] or [0097] a light chain comprising: [0098] CDR1 having the sequence QDINKY (SEQ ID NO:7); [0099] CDR2 having the sequence YTS (SEQ ID NO:8); [0100] CDR3 having the sequence LQYDYLLH (SEQ ID NO:9).
[0101] In an embodiment, the antibody, Fn amyloid-like FadA-binding fragment thereof, or Fn amyloid-like FadA-binding fusion protein light chain comprises: [0102] CDR1 having the sequence QSLANSYGNTY (SEQ ID NO:4); [0103] CDR2 having the sequence GIS (SEQ ID NO:5); and [0104] CDR3 having the sequence LQGTHQPPT (SEQ ID NO:6.
[0105] In an embodiment, the antibody, Fn amyloid-like FadA-binding fragment thereof, or Fn amyloid-like FadA-binding fusion protein light chain comprises: [0106] CDR1 having the sequence QDINKY (SEQ ID NO:7); [0107] CDR2 having the sequence YTS (SEQ ID NO:8); and [0108] CDR3 having the sequence LQYDYLLH (SEQ ID NO:9).
[0109] In embodiments, the antibody, Fn amyloid-like FadA-binding fragment, or Fn amyloid-like FadA-binding fusion protein comprise framework regions of a light chain and/or a heavy chain which are human framework regions or have 85% or more sequence identity therewith.
[0110] In embodiments, the antibody is a humanized antibody.
[0111] In embodiments, the antibody or antigen-binding fragment thereof has a human sequence Fc region or has 85% or more sequence identity therewith.
[0112] In embodiments, the antibody or fragment thereof is chimeric.
[0113] In embodiments, the antibody is a monospecific antibody comprising two heavy chains of identical sequence and two light chains of identical sequence.
[0114] In embodiments, the antibody is a monoclonal antibody.
[0115] In embodiments, the antibody is an IgG1() or an IgG4(). In embodiments, the antibody is an IgG2().
[0116] In embodiments, the Fn amyloid-like FadA-binding fragment is an Fab fragment, an Fab fragment, or an F(ab) fragment.
[0117] In embodiments, the Fn amyloid-like FadA-binding fragment is a single chain variable fragment (scFv).
[0118] A pharmaceutical composition is provided comprising an antibody which binds Fn amyloid-like FadA, or a Fn amyloid-like FadA-binding fragment thereof, or a Fn amyloid-like FadA-binding fusion protein, as described herein, and a carrier.
[0119] A method is provided of preventing or treating disease in a subject in a subject in need thereof comprising administering to the subject a therapeutically effective amount of an agent which inhibits or blocks an amyloid-like FadA secreted from Fusobacterium nucleatum (Fn).
[0120] A method is provided of reducing development of or treating disease associated with Fn amyloid-like FadA in a subject, comprising administering to the subject an amount of an agent which inhibits, blocks or binds a Fusobacterium nucleatum amyloid-like adhesin A FadA (Fn amyloid-like FadA) effective to reduce development of or treat a disease associated with Fn amyloid-like FadA.
[0121] In embodiments, the agent is an antibody, or Fn amyloid-like FadA-binding fragment, or Fn amyloid-like FadA-binding fusion protein as described herein.
[0122] In embodiments, the agent is Bapineuzumab, Solanezumab, Gantenerumab, Crenezumab, Ponezumab, Aducanumab, or BAN2401.
[0123] In embodiments, the agent is an antibody, and is a monoclonal antibody.
[0124] In embodiments, the agent is the pharmaceutical composition described herein.
[0125] In embodiments, the disease is associated with extra-oral Fusobacterium nucleatum in the subject.
[0126] In embodiments, the disease is a cancer, atherosclerosis, rheumatoid arthritis, a respiratory tract infection, or a gastrointestinal disorder.
[0127] In embodiments, the disease is a cancer. In embodiments, the cancer is pancreatic or colorectal.
[0128] In embodiments, the disease is associated with pathogenic, oral Fusobacterium nucleatum in the subject.
[0129] In embodiments, the disease is a dental disease.
[0130] In embodiments, the dental disease is periodontal bone loss.
[0131] In embodiments, the methods further comprise administering an anti-anaerobic bacteria antibiotic to the subject.
[0132] In embodiments, the agent is administered systemically or locally.
[0133] In embodiments, the antibiotic is administered systemically or locally.
[0134] In embodiments, the disease is colorectal cancer and the agent and/or antibiotic is administered rectally.
[0135] In embodiments, the antibiotic is a nitroimidazole.
[0136] In embodiments, the nitroimidazole is metronidazole.
[0137] A therapeutic mouthrinse is provided comprising i) an amount of an agent which inhibits, blocks or binds a Fusobacterium nucleatum amyloid-like adhesin A (Fn amyloid-like FadA) and ii) a liquid carrier.
[0138] In embodiments, the agent is an antibody, or Fn amyloid-like FadA-binding fragment, or Fn amyloid-like FadA-binding fusion protein, of any of Claims 1-14, Bapineuzumab, Solanezumab, Gantenerumab, Crenezumab, Ponezumab, Aducanumab, or BAN2401.
[0139] A method is provided of treating an oral or dental disease in a subject associated with pathogenic, oral Fusobacterium nucleatum (Fn) comprising administering an amount of the therapeutic mouthrinse of as described herein effective to treat the oral or dental disease.
[0140] In embodiments, the oral or dental disease is periodontal bone loss.
[0141] A method of inhibiting Fusobacterium nucleatum (Fn) mediated stimulation of a colon cancer in a subject comprising administering an amount of an antibody, or Fn amyloid-like FadA-binding fragment, or Fn amyloid-like FadA-binding fusion protein as described herein or pharmaceutical composition comprising such, or an amount of Bapineuzumab, Solanezumab, Gantenerumab, Crenezumab, Ponezumab, Aducanumab, or BAN2401, effective to inhibit Fn-mediated stimulation of a colon cancer.
[0142] In embodiments, the subject does not have, or has not been diagnosed with, a dementia.
[0143] In embodiments, the subject does not have, or has not been diagnosed with, Alzheimer's disease.
[0144] In embodiments, the methods further comprise obtaining, or having obtained, an identification of the subject as having Fn amyloid-like FadA pathogenic Fusobacterium nucleatum (Fn) resident in their body.
[0145] In embodiments, the presence of Fusobacterium nucleatum (Fn) is determined from detecting or quantifying an amount of Fn amyloid-like FadA in a sample from the subject and comparing the level of the Fn amyloid-like FadA in the sample to a reference value of the expression level of Fn amyloid-like FadA, wherein an amount in excess of the reference value indicates that the subject has a level of pathogenic Fn.
[0146] In embodiments, detecting or quantifying an amount of Fn amyloid-like FadA in a sample comprises contacting the sample, or a derivative from the sample, with an agent that binds Fn amyloid-like FadA.
[0147] In embodiments, the agent is an antibody or antibody fragment as described herein, or is an antibody that binds Fn amyloid-like FadA.
[0148] In embodiments, two or more different antibodies or antibody fragments are used to contact the sample or derivative from the sample.
[0149] In embodiments, the agent is Congo Red or Thioflavin-T.
[0150] In embodiments, the agent is conjugated to a detectable marker.
[0151] Fn amyloid-like FadA complexes are generated from Fn, and they do not encompass human amyloid proteins as generated from human cells.
[0152] A method is provided of diagnosing a disease in a tissue or organ of a subject as being associated with pathogenic Fusobacterium nucleatum comprising quantifying the amount of Fusobacterium nucleatum amyloid-like adhesin A (Fn amyloid-like FadA) in a sample of the diseased tissue or organ and comparing the level of the Fn amyloid-like FadA in the sample to a reference value of the expression level of Fn amyloid-like FadA, wherein a level Fn amyloid-like FadA in the sample above the reference value indicates that the disease is associated with pathogenic Fusobacterium nucleatum.
[0153] A method is provided of detecting a disease in a subject comprising: [0154] assaying a sample from the subject for the expression level of Fusobacterium nucleatum amyloid-like adhesin A (Fn amyloid-like FadA); [0155] comparing the level of the Fn amyloid-like FadA in the sample to a known reference value of the expression level of Fn amyloid-like FadA; [0156] detecting that the subject has a disease if the level of the expression of Fn amyloid-like FadA is increased as compared to the reference value.
[0157] In embodiments, the disease is a disease associated with Fn amyloid-like FadA.
[0158] In embodiments, the disease is a cancer, dental disease, atherosclerosis, rheumatoid arthritis, a respiratory tract infection, or a gastrointestinal disorder.
[0159] In embodiments, the disease is a cancer and is pancreatic or colorectal.
[0160] An antibody is provided which binds Fusobacterium nucleatum amyloid-like adhesin A (Fn amyloid-like FadA), or an Fn amyloid-like FadA-binding fragment thereof, or a Fn amyloid-like FadA-binding fusion protein as described herein for use as a medicament in treating a cancer or a dental disease.
[0161] In embodiments, the cancer is a colon cancer or a pancreatic cancer.
[0162] In embodiments, the dental disease is periodontal bone loss.
[0163] In embodiments, the antibody is Bapineuzumab, Solanezumab, Gantenerumab, Crenezumab, Ponezumab, Aducanumab, or BAN2401.
[0164] An antibody is provided which binds Fusobacterium nucleatum amyloid-like adhesin A (Fn amyloid-like FadA), or an Fn amyloid-like FadA-binding fragment thereof, or a Fn amyloid-like FadA-binding fusion protein, comprising, comprising complementary-determining regions CDR1 through CDR6, wherein one or more of CDR1 through CDR6 has 85% or greater identity with, but not 100% identity with, the CDR1 through CDR6 sequences set forth as follows: [0165] a heavy chain comprising: [0166] CDR1 having the sequence GYTFTTYW (SEQ ID NO: 1); [0167] CDR2 having the sequence INPNTDYT (SEQ ID NO:2); [0168] CDR3 having the sequence ARSGYFGSRYYFDY (SEQ ID NO:3); [0169] and either [0170] a light chain comprising: [0171] CDR4 having the sequence QSLANSYGNTY (SEQ ID NO:4); [0172] CDR5 having the sequence GIS (SEQ ID NO:5); [0173] CDR6 having the sequence LQGTHQPPT (SEQ ID NO:6); [0174] or [0175] a light chain comprising: [0176] CDR4 having the sequence QDINKY (SEQ ID NO:7); [0177] CDR5 having the sequence YTS (SEQ ID NO:8); [0178] CDR6 having the sequence LQYDYLLH (SEQ ID NO:9).
[0179] A nucleic acid encoding a heavy chain of an antibody as described herein.
[0180] A nucleic acid encoding a light chain of an antibody as described herein.
[0181] In embodiments, the nucleic acid is an expression vector.
[0182] A hybridoma is provided comprising a nucleic acid as described herein.
[0183] In embodiments, the anti-Fn amyloid-like FadA antibody or fragment thereof of the invention, comprises (i) a VH framework comprising the framework sequence of human germline IGHV1-2*02, IGHV1-2*04, IGHV1-2*05, IGHV1-18*04, IGHV1-69-2*01, IGHV1-46*01, IGHD5-12*01, IGHD5-24*01, IGHD6-25*01, IGHJ3*01, IGHJ4*01, IGHJ4*03, IGHJ6*01, IGHJ6*02 and/or (ii) a VL framework comprising the framework sequence of human germline IGKV1-13*02, IGKV1-27*01, IGKV3-7*02, IGKV4-1*01, IGKV1D-13*02, IGKV3D-7*01, IGKJ1*01, IGKJ2*01, IGKJ4*01, IGKJ4*02. In embodiments, the anti-Fn amyloid-like FadA or fragment thereof, comprises an optimized version of, having less than 100% sequence identity with, a (i) a VH framework comprising the framework sequence of human germline IGHV1-2*02, IGHV1-2*04, IGHV1-2*05, IGHV1-18*04, IGHV1-69-2*01, IGHV1-46*01, IGHD5-12*01, IGHD5-24*01, IGHD6-25*01, IGHJ3*01, IGHJ4*01, IGHJ4*03, IGHJ6*01, IGHJ6*02 and/or (ii) a VL framework comprising the framework sequence of human germline IGKV1-13*02, IGKV1-27*01, IGKV3-7*02, IGKV4-1*01, IGKV1D-13*02, IGKV3D-7*01, IGKJ1*01, IGKJ2*01, IGKJ4*01, IGKJ4*02.
