COMPOSITION FOR PREVENTING OR TREATING INFLAMMATORY DISEASES, CONTAINING, AS ACTIVE INGREDIENT STEM CELLS OVEREXPRESSING SOD3
20240075072 ยท 2024-03-07
Inventors
Cpc classification
A61K35/51
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K35/28
HUMAN NECESSITIES
International classification
A61K35/28
HUMAN NECESSITIES
A61K35/50
HUMAN NECESSITIES
A61K35/51
HUMAN NECESSITIES
Abstract
The present invention provides a pharmaceutical composition for preventing or treating inflammatory diseases, containing, as an active ingredient, stem cells overexpressing SOD3. The present inventor has ascertained that mesenchymal stem cells (MSCs) overexpressing SOD3 have a stronger antioxidant activity and immune regulatory function than normal MSCs, and thus the MSCs overexpressing SOD3 can be an effective treatment agent for inflammatory diseases, autoimmune diseases, organ transplant rejection and the like.
Claims
1. A pharmaceutical composition for preventing or treating an inflammatory disease, the pharmaceutical composition comprising, as an active ingredient, stem cells overexpressing extracellular superoxide dismutase (SOD3).
2. The pharmaceutical composition of claim 1, wherein the stem cells are mesenchymal stem cells.
3. The pharmaceutical composition of claim 2, wherein the mesenchymal stem cells are derived from a tissue selected from the group consisting of umbilical cord, umbilical cord blood, placenta, bone marrow, adipose tissue, muscle, amniotic fluid, and amniotic membrane.
4. The pharmaceutical composition of claim 1, wherein the inflammatory disease is a Th2 or Th17-mediated disease.
5. The pharmaceutical composition of claim 4, wherein the Th2 or Th17-mediated disease is selected from the group consisting of a transplant rejection, an autoimmune disease, an inflammatory bowel disease, an inflammatory eye disease, an inflammatory skin disease, and an allergic disease.
6. The pharmaceutical composition of claim 1, wherein the inflammatory disease is one or more disease selected from the group consisting of acute or chronic transplant rejection, graft versus host disease, inflammatory bowel disease, Crohn's disease, ulcerative colitis, inflammatory skin disease, multiple sclerosis, pancreatitis, traumatic shock, bronchial asthma, allergic rhinitis, allergic conjunctivitis, cystic fibrosis, acute bronchitis, chronic bronchitis, acute bronchiolitis, chronic bronchiolitis, osteoarthritis, gout, spondyloarthropathies, ankylosing spondylitis, Reiter's syndrome, psoriatic arthropathy, bowel disease spondylitis, juvenile arthropathy, juvenile ankylosing spondylitis, reactive arthropathy, infectious arthritis, post-infectious arthritis, Lou Gehrig's disease, nodular polyarteritis, hypersensitive vasculitis, Lou Gehrig's granulomatosis, polymyalgia rheumatica, joint cell arteritis, calcium pyrophosphate deposition arthropathy, pseudo gout, non-articular rheumatism, bursitis, tendovaginitis, epicondylitis, neuropathic joint disease or charcot joint, hemarthrosis, allergic purpura, hypertrophic osteoarthropathy, multicentric reticulohistiocytoma, scoliosis, hemochromatosis, hemoglobinopathy, hyperlipoproteinema, hypogammaglobulinemia, familial Mediterranean fever, Behcet's disease, systemic lupus erythematosus, relapsing fever, multiple sclerosis, septicemia, septic shock, acute respiratory distress syndrome, multiorgan dysfunction syndrome, chronic obstructive pulmonary disease, rheumatoid arthritis, acute lung injury, broncho-pulmonary dysplasia, type 1 diabetes, type 2 diabetes, arteriosclerosis, Alzheimer's dementia, familial cold autoinflammatory syndrome, Muckle-Wells syndrome, neonatal multisystem inflammatory disease, chronic infantile neurologic cutaneous articular syndrome, adult-onset Still's disease, contact dermatitis, hydatidiform mole, syndrome of pyogenic arthritis, pyoderma gangrenosum and acne (PAPA syndrome), hyperimmunoglobulin D syndrome, cryopyrin-associated periodic syndrome, keratitis, conjunctivitis, retinitis, retinal vasculitis, uveitis, eyeliditis, allergic conjunctivitis, dry eye, progressive systemic sclerosis, polymyositis, autoimmune encephalomyelitis, myasthenia gravis, polyarteritis nodosa, and fibromyalgia syndrome.
