P21 MRNA TARGETING DNAZYMES

20240076671 ยท 2024-03-07

Assignee

Inventors

Cpc classification

International classification

Abstract

A composition of matter comprising a DNAzyme molecule capable of mediating cleavage of p21 mRNA corresponding to SEQ ID NO: 1, wherein said DNAzyme molecule comprises a nucleic acid sequence at least 80% identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 23, 29, 33-38, 40, 42, 45-48, 53-60, 63-65, 69-74 or 78, is disclosed. Methods of eradicating senescent cells or cancer cells, as well as methods of treating senescence-associated diseases or disorders, cancer, and fibrotic diseases and disorders are also disclosed.

Claims

1. A DNAzyme molecule comprising the nucleic acid sequence as set forth in any one of SEQ ID NOs: 54, 6-29, 30-40, or 42-78.

2. The DNAzyme of claim 1, wherein said nucleic acid sequence comprises a modification that increases the stability or prevents degradation of the DNAzyme molecule.

3. The DNAzyme of claim 2, wherein said modification comprises an edge-blocker oligonucleotide.

4. The DNAzyme of claim 2, wherein said modification comprises an inverted deoxythymidine (dT) positioned at the 3 end of the DNAzyme molecule.

5. The DNAzyme of claim 1, wherein said DNAzyme molecule is attached to a heterologous moiety.

6. The DNAzyme of claim 5, wherein the heterologous moiety comprises a cell-targeting moiety or a cell-penetrating moiety.

7. The DNAzyme of claim 6, wherein the cell-targeting moiety is an affinity moiety.

8. The DNAzyme of claim 6, wherein the cell-targeting moiety binds to a senescent cell specific cell surface polypeptide.

9. The DNAzyme of claim 6, wherein the cell-targeting moiety binds to a cancer cell specific cell surface polypeptide.

10. A pharmaceutical composition comprising the DNAzyme of claim 1 and a pharmaceutically acceptable carrier.

11. A method of treating a disease in a subject in need thereof, said disease selected from a senescence-associated disease or disorder, a cancer, or a fibrotic disease or disorder, the method comprising administering to the subject a therapeutically effective amount of a DNAzyme molecule, said DNAzyme molecule comprising a nucleic acid sequence as set forth in any one of SEQ ID NOs: 54, 6-29, 30-40, or 42-78, wherein said administration treats said disease.

12. The method of claim 11, wherein when said disease is a senescence-associated disease or disorder, or a cancer, said method eradicates senescent cells or cancer cells, respectively.

13. The method of claim 11, wherein said senescence-associated disease or disorder is selected from the group of an age-related disease or disorder, a neurological disease or disorder, a neurodegenerative disease or disorder, a cardiovascular disease or disorder, a pulmonary disease or disorder, an inflammatory disease or disorder, an autoimmune disease or disorder, a metabolic disease or disorder, a hepatic disease or disorder, a dermatological disease or disorder, an eye disease or disorder, a fibrotic disease or disorder, a cardiac disease or disorder, a vascular disease or disorder, a renal disease or disorder, and a cancer.

14. The method of claim 13, wherein said cancer is a therapy-resistant cancer.

15. The method of claim 11, wherein said fibrotic disease or disorder is selected from the group of a pulmonary fibrosis, a liver fibrosis, a kidney fibrosis, a pancreatic fibrosis, a cardiac fibrosis, a scleroderma or systemic sclerosis, an oral submucosa fibrosis, an intestinal fibrosis, an eosinophilic esophagitis, hypereosinophilic syndromes (HES), and Loeffler's endomyocarditis or skin fibrosis.

16. The method of claim 15, wherein said pulmonary fibrosis is idiopathic pulmonary fibrosis.

17. The method of claim 15, wherein said liver fibrosis is non-alcoholic steatohepatitis.

18. The method of claim 11, wherein said administration comprises systemic, intranasal, inhalation, intracerebroventricular, intrathecal, oral, local injection, intratumoral, or intravenous administration.

19. The method of claim 11, wherein said subject is a human subject.

20. The method of claim 11, wherein said nucleic acid sequence comprises a modification that increases the stability or prevents degradation of the DNAzyme molecule.

21. The method of claim 20, wherein said modification comprises an edge-blocker oligonucleotide or an inverted deoxythymidine (dT) positioned at the 3 end of the DNAzyme molecule.

22. The method of claim 11, wherein said DNAzyme molecule is attached to a heterologous moiety.

23. The method of claim 22, wherein the heterologous moiety comprises a cell-targeting moiety or a cell-penetrating moiety.

24. The method of claim 23, wherein the cell-targeting moiety is an affinity moiety, optionally binding to a senescent cell specific cell surface polypeptide or cancer cell specific cell surface polypeptide.

Description

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

[0070] The patent application file contains at least on drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the office upon request and payment of necessary fees.

[0071] Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

[0072] FIG. 1 is a schematic illustration of the p53- and p16-pRB pathways controlling cellular senescence [modified from Campisi, J. and Di Fagagna, FDA, Nature reviews Molecular cell biology (2007) 8(9), 729-740]. Abbreviations are as follows: alternate-reading-frame protein (ARF), HDM2 (an E3 ubiquitin ligase), cyclin-dependent kinases (CDKs), p16-retinoblastoma protein (pRB).

[0073] FIGS. 2A-2C is a schematic illustration of DNAzyme-mediated senolytic activity. FIG. 2A: DNAzyme structurecomposed of two recognition arms that bind the mRNA sequence and a catalytic core which cleaves the target mRNA. FIG. 2B: Mechanism of actionthe DNAzyme binds to the target mRNA via base paring with the recognition arms and the catalytic core (also referred to as catalytic site) is then able to cleave the phosphodiester bond thereby preventing subsequent protein translation. DNAzyme molecules are able to release themselves from the target mRNA following cleavage and recycle to cleave additional mRNA molecules of the same target.

[0074] FIG. 2C: Senolytic activity is achieved by degradation and silencing of key senescence survival regulator targets thereby causing senescent cell death.

[0075] FIG. 3 illustrates the mRNA sequence for human p21 (i.e. Homo sapiens cyclin dependent kinase inhibitor 1A (CDKN1A), transcript variant 3, mRNA, NM_001291549.3, as set forth in SEQ ID NO: 1).

[0076] FIGS. 4A-4D illustrate in vitro cleavage of human p21 mRNA by DNAzymes (also designated as Dz or Dnz). FIG. 4A: agarose gel electrophoresis of p21 mRNA incubated with several targeting DNAzymes. FIG. 4B: Quantification of FIG. 4A. Scrambled DNAzymes controls were mutated in either the sequence recognition arms or catalytic core (Scr A and B, respectively). FIG. 4C: time and concentration dependent cleavage of the p21 mRNA using the DNAzyme 1670. FIG. 4D: Quantitative analysis of time and concentration dependent cleavage of the p21 mRNA using the DNAzyme 1670.

[0077] FIGS. 5A-5J illustrate fluorescent microscopy tracking of p21-targeting DNAzyme internalization, p21 mRNA and protein level reduction, and subsequent induction of apoptosis leading to senescent cell elimination. FIGS. 5A-5C: Internalization of Cy5-labeled DNAzyme (red) as demonstrated by the appearance of staining in DNAzyme-treated senescent cells (FIG. 5A: untreated, FIG. 5B: treated, FIG. 5C: quantified). FIG. 5D: p21 mRNA downregulation during the first 24 hours following DNAzyme treatment. Specifically, p21 mRNA levels were monitored over 24 hours following treatment with DNAzyme 1670, DNAzyme 985 and their scrambled controls (2000 nM each). FIGS. 5E-5G: p21 protein downregulation 48 hours following senescent cell treatment with DNAzyme 1670 (1000 nM) (FIG. 5E: before treatment with DNAzyme, FIG. 5F: after 48 hours incubation with DNAzyme, FIG. 5G: quantified). FIGS. 5H-5J: Senescent cell death was quantified by staining for Cleaved Caspase 3/7 (CC3/7) (FIG. 5H: before treatment, FIG. 5I: 72 hours after treatment, FIG. 5J: quantification of CC3/7 over time). Specifically, time course analysis of CC3 activation following DNAzyme 1670 and DNAzyme 985 and their respective scrambled controls (1000 nM each).

[0078] FIGS. 6A-6D illustrate that p21 mRNA-targeting DNAzymes show specific and efficient killing of senescent cells. FIG. 6A: Bright-field images of senescent human IMR-90 fibroblast cells treated with DNAzyme 1114 or untreated control. FIG. 6B: Viability assay. Of note, killing of senescent cells by p21 mRNA-targeting DNAzymes was effective (of note: scrambled; scr shows no killing), the effect was specific to senescent cells as growing (non-senescent) IMR-90 cells treated with DNAzymes did not undergo cell death. FIG. 6C: Selectivity of DNAzyme 1114 was maintained over a large range of concentrations. FIG. 6D: Effect of DNAzyme 1114 was not cell-lineage dependent as senescent, but not growing cells, from the lung fibroblast and epithelial kidney lineages (WI-38 and REC, respectively) were effectively eliminated.

[0079] FIGS. 7A-7B illustrate DNAzyme improvements. FIG. 7A: Extension of the DNA binding arm length from 9 to 11 bases increased target mRNA degradation in vitro as seen by quantification of agarose gel electrophoresis. FIG. 7B: Addition of an inverted dT sequence at the 3 end of the DNAzyme increased stability in BALF (bronchalveolar lavage fluid) (compared respective black traces to corresponding red traces).

[0080] FIG. 8 illustrates the mRNA sequence for mouse p21 (i.e. NM_007669.5 Mus musculus cyclin-dependent kinase inhibitor 1A (P21) (Cdkn1a), transcript variant 1, mRNA, as set forth in SEQ ID NO: 3).