[0184] Fragments of antibodies can be prepared, for example, by cleaving an intact antibody or by recombinant means. See generally, Fundamental Immunology, Ch. 7 (Paul, W., ed., 2nd ed. Raven Press, N.Y. (1989), hereby incorporated by reference in its entirety). Antigen-binding fragments may be produced by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies or by molecular biology techniques. In some embodiments, a fragment is an Fab, Fab, F(ab)2, Fd, Fv, complementarity determining region (CDR) fragment, single-chain antibody (scFv), (a variable domain light chain (VL) and a variable domain heavy chain (VH) linked via a peptide linker. In an embodiment, the scFv comprises a variable domain framework sequence having a sequence identical to a human variable domain FR1, FR2, FR3 or FR4. In an embodiment, the scFv comprises a linker peptide from 5 to 30 amino acid residues long. In an embodiment, the scFv comprises a linker peptide comprising one or more of glycine, serine and threonine residues.
[0185] In embodiments, a linker of the scFv is 10-25 amino acids in length. In an embodiment the peptide linker comprises glycine, serine and/or threonine residues. (For example, see Bird et al., Science, 242: 423-426 (1988) and Huston et al., Proc. Natl. Acad. Sci. USA, 85:5879-5883 (1988) each of which are hereby incorporated by reference in their entirety), or a polypeptide that contains at least a portion of an antibody that is sufficient to confer specific antigen binding on the polypeptide, including a diabody. From N-terminus to C-terminus, both the mature light and heavy chain variable domains comprise the regions FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The assignment of amino acids to each domain can be in accordance with the definitions of Kabat, Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987 and 1991)), Chothia & Lesk, J. Mol. Biol. 196:901-917 (1987), or Chothia et al., Nature 342:878-883 (1989), each of which are hereby incorporated by reference in their entirety).
[0186] The term monoclonal antibody as used herein refers to an antibody member of a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible mutations, e.g., naturally occurring mutations, that may be present in minor amounts. Thus, the modifier monoclonal indicates the character of the antibody as not being a mixture of discrete antibodies. In contrast to polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody of a monospecific monoclonal antibody preparation is directed against a single determinant on an antigen. A bispecific antibody, recognizing two antigens, in one embodiment, can be manufactured from two monoclonal antibodies. In addition to their specificity, monoclonal antibody preparations are advantageous in that they are typically uncontaminated by other immunoglobulins. Thus, an identified monoclonal antibody can be produced by non-hybridoma techniques, e.g., by appropriate recombinant means once the sequence thereof is identified.
[0187] In an embodiment of the inventions described herein, the antibody is isolated. As used herein, the term isolated antibody refers to an antibody that by virtue of its origin or source of derivation has one, two, three or four of the following: (1) is not associated with naturally associated components that accompany it in its native state, (2) is free of other proteins from the same species, (3) is expressed by a cell from a different species, and (4) does not occur in nature absent the hand of man.
[0188] In an embodiment the antibody is humanized. Humanized forms of non-human (e.g., murine) antibodies are chimeric antibodies that contain minimal sequence derived from non-human immunoglobulin. In one embodiment, a humanized antibody is a human immunoglobulin (recipient antibody) in which residues from a hypervariable region (HVR) (or CDR) of the recipient are replaced by residues from a HVR (or CDR) of a non-human species (donor antibody) such as mouse, rat, rabbit, or nonhuman primate having the desired specificity, affinity, and/or capacity. In an embodiment, the antibody has 1, 2, 3, 4, 5, or all 6 CDR1-3 of both the heavy and light chain of the antibodies described herein. In a preferred embodiment, framework (FR) residues of the murine mAb are replaced with corresponding human immunoglobulin variable domain framework (FR) residues. These may be modified further in embodiments to further refine antibody performance. Furthermore, in a specific embodiment, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. In an embodiment, the humanized antibodies do not comprise residues that are not found in the recipient antibody or in the donor antibody. In general, a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all, or in embodiments substantially all, of the hypervariable loops correspond to those of a non-human immunoglobulin, and all, or in embodiments substantially all, of the FRs are those of a human immunoglobulin sequence. The humanized antibody optionally will also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. See, e.g., Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature 332:323-329 (1988); Presta, Curr. Op. Struct. Biol. 2:593-596 (1992); Vaswani and Hamilton, Ann. Allergy, Asthma & Immunol. 1:105-115 (1998); Harris, Biochem. Soc. Transactions 23:1035-1038 (1995); Hurle and Gross, Curr. Op. Biotech. 5:428-433 (1994); and U.S. Pat. Nos. 6,982,321 and 7,087,409, the contents of each of which references and patents are hereby incorporated by reference in their entirety. In one embodiment where the humanized antibodies do comprise residues that are not found in the recipient antibody or in the donor antibody, the Fc regions of the antibodies are modified as described in WO 99/58572, the content of which is hereby incorporated by reference in its entirety.
[0189] Techniques to humanize a monoclonal antibody are well known. Some are described in, for example, U.S. Pat. Nos. 4,816,567; 5,807,715; 5,866,692; 6,331,415; 5,530,101; 5,693,761; 5,693,762; 5,585,089; and 6,180,370, the content of each of which is hereby incorporated by reference in its entirety. A number of humanized antibody molecules comprising an antigen-binding site derived from a non-human immunoglobulin have been described, including antibodies having rodent or modified rodent V regions and their associated complementarity determining regions (CDRs) fused to human constant domains. See, for example, Winter et al. Nature 349: 293-299 (1991), Lobuglio et al. Proc. Nat. Acad. Sci. USA 86: 4220-4224 (1989), Shaw et al. J. Immunol. 138: 4534-4538 (1987), and Brown et al. Cancer Res. 47: 3577-3583 (1987), the content of each of which is hereby incorporated by reference in its entirety. Other references describe rodent hypervariable regions or CDRs grafted into a human supporting framework region (FR) prior to fusion with an appropriate human antibody constant domain. See, for example, Riechmann et al. Nature 332: 323-327 (1988), Verhoeyen et al. Science 239: 1534-1536 (1988), and Jones et al. Nature 321: 522-525 (1986), the content of each of which is hereby incorporated by reference in its entirety. Another reference describes rodent CDRs supported by recombinantly veneered rodent framework regionsEuropean Patent Publication No. 0519596 (incorporated by reference in its entirety). These humanized molecules are designed to minimize unwanted immunological response toward rodent anti-human antibody molecules which limits the duration and effectiveness of therapeutic applications of those moieties in human recipients. The antibody constant region can be engineered such that it is immunologically inert (e.g., does not trigger complement lysis). See, e.g. PCT Publication No. WO99/58572; UK Patent Application No. 9809951.8. Other methods of humanizing antibodies that may also be utilized are disclosed by Daugherty et al., Nucl. Acids Res. 19: 2471-2476 (1991) and in U.S. Pat. Nos. 6,180,377; 6,054,297; 5,997,867; 5,866,692; 6,210,671; and 6,350,861; and in PCT Publication No. WO 01/27160 (each incorporated by reference in their entirety).
[0190] Other forms of humanized antibodies have one or more, or all, CDRs (CDR L1, CDR L2, CDR L3, CDR H1, CDR H2, or CDR H3) which are altered with respect to the original antibody, which are also termed one or more CDRs derived from one or more CDRs from the original antibody.
[0191] In embodiments, the antibodies or fragments herein can be produced recombinantly, for example antibodies expressed using a recombinant expression vector transfected into a host cell, antibodies isolated from a recombinant, combinatorial human antibody library, antibodies isolated from an animal (e.g., a mouse) that is transgenic for human immunoglobulin genes.
[0192] The term K.sub.d, as used herein, is intended to refer to the dissociation constant of an antibody-antigen interaction. One way of determining the K.sub.d or binding affinity of antibodies to the Fn amyloid-like FadA can be by measuring binding affinity of monofunctional Fab fragments of the antibody. (The affinity constant is the inverted dissociation constant). To obtain monofunctional Fab fragments, an antibody (for example, IgG) can be cleaved with papain or expressed recombinantly. The affinity of a fragment of an antibody can be determined, for example, by surface plasmon resonance (BIAcore3000 surface plasmon resonance (SPR) system, BIAcore Inc., Piscataway N.J.). CM5 chips can be activated with N-ethyl-N-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) according to the supplier's instructions. The antigen can be diluted into 10 mM sodium acetate pH 4.0 and injected over the activated chip at a concentration of 0.005 mg/mL. Using variable flow time across the individual chip channels, two ranges of antigen density can be achieved: 100-200 response units (RU) for detailed kinetic studies and 500-600 RU for screening assays. Serial dilutions (0.1-10 estimated K.sub.d) of purified Fab samples are injected for 1 min at 100 microliters/min and dissociation times of up to 2 h are allowed. The concentrations of the Fab proteins are determined by ELISA and/or SDS-PAGE electrophoresis using a Fab of known concentration (as determined by amino acid analysis) as a standard. Kinetic association rates (k.sub.on) and dissociation rates (k.sub.off) are obtained simultaneously by fitting the data to a 1:1 Langmuir binding model (Karlsson, R. Roos, H. Fagerstam, L. Petersson, B. (1994). Methods Enzymology 6. 99-110, the content of which is hereby incorporated in its entirety) using the BIA evaluation program. Equilibrium dissociation constant (K.sub.d) values are calculated as k.sub.off/k.sub.on. This protocol is suitable for use in determining binding affinity of an antibody or fragment to any antigen. Other protocols known in the art may also be used. For example, ELISA.
[0193] In embodiments, the antibody or antigen-binding fragment thereof or fusion protein binds to an Fn amyloid-like FadA with an affinity of 100.0 nM KD or stronger.
[0194] In embodiments, the antibody or antigen-binding fragment thereof or fusion protein binds to an Fn amyloid-like FadA with an affinity of 10.0 nM K.sub.D or stronger.
[0195] In embodiments, the antibody or antigen-binding fragment thereof or fusion protein binds to an Fn amyloid-like FadA with an affinity of 2.0 nM K.sub.D or stronger.
[0196] In embodiments, the antibody or antigen-binding fragment thereof or fusion protein binds to an Fn amyloid-like FadA with an affinity of 1.0 nM K.sub.D or stronger.
[0197] In embodiments, the antibody or antigen-binding fragment thereof or fusion protein binds to an Fn amyloid-like FadA with an affinity of 0.1 nM K.sub.D or stronger.
[0198] In embodiments, the antibodies of the invention have an EC.sub.50 for the antigen Fn amyloid-like FadA of 100 ng/ml or less.
[0199] An epitope that specifically binds to an antibody or a polypeptide is a term well understood in the art, and methods to determine such specific or preferential binding are also well known in the art. A molecular entity is said to exhibit specific binding or preferential binding if it reacts or associates more frequently, more rapidly, with greater duration and/or with greater affinity with a particular cell or substance than it does with alternative cells or substances. An antibody specifically binds or preferentially binds to a target if it binds with greater affinity, avidity, more readily, and/or with greater duration than it binds to other substances. For example, an antibody that specifically or preferentially binds to a given (conformational) sequence in Fn amyloid-like FadA is an antibody that binds this epitope with greater affinity, avidity, more readily, and/or with greater duration than it binds to other epitopes. In embodiments of the antibodies or fragments, herein the antibodies or fragments preferentially bind Fn amyloid-like FadA. It is also understood by reading this definition that, for example, an antibody (or moiety or epitope) that specifically or preferentially binds to a first target may or may not specifically or preferentially bind to a second target. As such, specific binding or preferential binding does not necessarily require (although it can include) exclusive binding.
