APTAMERS AND USE OF THE APTAMERS IN THE DIAGNOSIS AND TREATMENT OF A SARS-COV-2 INFECTION

20240076680 · 2024-03-07

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to an aptamer not binding to the receptor-binding domain of the SARS-CoV-2 spike glycoprotein nor inhibiting the interaction of the receptor-binding domain (RED) of spike glycoprotein with angiotensin-converting enzyme II (ACE2) and/or comprising or consisting of a nucleotide sequence SEQ ID NO: 1, a composition comprising the aptamer, and the use of the aptamer in the detection of SARS-CoV-2 or diagnosis or treatment of a SARS-CoV-2 infection.

Claims

1. An aptamer binding to SARS-CoV-2 spike glycoprotein, wherein the aptamer does not bind to the receptor-binding domain of the SARS-CoV-2 spike glycoprotein nor inhibit the interaction of the receptor-binding domain (RBD) of SARS-CoV-2 spike glycoprotein with angiotensin-converting enzyme II (ACE2) and/or comprises or consists of a nucleotide sequence 5-N.sub.1N.sub.2AN.sub.3GGTAGGTAN.sub.4TGCTTGGTAGGGAN.sub.5AN.sub.6TN.sub.7N.sub.8GN.sub.9N.sub.10-3 (SEQ ID NO: 1) or a pharmaceutically acceptable salt thereof, wherein: N.sub.1, N.sub.2 independently represent G or C, N.sub.3, N.sub.4 independently represent T or G, N.sub.5 represents T or A, N.sub.6, N.sub.7, Ns independently represent G or C, and N.sub.9, N.sub.10 independently represent C or T.

2. The aptamer according to claim 1, wherein the aptamer comprises or consists of a nucleotide sequence 5-CCATGGTAGGTATTGCTTGGTAGGGATAGTGGGCT-3 (SEQ ID NO: 2) or 5-GGAGGGTAGGTAGTGCTTGGTAGGGAAACTCCGCC-3 (SEQ ID NO: 3) or a pharmaceutically acceptable salt thereof.

3. The aptamer according to according to claim 1, wherein the aptamer comprises or consists of a nucleotide sequence or a pharmaceutically acceptable salt thereof selected from the group comprising: TABLE-US-00006 (SEQIDNO:4) 5-CCCATGGTAGGTATTGCTTGGTAGGGATAGTGGGCTTGATG-3, (SEQIDNO:5) 5-CCATGGTAGGTATTGCTTGGTAGGGATAGTGGGCTTGATG-3, and (SEQIDNO:6) 5-CCCATGGTAGGTATTGCTTGGTAGGGATAGTGGGTTTGATG-3.

4. The aptamer according to claim 1, wherein the aptamer comprises or consists of a nucleotide sequence or a pharmaceutically acceptable salt thereof selected from the group comprising: TABLE-US-00007 (SEQIDNO:7) 5-AGGAGGGTAGGTAGTGCTTGGTAGGGAAACTCCGCCGATT-3, (SEQIDNO:8) 5-AAGGAGGGTAGGTAGTGCTTGGTAGGGAAACTCCGCCGATT-3, (SEQIDNO:9) 5-AAGGAGGGTAGGTAGTGCTTGGTAGGGAAACTCCGCCGAT-3, (SEQIDNO:10) 5-AGGAGGGTAGGTAGTGCTTGGTAGGGAAACTCCGTCGATT-3, and (SEQIDNO:11) 5-AAGGAGGGTAGGTAGTGCTTGGTAGGGAAACTCCGTCGAT-3.

5. The aptamer according to claim 1, wherein the aptamer comprises or consists of a nucleotide sequence selected from the group comprising: 5-GGGAGAGGAGGGAGATAGATATCAACCCATGGTAGGTATTGCTTGGTAGGGATAGT GGGCTTGATGTTTCGTGGATGCCACAGGAC-3 (SEQ ID NO: 12), 5-GATATCAACCCATGGTAGGTATTGCTTGGTAGGGATAGTGGGCTTGATGTT-3 (SEQ ID NO: 13), 5-ATCAACCCATGGTAGGTATTGCTTGGTAGGGATAGTGGGCTTGAT-3 (SEQ ID NO: 14), 5-CAACCCATGGTAGGTATTGCTTGGTAGGGATAGTGGGCTTG-3 (SEQ ID NO: 15), 5-CCCATGGTAGGTATTGCTTGGTAGGGATAGTGGG-3 (SEQ ID NO: 16), and pharmaceutically acceptable salts thereof.

6. The aptamer according to claim 1, wherein the aptamer is part of a dimer, trimer or multimer comprising two, three or multiple nucleotide sequences selected from the group comprising SEQ ID NOs: 1-20, wherein the nucleotide sequences are connected by a linker.

7. The aptamer according to claim 1, for use as a medicament or a diagnostic reagent.

8. The aptamer for use according to claim 7, wherein the aptamer is for use in the detection of SARS-CoV-2 or diagnosis or treatment of a SARS-CoV-2 infection.