[0081] FIGS. 9A-9B illustrate the establishment of mouse p21-targeting DNAzymes for in vivo studies. FIG. 9A: Mouse p21 mRNA in vitro cleavage shown by agarose gel electrophoresis.

[0082] FIG. 9B: Mouse senescent lung fibroblast (mLF) killing by several DNAzyme sequences (Scr; scrambled sequence control).

[0083] FIGS. 10A-10D illustrate that p21 DNAzyme reduces fibrosis in vivo. FIG. 10A: Schematic illustration of experimental settings. FIG. 10B: Ashcroft score by histological assessment of lung sections from mice sacrificed at day 21 after bleomycin treatment. FIG. 10C: Average body weight at day 21 following lung fibrosis-inducing bleomycin treatment. FIG. 10D: Survival curves following DNAzyme treatment.

[0084] FIGS. 11A-11C illustrate the mechanism of action of p21-targeting DNAzymes. FIG. 11A: Staining of ?H2A.X and p53BP1 (DAPI in blue) in DNAzyme 1670 versus scrambled control treated senescent cells (DNAzyme concentration: 1000 nM). Scale bar is 350 ?m. FIGS. 11B-11C: Time course of ?H2A.X and p53BP1 accumulation, respectively, following DNAzyme 1670 and DNAzyme 985 treatment or their respective scrambled controls (1000 nM each). Error bars are SEM.

[0085] FIGS. 12A-12G illustrate efficacy and selectivity of DNAzymes. FIG. 12A: Growing and senescent cell survival over time following treatment with DNAzyme 1670 and DNAzyme 985 and their respective controls (1000 nM each). Statistical analysis for each DNAzyme comparing senescent with growing cells. FIG. 12B: Dose dependent analysis of DNAzyme 1670. FIG. 12C: Dose dependent analysis of DNAzyme 985. FIG. 12D: DNAzyme-mediated senolytic activity of DNAzyme 1670 and DNAzyme 985 on BJ foreskin fibroblasts. DNAzyme concentration: 625 nM. FIG. 12E: DNAzyme-mediated senolytic activity of DNAzyme 1670 and DNAzyme 985 on IMR-90 induced to senesce by Replicative Induced Senescence (RIS) (i.e. by replicative exhaustion) and Oncogene Induced Senescence (OIS) (i.e. by H-Ras activation). DNAzyme concentration: 1000 nM. FIGS. 12F-12G: DNAzyme-mediated senolytic activity of DNAzyme 1670 on Therapy Induced Senescence (TIS) cancer cells. Combination of DNAzyme 1670 with sub-clinical Etoposide treatment using several cell lines (FIG. 12F). Sub-clinical and clinical chemotherapy doses were determined for the various cell lines used (see chemotherapy and DNAzyme concentrations in the general materials and experimental procedures section below). Combination of DNAzyme 1670 with additional chemotherapies in HepG2 cancer cell line (FIG. 12G). Doxo: Doxorubicin, Palbo: Palbociclib. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001.

[0086] FIGS. 13A-13O illustrate stability, biodistribution, and safety of a p21-targeting DNAzyme. FIG. 13A: Time dependent stability of unmodified DNAzyme 1670 in PBS, serum and BALF analyzed by agarose gel electrophoresis. FIG. 13B: Stability of DNAzyme 1670 in PBS and serum, with or without a 3 inverted-dT modification. Error bars are SEM. FIG. 13C: Stability of DNAzyme 1670 in PBS and BALF from naive and bleomycin treated (at day 7 post treatment) mice with or without a 3 inverted-dT modification. FIG. 13D: Long term kinetics of DNAzyme 1670 biodistribution in the lung over time. Quantification of signal in the lung of 5 Cy5.5-labeled and 3 inverted dT modified-DNAzyme 1670 after intratracheal administration in na?ve and bleomycin-treated (at day 7 post treatment) miceusing image analysis software. Error bars are SEM. FIG. 13E: Experimental paradigm of an in-vivo safety study of DNAzyme 1670 using healthy C57/B6 mice of both sexes. FIG. 13F: Body weight index (percent of day 0) during the safety experiment. Error bars are SEM. FIGS. 13G-13O: Blood counts of selected cell types after two-week treatment with DNAzyme 1670.

[0087] FIGS. 14A-14F illustrate that p21-targeting DNAzyme ameliorates idiopathic pulmonary fibrosis (IPF) in a mouse disease model (following the schematic illustration of FIG. 10A). FIG. 14A: Oxygen saturation in blood. FIG. 14B: Quantification of p21 staining using immunohistochemistry (IHC) by image analysis of lung sections at day 21 (data not shown). FIG. 14C: RNA expression analysis of senescence and senescence associated secretory phenotype (SASP) genes in the post caval lobe of the lung at day 21 (normalized to Rplp0). FIG. 14D: Quantification of collagen content in Masson's Trichrome stained histological sections (of FIG. 14B). FIG. 14E: Quantification of hydroxyproline content from left lung samples at day 21. FIG. 14F: Density quantification of Masson's Trichrome stained sections.

[0088] FIGS. 15A-15C illustrate that p21 upregulation in chemotherapy induced senescence (CIS) is blocked by p21-targeting DNAzyme. FIG. 15A: Staining and quantification of p21 protein in HepG2 cells following Etoposide alone or together with DNAzyme 1670. Of note, data shows that p21 upregulation is blocked when DNAzyme 1670 is introduced into the cells. FIGS. 15B-15C: Evaluation of p21 protein in cell lysate by immunofluorescence (IF) and enzyme-linked immunosorbent assay (ELISA), respectively, following treatment of Etoposide alone or together with scramble or DNAzyme 1670. Of note, data indicates that DNAzyme 1670 can counteract the upregulation in p21 levels.

[0089] FIGS. 16A-16B illustrate killing of HepG2 cells by p21-targeting DNAzymes. FIG. 16A: Evaluation of killing efficacy of p21-targeting DNAzymes on HepG2 cells, when introduced together with Etoposide. FIG. 16B: Dose response analysis comparing the effects of scramble versus DNAzyme 1670 on cancer cells (A549), demonstrating that p21 DNAzyme is effective at much lower concentration.

[0090] FIGS. 17A-17B illustrate p21-targeting DNAzyme in chronic kidney disease model (CKD). FIG. 17A: Kidney-Body weight ratio in unilateral ureteral obstruction (UUO)-treated mouse as a model of CKD. Of note, treatment with p21-targeting DNAzyme reduced the kidney weight which correlates with disease severity. FIG. 17B: Quantification of fibrotic area in kidney from UUO-treated mice, following treatment with p21-targeting DNAzyme. Of note, treatment with p21-targeting DNAzyme showed significant reduction in the fibrosis.

[0091] FIGS. 18A-18O illustrate the identification and activity of a p21-targeting DNAzyme (DZ). FIG. 18A shows screening strategy. Screening for in vitro mRNA cleavage and for senolytic activity (% killing) with specific DZ (500 nM). IMR90 cells induced to senesce by Etoposide treatment were used to evaluate the senolytic activity of DZs throughout this figure. FIG. 18B presents DZs covering a region in the p21 mRNA hypothesized to display an accessible structure for cleavage. An example of an optimal target region is seen between bases 1967-2021. FIG. 18C presents phase contrast and fluorescent images of IMR-90 cells stained for senescence-associated (SA)-?-galactosidase (dark blue), p21 (orange) and DAPI (light blue). Scale bar is 350 ?m. FIG. 18D presents screening results, correlation analysis of DZ mRNA cleavage score vs killing percentage. FIG. 18E presents in vitro cleavage analysis of p21 mRNA by top hits (500 nM). Target the full length p21 mRNA quantified by densitometry. DZs with scrambled arms (ScrA) and loop (ScrB) regions show no activity. FIG. 18F presents killing assay of lead DZs (500 nM). Statistical comparison between growing and senescent cells is presented as #. FIG. 18G shows in vitro cleavage analysis of p21 IVT-RNA by hit DNAzymes (500 nM). DNAzymes with scrambled arms (ScrA) and loop (ScrB) regions show no activity. FIG. 18H shows snapshot from a molecular dynamics simulation of DZ p21 (purple) together with its target RNA (gray). Below are sequences of the DZ (purple; SEQ ID NO:149) and RNA (gray; SEQ ID NO:150). FIG. 18I shows kinetic assay of short probe cleavage by DZ p21. FIG. 18J shows time and dose dependence cleavage of the full p21 RNA by DZ p21. FIG. 18K shows quantification of FIG. 18J by densitometry. FIG. 18L shows read abundance analysis from RNA sequencing data, focused around the designated cleavage site of DZ p21. Blue, control samples; red, DZ p21-treated samples, both in independent triplicates, normalized relative to control samples average. The DZ cleavage site lies within the valley-shaped pattern in the middle of the red (treated groups) traces. FIG. 18M shows cleavage event score calculated for each purine-pyrimidine (RY) site in the human transcriptome based on RNA sequencing data. Color key represents site density per pixel. Site position along the contiguous reference genome is on the X axis; Y axis is the score calculated per site. Star, the specific DZ p21 cleavage site. Approximately 80 million RY sites are represented in the graph. FIG. 18N shows deeper analysis of the 5,000 highest ranking sites, based on NUPACK-simulated relative equilibrium concentration (Ceq) and ?G of the DZ-site complex, plotted against the Hamming distance of the shape of the predicted complex from a correct DZ-target catalytic complex, expressed in dot-parentheses notation. Star, the specific DZ p21 cleavage site. FIG. 18O shows nanopore RNAseq analysis of p21 IVT-RNA spiked in total RNA. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001; ###P<0.001; ####P<0.0001.