7. The pharmaceutical composition of claim 6, wherein the inflammatory skin disease is one or more disease selected from the group consisting of psoriasis, atopic dermatitis, eczematous dermatitis, contact dermatitis, seborrheic dermatitis, pityriasis rosea, squamous cellulitis, vasculitis, pityriasis rubra pilaris, cellulitis, folliculitis, carbuncle, pemphigus, bullous pemphigus, epidermolysis bullosa, urticaria, angioedema, vasculitis, erythema, and cutaneous eosinophilia.
8. The pharmaceutical composition of claim 1, wherein the SOD3 comprises the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3.
9. The pharmaceutical composition of claim 1, wherein the stem cells overexpressing SOD3 are obtained by transfecting stem cells with a recombinant expression vector comprising a polynucleotide encoding SOD3.
10. The pharmaceutical composition of claim 9, wherein the recombinant expression vector is selected from the group consisting of a retrovirus vector, an adenovirus vector, an adeno-associated virus (AAV) vector, a vaccinia virus vector, a herpes virus vector, a lentivirus vector, and an avipox virus vector.
11. The pharmaceutical composition of claim 9, wherein the polynucleotide encoding SOD3 comprises the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4.
12. A use of stem cells overexpressing SOD3 for preparing an agent for treatment of an inflammatory disease.
13. A method for treating an inflammatory disease, the method being characterized by administering an effective amount of a pharmaceutical composition to a subject in need thereof, the pharmaceutical composition comprising, as an active ingredient, stem cells overexpressing SOD3.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
MODE FOR CARRYING OUT THE INVENTION
[0112] Hereinafter, the present invention will be described in detail.
[0113] However, the following examples are merely for illustrating the present invention and are not intended to limit the scope of the present invention.
[0114] <Methods>
[0115] Culture and Identification of MSCs
[0116] Human umbilical cord blood derived mesenchymal stem cells (hUCB-MSCs) were collected from blood samples of human umbilical cord with the consent of donors. The blood samples of umbilical cord were stored in a blood collection bag containing citrate phosphate glucose as an anti-coagulant. Treatments for experiments were conducted within 24 hours. A fraction of the mononuclear cells was separated by centrifugation in a Ficoll-Paque PLUS gradient (Amersham Biosciences). The fraction was washed with HBSS (Jeil Biotech Services), and resuspended in low-glucose Dulbecco's modified Eagle's medium (DMEM, Invitrogen Corp), 20% fetal bovine serum (Gibco-BRL), 2 mM L-glutamine, 1 mM sodium pyruvate, and 1% antibiotic/antimycotic (Life Technologies). The antibiotic/antimycotic contains 100 U/ml penicillin, 100 g/ml streptomycin, and 25 jig/ml amphotericin B. After 7 days, non-adherent cells were discarded, and adherent cells were cultured with two medium changes per week. Cells were maintained at 37[ ] in a humidified atmosphere containing 5% CO.sub.2. Approximately 60% of the confluent cells were detached with 0.1% trypsin-EDTA and re-plated in culture flasks.
[0117] The immunophenotypes of the hUCB-MSC were assessed for the presence of positive markers for MSC-related antigens and the absence of markers for hematopoietic lineage markers by flow cytometry (Epics XL, Beckman Coulter). The positive markers include CD90 (Thy-1), CD105 (endoglin), and SH3 (CD73), and the hematopoietic lineage markers include CD34 and CD45 and endothelial markers such as CD31. The cells were positive for HLA class I but negative for HLA-DR. The respective fluorescent conjugated monoclonal antibodies were obtained from Becton Dickinson.
[0118] Confirmation of SOD3 Transfection and SOD3 Overexpression Using Electroporation
[0119] The experimental results in
[0120] Adenovirus Expression Vector an Transfection Conditions for SOD3 Transfection
[0121] The experimental results in
[0122] SOD3 Activity Measurement
[0123] The enzyme activity of SOD3 was confirmed by measuring superoxide radicals. 200M xanthine (Sigma) and 50M WST-1 (Dojindo) in PBS were mixed with 20 l of sample, followed by treatment with 0.0005 units of XOD (Sigma), and then the formazan dye signal development was spectroscopically measured.