9. A diagnostic or pharmaceutical composition comprising the aptamer according to claim 1.

10. The diagnostic or pharmaceutical composition according to claim 9 for use in the detection of SARS-CoV-2 or diagnosis or treatment of a SARS-CoV-2 infection.

11. A diagnostic composition according to claim 9, wherein the diagnostic composition is used in an enzyme-linked oligonucleotide assay (ELONA) or in a lateral flow assay (LFA).

12. The pharmaceutical composition according to claim 9, wherein the pharmaceutical composition is in a form of a nasal spray.

13. Use of an aptamer according to claim 1, for the manufacture of a medicament or a diagnostic reagent.

14. An in vitro method of detecting SARS-CoV-2 or diagnosing a SARS-CoV-2 infection, the method comprising the step of detecting the binding of an aptamer according to claim 1 to SARS-CoV-2 Spike glycoprotein in a sample obtained from a subject.

15. A method of treating a SARS-CoV-2 infection, the method comprising the step of administering to a subject a therapeutically effective amount of an aptamer according to claim 1.

16. The aptamer according to claim 6, wherein the linker is selected from the group consisting of a nucleotide linker, polyethylene glycole, a peptide linker, an alkyl linker or an aminoalkyl linker.

17. The use of the aptamer according to claim 13, wherein the medicament or diagnostic agent is used for detection of SARS-CoV-2 or diagnosis or treatment of a SARS-CoV-2 infection.

Description

THE FIGURES SHOW

[0050] FIG. 1 results of the screening of the DNA of selection cycles 1 (R1) and 12 (R12) targeting SARS-CoV-2 spike, Erk2, and Dectin-1.

[0051] FIG. 2 results of the screening of the DNA of the starting library (SL), selection cycle 12 (R12), sequences SP1-8 targeting SARS-CoV-2 spike, and SP5sc.

[0052] FIG. 3 results of the screening of the sequences SP5-8 and SP5sc targeting SARS-CoV-2 spike, SARS-CoV-1 spike, RBD and ACE2.

[0053] FIG. 4 results of the screening of the aptamers SP5-7 targeting SARS-CoV-2 spike compared to truncated aptamers and sequences with one point mutation.

[0054] FIG. 5 results of the ELONA assay using the 5-biotinylated aptamers SP6 and SP6.34, and non-binding control sequences and SARS-CoV-2 spike.

[0055] FIG. 6 results of the affinity determination for 5-biotinylated full-length aptamers SP5, SP6 and SP7 at 37 C. in FIGS. 6 A), C), E) and at 25 C. in FIGS. 6 B), D) and F).

[0056] FIG. 7 Coomassie-stained protein gels illustrating that the interaction between SARS-CoV-2 spike and ACE2 was not affected by aptamer SP6.

[0057] FIG. 8 infection results of aptamer SP6 for CoV2-S pseudotype and VSV-G pseudotype.

MATERIALS AND METHODS

[0058] Coupling of SARS-CoV-Proteins to Dynabeads His-Tag Isolation & Pulldown:

[0059] For immobilization of SARS-CoV-proteins, Dynabeads His-Tag Isolation & Pulldown (ThermoFisher) were used. For this purpose, 9.6 nmol of SARS-CoV-proteins, prepared in 1 mL wash/binding buffer (50 mM Sodium-Phosphate, pH 8.0, 300 mM NaCl, 0.01% Tween-20) were coupled to 100 L of bead solution (40 mg beads/mL), according to the manufacturer's protocol. The provided buffer, by the manufacturer, of the bead solution was discarded by separation before coupling, using a DynaMag-2 Magnet (ThermoFisher). For the coupling reaction, the solution was incubated for 30 min on 4 C., using a Tube Revolver Model D-6050 (neoLab) rotating at a speed of 20 rpm. According to the manufacturer's protocol, three washing steps with 1 mL wash/binding buffer were carried out, followed by one additional washing step with storing buffer (ssDNA selection=1.25PBS; 171.25 mM NaCl (Fisher Scientific), 3.38 mM KCl (Roth), 12.5 mM Na.sub.2HPO.sub.4 (Roth), 2.2 mM KH.sub.2PO.sub.4 (Roth), pH 7.4; 1 mg/mL Albumin (BSA) Fraction V (pH 7.0) (AppliChem); 3.25 mM MgCl.sub.2//2fRNA selection=1.25PBS; 171.25 mM NaCl (Fisher Scientific), 3.38 mM KCl (Roth), 12.5 mM Na.sub.2HPO.sub.4 (Roth), 2.2 mM KH.sub.2PO.sub.4 (Roth), pH 7.4; 1 mg/mL Albumin (BSA) Fraction V (pH 7.0) (AppliChem)), before resuspending SARS-CoV2-protein beads in 1 mL of storing buffer. In the particular case of competitor, 0.125 mg/mL Heparin was added to the storing buffer.