[0200] Depending on the amino acid sequences of the constant domains of their heavy chains, antibodies (immunoglobulins) can be assigned to different classes. The antibody or fragment can be, e.g., any of an IgG, IgD, IgE, IgA or IgM antibody or fragment thereof, respectively. In an embodiment the antibody is an immunoglobulin G. In an embodiment the antibody fragment is a fragment of an immunoglobulin G. In an embodiment the antibody is an IgG1, IgG2, IgG2a, IgG2b, IgG3 or IgG4. In an embodiment the antibody comprises sequences from a human IgG1, human IgG2, human IgG2a, human IgG2b, human IgG3 or human IgG4. A combination of any of these antibody subtypes can also be used. One consideration in selecting the type of antibody to be used is the desired serum half-life of the antibody. For example, an IgG generally has a serum half-life of 23 days, IgA 6 days, IgM 5 days, IgD 3 days, and IgE 2 days. (Abbas A K, Lichtman A H, Pober J S. Cellular and Molecular Immunology, 4th edition, W.B. Saunders Co., Philadelphia, 2000, hereby incorporated by reference in its entirety).
[0201] The variable region or variable domain of an antibody refers to the amino-terminal domains of the heavy or light chain of the antibody. The variable domain of the heavy chain may be referred to as VH. The variable domain of the light chain may be referred to as VL. These domains are generally the most variable parts of an antibody and contain the antigen-binding sites. The term variable refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the variable domains of antibodies. It is concentrated in three segments called hypervariable regions (HVRs) (or CDRs) both in the light-chain and the heavy-chain variable domains. The more highly conserved portions of variable domains are called the framework regions (FR). The variable domains of native heavy and light chains each comprise four FR regions, largely adopting a beta-sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the beta-sheet structure. The CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, National Institute of Health, Bethesda, Md. (1991)). The constant domains are not involved directly in the binding of an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity.
[0202] The light chains of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa () and lambda (), based on the amino acid sequences of their constant domains.
[0203] Framework or FR residues are those variable domain residues other than the HVR residues as herein defined.
[0204] The term hypervariable region or HVR when used herein refers to the regions of an antibody variable domain which are hypervariable in sequence and/or form structurally defined loops. Generally, antibodies comprise six HVRs; three in the VH (H1, H2, H3) and three in the VL (L1, L2, L3). In native antibodies, H3 and L3 display the most diversity of the six HVRs, and H3 in particular is believed to play a unique role in conferring fine specificity to antibodies. See, e.g., Xu et al., Immunity 13:37-45 (2000); Johnson and Wu, in Methods in Molecular Biology 248:1-25 (Lo, ed., Human Press, Totowa, N.J., 2003). Indeed, naturally occurring camelid antibodies consisting of a heavy chain only are functional and stable in the absence of light chain. See, e.g., Hamers-Casterman et al., Nature 363:446-448 (1993); Sheriff et al., Nature Struct. Biol. 3:733-736 (1996). A number of HVR delineations are in use and are encompassed herein. The Kabat Complementarity Determining Regions (CDRs) are based on sequence variability and are the most commonly used (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991) hereby incorporated by reference in its entirety). There are CDRs 1, 2, and 3 for each of the heavy and light chains. Chothia refers instead to the location of the structural loops (Chothia and Lesk, J. Mol. Biol. 196:901-917 (1987)). The AbM HVRs represent a compromise between the Kabat HVRs and Chothia structural loops and are used by Oxford Molecular's AbM antibody modeling software. The contact HVRs are based on an analysis of the available complex crystal structures. HVRs may comprise extended HVRs as follows: 24-36 or 24-34 (L1), 46-56 or 50-56 (L2) and 89-97 or 89-96 (L3) in the VL and 26-35 (H1), 50-65 or 49-65 (H2) and 93-102, 94-102, or 95-102 (H3) in the VH. The variable domain residues are numbered according to Kabat et al., supra, for each of these definitions.
[0205] The term Fc region herein is used to define a C-terminal region of an immunoglobulin heavy chain, including native sequence Fc regions and variant Fc regions. Although the boundaries of the Fc region of an immunoglobulin heavy chain might vary, the human IgG heavy chain Fc region is usually defined to stretch from an amino acid residue at position Cys226, or from Pro230, to the carboxyl-terminus thereof. The C-terminal lysine of the Fc region may be removed, for example, during production or purification of the antibody, or by recombinantly engineering the nucleic acid encoding a heavy chain of the antibody. Accordingly, an intact antibody as used herein may be an antibody with or without the otherwise C-terminal lysine. In an embodiment, the Fc domain has the same sequence or 99% or greater sequence similarity with a human IgG1 Fc domain. In an embodiment, the Fc domain has the same sequence or 99% or greater sequence similarity with a human IgG2 Fc domain. In an embodiment, the Fc domain has the same sequence or 99% or greater sequence similarity with a human IgG3 Fc domain. In an embodiment, the Fc domain has the same sequence or 99% or greater sequence similarity with a human IgG4 Fc domain. In an embodiment, the Fc domain is not mutated. In an embodiment, the Fc domain is mutated at the CH2-CH3 domain interface to increase the affinity of IgG for FcRn at acidic but not neutral pH (Dall'Acqua et al, 2006; Yeung et al, 2009). In an embodiment, the Fc domain has the same sequence as a human IgG1 Fc domain.
[0206] In embodiments, the variable regions disclosed herein are not modified. In embodiments, the invention encompasses modifications to the variable regions disclosed herein. For example, the invention includes antibodies comprising functionally equivalent variable regions and CDRs which do not significantly affect their properties as well as variants which have enhanced or decreased activity and/or affinity. For example, the amino acid sequence may be mutated to obtain an antibody with the desired binding affinity to Fn amyloid-like FadA. Examples of modified polypeptides include polypeptides with conservative substitutions of amino acid residues, one or more deletions or additions of amino acids which do not significantly deleteriously change the functional activity, or which mature (enhance) the affinity of the polypeptide for its ligand or use of chemical analogs.
[0207] Amino acid sequence insertions include amino- and/or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Examples of terminal insertions include an antibody with an N-terminal methionyl residue or the antibody fused to an epitope tag. Other insertional variants of the antibody molecule include the fusion to the N- or C-terminus of the antibody of an enzyme or a polypeptide which increases the half-life of the antibody in the blood circulation.
[0208] Substitution variants have at least one amino acid residue in the antibody molecule removed and a different residue inserted in its place. The sites of greatest interest for substitutional mutagenesis include the hypervariable regions, but framework alterations are also contemplated. Conservative substitutions are shown in Table 1 under the heading of conservative substitutions. If such substitutions result in a change in biological activity, then more substantial changes, denominated exemplary substitutions in Table A, or as further described below in reference to amino acid classes, may be introduced and the products screened.
TABLE-US-00001 TABLE A Amino Acid Substitutions Original Conservative Residue Substitutions Exemplary Substitutions Ala (A) Val Val; Leu; Ile Arg (R) Lys Lys; Gln; Asn Asn (N) Gln Gln; His; Asp, Lys; Arg Asp (D) Glu Glu; Asn Cys (C) Ser Ser; Ala Gln (Q) Asn Asn; Glu Glu (E) Asp Asp; Gln Gly (G) Ala Ala His (H) Arg Asn; Gln; Lys; Arg Ile (I) Leu Leu; Val; Met; Ala; Phe; Norleucine Leu (L) Ile Norleucine; Ile; Val; Met; Ala; Phe Lys (K) Arg Arg; Gln; Asn Met (M) Leu Leu; Phe; Ile Phe (F) Tyr Leu; Val; Ile; Ala; Tyr Pro (P) Ala Ala Ser (S) Thr Thr Thr (T) Ser Ser Trp (W) Tyr Tyr; Phe Tyr (Y) Phe Trp; Phe; Thr; Ser Val (V) Leu Ile; Leu; Met; Phe; Ala; Norleucine
[0209] Substantial modifications in the biological properties of the antibody are accomplished by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a -sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. Naturally occurring residues are divided into groups based on common side-chain properties: [0210] (1) Non-polar: Norleucine, Met, Ala, Val, Leu, Ile; [0211] (2) Polar without charge: Cys, Ser, Thr, Asn, Gln; [0212] (3) Acidic (negatively charged): Asp, Glu; [0213] (4) Basic (positively charged): Lys, Arg; [0214] (5) Residues that influence chain orientation: Gly, Pro; and [0215] (6) Aromatic: Trp, Tyr, Phe, His.
[0216] Non-conservative substitutions are made by exchanging a member of one of these classes for another class.
[0217] One type of substitution, for example, that may be made is to change one or more cysteines in the antibody, which may be chemically reactive, to another residue, such as, without limitation, alanine or serine. For example, there can be a substitution of a non-canonical cysteine. The substitution can be made in a CDR or framework region of a variable domain or in the constant region of an antibody. In some embodiments, the cysteine is canonical. Any cysteine residue not involved in maintaining the proper conformation of the antibody also may be substituted, generally with serine, to improve the oxidative stability of the molecule and prevent aberrant cross-linking. Conversely, cysteine bond(s) may be added to the antibody to improve its stability, particularly where the antibody is an antibody fragment such as an Fv fragment.
[0218] A modification or mutation may also be made in a framework region or constant region to increase the half-life of an antibody. See, e.g., PCT Publication No. WO 00/09560. A mutation in a framework region or constant region can also be made to alter the immunogenicity of the antibody, to provide a site for covalent or non-covalent binding to another molecule, or to alter such properties as complement fixation, FcR binding and antibody-dependent cell-mediated cytotoxicity. According to the invention, a single antibody may have mutations in any one or more of the CDRs or framework regions of the variable domain or in the constant region.
[0219] In an embodiment, an antibody described herein is recombinantly produced. In an embodiment, the fusion protein is produced in a eukaryotic expression system.
[0220] In an embodiment, the fusion protein produced in the eukaryotic expression system comprises glycosylation at a residue on the Fc portion corresponding to Asn297.
[0221] Compositions or pharmaceutical compositions comprising the antibodies, ScFvs or fragments of antibodies disclosed herein are preferably comprise stabilizers to prevent loss of activity or structural integrity of the protein due to the effects of denaturation, oxidation or aggregation over a period of time during storage and transportation prior to use. The compositions or pharmaceutical compositions can comprise one or more of any combination of salts, surfactants, pH and tonicity agents such as sugars can contribute to overcoming aggregation problems. Where a composition or pharmaceutical composition of the present invention is used as an injection, it is desirable to have a pH value in an approximately neutral pH range, it is also advantageous to minimize surfactant levels to avoid bubbles in the formulation which are detrimental for injection into subjects. In an embodiment, the composition or pharmaceutical composition is in liquid form and stably supports high concentrations of bioactive antibody in solution and is suitable for inhalational or parenteral administration. In an embodiment, the composition or pharmaceutical composition is suitable for intravenous, intramuscular, intraperitoneal, intradermal and/or subcutaneous injection. In an embodiment, the composition or pharmaceutical composition is in liquid form and has minimized risk of bubble formation and anaphylactoid side effects. In an embodiment, the composition or pharmaceutical composition is isotonic. In an embodiment, the composition or pharmaceutical composition has a pH or 6.8 to 7.4.
[0222] In an embodiment the ScFvs or fragments of antibodies disclosed herein are lyophilized and/or freeze dried and are reconstituted for use.
[0223] Examples of pharmaceutically acceptable carriers include, but are not limited to, phosphate buffered saline solution, sterile water (including water for injection USP), emulsions such as oil/water emulsion, and various types of wetting agents. Preferred diluents for aerosol or parenteral administration are phosphate buffered saline or normal (0.9%) saline, for example 0.9% sodium chloride solution, USP. Compositions comprising such carriers are formulated by well-known conventional methods (see, for example, Remington's Pharmaceutical Sciences, 18th edition, A. Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990; and Remington, The Science and Practice of Pharmacy 20th Ed. Mack Publishing, 2000, the content of each of which is hereby incorporated in its entirety). In non-limiting examples, the can comprise one or more of dibasic sodium phosphate, potassium chloride, monobasic potassium phosphate, polysorbate 80 (e.g., 2-[2-[3,5-bis(2-hydroxyethoxy)oxolan-2-yl]-2-(2-hydroxyethoxy)ethoxy]ethyl (E)-octadec-9-enoate), disodium edetate dehydrate, sucrose, monobasic sodium phosphate monohydrate, and dibasic sodium phosphate dihydrate.
[0224] The antibodies, or fragments of antibodies, or compositions, or pharmaceutical compositions described herein can also be lyophilized or provided in any suitable forms including, but not limited to, injectable solutions or inhalable solutions, gel forms and tablet forms.