[0124] MTT Assay
[0125] MTT assay was conducted to measure the cell proliferation of MSCs (Man et al., 2006; Weichert et al., 1991). 610.sup.3 MSCs were incubated for 24 hours, and the cultured MSCs were transfected with human SOD3 gene using electroporation, and at 24 hours, 48 hours, and 72 hours, corresponding wells were treated with 20 l of MTT (5 mg/ml), and further incubated for 4 hours. Medium was removed, and the cells were lysed with 100 l of dimethyl sulfoxide per well, and the absorbance was measured using absorption wavelength of 595 nm (Bio-Tek Instruments, Winooski, VT, USA).
[0126] Measurement of Reactive Oxygen Species Generated in MSCs by TNF- and IFN- Stimulations
[0127] MSCs were dispensed on 6-well plates and incubated for 24 hours, and then stimulated with 10 ng/ml TNF- and 100 U/ml IFN- for 1 hour. The cells were stabilized with Hanks balanced salt solution (HBSS) for 30 minutes, and then stained with 10 M 2,7-dichlorofluorescin diacetate (H2DCF-DA) at 37E for 30 minutes. ROS was observed by a confocal microscope at an emission wavelength of 513 nm and an excitation wavelength of 488 nm through DCF-fluorescence, and fluorescence was measured by a fluorescence spectrophotometer (Synergy, BIOTEK, US).
[0128] Immunosuppressive Molecule Expression Analysis
[0129] For analysis of the expression of genes with immunosuppressive functions expressed in MSCs, MSCs were incubated by the following method, and the gene expression was analyzed in the presence or absence of stimulations with TNF- and IFN-: [0130] Day 0: MSCs (110.sup.4 cells/cm.sup.2) were incubated on a 60-mm culture dish (medium volume: 3 ml) and cells were incubated to 70-80% confluency. [0131] Day 1: The incubated MSCs were transfected with SOD3 by the infection with adenovirus containing wild-type SOD3 or a control virus (AdLacZ) for 24 hours. [0132] Day 2: The medium was exchanged with new MSC growth medium 24 h after viral infection. [0133] Day 3: After additional incubation for 24 hours, TNF- (10 ng/ml) and IFN- (100 Unit/ml) were added to obtain stimulated or unstimulated cells, and the corresponding gene expressions were analyzed by the measurement of mRNA levels.
[0134] For gene expression analysis, cDNA was synthesized from 1 l of total RNA using QuantiTect Reverse Transcription Kit (QIAGEN). Briefly, genomic DNA was removed from template RNA using gDNA wipeout buffer, incubated at 42E for 2 m, and immediately stored on ice. Thereafter, the reverse transcriptase, RT buffer, and RT primer mix were mixed with the template RNA, and the reaction was carried out at 42 for 15 m and at 95 for 3 m. The synthesized cDNA was stored at 20 before use. Then, 0.25 template, 1 l of corresponding primers, 10 l of TOP polymerase mixture, and 8.75 l of distilled water were mixed, and RT-PCR was performed in a final volume of 20 l. The PCR results were confirmed by electrophoresis on 1% agarose gel. The primer sequences used for RT-PCR and real-time PCR were as follows, and were customized by Bioneer (Korea): icIL-1Ra forward 5-TTATGGGCAGCAGCTCAGTT-3(SEQ ID NO: 15), reverse 5-TTGACACAGGACAGGCACAT-3(SEQ ID NO: 16); sIL-1Ra forward 5-TCCGCAGTCACCTAATCACTC-3 (SEQ ID NO: 17), reverse 5-TTGACACAGGACAGGCACAT-3 (SEQ ID NO: 18); unspliced IL-1Ra forward 5-GGCCTCCGCAGTCACCTAATCACTCT-3(SEQ ID NO: 19), reverse 5-GGTCGCACTATCC ACATCTGGG-3(SEQ ID NO: 20); HO-1 forward 5-CCTGGTGTCCCTTCAATCAT-3 (SEQ ID NO: 21), reverse 5-GGCGATGAGGTGGAATACAT-3 (SEQ ID NO: 22); IDO-1 forward 5-TGTGAACCCAAAAGCATTTTTC-3 (SEQ ID NO: 23), reverse 5-AAAGACGCTGCTTTGGCC-3(SEQ ID NO: 24); TGF- forward 5-CCCAGCATCTGCAAAGCTC-3 (SEQ ID NO: 25), reverse 5-GTCAATGTACAGCTGCCGCA-3 (SEQ ID NO: 26); Galectin-1 forward 5-GGTCTGGTCGCCAGCAACCTGAAT-3 (SEQ ID NO: 27), reverse 5-TGAGGCGGTTGGGGAACTTG-3(SEQ ID NO: 28); IL-10 forward 5-AAGCTGAGAACCAAGACCCAGACATCAAGGCG-3(SEQ ID NO: 29), reverse 5-AGCTATCCCAGAGCCCCAGATCCGATTTTGG-3(SEQ ID NO: 30); and GAPDH forward 5-AAGGTCGGAGTCAACGGATTTGGT-3 (SEQ ID NO: 31), reverse 5-AGTGATGGCATGGACTGTGGTCAT-3 (SEQ ID NO: 32).