[0092] FIGS. 19A-19K illustrate the mechanism of action of p21-targeting DZ. FIG. 19A shows images demonstrating internalization of Cy-5.5 labeled DZ p21, and quantification using flow cytometry (DZ concentration 500 nM). FIG. 19B shows p21 mRNA levels over time following treatment with DZ p21 or scrambled control (2000 nM). FIG. 19C shows time course of p21 levels (protein) in senescent cells treated with DZ p21 or scrambled control (1000 nM each, DAPI in blue). Error bars are SEM. p21 protein expression 48 h treatment with DZ p21 (1000 nM). Scale bar is 350 ?m. FIGS. 19D-19E show time course of ?H2AX (FIG. 19D) and p53BP1 (FIG. 19E) accumulation in senescent cells treated with DZ p21 or scrambled control (DZ concentration 1000 nM). Error bars are SEM. FIG. 19F shows heat map of RNAseq analysis showing all statistically significant genes differentially expressed between DZ p21 or scrambled control 72 h post transfection of senescent IMR90 cells. FIG. 19G shows pathway enrichment analysis FIG. 19H shows time course analysis of CC3 activation following DZ p21 or scrambled controls (1000 nM each). FIG. 19I shows growing and senescent cell survival over time following treatment with DZ p21 or scrambled control (1000 nM each). Statistical analysis for each DZ comparing senescent IMR90 cells with growing IMR90 cells. FIG. 19J shows co-staining of p21 (orange) and p16 (green) following treatment with DZ p21 or scrambled control (1000 nM each, DAPI in blue). Scale bar is 200 ?m. Quantification of co-staining of p21 and p16. FIG. 19K shows schematic representation of the sequence of events following DZ p21 treatment in senescent cells. CC3; Cleaved Caspase-3. ***P<0.001; ****P<0.0001.

[0093] FIGS. 20A-20N illustrate efficacy and selectivity of p21-targeting DZ. FIG. 20A shows dose dependent killing effect of DZ p21 in IMR90 cells. FIG. 20B shows senolytic DZ activity of DZ p21 in IMR-90 cells induced to senesce by replicative exhaustion (RIS) and by H-Ras activation (Oncogene Induced Senescence; OIS). DZ concentration 1000 nM. FIG. 20C shows fluorescent images of OIS cells (GFP, green) treated with DZ p21 compared to scrambled control. FIGS. 20D-20E show senolytic DZ activity of DZ p21 in WI-38 lung fibroblasts (FIG. 20D) and BJ foreskin fibroblasts (FIG. 20E). DZ concentration 625 nM. FIG. 20F shows dose dependent analysis of DZ p21 in BJ cells compared to known senolytics, BCL-2 family protein inhibitors ABT-263 and ABT-737 (left), and a comparison of calculated senolytic index (right). FIG. 20G shows p21 mRNA levels following escalating doses of Etoposide treatment. FIG. 20H shows p21 mRNA levels in HepG2 cells following Etoposide treatment with either DZ p21 or scrambled control (40 nM each). FIG. 20I shows p21 protein levels in HepG2 cells following Etoposide treatment with either DZ p21 or scrambled control (20 nM and 40 nM each). FIG. 20J shows staining for p21 protein in HepG2 cells following Etoposide treatment with either DZ p21 or scrambled control (40 nM each). FIG. 20K shows Heat map showing killing of HepG2 72 h following escalating doses of Etoposide together with DZ p21 or ABT-263. FIG. 20L shows killing of HepG2 72 h following Etoposide (10 ?M) alone or together with DZ p21. FIG. 20M shows combination of DZ p21 with sub-clinical Etoposide treatment using several cell lines. Subclinical and clinical chemotherapy doses were determined for the various cell lines used. See chemotherapy and DZ concentrations in materials and methods. FIG. 20N shows combination of DZ p21 with additional chemotherapies in HepG2 cancer cell line. OIS; Oncogene Induced Senescence. RIS; Replicative Induced Senescence. TIS; Therapy Induced Senescence, Doxo; Doxorubicin, Palbo; Palbociclib. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001. Scale bar is 500 ?m.

[0094] FIGS. 21A-21J illustrate stability and biodistribution of a p21-targeting DZ. FIG. 21A shows killing of senescent mouse lung fibroblasts (mLF) by optimized DNAzyme. FIG. 21B shows mouse p21 IVT-RNA in vitro cleavage shown by agarose gel electrophoresis. FIG. 21C shows killing assay of DZ p21 with and without 3 inverted-dT addition (DNAzyme concentration 1250 nM). Gr; growing, Sen; senescent. FIG. 21D shows stability of DZ p21 in PBS and serum, with or without a 3 inverted-dT modification. Error bars are SEM. FIG. 21E shows stability of DZ p21 in PBS and BALF from naive and bleomycin-treated (at day 7 post treatment) mice with or without a 3 inverted-dT modification. FIG. 21F shows live image analysis of total body biodistribution over time of 5 Cy 5.5-labeled and 3 inverted dT modifiedDZ p21 after intratracheal administration in na?ve and bleomycin-treated (at day 7 post treatment) mice. Heat map false color correlates to Cy 5.5 levels. FIG. 21G shows time dependent stability of unmodified DZ p21 in PBS, serum and BALF, analyzed by agarose gel electrophoresis. FIG. 21H shows microscopic evaluation of Rhodamine 6G-labeled DZ p21 (Orange) uptake in mice lungs following intra nasal administration. Nuclei were counterstained with DAPI (blue). FIG. 21I shows ex-vivo images of extracted organs from the bleomycin treated mice from FIG. 21F. FIG. 21J shows quantification of FIG. 21I using image analysis. ***P<0.001; ****P<0.0001. Scale bar is 100 ?m.

[0095] FIGS. 22A-22S illustrate senolytic DZ ameliorates IPF in a mouse disease model. FIG. 22A shows experimental paradigm of the bleomycin-induced IPF model with two different treatment regimens (preventative and therapeutic) n=12. FIG. 22B shows Kaplan-Meier survival analysis of the different treatment groups in the experiment. FIG. 22C shows change in percent of body weight over time compared to day 0. Last observed carried forward (LOCF) values were used for dead mice. FIG. 22D shows body weight in grams on day 21. FIG. 22E shows percent of mice group achieving a given running distance (endurance) in a graded treadmill exercise test. FIG. 22F shows oxygen saturation in blood on day 21. FIG. 22G shows p21 mRNA expression levels in the post caval lobe of the lung at day 21 (normalized to Rplp0). FIGS. 22H-22I show p21 staining using immunohistochemistry (IHC) and quantification thereof by image analysis of lung sections at day 21. FIG. 22J shows RNA expression analysis of senescence and SASP genes in the post caval lobe of the lung at day 21 (normalized to Rplp0). FIGS. 22K-22L show ?-SMA IHC and quantification thereof by image analysis of lung sections at day 21. FIG. 22M shows Masson's Trichrome histological staining of lung sections at day 21. Squares marked on top images are enlarged on the bottom. FIG. 22N shows quantification of collagen content in Masson's Trichrome stained histological sections (of panel m). FIG. 22O shows quantification of hydroxyproline content from left lung samples at day 21. FIG. 22P shows density quantification of Masson's Trichrome stained sections. FIG. 22Q shows lung fibrosis grading by Aschroft score on day 21. IPF; Idiopathic Pulmonary Fibrosis, ?-SMA; alpha-smooth muscle actin, MTC; Masson's Trichrome. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001. Scale bar is 100 ?m. FIG. 22R shows the effects of DZ p21 in precision cut lung slices (PCLS) taken from a 54 y old patient with idiopathic pulmonary fibrosis. Relative expression levels of p21, collagen type I alpha 1 chain (COL1A1) and smooth muscle actin alpha 2 (ACTA2) (normalized to reference genes hypoxanthine phosphoribosyltransferase 1 (HPRT1) and 60S ribosomal protein P0 (RPLP0).

[0096] FIGS. 23A-23P illustrate systemic administration of senolytic DZ reduces fibrosis in mouse disease models. FIG. 23A shows ex-vivo images of extracted organs from the mice 2 h and 24 h following intravenous (I.V.) and subcutaneous (S.C.) administrations of 5 Cy 5.5-labeled and 3 inverted dT modifiedDZ p21. The left organs in each group were harvested from untreated mice. Heat map false color correlates to Cy 5.5 levels. FIG. 23B shows microscopic evaluation of DZ p21 (Orange) uptake into liver cells 24 h following intravenous administration, as was detected by FISH. Nuclei were counterstained with DAPI (blue). FIG. 23C shows experimental paradigm of the CCl4-induced liver fibrosis model, where CCl4 was given twice-a-week for 4 weeks for induction of chronic fibrosis. FIG. 23D shows p21 mRNA expression levels in the liver day 3 following DZ p21 administration (normalized to mplp). FIG. 23E shows liver-body ratio. FIG. 23F shows fibrotic area in the liver, quantified from sirius red stained sections for collagen. FIG. 23G shows levels of p21 mRNA during development of fibrosis in STAMTM mouse model. FIG. 23H shows experimental paradigm of the non-alcoholic steatohepatitis (NASH)-associated liver fibrosis, where combination of streptozotocin (STZ) at birth combined with a high fat diet from 4 weeks of age, induce fibrosis starting two weeks later. FIG. 23I shows liver-body ratio. FIG. 23J shows triglyceride content in the liver. FIG. 23K shows plasma ALT levels. FIG. 23L shows fibrotic area in the liver, quantified from sirius red stained sections for collagen. FIG. 23M shows experimental paradigm of the Unilateral Ureteral Obstruction (UUO)-induced kidney fibrosis, where fibrosis is being developed in the left obstructed kidney while the right one remains healthy. FIG. 23N shows kidney-body weight ratio. FIG. 23O shows plasma blood urea nitrogen (BUN) levels. FIG. 23P shows fibrotic area in the kidney, quantified from sirius red stained sections for collagen.