[0225] In an embodiment the composition or pharmaceutical composition comprising the antibody, or antigen-binding fragment thereof, described herein is substantially pure with regard to the antibody, or antigen-binding fragment thereof. A composition or pharmaceutical composition comprising the antibody, or antigen-binding fragment thereof, described herein is substantially pure with regard to the antibody or fragment when at least 60% to 75% of a sample of the composition or pharmaceutical composition exhibits a single species of the antibody, or antigen-binding fragment thereof. A substantially pure composition or pharmaceutical composition comprising the antibody, or antigen-binding fragment thereof, described herein can comprise, in the portion thereof which is the antibody, or antigen-binding fragment, 60%, 70%, 80% or 90% of the antibody, or antigen-binding fragment, of the single species, more usually about 95%, and preferably over 99%. Purity or homogeneity may be tested by a number of means well known in the art, such as polyacrylamide gel electrophoresis or HPLC.
[0226] Administration can be auricular, buccal, conjunctival, cutaneous, subcutaneous, endocervical, endosinusial, endotracheal, enteral, epidural, via hemodialysis, interstitial, intrabdominal, intraamniotic, intra-arterial, intra-articular, intrabiliary, intrabronchial, intrabursal, intracardiac, intracartilaginous, intracaudal, intracavernous, intracavitary, intracerebral, intracisternal, intracorneal, intracoronary, intradermal, intradiscal, intraductal, intraepidermal, intraesophagus, intragastric, intravaginal, intragingival, intraileal, intraluminal, intralesional, intralymphatic, intramedullary, intrameningeal, intramuscular, intraocular, intraovarian, intraepicardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratendinous, intratesticular, intrathecal, intrathoracic, intratubular, intratumor, intratympanic, intrauterine, intravascular, intravenous, intraventricular, intravesical, intravitreal, laryngeal, nasal, nasogastric, ophthalmic, oral, oropharyngeal, parenteral, percutaneous, periarticular, peridural, rectal, inhalationally, retrobulbar, subarachnoid, subconjuctival, sublingual, submucosal, topically, transdermal, transmucosal, transplacental, transtracheal, ureteral, uretheral, and vaginal.
[0227] In embodiments, the antibody, fragment or fusion protein is administered at a dose of 0.5 mg/kg to 100 mg/kg. In embodiments, the antibody, fragment or fusion protein is administered at a dose of 101 mg/kg to 250 mg/kg. In embodiments, the antibody, fragment or fusion protein is administered at a dose of 251 mg/kg to 500 mg/kg. In embodiments, the antibody, fragment or fusion protein is administered at a dose of 501 mg/kg to 1000 mg/kg. In embodiments, the antibody, fragment or fusion protein is administered at a dose of 1001 mg/kg to 2000 mg/kg. In embodiments, the antibody, fragment or fusion protein is administered at a dose of up to 25 mg twice per daily, daily, every other day, weekly, monthly or every three months. In embodiments, the antibody, fragment or fusion protein is administered at a dose of 25 to 100 mg twice per daily, daily, every other day, weekly, monthly or every three months. In embodiments, the antibody, fragment or fusion protein is administered at a dose of 100 to 250 mg twice per daily, daily, every other day, weekly, monthly or every three months. In embodiments, the antibody, fragment or fusion protein is administered at a dose of 250 to 500 mg twice per daily, daily, every other day, weekly, monthly or every three months. In embodiments, the antibody, fragment or fusion protein is administered at a dose of 500 to 1000 mg twice per daily, daily, every other day, weekly, monthly or every three months. In embodiments, the antibody, fragment or fusion protein is administered at a dose of 1000 to 2000 mg twice per daily, daily, every other day, weekly, monthly or every three months.
[0228] A control value or a reference value of a parameter is a concept well-established in the art. For example, a reference value (a single value or a value range, for example) for the expression level of Fn amyloid-like FadA can be determined from one or more samples from, for example, unafflicted subjects, and can be normalized and/or matched as necessary.
[0229] And/or as used herein, for example, with option A and/or option B, encompasses the separate embodiments of (i) option A, (ii) option B, and (iii) option A plus option B.
[0230] All combinations of the various elements described herein are within the scope of the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
Experimental Results
[0231] Fusobacterium nucleatum (Fn) is a Gram-negative oral commensal, prevalent in various human diseases. It is unknown how this common commensal converts to a rampant pathogen. We report here that Fn secretes an adhesin (FadA) with amyloid-like properties (Fn amyloid-like FadA) via the Fap2 autotransporter to enhance its virulence. The extracellular FadA binds Congo Red and Thioflavin-T, as well as antibodies raised against human amyloid 42. Fn produces amyloid-like FadA under stress and disease conditions, but not in healthy sites or tissues. It functions as a scaffold for biofilm formation, confers acid tolerance, and mediates Fn binding to host cells. Furthermore, amyloid-like FadA induces periodontal bone loss and promotes CRC progression in mice, with its pathological effects attenuated by amyloid-binding compounds. The uncleaved signal peptide of FadA is required for the formation and stability of mature FadA fibrils. Our study provides a link between periodontal disease and CRC, and indicates anti-amyloid therapies as interventions for Fn-mediated disease processes.
[0232] Fn Produces Amyloid-Like FadA Regulated by Growth Phase
[0233] A distinctive property of amyloid and amyloid-like assemblies is their ability to bind amyloidophilic compounds such as Congo Red and Thioflavin-T (Evans et al, 2018; Tukel et al, 2009). To determine if Fn expresses amyloid-like FadA, we assessed whether Fn and its mutants bind Congo Red. Wild type Fn 12230 clearly bound Congo Red, depleting it from the solution in a density-dependent manner, while the fadA-deletion mutant US1 (fadA) was defective (
[0234] Because Congo Red was depleted in a bacterial density-dependent manner, we conducted a kinetic analysis to examine production of amyloid-like FadA over the course of growth. Fn cultures were harvested and lysed at increasing time points following subculture and incubated with 1% sarkosyl. Resistance to ionic detergent is a characteristic of amyloid-like proteins (Sondheimer & Lindquist, 2000). Sarkosyl-resistant (i.e., amyloid-like) FadA (pellet) increased over time, and by 48 hours (late stationary phase), FadA was only detected in the pellet but not in supernatant, indicating the existence of FadA as predominantly insoluble aggregates (
[0235] To examine the production of amyloid-like FadA aggregates, we employed semi-denaturing detergent agarose gel electrophoresis (SDD-AGE), followed by Western blot analysis using anti-FadA monoclonal antibody (mAb) 7H7. Amyloid-like (as opposed to amorphous or globular) assemblies are SDS-resistant and SDD-AGE allows for the resolution of these structures based on their size and resistance to the ionic detergent SDS. Fn produced massive and heterogeneously-sized amyloid-like FadA assemblies in stationary phase, similar as the curli-producing E. coli, but not in log phase (
[0236] Image analyses were then conducted to visually examine the FadA aggregates. Increased secretion of FadA aggregates by wild-type Fn was detected by immunohistochemistry (IHC) in stationary phase compared to log phase (
[0237] Pre-FadA is a Key Component of Amyloid-Like FadA Secreted by Type V Autotransporter Fap2
[0238] FadA is an unusual adhesin in that it exists in two forms: a full-length peptide consisting of 129 aa residues (15.5 kDa), termed pre-FadA, and a cleaved mature form consisting of 111 aa residues (13.6 kDa) without the signal peptide, termed mFadA (
[0239] Using SDD-AGE and Western blot analysis using mAb 7H7, we found that FadAc expressed in E. coli also formed detergent-resistant polymers, although their sizes were smaller than those produced by Fn. In contrast, mFadA did not form polymers (
[0240] To evaluate whether, and to what degree, FadA and its variants self-assemble into amyloid-like aggregates, we assessed binding of recombinant FadA proteins to two different antibodies that recognize amyloid structures: polyclonal anti-human amyloid- antibodies OC and A11. The difference between these two antibodies is that A11 recognizes pre-fibril oligomers, while OC recognizes mature fibrils (Kayed et al, 2007). Only A11 is suitable for immunofluorescence staining, but both can be used for the analysis of purified proteins by slot blot. Among the recombinant FadA mutants tested, L14A and L76A did not produce pre-FadA (
[0241] FadA proteins that reacted with A11 or OC bound the amyloid-specific dye Thioflavin-T in a dose-dependent manner. Without SDS, mFadA bound more Thioflavin-T than FadAc at the same protein concentrations tested, possibly because more filaments are available for binding (
[0242] To further investigate the role of pre-FadA in amyloid formation, we utilized a previously isolated spontaneous mutant, lam (for less adhesive mutant), which is defective in Fn autoaggregation, binding to host cells, and induction of IL8 (Han et al, 2000). The lam mutant was defective in producing pre-FadA but not mFadA (
[0243] DNA sequencing analysis of wild-type Fn 12230 and lam revealed two variations: (i) a 6-aa in-frame deletion in an open reading frame (ORF) sharing 62.3% identity to the Fap2 protein from Fn ATCC 23726, and (ii) a missense mutation (N284I) in a glycerol kinase homolog (Table 2). Fap2 is a Type V autotransporter required for Fn to interact with the immune cells and colonization in colorectal tumors (Abed et al, 2016; Coppenhagen-Glazer et al, 2015; Kaplan et al, 2010). It is possible that Fap2 is required for secretion of pre-FadA and/or the FadA polymers. Therefore, we analyzed Fn 23726 and its fap2 mutant in stationary phase by SDD-AGE and Western blot analysis. Similar to Fn 12230, Fn 23726 formed highly heterogeneous SDS-resistant FadA polymers while the fap2 mutant was almost completely defective (
[0244] Amyloid-Like FadA is Detected in Periodontal Disease and CRC
[0245] Our data indicates that not only does FadA assemble into an amyloid-like structure, but the formation of these structures is a regulated process. We hypothesize that the transition of FadA from monomers to amyloid-like fibrils substantiates Fn pathogenicity. Therefore, we examined the presence of amyloid-like FadA in periodontal disease and CRC. Previous studies have reported Fn and fadA gene levels are significantly increased in the colonic tissues and fecal microbiome of CRC patients, compared to the controls (Kostic et al, 2013; Rubinstein et al., 2013; Wirbel et al., 2019). Similarly, Fn 16S rRNA and fadA genes are also increased in periodontal diseased sites, compared to healthy subjects or healthy sites of periodontitis patients (
[0246] Amyloid-FadA Facilitates Biofilm Formation
[0247] In both periodontal disease and CRC, biofilms play important roles, allowing bacteria to secure colonization in the host, resist host immune defense, and acquire nutrients from other members of the microbial community (Tomkovich et al, 2019). We hypothesize that amyloid-like FadA may serve as a scaffold for biofilm formation. Sarkosyl-insoluble pellets were obtained from Fn 12230, US1 (fadA), and lam by differential centrifugation as described above, and were used to coat 96-well plates, followed by inoculation of Fn12230 (experimental scheme outlined in
[0248] To confirm it was indeed the amyloid-like FadA that promoted biofilm formation, we repeated the experiment in the presence of Congo Red (scheme detailed in
[0249] Amyloid-Like FadA Confers Acid Tolerance
[0250] Since Fn and fadA are detected in the fecal microbiome, it indicates the microorganism travels through the GI tract (Thomas et al., 2019; Wirbel et al., 2019). We speculate that secreted amyloid-like FadA may serve as a protective shield facilitating Fn survival in the acidic gastric environment (see
[0251] To determine whether and to what extent amyloid-like FadA plays a role in the observed acid-resistance of Fn, the viability of wild type and US1 (fadA) in stationary phase at pH 4.0 was tested in the presence or absence of Congo Red. Remarkably, Congo Red drastically reduced viability of wild-type Fn to the similar levels as US1, without affecting US1 (fadA), indicating that the FadA-mediated acid-resistance relies solely on its amyloid-like properties (
[0252] Amyloid-Like FadA Facilitates Fn Binding to CRC Cells
[0253] Fn binding to human CRC cells DLD1 increased by 2.5-fold in stationary phase compared to log phase (
[0254] Amyloid-Like FadA Facilitates Fn Colonization and Stimulation of CRC In Vivo
[0255] To examine the role of amyloid-like FadA in CRC progression in vivo, a mouse xenograft model was used. Consistent with the in vitro observations, Congo Red significantly inhibited Fn colonization in xenograft tumors (
[0256] Amyloid-Like FadA Induces Periodontal Bone Loss in Mice
[0257] To assess the virulence potential of amyloid-like FadA in periodontal disease, a mouse periodontitis model was established. Fn 12230, US1 (fadA) and lam were inoculated continuously into the oral cavity of C56BL/6 mice for 10 weeks. Significant periodontal bone loss was detected in the molars of mice treated with Fn 12230, but not in those treated with US1 (fadA) or lam (
[0258] Discussion
[0259] Fn is an abundant commensal bacterium dwelling in the oral flora of both periodontal healthy and periodontal disease-affected individuals. It is present in gingivitis, a reversible form of periodontal disease, but also in more severe forms of periodontitis where irreversible tissue damages occur. Once outside the oral cavity, Fn causes infections that are often life threatening. The motivation of this study was to determine how this bacterium functions both as a ubiquitous oral commensal and a rampant systemic pathogen. Here, we show that the virulence factor FadA undergoes a dramatic biochemical transformation into an amyloid-like structure to enhance its virulence potential. The amyloid-like FadA exhibits common amyloid properties such as binding to amyloid dyes Congo Red and Thioflavin-T, resistance to ionic detergents, and formation of large heterogeneous filamentous aggregates. In addition, it reacts with antibodies raised against human amyloid 42, which shares no primary sequence homology with FadA. The emergent amyloid-like properties of FadA facilitate several critical pathogenic attributes that ultimately allow Fn to survive under stressful conditions, form biofilms, bind host cells, colonize CRC tumors, stimulate CRC progression and induce periodontal bone loss. In particular, the enhanced virulence can be inhibited by the amyloid dyes or the anti-amyloid antibodies, indicating the critical role of the amyloid properties in pathogenesis. Amyloid-like FadA is specifically enriched in diseased periodontal sites and in colonic carcinomas, but not in the non-diseased controls, supporting that amyloid-like FadA may serve as a molecular switch for the commensal-to-pathogen conversion. Alternatively, expressing of amyloid-like FadA could also be an adaptive response to the changing environment, which then enhances the virulence potential of Fn. These two scenarios are not mutually exclusive, similar to the positive feedback interactions between FadA and Annexin A1 in CRC (Rubinstein et al., 2019).