[0135] Prostaglandin E2 Immunoassay
[0136] The measurement of prostaglandin E2 (PGE2) was repeated two times for all standards and samples. 100 l of standard diluent (Tissue Culture Media) was placed in NSB and Bo (0 g/ml standard material), and 100 l of standard material was added to appropriate wells. Similarly, 100 l of samples were added to the wells. Then, 50 l of assay buffer was added to the NSB wells, and 50 l of blue conjugate was added to each well except total activity (TA) and blank wells. Thereafter, 50 l of yellow antibody was added to each well, and incubated in a plate shaker (500 rpm or less) for 2 h. Each well was washed three times with 400 l wash solution. After the last wash, a buffer for each well was removed, and the remaining washing buffer was removed using a lint free paper towel, and then, 5 l of blue conjugate was added to the TA well. Then, 200 l of pNpp substrate solution was added to each well. After the reaction was allowed to proceed at room temperature without vibration for 45 minutes, 50 l of stop solution was added to each well, and then the absorbance was measured at 405 nm.
[0137] T Cell Proliferation Assay
[0138] Carboxyfluorescein diacetate succinimidyl ester (CFSE)-MLR assay was performed to determine the proliferation of CD4.sup.+ and CD8.sup.+ T cells co-cultured with MSCa and SOD3-transfected MSCs. The assay was performed by plating 110.sup.6 CFSE-labeled responder cells (whole spleen cells from C57BL/6 mice) in triplicate in 24-well plates (Costar, Corning, NY). The cells were stimulated with 110.sup.6 stimulator cells (Balb/c mouse cells) irradiated with 3000 cGY. For CFSE labeling, 20010.sup.6 cells/ml of responder cells were resuspended in PBS. CFSE (Molecular Probes, Inc) was added to make a final concentration of 5 M, and the cells, while protected from light, were gently shaken at room temperature for 10 minutes. CFSE labeling of cells was stopped by the addition of cold RPMI 1640 growth medium (GIBCO) and kept on ice for 5 minutes. The cells were pelleted and washed twice with the growth medium and resuspended. Both the CFSE-labeled responder cells and irradiated stimulator cells were adjusted to a concentration of 210.sup.6 cells/ml in the growth medium, and co-cultured in a total volume of 1 ml in 24-well plates with MSCs or SOD3-transfected MSCs at a ratio of 10:1 and incubated at 37, in 5% CO.sub.2 and 100% humidity. After a 5-day culture period, cells were harvested, washed twice, and resuspended in PBS. Subordinate factors of responder cells were quantified by using the FITC conjugated anti-mouse CD4 and PE-conjugated anti-mouse CD8 (BD Biosciences Pharmingen).
[0139] T Cell Differentiation Assay
[0140] Naive CD4.sup.+ T cells were isolated by negative selection from spleens and lymph nodes of C57BL/6 mice using MACS column (Miltenyi Biotech). The isolated cells were activated by plate-bound anti-CD3 antibody, and anti-CD28 antibody (2 g/ml) added to RPMI 1640 medium containing 10% FBS, 2 mM glutamine, and 1% penicillin-streptomycin. The cells were polarized under Th1 polarizing conditions (10 g/ml anti-IL4 Ab, 10 ng/ml IL-12), Th2 polarizing conditions (10 g/ml anti-IFN- Ab, 10 ng/ml IL-4), Th17 polarizing condition (20 ng/ml IL-6, 5 ng/ml TGF-, 10 g/ml IFN- antibody, 10 g/ml IL-4 antibody) or Treg polarizing conditions (5 ng/ml TGF- and 10 ng/ml IL-2), and then co-cultured with MSCs or SOD3-transfected MSCs at a ratio of 10:1 for 4 days. All cytokines and antibodies used for CD4.sup.+ T cell differentiation were purchased from BD Biosciences. After 4 days, the cells were harvested for mRNA expression analysis using cytokines or molecules specific for Th1, Th2, Th17, or Treg cell differentiation.