[0060] Automated Selection:

[0061] ssDNA Selection

[0062] For the ssDNA selection, a D2 DNA library (5-GGGAGAGGAGGGAGATAGATATCAA-N40-TITCGTGGATGCCACAGGAC-3, (SEQ ID NO: 21)) and D2 primers were used, synthesized by Ella Biotech GmbH (Munich, Germany). For amplifying the library by PCR, the following primers were used: forward primer, including a Cyanin dye (Cy5) modification at the 5 end (Cy5-D2 fw) 5 Cy5-GGGAGAGGAGGGAGATAGATATCAA-3 (SEQ ID NO: 22) and reverse primer, including a phosphate modification at the 5 end (Phos-D2 rv) 5 P-GTCCTGTGGCATCCACGAAA-3 (SEQ ID NO: 23) in PCR master mix (1 colorless GoTaq Flexi Buffer (Promega), 2 mM MgCl.sub.2 (Roth), 0.2 mM dNTP (Genaxxon) each). The PCR reaction was performed by using GoTaq G2 Flexi DNA Polymerase (Promega) for amplification, including 1 M of Cy5-D2 fw and Phos-D2 rv primers each, in a total reaction volume of 100 L. Cycling the PCR program (30 s 95 C., 30 s 62 C., 30 s 72 C.; hold 10 C.) in a TRobot thermal cycler (Biometra) in the first four selection rounds for 18 PCR cycles and in all following selection rounds after for 16 PCR cycles. For all steps performed on the TRobot, an arched auto-sealing lid (Bio-Rad) was used to seal the reaction plate. 1 L GoTaq G2 Flexi DNA Polymerase (Promega) was added to start the PCR reaction. For generating ssDNA after PCR, a lambda exonuclease digestion was performed, using 2 L lambda exonuclease (ThermoFisher).

[0063] The automated pipetting steps were performed by a Biomek NX.sup.P (Beckman Coulter). Initializing the automated selection with an incubation of 0.5 nmol of D2 ssDNA library pipetted to the SARS-CoV-proteins immobilized on Dynabeads His-Tag Isolation & Pulldown (ThermoFisher) for 30 min at 37 C. while shaking at a speed of 700 rpm; pipetting up and down every 5 min during incubation. For a final concentration in the selection of 3 mM MgCl.sub.2 and 1 PBS, the initial 0.5nmol D2 ssDNA library was prepared with MgCl.sub.2 (Roth) and phosphate-buffered saline (PBS; 137 mM NaCl (Fisher Scientific), 2.7 mM KCl (Roth), 10 mM Na.sub.2HPO.sub.4 (Roth), 1.76 mM KH.sub.2PO.sub.4 (Roth), pH 7.4). Followed by a washing step after incubation, the samples were washed two times with wash buffer (3 mM MgCl.sub.2, 1 PBS), increasing the number of washing steps every selection round by two more washes, until reaching a total of eight washes per selection round. Prior to PCR, the ssDNA was recovered by incubation of 5 min at 80 C. in a TRobot thermal cycler using double distilled H.sub.2O (TKA Wasseraufbereitungssysteme GmbH). After PCR, a lambda exonuclease digestion followed to generate ssDNA by incubating 2 L lambda exonuclease with 30L of PCR product for 60 min at 37 C. 20 L of the ssDNA were pipetted into 80 L of beads suspension to start the next selection round.

[0064] Agarose Gel Analysis:

[0065] Agarose LE (Genaxxon) was used to perform a 4% agarose Gel and was pre-stained with ethidium bromide (Roth). 1 L 6DNA Loading Dye (Thermo Scientific) with 5 L of dsDNA were mixed and loaded on the gel. As reference 4 L of GeneRuler Ultra Low Range DNA Ladder (Thermo Scientific) were loaded on the gel. A Genoplex system (VWR) was used for visualization of the DNA.

[0066] Next-Generation Sequencing (NGS):

[0067] The starting library and enriched libraries of cycle 3 to 12 were analyzed by NGS using the Illumina HiSeq1500 platform. Samples were prepared according to Tolle and Mayer (2016). Preparation of SELEX Samples for Next-Generation Sequencing. Methods Mol Biol 1380: 77-84. Briefly, 12 different index primers were attached to the different libraries via PCR, allowing the analysis of 12 samples in parallel on one lane. PCR products were purified using the NucleoSpin Clean-Up kit (Macherey Nagel), and equal amounts of PCR product of each library were mixed to a final amount of 2 g DNA. For the hybridization to the flow cell a subsequent adapter ligation step was performed according to the manufacturer's instructions (TruSeq DNA PCR-Free Sample Preparation Kit LT, Illumina). Samples were purified by agarose gel purification.

[0068] The NGS data was analyzed using the inhouse AptaNext software and MEME suite (Bailey, T. L. et al. (2009). MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res 37(Web Server issue): W202-20). Five families from cycle 12 were identified and the most abundant sequences were tested in a FACS binding assay. Secondary structures of the aptamers were predicted with Mfold (Zuker, M. (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31(13): 3406-341).