[0260] Fn has long been recognized as an essential component of subgingival biofilm. The discovery of amyloid-like FadA as a scaffold sheds mechanistic light on the critical role of Fn in dental plaque development. Furthermore, our data from the mouse periodontitis model indicates that Fn plays more than just a scaffolding role in periodontal disease; instead, it is actively involved in the disease process. Our results clearly demonstrate that amyloid-like FadA, rather than FadA monomers, is the key driver of pathogenesis, not only in periodontal disease, but also in CRC progression. Recent studies have linked periodontal disease to CRC (Kim et al, 2019). The causal role of amyloid FadA in both periodontal disease and CRC provides a possible mechanistic link between these two diseases. Elevated amyloid-like FadA in periodontal disease sites may facilitate systemic dissemination of Fn thus increasing the risk for developing systemic infections such as pregnancy complications as well as cancer.
[0261] The current study reveals that in the presence of amyloid FadA, Fn could survive the acidic environment and disseminate through the GI tract. While Fn can also disseminate via circulation, the saliva, which contains high titers of bacteria, is constantly being swallowed, providing a means for GI dissemination. Findings of significantly increased Fn and fadA in the fecal microbiome of CRC patients are consistent with the GI translocation (Thomas et al., 2019; Wirbel et al., 2019). Oral inoculation of Fn stimulated colonic tumor formation in mice (Kostic et al., 2013; Rubinstein et al., 2019). We note that bacterial conglomerates, as they are in saliva, could be even more resistant to acidic environment than a singular species in planktonic broth. We have recently demonstrated that the Fusobacteria communities in stomach and colon share more similarities, with their community diversities significantly reduced compared to in saliva (Richardson et al, 2020). It is plausible that Fn strains expressing elevated amyloid-FadA may have selective advantage during transmission, through either circulation or the GI tract. Identification of amyloid-producing Fn may help identify individuals at risk for developing diseases implicated by Fn.
[0262] It should be pointed out that acid tolerance is not only beneficial to the bacteria during GI translocation, but also help their survival in the tumor microenvironment. Due to increased glycolysis in cancer, high levels of lactate are secreted, leading to acidic extracellular environment (Jiang, 2017). The enhanced colonization and growth stimulation of CRC by amyloid FadA may be due to a combination of enhanced biofilm formation, acid tolerance, and binding to the cancer cells.
[0263] Previous studies showed that pre-FadA is required for FadA function (Temoin et al, 2012b; Xu et al., 2007). We now discover that it is a key component of amyloid-like FadA, required for the formation of mature fibrils. It is unclear if pre-FadA alone, or a mixture of pre-FadA and mFadA, is present in the secreted amyloid-like FadA. We speculate that the mFadA filaments observed in the crystal structure could be intercalated with pre-FadA. The highly hydrophobic signal peptides from two neighboring filaments may form anti-parallel -sheets serving as hooks to link the filaments, stacking multiple FadA filaments into fibrous structure (
[0264] The finding that amyloid-like FadA is secreted via the autotransporter Fap2 is unexpected and intriguing. Since the Fap2 mutants are defective in producing pre-FadA, without affecting mFadA, Fap2 may be required for secreting pre-FadA and/or amyloid-like FadA. Fap2 mutants have been found to be defective for colonizing murine placentas and colorectal tumors, similar as the fadA-deletion mutant (Abed et al., 2016; Coppenhagen-Glazer et al., 2015). It is plausible that some effects exhibited by the Fap2 mutant may be due to lack of amyloid-FadA. Since wild-type Fn produces significantly larger polymers than E. coli expressing FadA, additional bacterial components may be involved in the fibril formation and/or secretion.
[0265] Unveiling the significance of amyloid-like FadA in Fn pathogenesis opens new doors for therapies. CRC implicated with Fn often has poor prognosis, due to its activation of the oncotarget Annexin A1, induction of chemo-resistance and stimulation of metastasis (Bullman et al, 2017; Casasanta et al, 2020; Mima et al, 2016; Rubinstein et al., 2019; Yu et al, 2017). However, the use of broad-spectrum antimicrobials to treat cancer is undesirable due to disturbance of the entire flora. A specific therapy against Fn virulence factors may be more effective. Our results suggest that targeting amyloid-like FadA could substantially and specifically inhibit the pathogenic potential of Fn in multiple diseases. While Congo Red is very unlikely to be useful due to its carcinogenicity, the anti-FadA antibody 7H7 and many other anti-amyloid compounds, such as those inhibiting polymerization of the curli fibers produced by E. coli (Cegelski et al, 2009), present untapped potential as anti-cancer agents. Some anti-amyloid drugs that have failed as treatments for neurodegenerative disease because of the immense challenge of traversing the blood-brain barrier could have previously unexpected utility against Fn-driven CRC and other debilitating diseases. Since FadA is uniquely encoded by Fusobacterium (Han et al., 2005), it is an ideal therapeutic target to specifically inhibit Fn-mediated pathogenesis.
[0266] In summary, we present evidence that Fn regulates its virulence by controlling the production of amyloid-like FadA. With increasing evidence of commensal microbes turning pathogenic in various human diseases, the discovery that Fn secretes an amyloid-like adhesin to enhance its pathogenicity represents a novel paradigm. Furthermore, the discovery that an amyloid-like bacterial protein promotes both periodontal disease and tumorigenesis not only sheds remarkable new lights on how oral health could impact extra-oral infections, but also broadens the scope for therapeutic development for a variety of human diseases.
[0267] Materials and Methods
[0268] Bacterial strains and cell cultures. The bacterial strains used in this study are listed in Table 4. Fn strains were grown as described (Han, 2006). Human CRC cells DLD1 were maintained as previously described (Rubinstein et al., 2019; Rubinstein et al., 2013). E. coli MC4100, csg, and csgA were kindly provided by Dr. Matthew Chapman at University of Michigan.
[0269] Congo Red depletion assay. Fn 12230, US1(fadA) and lam were grown to stationary phase, followed by resuspension in PBS to OD600 of 0.5, 1.0, 1.5 and 2.0. Five microliters of 2 mg/ml Congo Red (Sigma-Aldrich CAT #C6277) was added to 1 ml bacterial suspension to reach a final concentration of 10 g/ml and incubated at room temperature for 10 min. The bacterial suspensions were centrifuged at 10,000 g for 5 min. An aliquot of 200 l of supernatant was transferred to a 96-well plate to measure OD500 in a microplate reader. Each experiment was performed in duplicate and repeated four times.
[0270] Semi-denaturing detergent agarose gel electrophoresis (SDD-AGE). Fn 12230, Fn 23726 and their respective mutants were grown to 0.3-0.4 OD600 (log phase) or >0.8 OD600 (stationary phase). Recombinant E. coli BL21 expressing FadAc or mFadA were grown to 0.6 OD600, followed by induction with 1 mM IPTG for 3 hours. E. coli MC4100, curli and csgA were grown for 48 h at 26 C. on YESCA plates. The bacteria were then collected by centrifugation at 5,000 g for 5 min, and lysed by incubation in the lysis buffer (10 mM Tris pH8.0, 0.1 M NaCl, 0.1 mM EDTA, 0.5% Triton X-100, and 2 mg/ml lysozyme) at 40 C. for 20 min with rotation. Sarkosyl was then added to a final concentration of 1% and incubated at 40 C. for 20 min with rotation. The samples were centrifuged at 18,000 g at 40 C. for 20 min. After measuring the protein concentrations by BCA, the pellets were stored at 80 C. until use. An aliquot of 50 g (for E. coli, Fn 23726 and its mutants) or 100 g (for Fn 12230 and its mutants) of the pellets prepared above were incubated with 4loading buffer [0.5TAE (20 mM Tris pH 8.3, 20 mM acetic acid, 0.5 mM EDTA), 8% SDS, 20% glycerol, bromophenol blue] for 10 min before loading onto 1.7% agarose gel containing 0.5TAE and 0.1% SDS. The electrophoresis was carried out overnight at 40 C with circulating 0.5TAE containing 0.1% SDS. Components on the gel were then immobilized onto nitrocellulose membrane by capillary transfer in TBS (50 mM Tris-HCl, 150 mM NaCl pH 7.4) for 24 hours at room temperature, followed by Western blot analysis (see below).
[0271] Western-blot analysis. One milliliter each of Fn 12230, US1 and lam in stationary phase was pelleted by centrifugation, and loaded onto 12% SDS-PAGE. Following electrophoresis, the bacterial components were transferred to PVDF membranes (Bio-Rad, Hercules, CA). The membrane was blocked with 5% skim milk in TBS containing 0.1% Tween 20 (TBST) at room temperature for 1 hour followed by incubation with anti-FadA monoclonal antibody (mAb) 7H7 at 1:4000 dilution in 0.5% skim milk in TBST at 4 C. overnight. After washing three times with TBST, the membrane was incubated with HRP-conjugated goat-anti-mouse IgG at 1:4,000 dilution in TBST at room temperature for 1 hour. Following washes, the immune-reactive components were detected with ECL Western Blotting Substrate (Thermo Fisher Scientific).
[0272] Time course study. Fn 12230 and US1 were sub-cultured to OD600 of 0.1 and grown in Columbia Broth supplemented with 5 g/ml hemin and 1 g/ml menadione at 37 C. under anaerobic conditions. Ten OD600 units of bacteria were harvested by centrifugation at 12-hr intervals, followed by centrifugation at 5,000 g for 5 min. The bacteria were lysed with 500 l lysis buffer containing 2 mg/ml lysozyme at 40 C. for 20 min with rotation, followed by addition of sarkosyl to a final concentration of 1% and incubated at 4 C. for 20 min with rotation. An aliquot of 30 l homogeneous mixture was saved as Total sample. The remaining mixture was centrifuged at 100,000 g for 20 min at 4 C. An aliquot of 30 l supernatant was saved as Supernatant. The pellet was resuspended in 470 l lysis buffer, and an aliquot of 30 l was taken as Pellet sample. The samples were then analyzed by Western blot analysis as described above. Ponceau staining of lysozyme was used as a loading control.