[0141] Experimental Models and Disease Models
[0142] The mice used in the experiments were 8-week aged C57BL/6 mice and fed with standard mouse feed and water without specific pathogen, and the experiments were performed following the regulations of the Catholic Ethics Committee of the Catholic University in accordance with the guidelines of the Ministry of Health and Welfare.
[0143] For induction of chronic and aggressive inflammation on skin of the mice, the hair of the back of the mice was removed by shaving, and 62.5 mg of imiquimod (IMQ) cream (5%, Aldara 3M pharmaceuticals) were applied to the skin of the shaved mice.
[0144] For introduction of atopy-like dermatitis, a mixture of 10 g of OVA protein and 4 mg of aluminum hydroxide as an antigen adjuvant was intraperitoneally injected into mice grown in SPF conditions at the start of the experiment (D0), day 7 (D7), and day 14 (D14), so that the animals were sensitized. From day 21 after the start of the experiment, a patch was prepared by wetting 11 cm.sup.2 gauze in 100 g of OVA dissolved in 100 l of PBS, and then attached to the shaved back of the mice to induce immune responses for 7 days. The immune responses were again induced by OVA patch in the same manner for one week starting from day 35. MSCs, LacZ-MSCs, and SOD3-MSCs were injected into the lesion site on day 42 after the start of the experiment, and skin changes were observed to the naked eye on day 49.
[0145] Subcutaneous Injection of MSCs into Mice
[0146] In the animal experiments using IMQ and ovalbumin, the subcutaneous injection of MSCs was conducted by subcutaneously injecting MSCs into mice at a cell number of 210.sup.6 cells for each experimental condition. Equal volume of phosphate buffered saline (PBS), which is a control for MSC subcutaneous injection, was subcutaneously injected.
[0147] Analysis of cAMP Concentration in Mouse Skin
[0148] The back skin cells and blood plasma were obtained from the mice at day 6 and 12 after IMQ coating to determine the cAMP concentration. For cAMP concentration analysis, cAMP ELISA kit (BD immunocytometry) was used.
[0149] Histological Evaluation and Fluorescent Immunohistochemistry in Mouse Models
[0150] The back skin cells were obtained from mice at day 6 and 12, and fixed in 4% paraformaldehyde (PFA) and embedded in paraffin. For skin samples, 4 m-thick tissue sections were prepared using a rotary microtome (Leica). Then, the tissue sections were dewaxed using xylene and dehydrated through gradients of alcohol. The pre-treated tissue sections were then stained with Hematoxylene and eosin stain (H and E stain). The fluorescent immunohistochemistry was performed by incubated the tissue sections with primary antibodies against CD4, CD8, CD11c, or Gr-1 and then proper fluorescence-labeled secondary antibodies against Alexa fluor 488 and Alexa fluor 647.
[0151] Flow Cytometry Analysis of Mouse Splenocytes
[0152] Total spleen cells were harvested from each group of mice and resuspended in MACS buffer (1PBS with 0.5% BSA). The cells were stained with FITC-conjugated anti-mouse CD4, PE-conjugated anti-mouse CD8, APC-conjugated anti-mouse Gr1, and PE-conjugated anti-mouse CD11c. After the staining was done for 30 minutes, the cells were washed with MACS buffer, followed by centrifugation, and then the cells were resuspended in 500 l of MACS buffer for FACS analysis.