[0097] FIGS. 24A-24F illustrate recapitulation of some key findings reported in the study, using an 8-17 DZ targeting p21 instead of the DZ p21 (10-23 type DZ). FIG. 24A shows position of 8-17 DZ cleavage on human p21 mRNA. FIG. 24B shows p21 mRNA knockdown in senescent IMR-90 cells treated with DZ or scrambled control. FIG. 24C shows dose-response curve showing selective killing of senescent IMR-90 cells by the 8-17 DZ p21, showing a senolytic index of 41.8 (ratio between IC50 on senescent cells and IC50 on growing cells). FIG. 24D shows killing of cells induced to senescence by various methods. RIS, replication-induced senescence; OIS, oncogene-induced senescence. Scr, scrambled control. FIG. 24E shows fluorescent images of OIS cells (GFP, green) treated with 8-17 DZ p21 compared to scrambled control. FIG. 24F shows senolytic activity of the 8-17 DZ p21 in WI-38 lung fibroblasts and BJ foreskin fibroblasts (DZ concentration 625 nM).

[0098] FIG. 25A shows experimental outline of an in-vivo toxicity study of DZ p21 using healthy C57/B6 mice of both sexes. Body weight index (percent of day 0) during the safety experiment. Error bars are SEM. FIG. 25B shows blood counts of selected cell types after two-week treatment with the DZ p21. FIG. 25C shows blood biochemistry panel of selected analytes after two-week treatment with the DZ p21. FIG. 25D shows histopathological assessment of toxicity in selected tissues. Table represents individual animal incidence and mean group severity of findings. BALF, Bronchoalveolar Lavage Fluid; WBC, White Blood Cells; RBC, Red Blood Cells; Plate, Platelets; Lymph, Lymphocytes; Mono, Monocytes; Neut, Neutrophils; Eos, Eosinophils; Baso, Basophils; HGB, Hemoglobin; Creat, Creatinine; CPK, Creatinine Phosphokinase Test; ALT, Alanine Aminotransferase Test; AST, Aspartate Aminotransferase Test.

[0099] FIG. 26 shows Kaplan-Meier survival analysis, correlating p21 expression with survival rates in various human cancers. CESC, cervical squamous cell carcinoma & endocervical adenocarcinoma THYM, thymoma; UVM, uveal melanoma; PAAD, pancreatic adenocarcinoma.

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

[0100] The present invention, in some embodiments thereof, relates to p21 mRNA targeting DNAzymes and, more particularly, but not exclusively, to the use of same for therapeutics.

[0101] The principles and operation of the present invention may be better understood with reference to the drawings and accompanying descriptions.

[0102] Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting.

[0103] Cellular senescence is a stable form of cell-cycle arrest that is associated with chronic inflammation and with various pathologies, including fibrosis, atherosclerosis, osteoarthritis, diabetes and cancer. Cellular senescence is typically controlled by the p53 and p16-retinoblastoma protein (pRB) tumor suppressor pathways. Active p53 establishes the senescence growth arrest in part by inducing the expression of p21, a cyclin-dependent kinase (CDK) inhibitor that, among other activities, suppresses the phosphorylation and, hence, the inactivation of pRB. In normal cells, p21 maintains its genuine signature function as a cell cycle inhibitor and anti-proliferative effector. However, upregulation of p21 enables senescent cells to maintain their viability after damage induction, and allows their retention within tissues. Increased expression of p21 is evident in various age-related conditions associated with cellular senescence. The p21 protein (and its mRNA) is therefore an attractive target for diseases such as cancer therapy and other cellular senescence related diseases.

[0104] While reducing the present invention to practice, the present inventors have generated p21 mRNA-targeting DNAzyme molecules which mediate efficient and specific p21 RNA interference. Accordingly, these DNAzyme molecules can be used in therapeutics of senescent-associated diseases and cancer.

[0105] Specifically, the present inventors have designed and generated 72 DNAzymes, of these 34 were capable of specifically targeting and mediating cleavage of p21 mRNA (see Table 2 and FIGS. 4A-B). The cleavage by DNAzymes could be controlled by the dosage and incubation time as shown in FIGS. 4C-D. The present inventors illustrated that the DNAzymes were internalized by senescence cells, reduced p21 mRNA and protein levels therein and lead to senescence cell death (see Table 2, and FIGS. 5A-J). Treatment of senescence cells with p21-targeting DNAzymes lead to cell death by apoptosis following accumulation of DNA damage (FIGS. 11A-C). It was further illustrated that cell death was not dependent on cell type and was specific to senescence cells i.e. non-senescence cells did not undergo cell death (see FIGS. 6A-D and 12A-D). Treatment efficacy was illustrated in replicative induced senescence (RIS), in oncogene induced senescence (OIS) as well as in therapy induced senescence (TIS), in the latter case in combination with sub-clinical chemotherapy doses (FIGS. 12E-G). In order to increase stability (e.g. in the bronchoalveolar lavage fluid (BALF) and in the serum) and improve efficiency, the DNAzyme binding arms were extended by 1-2 nucleotides or an inverted dT sequence was added to the 3 end of the DNAzyme (FIGS. 7A-B and 13B-C). These p21-targeting DNAzyme were illustrated to be stable and safe in an in vivo mice model (FIGS. 13A-O).

[0106] In order to test the in-vivo efficacy of DNAzymes in a mouse model, the present inventors further devised DNAzymes which specifically target mouse p21 mRNA (see Table 3). These DNAzymes were shown to specifically target mouse p21 mRNA (see FIG. 9A), were senolytic i.e. lead to senescence cell death (see FIG. 9B) and reduced fibrosis in-vivo as evident in an idiopathic pulmonary fibrosis (IPF) model illustrating lower fibrotic score, higher body weight, increased survival, improved oxygen saturation in the blood, as well as lower collagen and hydroxyproline levels (see FIGS. 10B-D, 14A and 14D-E, respectively). Similar results were demonstrated in a chronic kidney disease model (CKD) illustrating that p21-targeting DNAzymes (DNZ_p21) significantly reduced the weight of the obstructed kidney and reduced the fibrotic extent (FIGS. 17A-B, respectively). Taken together, these results emphasize the therapeutic potential of p21-mRNA targeting DNAzymes for therapy, such as senolytics.

[0107] Thus, according to one aspect of the present invention there is provided a composition of matter comprising a DNAzyme molecule capable of mediating cleavage of p21 mRNA corresponding to SEQ ID NO: 1, wherein the DNAzyme molecule comprises a nucleic acid sequence at least 80% identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 23, 29, 33-38, 40, 42, 45-48, 53-60, 63-65, 69-74 or 78.

[0108] The term p21 also known as cyclin-dependent kinase inhibitor 1 refers to the mRNA product of the p21 gene (CDKN1A) having a sequence as set forth in SEQ ID NO: 1 (GeneBank Accession No. NM_001291549.3) and homologs, orthologs and variants thereof. Additional exemplary p21 mRNAs include, but are not limited to, those provided in GeneBank Accession Nos. NM_000389.5, NM_001220777.2, NM_001220778.2, NM_001374509.1, NM_001374510.1, NM_001374511.1, NM_001374512.1, NM_001374513.1 and NM_078467.3, or variants thereof.

[0109] The term DNAzyme (also referred to as a DNA enzyme or deoxyribozyme or DZ or Dnz) as used herein refers to a DNA molecule that has complementarity in a substrate binding domain or region to a ribonucleic acid (RNA) substrate and is capable of catalyzing a modification (such as a cleavage) of the nucleic acid substrate. Typically, the complementarity functions to allow sufficient hybridization of the DNAzyme molecule to the substrate at a target region to allow the intermolecular cleavage of the substrate to occur thereby functionally inactivating it. The cleavage can occur via two optional mechanisms: (i) intrinsic catalytic activity of the DNAzyme (ii) recruitment of RNAse H to the hybridization site, leading to cleavage of the target RNA. As used throughout, the terms DNAzyme, DNA enzyme, deoxyribozyme, DZ, and Dnz may be used interchangeably, having the same meanings and qualities.

[0110] Thus, the term mediating cleavage refers to direct catalytic activity (i.e. by the DNAzyme molecule) or indirect catalytic activity (i.e. by an enzyme recruited by the DNAzyme molecule) which leads to cleavage and RNA interference of the p21 mRNA.

[0111] The term target RNA or target region of an RNA refers to an RNA molecule (e.g. an mRNA molecule encoding a p21 gene product) that is a target for downregulation. Similarly, the phrase target site refers to a sequence within a target RNA (e.g. within the p21 mRNA sequence) that is targeted for cleavage mediated by the DNAzyme molecule that contains sequences within its substrate binding domains that are complementary to the target site (as discussed below).

[0112] According to one embodiment, silencing of the p21 mRNA (e.g. cleavage of the p21 mRNA) results in downregulation of mRNA and/or protein expression levels.

[0113] According to one embodiment, down regulating p21 expression level refers to the absence of p21 mRNA and/or protein, as detected by RT-PCR or Western blot/Immunofluorescent staining, respectively.

[0114] According to other embodiment, down regulating p21 expression level refers to a decrease in the level of p21 mRNA and/or protein, as detected by RT-PCR or Western blot/Immunofluorescent staining, respectively. The reduction may be by at least a 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% reduction, as compared to the expression level of p21 prior to the treatment.

[0115] Down regulation of expression may be either transient or permanent.