[0273] Slot blot assay. Ten micrograms each of purified recombinant protein was slot-blotted onto nitrocellulose membrane (BioRad) and assayed for reactivity with polyclonal anti-amyloid fibril antibodies OC (-amyloid fibril OC, Sigma-Aldrich CAT #AB2286) at 1:5,000 dilution and goat-anti-rabbit IgG (GE Healthcare) at 1:10,000 dilution, or polyclonal anti-amyloid oligomer antibody A11 (-oligomer A11 at 1:5,000 dilution, ThermoFisher Scientific CAT #AHB0052) and goat-anti-rabbit IgG at 1:10,000 dilution, followed by detection with ECL Prime (GE Healthcare). Amyloid-like recombinant Rim4 was used as a positive control (Berchowitz et al., 2015) and histone H1 was used as a negative control. Loading was assessed by Ponceau stain (Sigma CAT #P7170).
[0274] Thioflavin-T binding assay. Thioflavin-T assay was conducted as previously described (Tukel et al., 2009). A mixture of 50 l of FadA proteins and 50 l of 10 M Thioflavin-T was added to a black 96-well plate and incubated for 10 min at room temperature. After incubation, the fluorescence intensity was determined using a SpectraMax M5 microplate reader at excitation wavelength of 440 nm and emission wavelength of 500 nm. For SDS stability test, the FadA proteins were pre-incubated in 0.1% SDS for 30 min at room temperature, followed by Thioflavin-T binding assay as described above.
[0275] Immunohistochemistry (IHC). Bacteria and dental plaque samples were fixed in 4% paraformaldehyde, resuspended in PBS and placed on electro-charged slides. Endogenous peroxidase was quenched in 3% hydrogen peroxide for 30 min, followed by washing. Slides were incubated with 5% skim milk for 1 hour at room temperature, followed by anti-FadA mAb 7H7 raised against FadAc at 1:800 dilution or mouse IgG isotype control (R&D Systems, Minneapolis, MN) overnight at 40 C. After washing, slides were blocked in 2.5% horse serum for 1 hour at room temperature and incubated with ImmPRESS HRP anti-mouse IgG (Vector Lab) for 30 min at room temperature followed by washes, before being developed with the DAB Peroxidase Substrate Kit (Vector Lab), counter stained hematoxylin, dried by sequential incubation in 70%, 95%, 100% ethanol and xylene, and covered in Permount mounting medium (Fisher chemical).
[0276] For formalin-fixed paraffin embedded (FFPE) mouse xenograft tumors, the slides were incubated at 60 C. for 1 hour, and de-paraffinized by incubation in xylene for three times, followed by rehydration with sequential incubation in 100%, 95%, 70% ethanol, ddH.sub.2O and PBS. Endogenous peroxidase was quenched in 3% hydrogen peroxide for 15 min, followed by washing. Slides were incubated with 2.5% horse serum in PBS containing 0.5% BSA for 2 hours at room temperature, followed by anti-Fn polyclonal antibodies at 1:500 dilution or rabbit IgG isotype control (Invitrogen) overnight at 40 C. After washing, slides were incubated with ImmPRESS HRP anti-rabbit IgG (Vector Lab) and developed as described above.
[0277] Double-immunofluorescent staining. Bacterial cells were fixed, washed with PBS and placed on slides followed by incubation with 3% hydrogen peroxide and 5% skim milk as described above. Slides were incubated with anti-FadA mAb 7H7 antibody at 1:800 dilution and anti-amyloid oligomer antibody A11 (ThermoFisher Scientific CAT #AHB0052) at 1:500 dilution or mouse IgG (R&D Systems, Minneapolis, MN) and rabbit IgG isotype (Invitrogen) controls overnight at 40 C. After washing, slides were incubated with Alexa Fluor 680-conjugated donkey anti-rabbit (Invitrogen) at 1: 1,000 dilution and Alexa Fluor 555-conjugated goat anti-mouse (Invitrogen) at 1:1,000 dilution, washed and covered in mounting medium containing DAPI.
[0278] For human colonic specimens, frozen tissue sections were fixed in 4% paraformaldehyde for 15 min, sequentially washed by 70% ethanol, ddH.sub.2O and PBS, and permeabilized by 0.1% Triton X-100 in PBS followed by blocking in 5% skim milk. Slides were incubated with -FadA mAb 7H7 antibody at 1:50 dilution and -amyloid antibody A11 at 1:25 dilution, or mouse and rabbit IgG controls, overnight at 40 C. Then slides were washed, incubated with secondary antibodies as described above.
[0279] Scanning Electron Microscope (SEM). Bacteria cultures were harvested by gentle centrifugation, washed in PBS, re-suspended in 2% (v/v) glutaraldehyde in PBS and fixed for one hour at 4 C. Bacteria were fixed again by 1% osmium tetroxide in PBS for one hour at 4 C. Fixed bacteria were dehydrated with 25%, 50%, 75% and 100% ethanol, then dried with the Critical Point Dryer (CPD) to remove ethanol. Before imaging, samples were coated with Au/Pd to be electrical conductive during electron microscopy. Zeiss Sigma VP SEM instrument was used at an operating voltage of 3 kV with an InLense detector to obtain more surface information of the bacteria exterior. ThermoFisher/FEI Talos F200FEI instrument operating at 200 kV was also utilized to observe both interior and exterior of bacteria at higher magnifications.
[0280] Bacterial genome sequencing and variation identification. Fn12230 and lam DNA was extracted using modified protocol of the Qiagen MagAttract PowerMicrobiome DNA/RNA Kit (Qiagen 27500-4-EP). To obtain the genome reference of Fn strain, paired-end library was prepared based on a low-volume Nextera sequencing protocol (Baym et al, 2015) and sequenced on Illumina HiSeq 4000 or HiSeq X platform to generate more than 3 million paired-end reads for each sample. Raw reads were then processed by Cutadapt v2.1 with following parameters --minimum-length 25:25 -u 15 -u -5 -U 15 -U -5 -q 15 --max-n 0 --pair-filter=any to remove low-quality bases and Nextera adapters. PacBio long-read sequencing was performed for the reference strain Fn 12230 by SNPsaurus to improve the performance of de novo genome assembling. Illumina reads passing quality filtering and PacBio long reads were assembled using Unicycler with hybrid mode to generate the genome sequence of reference strain and the genome were then annotated using Prokka v1.13.3 with parameter --rnammer -rfam. A complete genome of Fn 12230 (2.42 Mbp) and two circular plasmids (46.3 Kbp and 5.85 Kbp) was obtained. To identify the genomic variation of lam, the reads obtained with lam were aligned to the assembled reference genome using Bowtie2 v2.3.4 in paired-end mode with default setting. Resulting reads alignments were then processed by SAMtools v1.9 and Picard to fix paired-end mate and remove PCR duplicates. Remaining alignments in BAM format were processed using BCFtools v1.9 with following parameters --ploidy 1 and VCFtools v0.1.17 to call genomic variation (SNPs and Indels). Resulting variations were further subjected to manual inspection to remove any false positive due to low reads coverage and misalignment of homologous regions. The illumina reads for both strains, Pacbio reads for Fn12230 and de novo genome assembly of Fn12230 are deposited in NCBI database with the accession number SRA: PRJNA632750.
[0281] Verification of SNPs between Fn 12230 and lam. For each SNP in lam identified by genome sequencing, primers were designed (Table 5) to amplify the SNP-containing region from Fn 12230 and lam by PCR. The PCR amplicons were submitted for Sanger sequencing (Vendor) to verify the sequence variations.
[0282] Circular dichroism (CD) test. CD was used to evaluate the secondary structure of FadA and its mutants. One hundred microliter of 0.2 mg/ml purified FadA was analyzed by Chirascan V100 Spectrometer using a 1 mm path-length fused quartz cell. The measurements are an average of three scans for each sample, captured at a scan rate of 1 sec., bandwidth and step size of 1 nm, over a wavelength range of 190-250 nm. CD spectra were recorded and analyzed with BestSel server (see www at bestsel.elte.hu/).
[0283] Collection of dental plaque samples. This study was reviewed and approved by the Institutional Review Board of Columbia University Medical Center (IRB-AAAR7153). Subjects were recruited from patients who presented to Columbia University College of Dental Medicine. Inclusion criteria included subjects of 18 years of age or older who were in good general health or controlled common systemic conditions. Subjects with chronic periodontitis were defined as those with presence of proximal attachment loss 3 mm in 2 non-adjacent teeth. Both diseased and healthy sites (probing depth 3 mm, without clinical attachment loss and bleeding on probing) are present in the oral cavity. Periodontally healthy subjects were defined as those with no site with probing depth 3 mm, no site with attachment loss and bleeding on probing at 10% sites. Subjects who had been on antibiotics within 3 months of enrollment, were diagnosed with infectious diseases, such as HIV and hepatitis, and had history of periodontal treatment within 6 months, smoked more than 10 cigarettes per day, had uncontrolled or poorly controlled diabetes or other metabolic diseases, as well as women who were pregnant or nursing a child, were excluded. Written consent form was obtained from all the subjects before the plaque collection. Subgingival plaque samples were collected using sterilized curettes from the interproximal areas from a group of 40 patients: 20 diagnosed with chronic periodontitis and 20 periodontally healthy participants, matched for age, gender and race. From each patient with chronic periodontitis, two subgingival plaque samples were collected, with one pooled from the diseased sites (probing depth 7 mm, with clinical attachment loss) and another pooled from healthy sites (probing depth 3 mm, without clinical attachment loss and bleeding on probing).
[0284] Real-time quantitative PCR. DNA was extracted from plaque samples and the concentration was measured using NanoDrop ND 1000 spectrophotometer. Real-time quantitative PCR (qPCR) was performed in duplicates, using StepOnePlus (Applied Biosystems). Each 20 l reaction was prepared with Power SYBR Green PCR Master Mix kit according to the manufacturer's instructions (Applied Biosystems). Specific forward and reverse primers, listed in the Table 5, were used at concentration of 500 nM. PCR amplifications were performed as following: 95 C. for 10 minutes followed by 40 cycles of 95 C. for 30 seconds, 60 C. for 30 seconds, and 72 C. for 30 seconds, then 95 C. for 15 seconds and 60 C. for 1 minute, ending with a 95 C. for 15 seconds. To quantify gene copies, standard curves using plasmids carrying 16S rRNA gene or fadA gene were generated. Each experiment was performed in duplicate and repeated at least twice.
[0285] Biofilm assay. An aliquot of 50 l 0.2 mg/ml detergent-resistant pellet, or PBS, was added into each well in a 96-well plate and incubated at 37 C. for 5 hrs. A total of 200 l Fn 12230 (OD600 0.2), or Columbia broth alone, was added to the wells in the presence of 0, 10, and 50 g/ml Congo Red, followed by anaerobic incubation at 37 C. for 48 or 72 hrs. The wells were then washed, and the biofilms were stained with 100 l 0.1% crystal violet solution for 15 min. After washing, 100 l 95% ethanol was added to each well and incubate for 15 min at room temperature, and the optical density at OD550 was measured in a microplate reader. Each experiment was performed in duplicate and repeated four times. [00194] pH tolerance assay. Fn 12230 and US1 were grown to 0.4 OD600 (log phase) or >0.8 OD600 (stationary phase), resuspended in pre-reduced PBS at pH 4.0 or 7.0, and incubated at room temperature with or without 50 g/ml Congo Red. At 0, 1, or 2 hours, aliquots of the bacterial suspension were taken for serial dilutions and plating on blood agar plates. The plates were incubated anaerobically at 37 C. to enumerate the viable cell counts. Each experiment was performed in duplicate or triplicate and repeated 3-5 times.