[0153] Reverse Transcriptase-PCR and Real-Time Quantitative PCR for Mouse Skin Gene Expression Analysis
[0154] Total RNA was isolated from mouse back skin using TRIzol reagent (Invitrogen). cDNA was synthesized from 1 ug of total RNA using a reverse transcription system (Qiagen, Hilden, Germany). Primer sets of IL-1 (QT00113505), IL-1 (QT00021385), IL-4 (QT00160678), IL-6 (QT00182896), IL-10 (QT00106169), IL-17 (QT00103278), IL-20 (QT00126735), IL-22 (QT00128324), IL-23 (QT01663613), IFN (QT00000525), TNF- (QT01079561), TGF- (QT00025718), CXCL-1 (QT00199752), CCL20 (QT00261898), and GAPDH (QT02448075) were purchased from Qiagen (The serial number in parentheses is the Qiagen catalog number). Primer sequences for determining the expression levels of Foxp3, T-bet, GATA3, RORt, and SOD3 are as follows: Foxp3 forward GCAACAGCACTGGAACCTTC(SEQ ID NO: 5), Foxp3 reverse GCATTGCTTGAGGCTGCGTA(SEQ ID NO: 6); T-bet forward AGCCAGCCAAACAGAGAAGA(SEQ ID NO: 7), T-bet reverse AATGTGCACCCTTCAAACCC(SEQ ID NO: 8); GATA3 forward ACATGTCATCCCTGAGCCAC(SEQ ID NO: 9), GATA3 reverse AGGAACTCTTCGCACACTTG(SEQ ID NO: 10); RORt forward GCCTACAAT GCCACCACC(SEQ ID NO: 11), RORt reverse ATT GAT GAG AAC CAG GGC(SEQ ID NO: 12); SOD3 forward TGTTGGAGCAGAGGAGAAGCTCAAC (SEQ ID NO: 13); and SOD3 reverse AAGCTCTCTTGGAGCAGCTGGAAA(SEQ ID NO: 14). GAPDH mRNA was used as an endogenous control. PCR was performed using Rotor-Gene 6000 (Corbett) and QuantiTect SYBR Green PCR Kit(Qiagen). The amplification program consisted of 1 cycle at 95 for 10 min, followed by 35 cycles of at 95 for 20 seconds, 55 for 20 seconds, and 72 for 20 seconds.
[0155] Western Blot for Mouse Skin Protein Expression Analysis
[0156] Total protein was extracted using mice back skin. Equal amount of proteins were loaded per lane, followed by electrophoresis, and the proteins are blotted on membranes. Target proteins were incubated with primary antibodies specific for target molecules and detected using enhanced chemiluminescence system (GE health care Life Sciences).
[0157] Statistical Analysis
[0158] Data was expressed as meansSD, and statistical significance was assessed by student t-test or ANOVA for independent groups. Statistically significant differences are indicated by *, $, # in the drawings. All the experiments were repeated three times unless otherwise stated.
Example 1
[0159] Production of Mesenchymal Stem Cells (MSCs) Overexpressing SOD3 and Verification of Efficacy Thereof
[0160] <1-1> Confirmation of SOD3 Overexpression in SOD3-Transfected MSCs
[0161] SOD3 protein expression patterns and SOD3 activity of human SOD3 gene-transfected mesenchymal stem cells (MSCs) were investigated.
[0162] MSCs were transfected with human SOD3 gene using electrophoresis and harvested after 24 hours, and the protein expression levels were investigated by performing RT-PCR and western blot. The SOD3 activity was determined by measuring the amount of superoxide radicals present in the cell culture solution cultured for 24 hours.
[0163] As shown in
[0164] <1-2> Reduction of Reactive Oxygen Species in SOD3-Transfected MSCs
[0165] The amount of reactive oxygen species (ROS) generated due to TNF-/IFN- stimulations in SOD3-transfected MSCs was investigated.
[0166] MSCs were transfected with human SOD3 gene using electrophoresis, and stimulated with TNF- (10 ng/ml) and IFN- (100 U/ml) for 1 hour. The generated ROS were fluorescence-stained with H2DCF-DA and measured using a fluorescence spectrophotometer.
[0167] As shown in
[0168] <1-3> Effect of SOD3 Transfection on Cell Proliferation of MSCs
[0169] The effect of SOD3 transfection on the proliferation of MSCs was investigated using MTT assay.
[0170] As shown in
[0171] <1-4> Inhibitory Effect of SOD3-Transfected MSCs on Expression of Inflammation-Related Cytokines
[0172] The effect of SOD3-transfected MSCs on the expression levels of cytokines, which are important mediators in inflammatory responses, was investigated.