[0069] Constructs and Plasmids:

[0070] Plasmids for SARS-CoV-2-Se, SARS-CoV-2-S-HexaPro and SARS-CoV-Se (kindly provided by Jason McLellan, The University of Texas at Austin, USA) code for the prefusion-stabilized ectodomains of the S proteins and carry on the C-terimus a trimerization motif, a HRV 3C cleavage site, 8His and TwinStrep tags [Wrapp et al. (2020) Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation. Science 367, 1260-1263]. SARS-CoV-2-S(D614G)-A19 codes for the S protein (GenBank NC_045512) containing the D614G mutation and lacking the C-terminal 19 amino acids thus deleting the ER-retention motif and enhancing transport to the plasma membrane. SARSCoV-2-S-RBD codes for amino acids 319-591 of the S protein and contains the signal peptide of the S protein on the N-terminus to allow secretion and a HRV 3C cleavage site, 8His and TwinStrep tags on the C-terminus. ACE2e contains, after cleavage of the signal peptide, amino acids 19-615 of human ACE2 (UniProt Q9BYF1), an N-terminal myc tag and a C-terminal HRV 3C cleavage site followed by an 8His tag. The myc and ACE2 coding sequence was amplified form pCEP4-myc-ACE2 (addgene #141185) [Chan et al. (2020). Engineering human ACE2 to optimize binding to the spike protein of SARS coronavirus 2. Science 369, 1261-1265]. All these proteins were cloned into pCAG which is based on pCAGGS only lacking the SV40 on of the latter. All constructs were assembled from PCR-amplified fragments using Q5 DNA Polymerase (NEB) or synthetic genes (Eurofins) except for the pCAG backbone which was linearized by restriction digestion. For assembly the NEBuilder HiFi DNA Assembly Master Mix was used (NEB). Coding sequences of all constructs were verified by Sanger sequencing (Eurofins).

[0071] Protein Expression and Purification:

[0072] Proteins were expressed in FreeStyle 293F cells (Thermo). 293F cells at 110.sup.6 cells/ml in FreeStyle 293 Expression Medium (Thermo) were transfected with 1 mg plasmid and 2 mg PEI max (Polysciences) per liter of cells. 3-5 days after transfection proteins were purified from the culture medium after removing cells and debris by centrifugation (10 min, 800 g, rt, followed by 30 min, 10000 g, 4 C.). The cleared medium was adjusted to 50 mM HEPES/KOH, pH 7.8/300 mM NaCl/25 mM imidazole and loaded overnight onto a column containing 2 ml Protino Ni-NTA Agarose (Macherey-Nagel) per liter of medium. After washing with 50 mM HEPES/KOH, pH 7.8/300 mM NaCl/25 mM imidazole proteins were eluted in the same buffer containing 1 M imidazole. Eluted proteins were concentrated using Vivaspin Turbo concentrators (Sartorius) and loaded on a Superose 6 column (Cytiva) equilibrated in 20 mM HEPES/KOH, pH 7.8/150 mM NaCl to remove aggregated material. Peak fractions were pooled, concentrated, flash-frozen in liquid nitrogen and stored at 80 C.

[0073] Pseudovirus Generation:

[0074] VSV pseudotypes were generated as published by Hoffmann et al. (2020) SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 181, 271-280. Briefly, Hek293T cells transfected with pCAG-SARS-CoV-2-S(D614G)-A19 or pcDNA3.1-VSV-G, respectively, were inoculated with VSV-G* (kindly provided by Gert Zimmer, Institute of Virology and Immunology, Mittelhusern, Switzerland). In VSV-G* the VSV-G open reading frame is replaced by an expression cassette for GFP and firefly luciferase [Berger Rentsch, M., Zimmer, G. (2011) A Vesicular Stomatitis Virus Replicon-Based Bioassay for the Rapid and Sensitive Determination of Multi-Species Type I Interferon. PLoS One 6, e25858. doi:10.1371/journal.pone.0025858] allowing infected cells to be detected by GFP fluorescence or luciferase activity. After 1 h incubation at 37 C. the inoculum was removed, the cells were washed with DMEM and cultivated for 16-18 h in DMEM/2% FBS/30 mM Hepes at 34 C. The culture medium containing the pseudotyped particles was clarified from cellular debris by centrifugation (800 g, 5 min, rt). Aliquots were flash-frozen in liquid nitrogen and stored at 80 C.

EXAMPLE 1

[0075] Selection of Aptamers

[0076] Aptamers were selected using automated selection as described above. For this, the trimerized His-tagged extracellular domain of CoV2-S, stabilized in the prefusion conformation, was expressed and purified from HEK293 cells and immobilized for the selection on magnetic beads. After 12 rounds of selection, the selected ssDNA pool was PCR-amplified.

EXAMPLE 2

[0077] Determination of DNA binding targeting SARS-CoV-2 spike, Erk2 and Dectin-1

[0078] The binding of the DNA of selection cycles 1 (R1) and 12 (R12) targeting SARS-CoV-2 spike, Erk2 and Dectin-1 immobilized on magnetic beads was determined by FACS analysis. The proteins were immobilized on magnetic particles (ThermoFisher) via His-Tag as done for the selection and stored in 1.25PBS+1 mg/ml BSA at 4 C. 5-Cy5-labeled ssDNA libraries were prepared and incubated at a concentration of 500 nM with 4 l bead suspension in a final volume of 10 l 1 PBS with 3 mM MgCl2 and 0.8 mg/ml BSA at 37 C. and 650 rpm. After removal of the supernatant, beads were washed two times with 100 l 1 PBS with 3 mM MgCl2 and resuspended in 100 l 1PBS with 3 mM MgCl2 for analysis by flow cytometry. Approximately 20,000 events were analyzed for each sample.