[0286] Cell culture attachment assay. The assay was performed as previously described (Han et al., 2000). Briefly, DLD1 cells were seeded in 24-well plates at 110.sup.5 cells per well and grown to 90% confluent. The bacteria were either used or washed twice with PBS or 1 mg/mL Congo Red, before adding to the monolayers at a multiplicity of infection (MOI) of 50:1 and incubated for 1 hour at 37 C. in 5% CO.sub.2. Following washes with PBS, the monolayers were lysed with water, and serial dilutions of the lysates were plated onto blood agar plates to enumerate the total cell-associated bacteria. The level of attachment was expressed as the percentage of bacteria recovered following cell lysis relative to the total number of bacteria initially added. Each experiment was performed in duplicate and repeated four times. For the inhibitory binding assays, 20 l mAb 7H7, or 50 g FadA with or without 20 l rabbit IgG (1 mg/ml) or OC were mixed with Fn before adding to the cells.
[0287] CRC xenograft model. Four to five-week old female NCR/NU mice were purchased from Taconic Biosciences (NY, USA). An inoculum of 510.sup.6 HCT116 cells was injected subcutaneously and bilaterally into the mice. After 3-5 days, the following were injected into the tumors: 510.sup.6 CFU bacterial cells washed twice with PBS or 1 mg/ml Congo Red, 4 l (2 mg/ml) FadAc mixed with 6 l -amyloid OC antibody or rabbit IgG control, or 10 l (2 mg/ml) sarkosyl resistant pellets prepared from Fn or US1 (fadA) alone, or 4 l (5 mg/ml) sarkosyl resistant pellets mixed with 6 l rabbit IgG or OC. The tumor length and width were measured using calipers and tumor volumes were calculated using the following formula: Volume=(width)2length/2. After the tumors were taken out, they were fixed in 4% PFA for 24 hours and embedded in paraffin for IHC as described above.
[0288] Mouse periodontitis model. This study was reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) under Animal Care Protocol AC-AAAT1453 (Y2 M01). C57BL/6 mice were premedicated with prophylactic antibiotic regimen 1 week prior to bacterial inoculation. Approximately 110.sup.9 CFU each of Fn 12230, US1, and lam were resuspended in 2% carboxymethylcellulose (CMC). The oral cavity of 8 week-old C57BL/6 mice were prophylactically swabbed with 0.12% chlorhexidine gluconate in order to reduce endogenous bacterial flora prior to bacterial inoculation. Fn 12230, US1, and lam resuspended in CMC were administered via oral inoculation three-four times a week for 10 weeks, with CMC alone being administered as a control. At the conclusion of the 10-week period, inoculated C57BL/6 mice were sacrificed via CO.sub.2 and cervical dislocation, serum was collected by cardiac puncture, and mice were decapitated. Jaws were defleshed, maxillae were harvested, fixed in 4% paraformaldehyde (PFA) for 24 hours, and stored in 70% ethanol for prior to CT analysis.
[0289] CT analysis of mouse bone. Maxillae harvested from CMC alone, Fn 12230, US1, and lam inoculated C57BL/6 mice were scanned for CT using a Scanco vivaCT 80 System (Brttisellen, Switzerland) using machine settings of 55 kVp, 145 A, and 250 ms integration time. Grayscale images were reconstructed with a voxel size of 10.4 m, smoothed using a Gaussian filter to remove noise (sigma=0.8, support=1), and threshold was set at 40% of the maximum grayscale value to isolate mineralized tissue. CEJ to alveolar crest measurements were made manually on reconstructed images using ImageJ. Measurements for each mesiobuccal, distobuccal, buccal, and palatal root, or palatal root alone, among all mice were averaged, and the standard deviation was determined. The differences between groups were examined by two-tailed t-test and p<0.05 was considered statistically significant.
[0290] Statistical analysis. The differences between groups were examined by paired t-test or one-way ANOVA. P value<0.05 was considered statistically significant.
TABLE-US-00002 TABLE 1 Circular dichroism analysis of FadA protein. Wavelength range for Protein analysis (nm) helix (%) strand (%) FadAc 190-250 47.2 9.6 L-9A 190-250 24.4 21.8 mFadA 190-250 27.9 18.8 L14A 190-250 44.2 11.6 S71A 190-250 49.1 8
TABLE-US-00003 TABLE 2 SNP comparison between Fn 12230 and lam. Genome sequence Sanger sequence Location Fn Fn Variation (nt) 12230 lam 12230 lam Notes 1 1229082 A T T T Not a SNP 2 1472751 T C C C Not a SNP 3 1998179 A C 18 nt Indel confirmed: 6-aa in- frame deletion from ORF of 4501 aa, with 62.3% identity to Fap2 from Fn 23726 4 2028098 19 15 19 19 Not a SNP (GTCC) (GTCC) (GTCC) (GTCC) 5 2139412 A T A A Not a SNP 6 2180734 T A T A SNP confirmed: N284I in ORF of 845 aa; homologous to glycerol kinase
TABLE-US-00004 TABLE 3 FadA homologs identified on Fn 12230. Sequence Coverage of Gene identity alignment name CDS id Contig Start End Strand Length to FadA to FadA FadA DOJBCGPA_00667 Fnuc_hybrid.0 611715 612103 + 387 nt/ 100.00% 100.00% 129 aa FadA DOJBCGPA_00650 Fnuc_hybrid.0 590415 590816 + 402 nt/ 24.50% 96.10% 2 134 aa FadA DOJBCGPA_02330 Fnuc_hybrid.0 2332940 2333334 + 393 nt/ 25.00% 96.10% 3 131 aa
TABLE-US-00005 TABLE 4 Bacterial strains used in this study. Strain name Description Reference E. coli BL 21 Vector control (Xu et al, (DE3)/pET21(b) 2007) E. coli BL 21 Expresses recombinant FadAc (Xu et al., (DE3)/pYWH417-6 2007) E. coli BL 21 Expressed recombinant mFadA This study (DE3)/pYWH418 E. coli MC4100 Curli-producing strain (Evans et al, 2018) E. coli MC4100 Curli-defective mutant (Evans et al., csg 2018) E. coli MC4100 Curli-defective mutant (Evans et al., csgA 2018) Fn 12230 Trans tracheal isolate; lab working (Han et al, strain; Fn subsp polymorphum 2000) US1 fadA-deletion mutant of Fn 12230 (Han et al, 2005) lam Spontaneous mutant of Fn 12230 (Han et al., 2000) Fn ATCC 23726 Fn subsp nucleatum ATCC Fn 23726 (fap2) fap2-deletion mutant of Fn 23726 (Kaplan et al, 2009)
TABLE-US-00006 TABLE5 Primersusedinthisstudy. Primer name Primersequences(5-3) Bacterial16S ACTCCTACGGGAGGCAGCAG(SEQIDNO:10) F Bacterial16S ATTACCGCGGCTGCTGG(SEQIDNO:11) R Fn16SF AAGCGCGTCTAGGTGGTTATGT(SEQIDNO:12) Fn16SR TGTAGTTCCGCTTACCTCTCCAG(SEQIDNO:13) fadAF TAGCACAAAATGAACAAGTTTAC(SEQIDNO:14) fadAR ATAAAATCTTGTGTTAGCTTC(SEQIDNO:15) SNP1F CGATCTAGAATGAGTAAAAGCTTTTATAT(SEQIDNO:16) SNP1R CGACTCGAGTTATTTAGATTTATTAAGTT(SEQIDNO:17) SNP2F CGGTCTAGAATGAAAAAATCTTATATTTT(SEQIDNO:18) SNP2R CGACTCGAGTCAATTAGAGAATTTATTTT(SEQIDNO:19) SNP3F GCTCAAGAGTTGGGGGAACA(SEQIDNO:20) SNP3R TCCACCAGCATGTTGAACTGT(SEQIDNO:21) SNP4F TTGCTGTATGTCCGCCTGTT(SEQIDNO:22) SNP4R ATCGGACTTCCTGCTGAGAT(SEQIDNO:23) SNP5F AGCTCAAACTGGTGAGCCAA(SEQIDNO:24) SNP5R TCAGCCTTTGGGGCTTCTTC(SEQIDNO:25) SNP6F AAGGCAGTGAGTCAACCAGT(SEQIDNO:26) SNP6R TGCCCACCAATTAAAGTTGCAC(SEQIDNO:27)
TABLE-US-00007 TABLE6 Novelanti-amyloid-likeFadAantibody.VH&VL1orVH-VL2. Nucleotidesequence Translation VH CDR1 ggctacacctttactacctactgg GYTFTTYW(SEQID NO:1) CDR2 attaatcctaacactgattatact INPNTDYT(SEQID NO:2) CDR3 gcaagatccggttacttcggtagtaggtactactttgactac ARSGYFGSRYYFDY (SEQIDNO:3) VL1 CDR1 cagagtcttgcaaacagttatgggaacacctat QSLANSYGNTY(SEQ IDNO:4) CDR2 gggatttcc GIS(SEQIDNO:5) CDR3 ttacaaggtacacatcagcctccgacg LQGTHQPPT(SEQID NO:6) VL2 CDR1 caagacattaacaagtat QDINKY(SEQIDNO:7) CDR2 tacacatct YTS(SEQIDNO:8) CDR3 ctacagtatgattatcttctacac LQYDYLLH(SEQID NO:9)
[0291] Data Availability
[0292] The illumina reads of Fn 12230 and the lam mutant, Pacbio reads for Fn 12230, and de novo genome assembly of Fn12230 are deposited in NCBI database with the accession number SRA: PRJNA632750.