[0116] The term nucleic acid as used herein generally refers to a molecule (single-stranded or double-stranded oligomer or polymer) of DNA or RNA or a derivative, mimic or analog thereof, comprising a nucleobase. A nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine A, a guanine G, a thymine T, or a cytosine C) or a naturally occurring purine or pyrimidine base found in RNA (e.g., an adenine A, a guanine G, an uracil U or a cytosine C). The term nucleic acid encompasses the terms oligonucleotide and polynucleotide and nucleotides, each as a subgenus of the term nucleic acid. The term nucleic acid further includes nucleic acids derived from synthetic polynucleotide and/or oligonucleotide molecules composed of naturally occurring bases, sugars, and covalent internucleoside linkages (e.g., backbone), as well as synthetic polynucleotides and/or oligonucleotides having non-naturally occurring portions, which function similarly to respective naturally occurring portions, as further discussed herein below.

[0117] According to one embodiment, the DNAzyme molecule is synthetic. As used herein synthetic refers to a non-natural molecule.

[0118] The DNAzyme typically comprises a pair of binding arms which are complementary to binding regions on the nucleic acid substrate (e.g. p21 mRNA). Each binding arm of the DNAzyme comprises a number of nucleotides to permit sufficient bonding between the DNAzyme and its substrate to facilitate DNAzyme activity (i.e. cleavage of the p21 substrate at the target cleavage site). The binding arms may be the same or different lengths. Furthermore, the binding arms may comprise modified nucleotides, including modified bases, backbone, sugars and/or linkages to the extent that such modifications do not have an adverse effect on binding activity of the DNAzyme to the substrate (e.g. p21 mRNA). Such modifications are discussed below.

[0119] For example, each binding arm may comprise 5-25 nucleotides, 5-10 nucleotides, 10-15 nucleotides, 15-20 nucleotides or 20-25 nucleotides (e.g. deoxyribonucleotides or ribonucleotides). According to one embodiment, each binding arm comprises at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides (e.g. deoxyribonucleotides or ribonucleotides). According to a specific embodiment, each binding arm comprises at least about 8-10 nucleotides, e.g. 9 nucleotides (e.g. deoxyribonucleotides or ribonucleotides).

[0120] According to a specific embodiment, each of the binding arms of the DNAzyme molecule comprises no more than 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 nucleotides (e.g. deoxyribonucleotides or ribonucleotides).

[0121] As mentioned, the DNAzyme targets a nucleic acid-based substrate comprising binding regions which are essentially complementary to the binding arms of the DNAzyme, and which hybridize with the binding arms of the DNAzyme. The binding regions need not be fully complementary with the binding arms of the DNAzyme, provided that they hybridize sufficiently with the DNAzyme such that the catalytic activity of the DNAzyme is not adversely affected (e.g. exhibit at least about 70%, 80%, 85%, 90%, 95%, 97% or 99% complementarity). Typically, the cleavage site is within a target region of the substrate situated between the binding regions. The terminal 5- and 3 ends of the target region are each linked to a binding region at the appropriate corresponding terminus (e.g. 5 to 3) of the binding arm.

[0122] As used herein, the terms complementarity and complementary refer to a nucleic acid that can form one or more hydrogen bonds with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types of interactions. In reference to the nucleic molecules of the presently disclosed subject matter, the binding free energy for a nucleic acid molecule with its complementary sequence is sufficient to allow the relevant function of the nucleic acid to proceed, in some embodiments, binding with specificity by substrate binding domains of a DNAzyme of some embodiments of the invention such that the catalytic domain of the DNAzyme is brought in to close enough proximity with a target sequence to permit catalytic cleavage of the target sequence. The degree of complementarity between the substrate binding domains of the DNAzyme and the target region of a RNA (e.g. a p21 mRNA) can vary, but no more than by what is required in order to permit the DNAzyme to cleave or mediate cleavage (e.g. by RNase H) of the target region. Determination of binding free energies for nucleic acid molecules to determine percent complementarity is well known in the art. See e.g., Freier et al., 1986; Turner et al., 1987.

[0123] As used herein, the phrase percent complementarity refers to the percentage of contiguous residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively). The terms 100% complementary, fully complementary, and perfectly complementary indicate that all of the contiguous residues of a nucleic acid sequence can hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.

[0124] The DNAzyme additionally comprises a catalytic domain (also referred to as catalytic core) between the binding arms, generally in the form of a loop, which includes single-stranded DNA, and may optionally include double-stranded regions. The terminal 5- and 3 ends of the catalytic domain are each linked to a binding arm at the appropriate corresponding terminus of the binding arm (e.g. 5 to 3). The catalytic region may incorporate modified nucleotides, including modified bases, backbone, sugars and/or linkages to the extent that such modifications do not have an adverse effect on catalytic activity (i.e. cleavage activity) of the DNAzyme, such modifications are discussed below.

[0125] The size of the catalytic domain in each DNAzyme may include, for example, 5-100 nucleotides, e.g. 5-10 nucleotides, 10-20 nucleotides, 20-30 nucleotides, 30-40 nucleotides, 40-50 nucleotides, 50-75 nucleotides or 75-100 nucleotides (e.g. deoxyribonucleotides or ribonucleotides). According to one embodiment, the catalytic domain comprises at least about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides (e.g. deoxyribonucleotides or ribonucleotides). According to a specific embodiment, the catalytic domain comprises at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45 or 50 nucleotides (e.g. deoxyribonucleotides or ribonucleotides).

[0126] According to a specific embodiment, the catalytic domain of the DNAzyme molecule comprises no more than 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45 or 50 nucleotides (e.g. deoxyribonucleotides or ribonucleotides).

[0127] Exemplary DNAzyme catalytic domains which may be used in accordance with some embodiments of the invention, include, but are not limited to, the catalytic cores of lanthanide-dependent DNAzymes such as Cel3d, Lu12 and Tm7; the catalytic cores of magnesium-dependent DNAzymes such as 17E and 10-23, 8-17; the catalytic cores of uranyl-specific DNAzymes such as 39E and EHgOT; the catalytic cores of lead-dependent DNAzymes such as GR5; and functionally equivalent DNAzyme catalytic cores derived from any of these which exhibit a high degree of sequence identity, e.g. at least about 80%, 85%, 90%, 95% or 99%. The term functionally equivalent refers to DNAzyme catalytic cores which retain the ability to cleave the DNAzyme substrate or to recruit RNase H. Additional catalytic cores of DNAzymes which may be used in accordance with some embodiments of the invention include e.g. Bipartite I and Bipartite II (discussed in Feldman and Sen. Journal of molecular biology (2001) 313(2): 283-294, incorporated herein by reference), 10MD5 and I-R3 (discussed in Hollenstein, Molecules (2015) 20(11): 20777-20804, and in Zhou et al. Theranostics. 2017; 7(4): 1010-1025, both incorporated herein by reference).

[0128] According to one embodiment, the DNAzyme is a 10-23 type DNAzyme (i.e. comprises the 10-23 catalytic core).

[0129] The term 10-23 refers to a general DNAzyme model (discussed in detail in Sontoro and Joyce, PNAS (1997) 94 (9):4262-4266, incorporated herein by reference). DNAzymes of the 10-23 model typically have a catalytic domain of 15 nucleotides, which are flanked by two substrate binding domains. The catalytic domain of 10-23 DNAzymes typically comprises the sequence ggctagctacaacga (SEQ ID NO: 88). The DNAzyme 10-23 typically cleaves mRNA strands that contain an unpaired purine-pyrimidine pair. The length of the substrate binding domains of 10-23 DNAzymes is variable and may be of either equal length or variable length. According to one embodiment, the length of the substrate binding domains ranges between 6 and 14 nucleotides, e.g. between 8 and 12 nucleotides (e.g. 7, 8, 9, 10, 11, 12 nucleotides, e.g. 9 nucleotides).

[0130] According to one embodiment, the DNAzyme is a 8-17 type DNAzyme (i.e. comprises the 8-17 catalytic core).

[0131] The term 8-17 refers to a general DNAzyme model (discussed in detail in Sontoro and Joyce, PNAS (1997) 94 (9):4262-4266, incorporated herein by reference). DNAzymes of the 8-17 model typically have a catalytic domain of 14 nucleotides, which are flanked by two substrate binding domains. The catalytic domain of 8-17 DNAzymes typically comprises the sequence TCCGAGCCGGACGA (SEQ ID NO: 89). The length of the substrate binding domains of 8-17 DNAzymes is variable and may be of either equal length or variable length. According to one embodiment, the length of the substrate binding domains ranges between 6 and 14 nucleotides, e.g. between 8 and 12 nucleotides (e.g. 7, 8, 9, 10, 11, 12 nucleotides, e.g. 8 nucleotides).

[0132] According to one embodiment, the DNAzyme catalytic domain comprises the 16.2-11 catalytic core: GTGACCCCUUG (SEQ ID NO: 90); the 9-86 catalytic core: UCAUGCAGCGCGUAGUGUC (SEQ ID NO: 91); the 12-91 catalytic core: UGAUGCAGCGCAUGUGUC (SEQ ID NO: 92); the FR17_6 catalytic core: AAGCAGUUAAGAC (SEQ ID NO: 93) or the Bipartite I or Bipartite II catalytic core: AAGGAGGTAGGGGTTCCGCTCC (SEQ ID NO: 94).

[0133] According to one embodiment, the DNAzyme is an inducible DNAzyme. Exemplary inducible DNAzymes are MNAzymes (discussed in detail in Mokany et al., Journal of the American Chemical Society (2010) 132(3): 1051-1059, incorporated herein by reference). Specifically, MNAzymes are multicomponent complexes that produce amplified output signals in response to specific input signals. Multiple oligonucleotide partzymes assemble into active MNAzymes only in the presence of an input assembly facilitator such as a target nucleic acid. Once formed, MNAzymes catalytically modify a generic substrate, generating an amplified output signal that heralds the presence of the target while leaving the target intact.