[0079] FIG. 1 illustrates the results of the screening of the DNA of selection cycles 1 (R1) and 12 (R12) targeting SARS-CoV-2 spike (CoV2-S), Erk2 and Dectin-1. As can be taken from FIG. 1, DNA of cycle 12 (R12) selectively binds SARS-CoV-2 spike, whereas no binding was determined for DNA of cycle 1 for any of the proteins and DNA of cycle 12 for Erk2 and Dectin.

[0080] The enriched DNA populations were subjected to next-generation sequencing (NGS), in which 10.sup.6 to 10.sup.7 sequences were analyzed per selection cycle. Sequence analysis provided 8 candidate molecules having a nucleotide sequence as follows:

TABLE-US-00003 SP1: (SEQIDNO:24) 5-GGGAGAGGAGGGAGATAGATATCAAGGGCGGGAGGGAGGGGGGCC ACACCAAAACACGTTCAACTTTTCGTGGATGCCACAGGAC-3 SP2: (SEQIDNO:25) 5-GGGAGAGGAGGGAGATAGATATCAAGGGAGGGAGGGTGGGGGGTT CTCGCTGCGGGTTTTGGTGCTTTCGTGGATGCCACAGGAC-3 SP3: (SEQIDNO:26) 5-GGGAGAGGAGGGAGATAGATATCAAATCGGGGGGTGGGTTTGGGT ATGGGGTCTGCACTATGGCTTTTCGTGGATGCCACAGGAC-3 SP4: (SEQIDNO:27) 5-GGGAGAGGAGGGAGATAGATATCAATCGCGGGGGGCGGGTCGGGT GCTCGTTCGAGGGGTCGCAGTTTCGTGGATGCCACAGGAC-3 SP5: (SEQIDNO:18) 5-GGGAGAGGAGGGAGATAGATATCAACCATGGTAGGTATTGCTTGG TAGGGATAGTGGGCTTGATGTTTCGTGGATGCCACAGGAC-3 SP6: (SEQIDNO:12) 5-GGGAGAGGAGGGAGATAGATATCAACCCATGGTAGGTATTGCTTG GTAGGGATAGTGGGCTTGATGTTTCGTGGATGCCACAGGAC-3 SP7: (SEQIDNO:19) 5-GGGAGAGGAGGGAGATAGATATCAAAGGAGGGTAGGTAGTGCTTG GTAGGGAAACTCCGCCGATTTTTCGTGGATGCCACAGGAC-3 SP8: (SEQIDNO:20) 5-GGGAGAGGAGGGAGATAGATATCAAAAGGAGGGTAGGTAGTGCTT GGTAGGGAAACTCCGCCGATTTTTCGTGGATGCCACAGGAC-3.

EXAMPLE 3

[0081] Determination of aptamer binding targeting SARS-CoV-2 spike

[0082] The binding of the DNA of the starting library (SL) selection cycle 12 (R12), aptamer sequences SP1-8 and a non-binding scrambled control sequences SP5sc targeting SARS-CoV-2 spike immobilized on magnetic beads was investigated by FACS analysis according to example 2 to identify SARS-CoV-2 spike binding aptamers.

[0083] The following aptamers were determined: [0084] SP1: (SEQ ID NO: 24) [0085] SP2: (SEQ ID NO: 25) [0086] SP3: (SEQ ID NO: 26) [0087] SP4: (SEQ ID NO: 27) [0088] SP5: (SEQ ID NO: 18) [0089] SP6: (SEQ ID NO: 12) [0090] SP7: (SEQ ID NO: 19) [0091] SP8: (SEQ ID NO: 20)

[0092] FIG. 2 illustrates the results of the screening of the DNA of the starting library (SL), selection cycle 12 (R12), aptamer sequences SP1-8 and SP5sc targeting SARS-CoV-2 spike. As can be taken from FIG. 2, binding was obtained for the DNA of cycle 12 as well as for aptamers SP5, SP6, SP7 and SP8, whereas no binding was detectable for the DNA of the starting library as well as for the sequences of SP1-4 and the non-binding scrambled control sequences SP5sc. This shows the binding of the aptamers SP5, SP6, SP7 and SP8, corresponding to SEQ ID NOs: 18, 12, 19, 20, respectively, to SARS-CoV-2 spike glycoprotein.

EXAMPLE 4

[0093] Determination of aptamer binding targeting spike proteins of SARS-CoV-2 and SARS-CoV-1, RBD and ACE2

[0094] The binding of the aptamer sequences SP5-8, corresponding to SEQ ID NOs: 18, 12, 19, 20, respectively, and SP5sc targeting the spike proteins of SARS-CoV-2 or of SARS-CoV-1, RBD and ACE2 immobilized on magnetic beads was investigated by FACS analysis according to example 2 do determine the specificity of the obtained aptamers.