REFERENCES
[0293] Abed J, Emgard J E, Zamir G, Faroja M, Almogy G, Grenov A, Sol A, Naor R, Pikarsky E, Atlan K A et al (2016) Fap2 Mediates Fusobacterium nucleatum Colorectal Adenocarcinoma Enrichment by Binding to Tumor-Expressed Gal-GalNAc. Cell Host Microbe 20: 215-225 [0294] Baym M, Kryazhimskiy S, Lieberman T D, Chung H, Desai M M, Kishony R (2015) Inexpensive multiplexed library preparation for megabase-sized genomes. PLoS One 10: e0128036 [0295] Berchowitz L E, Kabachinski G, Walker M R, Carlile T M, Gilbert W V, Schwartz T U, Amon A (2015) Regulated Formation of an Amyloid-like Translational Repressor Governs Gametogenesis. Cell 163: 406-418 [0296] Boke E, Ruer M, Wuhr M, Coughlin M, Lemaitre R, Gygi S P, Alberti S, Drechsel D, Hyman A A, Mitchison T J (2016) Amyloid-like Self-Assembly of a Cellular Compartment. Cell 166: 637-650 [0297] Bullman S, Pedamallu C S, Sicinska E, Clancy T E, Zhang X, Cai D, Neuberg D, Huang K, Guevara F, Nelson T et al (2017) Analysis of Fusobacterium persistence and antibiotic response in colorectal cancer. Science 358: 1443-1448 [0298] Casasanta M A, Yoo C C, Udayasuryan B, Sanders B E, Umana A, Zhang Y, Peng H, Duncan A J, Wang Y, Li L et al (2020) Fusobacterium nucleatum host-cell binding and invasion induces IL-8 and CXCL1 secretion that drives colorectal cancer cell migration. Science signaling 13 [0299] Castellarin M, Warren R L, Freeman J D, Dreolini L, Krzywinski M, Strauss J, Barnes R, Watson P, Allen-Vercoe E, Moore R A et al (2012) Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma. Genome Res 22: 299-306 [0300] Cegelski L, Pinkner J S, Hammer N D, Cusumano C K, Hung C S, Chorell E, Aberg V, Walker I N, Seed P C, Almqvist F et al (2009) Small-molecule inhibitors target Escherichia coli amyloid biogenesis and biofilm formation. Nature chemical biology 5: 913-919 [0301] Coppenhagen-Glazer S, Sol A, Abed J, Naor R, Zhang X, Han Y W, Bachrach G (2015) Fap2 of Fusobacterium nucleatum is a galactose-inhibitable adhesin involved in coaggregation, cell adhesion, and preterm birth. Infect Immun 83: 1104-1113 [0302] Evans M L, Gichana E, Zhou Y, Chapman M R (2018) Bacterial Amyloids. In: Amyloid Proteins: Methods and Protocols, Sigurdsson E. M., Calero M., Gasset M. (eds.) pp. 267-288. Springer New York: New York, NY [0303] Fardini Y, Wang X, Temoin S, Nithianantham S, Lee D, Shoham M, Han Y W (2011) Fusobacterium nucleatum adhesin FadA binds vascular endothelial cadherin and alters endothelial integrity. Mol Microbiol 82: 1468-1480 [0304] Han Y W (2006) Laboratory maintenance of fusobacteria. Curr Protoc Microbiol Chapter 13: Unit 13A 11 [0305] Han Y W, Fardini Y, Chen C, Iacampo K G, Peraino V A, Shamonki J M, Redline R W (2010) Term stillbirth caused by oral Fusobacterium nucleatum. Obstet Gynecol 115: 442-445 [0306] Han Y W, Ikegami A, Rajanna C, Kawsar H I, Zhou Y, Li M, Sojar H T, Genco R J, Kuramitsu H K, Deng C X (2005) Identification and characterization of a novel adhesin unique to oral fusobacteria. J Bacteriol 187: 5330-5340 [0307] Han Y W, Shen T, Chung P, Buhimschi I A, Buhimschi C S (2009) Uncultivated bacteria as etiologic agents of intra-amniotic inflammation leading to preterm birth. J Clin Microbiol 47: 38-47 [0308] Han Y W, Shi W, Huang G T, Kinder Haake S, Park N H, Kuramitsu H, Genco R J (2000) Interactions between periodontal bacteria and human oral epithelial cells: Fusobacterium nucleatum adheres to and invades epithelial cells. Infect Immun 68: 3140-3146 [0309] Hsieh Y Y, Tung S Y, Pan H Y, Yen C W, Xu H W, Lin Y J, Deng Y F, Hsu W T, Wu C S, Li C (2018) Increased Abundance of Clostridium and Fusobacterium in Gastric Microbiota of Patients with Gastric Cancer in Taiwan. Scientific reports 8: 158 [0310] Ikegami A, Chung P, Han Y W (2009) Complementation of the fadA mutation in Fusobacterium nucleatum demonstrates that the surface-exposed adhesin promotes cellular invasion and placental colonization. Infect Immun 77: 3075-3079 [0311] Jiang B (2017) Aerobic glycolysis and high level of lactate in cancer metabolism and microenvironment. Genes Dis 4: 25-27 [0312] Kaplan C W, Ma X, Paranjpe A, Jewett A, Lux R, Kinder-Haake S, Shi W (2010) Fusobacterium nucleatum outer membrane proteins Fap2 and RadD induce cell death in human lymphocytes. Infect Immun 78: 4773-4778 [0313] Kayed R, Head E, Sarsoza F, Saing T, Cotman C W, Necula M, Margol L, Wu J, Breydo L, Thompson J L et al (2007) Fibril specific, conformation dependent antibodies recognize a generic epitope common to amyloid fibrils and fibrillar oligomers that is absent in prefibrillar oligomers. Molecular neurodegeneration 2: 18 [0314] Kim G W, Kim Y S, Lee S H, Park S G, Kim D H, Cho J Y, Hahm K B, Hong S P, Yoo J H (2019) Periodontitis is associated with an increased risk for proximal colorectal neoplasms. Scientific reports 9: 7528 [0315] Kostic A D, Chun E, Robertson L, Glickman J N, Gallini C A, Michaud M, Clancy T E, Chung D C, Lochhead P, Hold G L et al (2013) Fusobacterium nucleatum potentiates intestinal tumorigenesis and modulates the tumor-immune microenvironment. Cell Host Microbe 14: 207-215 [0316] Kostic A D, Gevers D, Pedamallu C S, Michaud M, Duke F, Earl A M, Ojesina A I, Jung J, Bass A J, Tabernero J et al (2012) Genomic analysis identifies association of Fusobacterium with colorectal carcinoma. Genome Res 22: 292-298 [0317] Liu Y, Baba Y, Ishimoto T, Iwatsuki M, Hiyoshi Y, Miyamoto Y, Yoshida N, Wu R, Baba H (2019) Progress in characterizing the linkage between Fusobacterium nucleatum and gastrointestinal cancer. Journal of gastroenterology 54: 33-41 [0318] Manson McGuire A, Cochrane K, Griggs A D, Haas B J, Abeel T, Zeng Q, Nice J B, MacDonald H, Birren B W, Berger B W et al (2014) Evolution of invasion in a diverse set of Fusobacterium species. mBio 5: e01864 [0319] Mima K, Nishihara R, Qian Z R, Cao Y, Sukawa Y, Nowak J A, Yang J, Dou R, Masugi Y, Song M et al (2016) Fusobacterium nucleatum in colorectal carcinoma tissue and patient prognosis. Gut 65: 1973-1980 [0320] Mitsuhashi K, Nosho K, Sukawa Y, Matsunaga Y, Ito M, Kurihara H, Kanno S, Igarashi H, Naito T, Adachi Y et al (2015) Association of Fusobacterium species in pancreatic cancer tissues with molecular features and prognosis. Oncotarget 6: 7209-7220 [0321] Nithianantham S, Xu M, Yamada M, Ikegami A, Shoham M, Han Y W (2009) Crystal structure of FadA adhesin from Fusobacterium nucleatum reveals a novel oligomerization motif, the leucine chain. J Biol Chem 284: 3865-3872 [0322] Ortiz P, Bissada N F, Palomo L, Han Y W, Al-Zahrani M S, Panneerselvam A, Askari A (2009) Periodontal therapy reduces the severity of active rheumatoid arthritis in patients treated with or without tumor necrosis factor inhibitors. J Periodontol 80: 535-540 [0323] Richardson M, Ren J, Rubinstein M R, Taylor J A, Friedman R A, Shen B, Han Y W (2020) Analysis of 16S rRNA genes reveals reduced Fusobacterial community diversity when translocating from saliva to GI sites. Gut Microbes 12: 1-13 [0324] Rubinstein M R, Baik J E, Lagana S M, Han R P, Raab W J, Sahoo D, Dalerba P, Wang T C, Han Y W (2019) Fusobacterium nucleatum promotes colorectal cancer by inducing Wnt/beta-catenin modulator Annexin A1. EMBO reports [0325] Rubinstein M R, Wang X, Liu W, Hao Y, Cai G, Han Y W (2013) Fusobacterium nucleatum promotes colorectal carcinogenesis by modulating E-cadherin/0-catenin signaling via its FadA adhesin. Cell Host Microbe 14: 195-206 [0326] Sanchez I, Mahlke C, Yuan J (2003) Pivotal role of oligomerization in expanded polyglutamine neurodegenerative disorders. Nature 421: 373-379 [0327] Segata N, Haake S K, Mannon P, Lemon K P, Waldron L, Gevers D, Huttenhower C, Izard J (2012) Composition of the adult digestive tract bacterial microbiome based on seven mouth surfaces, tonsils, throat and stool samples. Genome biology 13: R42 [0328] Sondheimer N, Lindquist S (2000) Rnq1: an epigenetic modifier of protein function in yeast. Molecular cell 5: 163-172 [0329] Strauss J, Kaplan G G, Beck P L, Rioux K, Panaccione R, Devinney R, Lynch T, Allen-Vercoe E (2011) Invasive potential of gut mucosa-derived Fusobacterium nucleatum positively correlates with IBD status of the host. Inflamm Bowel Dis 17: 1971-1978 [0330] Swidsinski A, Dorffel Y, Loening-Baucke V, Theissig F, Ruckert J C, Ismail M, Rau W A, Gaschler D, Weizenegger M, Kuhn S et al (2011) Acute appendicitis is characterised by local invasion with Fusobacterium nucleatum/necrophorum. Gut 60: 34-40 [0331] Tayeb-Fligelman E, Tabachnikov O, Moshe A, Goldshmidt-Tran O, Sawaya M R, Coquelle N, Colletier J P, Landau M (2017) The cytotoxic Staphylococcus aureus PSMalpha3 reveals a cross-alpha amyloid-like fibril. Science 355: 831-833 [0332] Temoin S, Chakaki A, Askari A, El-Halaby A, Fitzgerald S, Marcus R E, Han Y W, Bissada N F (2012a) Identification of oral bacterial DNA in synovial fluid of patients with arthritis with native and failed prosthetic joints. J Clin Rheumatol 18: 117-121 [0333] Temoin S, Wu K L, Wu V, Shoham M, Han Y W (2012b) Signal peptide of FadA adhesin from Fusobacterium nucleatum plays a novel structural role by modulating the filament's length and width. FEBS Lett 586: 1-6 [0334] Thomas A M, Manghi P, Asnicar F, Pasolli E, Armanini F, Zolfo M, Beghini F, Manara S, Karcher N, Pozzi C et al (2019) Metagenomic analysis of colorectal cancer datasets identifies cross-cohort microbial diagnostic signatures and a link with choline degradation. Nature medicine 25: 667-678 [0335] Tomkovich S, Dejea C M, Winglee K, Drewes J L, Chung L, Housseau F, Pope J L, Gauthier J, Sun X, Muhlbauer M et al (2019) Human colon mucosal biofilms from healthy or colon cancer hosts are carcinogenic. J Clin Invest 129: 1699-1712 [0336] Tukel C, Wilson R P, Nishimori J H, Pezeshki M, Chromy B A, Baumler A J (2009) Responses to amyloids of microbial and host origin are mediated through toll-like receptor 2. Cell Host Microbe 6: 45-53 [0337] Umana A, Sanders B E, Yoo C C, Casasanta M A, Udayasuryan B, Verbridge S S, Slade D J (2019) Utilizing Whole Fusobacterium Genomes To Identify, Correct, and Characterize Potential Virulence Protein Families. J Bacteriol 201 [0338] Wang X, Buhimschi C S, Temoin S, Bhandari V, Han Y W, Buhimschi I A (2013) Comparative microbial analysis of paired amniotic fluid and cord blood from pregnancies complicated by preterm birth and early-onset neonatal sepsis. PLoS One 8: e56131 [0339] Wirbel J, Pyl P T, Kartal E, Zych K, Kashani A, Milanese A, Fleck J S, Voigt A Y, Palleja A, Ponnudurai R et al (2019) Meta-analysis of fecal metagenomes reveals global microbial signatures that are specific for colorectal cancer. Nature medicine 25: 679-689 [0340] Xu M, Yamada M, Li M, Liu H, Chen S G, Han Y W (2007) FadA from Fusobacterium nucleatum utilizes both secreted and nonsecreted forms for functional oligomerization for attachment and invasion of host cells. J Biol Chem 282: 25000-25009 [0341] Yu T, Guo F, Yu Y, Sun T, Ma D, Han J, Qian Y, Kryczek I, Sun D, Nagarsheth N et al (2017) Fusobacterium nucleatum Promotes Chemoresistance to Colorectal Cancer by Modulating Autophagy. Cell 170: 548-563 e516 [0342] Evans M L, Gichana E, Zhou Y, Chapman M R (2018) Bacterial Amyloids. In: Amyloid Proteins: Methods and Protocols, Sigurdsson E. M., Calero M., Gasset M. (eds.) pp. 267-288. Springer New York: New York, NY [0343] Han Y W, Ikegami A, Rajanna C, Kawsar H I, Zhou Y, Li M, Sojar H T, Genco R J, Kuramitsu H K, Deng C X (2005) Identification and characterization of a novel adhesin unique to oral fusobacteria. J Bacteriol 187: 5330-5340 [0344] Han Y W, Shi W, Huang G T, Kinder Haake S, Park N H, Kuramitsu H, Genco R J (2000) Interactions between periodontal bacteria and human oral epithelial cells: Fusobacterium nucleatum adheres to and invades epithelial cells. Infect Immun 68: 3140-3146 [0345] Kaplan C W, Lux R, Haake S K, Shi W (2009) The Fusobacterium nucleatum outer membrane protein RadD is an arginine-inhibitable adhesin required for inter-species adherence and the structured architecture of multispecies biofilm. Mol Microbiol 71: 35-47 [0346] Xu M, Yamada M, Li M, Liu H, Chen S G, Han Y W (2007) FadA from Fusobacterium nucleatum utilizes both secreted and nonsecreted forms for functional oligomerization for attachment and invasion of host cells. J Biol Chem 282: 25000-25009