[0134] According to a specific embodiment, the DNAzyme molecule comprises 20-80 nucleotides, e.g. 20-70 nucleotides, e.g. 20-60 nucleotides, e.g. 20-50 nucleotides, e.g. 20-40 nucleotides, e.g. 20-30 nucleotides, e.g. 30-50 nucleotides, e.g. 30-40 nucleotides (e.g. deoxyribonucleotides or ribonucleotides). According to a specific embodiment, the DNAzyme molecule comprises at least about 20, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, 55, 60, 65, 70 or 75 nucleotides (e.g. deoxyribonucleotides or ribonucleotides).

[0135] According to a specific embodiment, the DNAzyme molecule comprises no more than 20-80 nucleotides, e.g. 20-70 nucleotides, e.g. 20-60 nucleotides, e.g. 20-50 nucleotides, e.g. 20-40 nucleotides, e.g. 20-30 nucleotides, e.g. 30-50 nucleotides, e.g. 30-40 nucleotides (e.g. deoxyribonucleotides or ribonucleotides). According to a specific embodiment, the DNAzyme molecule comprises no more than e.g. 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 50, 55, 60, 65, 70, 75 or 80 nucleotides (e.g. deoxyribonucleotides or ribonucleotides).

[0136] In some embodiments, one or more mutations or modifications within the catalytic domain of the DNAzyme molecule can be carried out to increase the catalytic activity of the DNAzyme molecule (e.g. by insertion, deletion, substitution or point mutation of nucleic acids). It is to be understood that any mutation or modification, e.g., within the substrate binding domain sequences or catalytic domain sequence, must not adversely impact the molecule's ability to induce catalysis (e.g. cleave) the specific substrate, i.e. p21.

[0137] According to a specific embodiment, the modification comprises the insertion, deletion, substitution or point mutation of 1-10 nucleotides, e.g. 1-8 nucleotides, e.g. 1-6 nucleotides, e.g. 1-5 nucleotides, e.g. 1-4 nucleotides, e.g. 1-3 nucleotides, or e.g. 1-2 nucleotides in the catalytic domain of the DNAzyme.

[0138] According to a specific embodiment, the modification comprises the insertion, deletion, substitution or point mutation of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, e.g. 1 or 2 nucleotides, in the catalytic domain of the DNAzyme.

[0139] Additionally or alternatively, the DNAzyme molecule may be modified to alter the length of the substrate binding domains of the DNAzyme molecule. The substrate binding domains of the DNAzyme molecule have binding specificity for and associate with a complementary sequence of bases within a target region of a substrate nucleic acid sequence (as discussed above). Methods of altering the length of the recognition domains are known in the art and include direct synthesis and PCR, for example.

[0140] Alteration of the length of the recognition domains of a DNAzyme molecule can have a desirable effect on the binding specificity of the DNAzyme molecule. For example, an increase in the length of the substrate binding domains can increase binding specificity between the DNAzyme molecule and the complementary base sequences of a target region in a substrate polynucleotide (i.e. p21). In addition, an increase in the length of the substrate binding domains can also increase the affinity with which the DNA molecule binds to the polynucleotide substrate. In various embodiments, these altered substrate binding domains in the DNAzyme molecule confer increased binding specificity and affinity between the DNAzyme molecule and its substrate (i.e. p21), however, it may decrease catalytic efficiency of the DNAzyme. Therefore, one of skill in the art will appreciate that alteration of the length of the recognition domains is a balance of optimal binding and catalytic activity.

[0141] According to a specific embodiment, the modification comprises the addition of 1-10 nucleotides, e.g. 1-8 nucleotides, e.g. 1-6 nucleotides, e.g. 1-5 nucleotides, e.g. 1-4 nucleotides, e.g. 1-3 nucleotides, or e.g. 1-2 nucleotides to the substrate binding domain (i.e. binding arm) of the DNAzyme.

[0142] According to a specific embodiment, the modification comprises the addition of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, e.g. 1 or 2 nucleotides, to the substrate binding domain (i.e. binding arm) of the DNAzyme.

[0143] Additionally or alternatively, the substrate binding domains of the DNAzyme molecule may be modified to improve binding to the p21 mRNA target. Accordingly, the modification may comprise the insertion, deletion, substitution or point mutation of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, e.g. 1 or 2 nucleotides, in the substrate binding domain of the DNAzyme.

[0144] According to a specific embodiment, the DNAzyme molecule comprises a nucleic acid sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 23, 29, 33-38, 40, 42, 45-48, 53-60, 63-65, 69-74 or 78.

[0145] As used herein, sequence identity or identity in the context of two nucleic acid sequences includes reference to the residues in the two sequences which are the same when aligned.

[0146] Identity (e.g., percent homology) can be determined using any homology comparison software, including for example, the BlastN software of the National Center of Biotechnology Information (NCBI) such as by using default parameters.

[0147] According to some embodiments of the invention, the identity is a global identity, i.e., an identity over the entire nucleic acid sequences of the invention and not over portions thereof.

[0148] The degree of homology or identity between two or more sequences can be determined using various known sequence comparison tools. Following is a non-limiting description of such tools which can be used along with some embodiments of the invention.

[0149] When starting with a polynucleotide sequence and comparing to other polynucleotide sequences the EMBOSS-6.0.1 Needleman-Wunsch algorithm (available from emboss(dot)sourceforge(dot)net/apps/cvs/emboss/apps/needle(dot)html) can be used.

[0150] According to some embodiment, determination of the degree of homology further requires employing the Smith-Waterman algorithm (for protein-protein comparison or nucleotide-nucleotide comparison).

[0151] According to one embodiment, the DNAzyme molecule comprises a nucleic acid sequence at least 80% identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 23, 29, 33-38, 40, 42, 45-48, 53-60, 63-65, 69-74 or 78.

[0152] According to one embodiment, the DNAzyme molecule comprises a nucleic acid sequence at least 85% identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 23, 29, 33-38, 40, 42, 45-48, 53-60, 63-65, 69-74 or 78.

[0153] According to one embodiment, the DNAzyme molecule comprises a nucleic acid sequence at least 90% identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 23, 29, 33-38, 40, 42, 45-48, 53-60, 63-65, 69-74 or 78.

[0154] According to one embodiment, the DNAzyme molecule comprises a nucleic acid sequence at least 95% identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 23, 29, 33-38, 40, 42, 45-48, 53-60, 63-65, 69-74 or 78.

[0155] According to one embodiment, the DNAzyme molecule comprises a nucleic acid sequence at least 98% identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 23, 29, 33-38, 40, 42, 45-48, 53-60, 63-65, 69-74 or 78.

[0156] According to one embodiment, the DNAzyme molecule comprises a nucleic acid sequence at least 99% identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 23, 29, 33-38, 40, 42, 45-48, 53-60, 63-65, 69-74 or 78.

[0157] According to one embodiment, the DNAzyme molecule comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 23, 29, 33-38, 40, 42, 45-48, 53-60, 63-65, 69-74 or 78.

[0158] According to a specific embodiment, the DNAzyme molecule is DNAzyme 1114 comprising a nucleic acid sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence set forth set forth in SEQ ID NO: 40.

[0159] According to a specific embodiment, the DNAzyme molecule is DNAzyme 1114 comprising a nucleic acid sequence set forth in SEQ ID NO: 40.

[0160] According to a specific embodiment, the DNAzyme molecule is DNAzyme 1670 comprising a nucleic acid sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence set forth set forth in SEQ ID NO: 54.

[0161] According to a specific embodiment, the DNAzyme molecule is DNAzyme 1670 comprising a nucleic acid sequence set forth in SEQ ID NO: 54.

[0162] According to a specific embodiment, the DNAzyme molecule is DNAzyme 985 comprising a nucleic acid sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence set forth set forth in SEQ ID NO: 36.

[0163] According to a specific embodiment, the DNAzyme molecule is DNAzyme 985 comprising a nucleic acid sequence set forth in SEQ ID NO: 36.

[0164] According to a specific embodiment, the DNAzyme molecule is DNAzyme 1987 comprising a nucleic acid sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence set forth set forth in SEQ ID NO: 73.

[0165] According to a specific embodiment, the DNAzyme molecule is DNAzyme 1987 comprising a nucleic acid sequence set forth in SEQ ID NO: 73.

[0166] Various modifications to DNAzyme molecules can be made to enhance the utility of these molecules. Such modifications can enhance affinity for the nucleic acid target, increase activity, increase specificity, increase stability and decrease degradation (e.g. in the presence of nucleases), increase shelf-life, enhance half-life and/or improve introduction of such DNAzyme molecules to the target site (for example, to enhance penetration of cellular membranes, confer the ability to recognize and bind to targeted cells, and enhance cellular uptake), as discussed in further detail below.

[0167] According to one embodiment, the DNAzyme molecule comprises a modification selected from an insertion, deletion, substitution or point mutation of a nucleic acid, as long as the molecule retains at least about 80%, 85%, 90%, 95%, 99% or 100% of its the biological activity (i.e. silencing activity, e.g. mediating catalytic activity on the p21 substrate).

[0168] It will be appreciated that insertions, deletions, substitutions or point mutations can be generated using methods that produce random or specific alterations. These mutations or modifications can, for example, change the length of, or alter the nucleotide sequence of, a loop, a spacer region or the substrate binding domain (e.g. binding arm of the DNAzyme as discussed above) or add one or more non-nucleotide moieties to the molecule to, for example, increase stability and/or decrease degradation.