[0095] FIG. 3 illustrates the results of the screening of the sequences SP5-8 and SP5sc targeting the spike proteins of SARS-CoV-2 (Spike2) or of SARS-CoV-1 (Spike1), RBD and ACE2. Binding was obtained specifically for sequences SP5, SP6, SP7 and SP8 targeting Spike2, whereas no binding was detectable for the control sequences SP5sc or any sequence targeting Spike1, RBD or ACE2.

[0096] This shows that the aptamers SP5, SP6, SP7 and SP8, corresponding to SEQ ID NOs: 18, 12, 19, 20, respectively, do not bind to the receptor-binding domain of the SARS-CoV-2 spike glycoprotein.

EXAMPLE 5

[0097] Determination of aptamer binding targeting SARS-CoV-2 spike glycoprotein

[0098] The binding of the aptamers SP5-7, truncated aptamers SP6.51, SP6.45, SP6.41, SP6.34, SP6.30, SP6.19, SP7.55, SP7.32, sequences with one point mutation SP6.34A, SP6.34G and SP6.34C and SP5sc targeting SARS-CoV-2 spike glycoprotein immobilized on magnetic beads was investigated by FACS analysis according to example 2 to determine positions to truncate the aptamer and point mutations, which impair binding.

[0099] The following truncated aptamer sequences and point mutation sequences were used:

TABLE-US-00004 SP6.51: (SEQIDNO:13) 5-GATATCAACCCATGGTAGGTATTGCTTGGTAGGGATAGTGGGCTT GATGTT-3 SP6.45: (SEQIDNO:14) 5-ATCAACCCATGGTAGGTATTGCTTGGTAGGGATAGTGGGCTTGA T-3 SP6.41: (SEQIDNO:15) 5-CAACCCATGGTAGGTATTGCTTGGTAGGGATAGTGGGCTTG-3 SP6.34: (SEQIDNO:16) 5-CCCATGGTAGGTATTGCTTGGTAGGGATAGTGGG-3 SP6.30: (SEQIDNO:28) 5-CATGGTAGGTATTGCTTGGTAGGGATAGTG-3 SP6.19: (SEQIDNO:29) 5-TATTGCTTGGTAGGGATAG-3 SP7.32: (SEQIDNO:17) 5-GGAGGGTAGGTAGTGCTTGGTAGGGAAACTCC-3 SP7.55: (SEQIDNO:30) 5-GGAGGGAGATAGATATCAAAGGAGGGTAGGTAGTGCTTGGTAGGG AAACTCCGCC-3 SP6.34A: (SEQIDNO:31) 5-CCCATGGTAGGTATTGCATGGTAGGGATAGTGGG-3, SP6.34G: (SEQIDNO:32) 5-CCCATGGTAGGTATTGGTTGGTAGGGATAGTGGG-3 and SP6.34C: (SEQIDNO:33) 5-CCCATGGTAGGTATTGCTTGGTAGCGATAGTGGG-3.

[0100] FIG. 4 illustrates the results of the screening of the aptamers SP5-7, truncated aptamers SP6.51, SP6.45, SP6.41, SP6.34, SP6.30, SP6.19, SP7.55, SP7.32, sequences with one point mutation SP6.34A, SP6.34G and SP6.34C and SP5sc targeting SARS-CoV-2 spike glycoprotein. Binding was obtained for aptamers SP5, SP6 and SP7 as well as truncated aptamers SP6.51, SP6.45, SP6.41, SP6.34 and SP7.32 to a much higher extend as the full-length aptamers. No binding was detectable for the non-binding control sequence SP5sc, truncated aptamer SP6.19 and point mutants SP6.34G and SP6.34C, whereas impaired binding was detectable for truncated aptamer SP7.55 and point mutant SP6.34A. Without being bound to a specific theory, it is assumed that the three-dimensional stem-loop structure of the aptamer is impaired, particularly that a putative apical stem structure is destabilized.

[0101] This shows that the motif of SEQ ID NO: 1 is important for binding of the aptamers to SARS-CoV-2 spike glycoprotein. Further, a sequence length less then of the motif of SEQ ID NO: 1 lead to reduced binding or loss of binding capacity.

EXAMPLE 6

[0102] SARS-CoV-2 spike glycoprotein detection by Sandwich ELONA

[0103] A Sandwich Enzyme-Linked OligoNucleotide Assay (ELONA) was performed to demonstrate SARS-CoV-2 spike glycoprotein detection using the full-length aptamer SP6 and truncated aptamer SP6.34 as well as non-binding control sequences SP6C (5-GGGAGAGGAGGGAGATAGATATCAACCCATGGTAGGTATTGCTTGGTAGCGATAGTGGG CTTGATGTITCGTGGATGCCACAGGAC-3 (SEQ ID NO: 34)) and SP6.34C.