[0173] SOD3-MSCs resulted from the transfection by electrophoresis or MSCs were stimulated with TNF- and IFN- for 12 hours while co-cultured with the human keratinocytes HaCaT cells, and then HaCaT cells were harvested. The levels of various inflammatory cytokines expressed by HaCaT cells are measured by qRT-PCT.
[0174] As shown in
[0175] The above results indicate that MSCs overexpressing and secreting SOD3, compared with MSCs not-overexpressing SOD3, inhibited the expressions of inflammatory cytokines induced by TNF- and IFN- more effectively and improved the expressions of anti-inflammatory cytokines greatly in co-cultured neighboring HaCaT cells, thereby regulating inflammatory responses multi-directionally and effectively.
[0176] <1-5> Analysis of Immunosuppression-Related Molecule Expressions in SOD3-Transfected MSCs
[0177] The expression patterns of immunosuppression-related materials expressed in SOD3-transuded MSCs were analyzed.
[0178] MSCs were incubated and transfected with AdLacZ or AdSOD3 adenovirus, and the intracellular mRNA expression levels of intracellular IL-1Ra (icIL-1Ra), soluble IL-1Ra (sIL-1Ra), unspliced IL-1Ra, HO-1, IDO-1, TGF-0, galectin-1, and IL-10 were measured using RT-PCR in the presence or absence of TNF- (10 ng/ml) and IFN- (100 U/ml) (A to
[0179] As shown in
[0180] It has been reported that the number of graft-infiltrating leukocytes was sharply reduced in transplant patients administered with IL-1Ra (Shiraishi M et al., J Surg Res., 58(5): 465-470, 1995). It can be therefore expected that the expression of IL-1Ra is greatly increased in MSCs overexpressing SOD3, through which the inflammation responses and transplant rejection can be effectively suppressed in transplant patients.
[0181] Meanwhile, TGF- and HO-1 are involved to promote the production of IL-10 and the formation of immunosuppressive Treg cells but inhibit pro-inflammatory cytokines in vitro and in vivo. HO-1 was confirmed to inhibit Th17 responses and exhibit anti-inflammatory activity by inhibiting p-STAT3-RORt pathway to regulate the kinetics of RORt and Foxp3 expressions, so that HO-1 is a novel therapeutic target for asthma, psoriasis, atopic dermatitis, and the like. In addition, human MSCs has been known to be able to induce the expression of indoleamine-2,3-dioxygenase-1 (IDO-1), and IDO-1 has been received as a key regulator of autoimmune diseases, such as acute graft-versus-host disease (GVHD), by inhibiting T cell proliferation and inducing apoptosis of immune cells to induce immunosuppression. Therefore, as verified in the above examples, the induction of activation of the catabolic pathway of tryptophan, such as HO-1 or IDO-1 by the overexpression of SOD3 in MSCs can be a potent therapeutic target for a number of autoimmune diseases.
[0182] <1-6> Effect of SOD3-Transfected MSCs on T Cell Proliferation
[0183] The effect of SOD3-transfected MSCs on the inhibition of T cell differentiation and proliferation was investigated.
[0184] The CFSE based-mixed lymphocyte reaction (MLR) experiment was performed while T cells isolated from different species of mice (C67BL/6 and BalB/C) were co-cultured without MSCs, or with untreated MSCs, LacZ-transfected MSCs, or SOD3-transfected MSCs according to the experiment condition, and then flow cytometry was subjected to CD4.sup.+ or CD8.sup.+ cells (
[0185] As shown in
[0186] <1-7> Effect of SOD3-Transfected MSCs on T Cell Differentiation
[0187] The effect of SOD3-transfected MSCs on T cell differentiation was investigated.
[0188] Nave T cells were co-cultured with untreated MSCs (MSC), LacZ-MSCs, or SOD3-MSCs according to the experimental conditions in each differentiation condition of Th1, Th2, Th17, or Treg cells, and the expression levels of differentiation-related major transcription factors expressed by differentiated T cells were measured by real-time qRT-PCR.
[0189] As shown in
[0190] As shown in
[0191] These results indicate that SOD3 transfection remarkably increases the original T cell differentiation regulatory effect of MSCs, and especially suggest the possibility that SOD3 transfection can suppress inflammation more effectively by lowering the differentiation of Th17 cells acting as pathogenic cells and inducing the differentiation of Treg cells having an inflammation-modulating effect in inflammatory diseases.