[0169] The DNAzyme molecule of the invention is optimally stable within cells until translation of the target RNA has been inhibited long enough to reduce the levels of the undesirable protein. This period of time varies between hours to days depending upon the cell type and state (e.g. senescence). Although DNAzyme molecules as described herein are considered advantageous over RNA based molecules in that DNAzymes are less sensitive to degradation, in some embodiments it is desirable to further increase stability and nuclease resistance of the DNAzymes. Furthermore, when RNA based molecules are utilized, these may be modified to increase their stability and nuclease resistance.

[0170] According to one embodiment, the modification is selected from the group consisting of a nucleobase modification, a sugar modification, and an internucleotide linkage modification (e.g. phosphorus-modified internucleotide linkage), as is broadly described herein under.

[0171] According to one embodiment, the DNAzyme molecule comprises one or more chemical modifications.

[0172] Any chemical modification can be applied to the DNAzyme molecule of the invention as long as the molecule retains at least about 80%, 85%, 90%, 95%, 99% or 100% of its the biological activity (i.e. silencing activity, e.g. mediating catalytic activity on the p21 substrate).

[0173] According to one embodiment, the DNAzyme molecule includes at least one base (e.g. nucleobase) modification or substitution.

[0174] As used herein, unmodified or natural bases include the purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified bases include but are not limited to other synthetic and natural bases, such as: 5-methylcytosine (5-me-C); 5-hydroxymethyl cytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine, and 2-thiocytosine; 5-halouracil and cytosine; 5-propynyl uracil and cytosine; 6-azo uracil, cytosine, and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines; 5-halo, particularly 5-bromo, 5-trifluoromethyl, and other 5-substituted uracils and cytosines; 7-methylguanine and 7-methyladenine; 8-azaguanine and 8-azaadenine; 7-deazaguanine and 7-deazaadenine; and 3-deazaguanine and 3-deazaadenine. Additional modified bases include those disclosed in: U.S. Pat. No. 3,687,808; Kroschwitz, J. I., ed. (1990), The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, John Wiley & Sons; Englisch et al. (1991), Angewandte Chemie, International Edition, 30, 613; and Sanghvi, Y. S., Antisense Research and Applications, Chapter 15, pages 289-302, S. T. Crooke and B. Lebleu, eds., CRC Press, 1993. Such modified bases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6-substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2? C. (Sanghvi, Y. S. et al. (1993), Antisense Research and Applications, pages 276-278, CRC Press, Boca Raton), and are presently preferred base substitutions, even more particularly when combined with 2-O-methoxyethyl sugar modifications. Additional base modifications are described in Deleavey and Damha, Chemistry and Biology (2012) 19: 937-954, incorporated herein by reference.

[0175] According to one embodiment, the modification is in the backbone (i.e. in the internucleotide linkage and/or the sugar moiety).

[0176] Sugar modification of nucleic acid molecules have been extensively described in the art (see PCT International Publication Nos. WO 92/07065, WO 93/15187, WO 98/13526, and WO 97/26270; U.S. Pat. Nos. 5,334,711; 5,716,824; and U.S. Pat. No. 5,627,053; Perrault et al., 1990; Pieken et al., 1991; Usman & Cedergren, 1992; Beigelman et al., 1995; Karpeisky et al., 1998; Earnshaw & Gait, 1998; Verma & Eckstein, 1998; Burlina et al., 1997; all of which are incorporated herein by reference). Such publications describe general methods and strategies to determine the location of incorporation of sugar, base, and/or phosphate modifications and the like into nucleic acid molecules without modulating catalysis. Exemplary sugar modifications include, but are not limited to, 2-modified nucleotide, e.g., a 2-deoxy, 2-fluoro (2-F), 2-deoxy-2-fluoro, 2-O-methyl (2-O-Me), 2-O-methoxyethyl (2-O-MOE), 2-O-aminopropyl (2-O-AP), 2-O-dimethylaminoethyl (2-O-DMAOE), 2-O-dimethylaminopropyl (2-O-DMAP), 2-O-dimethylaminoethyloxyethyl (2-O-DMAEOE), 2-Fluoroarabinooligonucleotides (2-F-ANA), 2-ON-methylacetamido (2-O-NMA), 2-NH2 or a locked nucleic acid (LNA). Additional sugar modifications are described in Deleavey and Damha, Chemistry and Biology (2012) 19: 937-954, incorporated herein by reference.

[0177] Thus, for example, oligonucleotides can be modified to enhance their stability and/or enhance biological activity by modification with nuclease resistant groups, for example, the DNAzyme molecule of the invention can include 2-O-methyl, 2-fluorine, 2-O-methoxyethyl, 2-O-aminopropyl, 2-amino, and/or phosphorothioate linkages. Inclusion of locked nucleic acids (LNA), e.g. inclusion of nucleic acid analogues in which the ribose ring is locked by a methylene bridge connecting the 2-0 atom and the 4-C atom, ethylene nucleic acids (ENA), e.g., 2-4-ethylene-bridged nucleic acids, and certain nucleobase modifications such as 2-amino-A, 2-thio (e.g., 2-thio-U), G-clamp modifications, can also increase binding affinity to the target. The inclusion of pyranose sugars in the oligonucleotide backbone can also decrease endonucleolytic cleavage. The binding arms may further include peptide nucleic acid (PNA) in which the deoxribose (or ribose) phosphate backbone in the DNA is replaced with a polyamide backbone, or may include polymer backbones, cyclic backbones, or acyclic backbones. The binding regions may incorporate sugar mimetics, and may additionally include protective groups, particularly at terminal ends thereof, to prevent undesirable degradation (as discussed below).

[0178] Exemplary internucleotide linkage modifications include, but are not limited to, phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkyl phosphotriester, methyl phosphonate, alkyl phosphonate (including 3-alkylene phosphonates), chiral phosphonate, phosphinate, phosphoramidate (including 3-amino phosphoramidate), aminoalkylphosphoramidate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphotriester, boranophosphate (such as that having normal 3-5 linkages, 2-5 linked analogues of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3-5 to 5-3 or 2-5 to 5-2), boron phosphonate, phosphodiester, phosphonoacetate (PACE), morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, alkylsilyl, substitutions, peptide nucleic acid (PNA) and/or threose nucleic acid (TNA). Various salts, mixed salts, and free acid forms of the above modifications can also be used. Additional internucleotide linkage modifications are described in Deleavey and Damha, Chemistry and Biology (2012) 19: 937-954; and Hunziker & Leumann, 1995 and De Mesmaeker et al., 1994, both incorporated herein by reference.

[0179] According to a specific embodiment, the modification comprises modified nucleoside triphosphates (dN*TPs).

[0180] According to one embodiment, the modification comprises an edge-blocker oligonucleotide.

[0181] According to a specific embodiment, the edge-blocker oligonucleotide comprises a phosphate, an inverted deoxythymidine (dT) and an amino-C7.

[0182] According to a specific embodiment, the modification comprises an inverted deoxythymidine (dT) positioned in at least one terminal end of the DNAzyme molecule. For example, an inverted dT can be incorporated at the 3-end of an oligo, leading to a 3-3 linkage which inhibits both degradation by 3 exonucleases and extension by DNA polymerases.

[0183] According to a specific embodiment, the DNAzyme molecule comprises DNAzyme 985 (set forth in SEQ ID NO: 36), DNAzyme 1114 (set forth in SEQ ID NO: 40), DNAzyme 1670 (set forth in SEQ ID NO: 54), or DNAzyme 1987 (set forth in SEQ ID NO: 73), wherein the DNAzyme comprises an inverted deoxythymidine (dT) positioned at the 3 end of the DNAzyme molecule.

[0184] According to one embodiment, the DNAzyme molecule is modified to comprise one or more protective group, e.g. 5 and/or 3-cap structures.

[0185] As used herein, the phrase cap structure is meant to refer to chemical modifications that have been incorporated at either terminus of the oligonucleotide (see e.g., U.S. Pat. No. 5,998,203, incorporated by reference herein). These terminal modifications protect the nucleic acid molecule from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap modification can be present at the 5-terminus (5-cap) or at the 3-terminal (3-cap), or can be present on both termini. In non-limiting examples: the 5-cap is selected from the group comprising inverted abasic residue (moiety); 4,5-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide, 4-thio nucleotide; carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide; L-nucleotides; alpha-nucleotides; modified base nucleotide; phosphorodithioate linkage; threo-pentofuranosyl nucleotide; acyclic 3,4-seco nucleotide; acyclic 3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3-3-inverted nucleotide moiety; 3-3-inverted abasic moiety; 3-2-inverted nucleotide moiety; 3-2-inverted abasic moiety; 1,4-butanediol phosphate; 3-phosphoramidate; hexylphosphate; aminohexyl phosphate; 3-phosphate; 3-phosphorothioate; phosphorodithioate; or bridging or non-bridging methylphosphonate moiety.

[0186] In some embodiments, the 3-cap is selected from a group comprising inverted deoxynucleotide, such as for example inverted deoxythymidine, 4,5-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide; 4-thio nucleotide, carbocyclic nucleotide; 5-amino-alkyl phosphate; 1,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate; 6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate; threo-pentofuranosyl nucleotide; acyclic 3,4-seco nucleotide; 3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide, 5-5-inverted nucleotide moiety; 5-5-inverted abasic moiety; 5-phosphoramidate; 5-phosphorothioate; 1,4-butanediol phosphate; 5-amino; bridging and/or non-bridging 5-phosphoramidate, phosphorothioate and/or phosphorodithioate, bridging or non-bridging methylphosphonate and 5-mercapto moieties (see generally Beaucage & Iyer, 1993; incorporated by reference herein).