[0104] 33 ng/ml of nanobody VHH E (Nanobody Core Facility) was immobilized in 20 l bicarbonate/carbonate buffer (pH 9.6) on 96 halve-well microtiter plates (MICROLON 600, VWR) at 4 C. over night. After removal of the supernatant, two washing steps with 100 l 1 PBS with 0.05% Tween 20 were performed. Wells were blocked with 1 PBS with 5% BSA for 1 hour at RT, followed by two washing steps with 100 l 1 PBS with 3 mM MgCl.sub.2. Afterwards the SARS-CoV-2 spike glycoprotein at concentrations of 1000, 500, 100, 50, 10, 5 and 1 nM in 1 PBS with 3 mM MgCl.sub.2 and 0.8 mg/ml BSA was incubated in 20 l at RT. After removal of the supernatant, two washing steps with 1PBS with 3 mM MgCl.sub.2 were performed. Next, 5-biotinylated DNA aptamers SP6 and SP6.34 and controls SP6C and SP6.34C in 1 PBS with 3 mM MgCl.sub.2 and 0.8 mg/ml BSA at a 500 nM concentration were incubated in 20 l at RT, followed by two washing steps with 1PBS with 3 mM MgCl.sub.2. Streptavidin-HRP (GE Healthcare) in a 1:1000 dilution in 1PBS with 3 mM MgCl.sub.2 was incubated in 20 l at RT, followed by two washing steps with 1PBS with 3 mM MgCl2. Finally, 100 l ABTS (ThermoFisher) per well were incubated at RT for 40 min and the absorbance at 405 nm was measured on a Tecan Nanoquant (Tecan).

[0105] FIG. 5 illustrates the results of the ELONA assay using the 5-biotinylated aptamers SP6 and SP6.34, non-binding control sequences SP6C and SP6.34C and SARS-CoV-2 spike glycoprotein (Spike2) at concentrations of 1000, 500, 100, 50, 10, 5 and 1 nM. It was possible to detect Spike2 concentrations of 1000, 500, 100, 50, 10 and 5 nM using SP6 and SP6.34, whereas no detection was possible for a SARS-CoV-2 spike glycoprotein concentration of 1 nM or for the non-binding control sequences SP6C and SP6.34 at any SARS-CoV-2 spike glycoprotein concentration.

EXAMPLE 7

[0106] K.sub.D determination using surface plasmon resonance

[0107] Affinities of the 5-biotinylated full-length aptamers SP5, SP6 and SP7 were determined by surface plasmon resonance (SPR) on a BIAcore 3000 instrument (GE Healthcare Europe). All buffers were filtered and degassed prior use. 50 nM biotinylated aptamers SP5 (flow cell 2), SP6 (flow cell 3) and SP7 (flow cell 4) and the control SP5sc (flow cell 1) in 0.5 M NaCl were immobilized on XanTec SAD chips (XanTec Bioanalytics) with a flow rate of 10 l/min at 25 C. until a response of 200 response units was reached. The SARS-CoV-2 spike glycoprotein protein in 1 PBS with 3 mM MgCl.sub.2 and 1 mg/ml BSA was injected at concentrations of 1000, 700, 316, 200, 100, 31.6, 10, 3.16 and 1 nM for 180 s at 25 C. and 37 C. The dissociation time was 400 s, followed by a regeneration step with 0.5% sodium dodecyl sulfate. After each regeneration step a new injection of SARS-CoV-2 spike glycoprotein at a higher concentrations followed up to 1000 nM. Data was evaluated using the BIAevaluation 4.1 (Biacore) software: 1:1 binding with drifting baseline.

[0108] FIG. 6 illustrates the results of the affinity determination by SPR for 5-biotinylated full-length aptamers SP5, SP6 and SP7 at 37 C. and 25 C. in FIGS. 6 A), C) and E) and FIGS. 6 B), D) and F), respectively. After injection start of the SARS-CoV-2 spike glycoprotein (Spike2) at concentrations of 1000, 700, 316, 200, 100, 31.6, 10, 3.16 and 1 nM after 120 sec, an increase of response can be detected for SP5, SP6 and SP7 at both temperatures for the respective flow cell minus the response for the reference flow cell 1, which bears the non-binding control SP5sc. During SARS-CoV-2 spike glycoprotein injection, no plateau area was reached for any of the sequences at both temperatures. After injection stop after 300 sec and only 1PBS with 3 mM MgCl.sub.2 buffer flow, no reduction of response was detected, which would be caused by dissociation of the Spike2-aptamer complex.

[0109] The following Table 1 summarises the K.sub.D, k.sub.a and k.sub.d rates of SP5, SP6 and SP7 at 37 C. and 25 C.

TABLE-US-00005 TABLE 1 Binding and affinity constants of aptamers SP5 (SEQ ID NO: 18), SP6 (SEQ ID NO: 12) and SP7 (SEQ ID NO: 19) with different modifications Sequence temperature k.sub.a (10.sup.4M.sup.1s.sup.1) K.sub.d (10.sup.4s.sup.1) K.sub.D [nM] SP5 37 C. .sup.1 0.2 37 36 9.2 7.9 SP6 37 C. 2.1 0.6 4.5 1.9 .sup.21 4.6 Sp7 37 C. 1.5 0.4 2.9 1.2 18.9 5.5 SP5 25 C. 1.19 0.08 1.74 0.01 14.7 0.8 SP6 25 C. 2.5 0.3 3.4 0.2 13.9 0.6 Sp7 25 C. 1.3 0.2 1.7 0.7 13.1 3.8

[0110] This shows that the aptamers SP5, SP6 and SP7 bind with good affinity to SARS-CoV-2 spike glycoprotein. Further, a low k.sub.off rate was seen.