Example 2
[0192] Imiquimod-Induced Chronic and Aggressive Dermatitis Biological Models
[0193] <2-1> Skin Inflannation Inhibitory Effect of SOD3-Transfected MSCs
[0194] It was investigated whether SOD3-transfected MSCs has an inflammation-modulating effect in the body, on the basis of the regulatory effect of MSCs overexpressing SOD3 on T cell proliferation and differentiation, observed in <Example 1>.
[0195] The imiquimod (IMQ), which is known to induce psoriasis-like acute and aggressive dermatitis by activating signaling of the innate immune system, was applied to the shaved back skin in mice every day to induce skin inflammation responses. According to the experimental setup in
[0196] As shown in
[0197] As shown in
[0198] These results indicate that MSCs, which overexpress SOD3 by SOD3 transfection, had a significant effect in the alleviation of skin inflammation compared with general MSCs.
[0199] <2-2> Inhibitory Effect of SOD3-Transfected MSCs on Infiltration of Neutrophils and Dendritic Cells
[0200] The composition and recruitment of immune cells in spleens and skin of mice with IMQ-induced dermatitis were investigated.
[0201] CD4.sup.+ T cells, CD8.sup.+ T cells, neutrophils (Gr1.sup.+ cells), and dendritic cells (CD11c.sup.+ cells), which constitute the spleens of the mice injected with respective types of MSCs according to the experimental conditions, were examined by flow cytometry (
[0202] As shown in
[0203] As shown in
[0204] <2-3> Inhibitory Effect of SOD3-Transfected MSCs on Expression of Inflammation Response Mediators
[0205] The expression patterns of cytokines in the back skin of the mice with skin inflammations induced by IMQ were measured by qRT-PCR.
[0206] As shown in
[0207] The expression level of IL-10, which is an anti-inflammatory cytokine and is associated with the inflammation modulation of Treg, was slightly increased due to MSC treatment unlike the other inflammatory cytokines, and the IL-10 increase effect was observed to be excellent in SOD3-MSCs.
[0208] The above results indicate that the inflammation-modulating action of MSCs was increased more effectively due to SOD3 introduction, suggesting that the symptoms of inflammation diseases can be alleviated by complexly regulating the expressions and actions of various cytokines.
[0209] <2-4> Effect of SOD3-Transfected MSCs on Inflammation-Related Signaling
[0210] IMQ has been known to activate TLR-7 and/or TLR-8 and exhibit biological effects through subordinate NFkB signaling systems. Therefore, the effect of the treatment with MSCs, including MSCs overexpressing or not-overexpressing SOD3, on signaling by TLR-7/TRL-8 was investigated by western blot experiments using IMQ-applied skin.
[0211] As shown in
[0212] <2-5> cAMP Concentration Increase in Blood Plasma and Cells
[0213] Inflammation is triggered when T-helper cells stimulated by antigens infiltrating into the body proliferate to secrete inflammation-inducing substances. The proliferation of T-helper cells occurs by a changed ratio of cAMP to cGMP, which are two substances responsible for cell division. The high cGMP concentration results in faster cell division, and the high cAMP concentration results in slow cell division. The imbalance of such a ratio increases the likelihood of suffering from inflammatory diseases. For example, the cGMP concentration in cells or blood plasma is high in many psoriasis patients. Therefore, the cAMP concentration in the blood plasma of the mice treated with the respective types of MSCs according to the experimental conditions was measured by ELISA.
[0214] As shown in
Example 3
[0215] Atopic-Like Dermatitis Biological Model Induced by Ovalbumin
[0216] The in vivo inflammation regulatory effect of MSCs overexpressing SOD3 was investigated using other animal models. Atopic-like dermatitis was induced in Balb/C mice using ovalbumin (OVA) as an antigen, and the inflammation inhibitory effects by MSCs were compared and observed.
[0217] According to the experimental setup shown in
[0218] As shown in
INDUSTRIAL APPLICABILITY
[0219] The mesenchymal stem cells overexpressing SOD3 have more potent antioxidative activity, immunoregulatory functions, and cellular immunoregulatory functions than general mesenchymal stem cells. The mesenchymal stem cells overexpressing SOD3 can be favorably used in the development of more effective stem cell therapeutics for inflammatory diseases, autoimmune diseases, or transplant rejections.