EXAMPLE 8

[0111] Determination that binding of ACE2 to SARS-CoV-2 spike glycoprotein not inhibited by aptamer SP6

[0112] As aptamer SP6 appears not to bind to the RBD of SARS-CoV-2 spike glycoprotein it was tested whether SP6 would interfere with binding of SARS-CoV-2 spike glycoprotein to ACE2. To this end His-tagged SARS-CoV-2 spike glycoprotein was pulled by Ni-NTA magnetic beads and co-pulldown of ACE2 lacking the His tag (ACE2His) was analyzed.

[0113] For spike-ACE2 complex pulldowns 1 M SARS-CoV-2-S-HexaPro and ACE2 (without 8His tag) were incubated in the presence of 3 M SP6 or VHH E, as indicated, in PBS/4 mM MgCl.sub.2/2.5 M BSA. An aliquot was removed (input) and 20 l pre-equilibrated HisPur Ni-NTA Magnetic Beads (Thermo) were added. After 30 min incubation at room temperature (rt) on an overhead rotator beads were collected on a magnet and an aliquot was removed from the supernatant (unbound). After washing two times with 250 l PBS/3 mM MgCl.sub.2 proteins were eluted with 25 mM HEPES/KOH, pH 7.8/150 mM NaCl/1 M imidazole (eluate). Samples were separated by SDS-PAGE. Coomassie-stained gels were scanned on an Odyssey Sa (Licor).

[0114] FIG. 7 shows the Coomassie-stained gels illustrating that whereas the interaction between SARS-CoV-2 spike glycoprotein and ACE2 was abolished by nanobody VHH E it was not affected by aptamer SP6. Densitometry of the bands gave ratios of ACE2: S of 0.18 and 0.16 in the absence or presence of SP6, respectively. This demonstrates that aptamer SP6 does not affect binding of SARS-CoV-2 spike protein to ACE2.

EXAMPLE 9

[0115] Determination of Inhibition of Pseudovirus Infection

[0116] To address the question whether SP6 would interfere with infection the established VSV-G-based pseudotype system was used which allows infection being quantified by flow cytometry. ACE2-expressing Vero E6 cells were infected with Cov2-S or VSV-G pseudotyped viruses which had been pre-incubated with aptamers or not as detailed below. Pseudotype particle number was adjusted such that the infection rate of untreated pseudotypes was between 8% and 10%. The low infection rate was chosen to prevent multiple infections of a single cell which would preclude reliable measurements.

[0117] Vero E6 cells were cultivated in DMEM (Thermo)/10% FBS (PAN) at 37 C. and 8% CO.sub.2. The day before infection 510.sup.4 cells were plated per well of a 24well plate. Virus particles pseudotyped with SARS-CoV-2-S(D614G)-A19 or VSV-G were pre-incubated for 20 min at room temperature (rt) with the indicated aptamer in DMEM/3 mM MgCl.sub.2. The culture medium was removed from the cells and replaced by 150 l pre-incubated virus (MOI0.1). After incubation for 1 h at 37 C. 0.5 ml DMEM/10% FBS/3 mM MgCl.sub.2 was added and the cells were cultivated for 16-18 h. Cells were detached with trypsin, fixed for 20 min at rt with 4% formaldehyde, pelleted (800 g, 5 min, rt) and resuspended in PBS. Infection rate was determined as percentage of GFP-positive cells by flow cytometry (BectonDickinson). For statistical analysis the non-parametric Kruskal-Wallis test and Dunn's multiple comparison post-test was used because due to the small sample size of n=5 Gaussian distribution fo the values could not be tested. Analysis was performed with Prism 5.0f (GraphPad).

[0118] FIG. 8 illustrates the infection results. As can be taken from the FIG. 8, SP6 showed a concentration-dependent reduction of infection by CoV2-S pseudotype. In contrast, VSV-G pseudotype was not affected demonstrating that the inhibitory effect of SP6 depends on the presence of CoV2-S on the viral particles and excluding an unspecific effect on the infection process of the VSV backbone virus. SP6C showed some reduction of infection in agreement with its reduced binding to CoV2-S in the pulldown assay. Inhibition by SP6C did not reach statistical significance but also depended on the presence of CoV2-S on the viral particles, n=5, *** p<0.001, ** p<0.01, numbers on the y-axis represent percent infected cells.

[0119] This shows that the aptamer provides a reduction of infection by CoV2-S pseudotype and thus could be usable in the treatment of a SARS-CoV-2 infection.

[0120] The work leading to this invention has received funding from BMBF under grant agreement n 01K120154.