[0187] A DNAzyme molecule can be further modified by including a 3 cationic group, or by inverting the nucleoside at the terminus with a 3-3 linkage. In another alternative, the 3-terminus can be blocked with an aminoalkyl group, e.g., a 3 C5-aminoalkyl dT. Other 3 conjugates can inhibit 3-5 exonucleolytic cleavage. While not being bound by theory, a 3 conjugate, such as naproxen or ibuprofen, may inhibit exonucleolytic cleavage by sterically blocking the exonuclease from binding to the 3 end of the oligonucleotide. Even small alkyl chains, aryl groups, or heterocyclic conjugates or modified sugars (D-ribose, deoxyribose, glucose etc.) can block 3-5-exonucleases.

[0188] According to one embodiment, the 5-terminus can be blocked with an aminoalkyl group, e.g., a 5-O-alkylamino substituent. Other 5 conjugates can inhibit 5-3 exonucleolytic cleavage. While not being bound by theory, a 5 conjugate, such as naproxen or ibuprofen, may inhibit exonucleolytic cleavage by sterically blocking the exonuclease from binding to the 5 end of the oligonucleotide. Even small alkyl chains, aryl groups, or heterocyclic conjugates or modified sugars (D-ribose, deoxyribose, glucose etc.) can block 3-5-exonucleases.

[0189] In one embodiment, the DNAzyme molecule includes a modification that improves targeting. Examples of modifications that target DNAzymes to particular cell types include carbohydrate sugars such as galactose, N-acetylgalactosamine, mannose; vitamins such as folates; other ligands such as RGDs and RGD mimics; and small molecules including naproxen, ibuprofen or other known protein-binding molecules (further discussed hereinbelow).

[0190] According to one embodiment, the DNAzyme molecule of the invention can be constructed using chemical synthesis and/or enzymatic ligation reactions using procedures known in the art (as discussed in detail below). For example, the polynucleotide can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the polynucleotide and target nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used (as discussed in detail hereinabove).

[0191] The DNAzyme molecule designed according to the teachings of the present invention can be generated according to any oligonucleotide synthesis method known in the art, including both enzymatic syntheses and solid-phase syntheses. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Pat. Nos. 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.

[0192] According to one embodiment, chemical synthesis can be achieved by the diester method, triester method, polynucleotides phosphorylase method and by solid-phase chemistry. These methods are discussed in further detail below.

[0193] Diester Method: The diester method was the first to be developed to a usable state. The basic step is the joining of two suitably protected deoxynucleotides to form a dideoxynucleotide containing a phosphodiester bond.

[0194] Triester Method: The main difference between the diester and triester methods is the presence in the latter of an extra protecting group on the phosphate atoms of the reactants and products. The phosphate protecting group is usually a chlorophenyl group, which renders the nucleotides and polynucleotide intermediates soluble in organic solvents. Therefore purifications are done in chloroform solutions. Other improvements in the method include (i) the block coupling of trimers and larger oligomers, (ii) the extensive use of high-performance liquid chromatography for the purification of both intermediate and final products, and (iii) solid-phase synthesis.

[0195] Polynucleotide Phosphorylase Method: This is an enzymatic method of DNA synthesis that can be used to synthesize many useful oligonucleotides. Under controlled conditions, polynucleotide phosphorylase adds predominantly a single nucleotide to a short oligonucleotide. Chromatographic purification allows the desired single adduct to be obtained. At least a trimer is required to start the procedure, and this primer must be obtained by some other method. The polynucleotide phosphorylase method works and has the advantage that the procedures involved are familiar to most biochemists.

[0196] Solid-Phase Methods: Drawing on the technology developed for the solid-phase synthesis of polypeptides, it has been possible to attach the initial nucleotide to solid support material and proceed with the stepwise addition of nucleotides. All mixing and washing steps are simplified, and the procedure becomes amenable to automation. These syntheses are now routinely carried out using automatic nucleic acid synthesizers. Equipment and reagents for executing solid-phase synthesis are commercially available from, for example, Applied Biosystems.

[0197] Phosphoramidite chemistry has become by far the most widely used coupling chemistry for the synthesis of oligonucleotides. As is well known to those skilled in the art, phosphoramidite synthesis of oligonucleotides involves activation of nucleoside phosphoramidite monomer precursors by reaction with an activating agent to form activated intermediates, followed by sequential addition of the activated intermediates to the growing oligonucleotide chain (generally anchored at one end to a suitable solid support) to form the oligonucleotide product.

[0198] Recombinant Methods: Recombinant methods for producing nucleic acids in a cell are well known to those of skill in the art and can be implemented in cases where the DNAzyme molecule does not comprise chemical modifications. These include the use of vectors, plasmids, cosmids, and other vehicles for delivery a nucleic acid to a cell, which may be the target cell or simply a host cell (to produce large quantities of the desired RNA molecule). Alternatively, such vehicles can be used in the context of a cell free system so long as the reagents for generating the RNA molecule are present. Such methods include those described in Sambrook, 2003, Sambrook, 2001 and Sambrook, 1989, which are hereby incorporated by reference.

[0199] Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the capabilities of one skilled in the art and can be accomplished via established methodologies as detailed in, for example: Sambrook, J. and Russell, D. W. (2001), Molecular Cloning: A Laboratory Manual; Ausubel, R. M. et al., eds. (1994, 1989), Current Protocols in Molecular Biology, Volumes I-III, John Wiley & Sons, Baltimore, Maryland; Perbal, B. (1988), A Practical Guide to Molecular Cloning, John Wiley & Sons, New York; and Gait, M. J., ed. (1984), Oligonucleotide Synthesis; utilizing solid-phase chemistry, e.g. cyanoethyl phosphoramidite followed by deprotection, desalting, and purification by, for example, an automated trityl-on method or HPLC.

[0200] According to one embodiment, the DNAzyme molecule is attached to a heterologous moiety that is selected to improve stability, increase half-life (e.g. in the serum, BALF), distribution, cellular uptake, crossing of the blood brain barrier (BBB) or to target the DNAzyme molecule to a cell of interest. Thus, the DNAzyme molecule may be modified to include a non-nucleotide moiety, as discussed in detail below.

[0201] As used herein the phrase heterologous moiety refers to a sequence which does not form an intrinsic part of the DNAzyme molecule. Preferably, the heterologous moiety does not affect the biological activity of the DNAzyme, i.e. silencing activity, e.g. mediating catalytic activity on the p21 substrate.

[0202] According to one embodiment, the heterologous moiety is a proteinaceous moiety.

[0203] According to one embodiment, the heterologous moiety is a non-proteinaceous moiety.

[0204] According to one embodiment, the heterologous moiety is a cell-targeting moiety.

[0205] As used herein, the expression cell-targeting moiety refers to any substance that binds to a molecule expressed or presented on the target cell of interest, preferably in a specific manner, e.g. not expressed/presented on other cell types or expressed/presented at higher levels than in other cell types. According to a specific embodiment, the molecule expressed or presented on the target cell of interest is a polypeptide, e.g. receptor. This binding specificity allows the delivery of the DNAzyme molecule, which is attached to the cell-targeting moiety, to the cell, tissue or organ that expresses or presents the molecule (e.g. polypeptide, glycoprotein, receptor, ligand). In this way, a DNAzyme attached to a cell-targeting moiety will be directed specifically to the target cells when administered to a subject (e.g. human) or contacted in vitro with a population of cells of different types.

[0206] The phrase target cell or target cell of interest refers to a cell that expresses a target RNA (e.g. p21 mRNA) and into which a DNAzyme molecule is intended to be introduced. A target cell is, in some embodiments, a cell in a subject. According to a specific embodiment, the cell is a senescent cell. According to a specific embodiment, the cell is a cancerous cell.

[0207] The term senescent cell as used herein refers to a cell that exhibits cell cycle arrest, generally during the G1 transition of the cell cycle or in few cases in G2, elicited by replicative exhaustion due to telomere attrition or in response to stresses such as DNA damage, chemotherapeutic drugs, or aberrant expression of oncogenes. The term senescent cell includes a cell which has entered senescence or is at the onset of senescence, i.e. a pre-senescent cell.

[0208] The term cancerous cell or cancer cell as used herein refers to cells associated with phenotypes such uncontrolled proliferation, loss of specialized functions, immortality, significant metastatic potential, significant increase in anti-apoptotic activity, rapid growth and proliferation rate, and certain characteristic morphology and cellular markers. In some circumstances, cancer cells will be in the form of a tumor, such cells may exist locally within a subject (e.g. solid tumor), alternatively, cancer cells may circulate in the blood stream or in the lymphatic system as independent cells, for example, leukemic cells or lymphoma cells, respectively (e.g. non-solid tumor such as a hematologic malignancy), or may be dispersed throughout the body (e.g. metastasis).

[0209] A cell-targeting moiety according to the present invention may show a Kd for the target (the molecule expressed or presented on the target cell of interest, e.g. polypeptide, e.g. receptor, expressed on the senescent cell) of at least about 10-4 M, alternatively at least about 10-5 M, alternatively at least about 10-6 M, alternatively at least about 10-7 M, alternatively at least about 10-8 M, alternatively at least about 10-9 M, alternatively at least about 10-10 M, alternatively at least about 10-11 M, alternatively at least about 10-12 M or greater.

[0210] According to one embodiment, the cell-targeting moiety is a synthetic component.

[0211] According to one embodiment, the cell-targeting moiety is a nanoparticle capable of binding an antigen, a receptor or other protein, or non-proteinaceous membrane compounds of a target cell. A wide range of nanocarriers for nucleic acid drug delivery may be used in accordance with the present invention, including but not limited to, cationic polymers (for example, polyethylenimine), dendrimers, CPPs (for example, MPG-8, PepFect6, RVG-9R, and Xentry-KALA), calcium phosphate nanoparticles, exosomes, and lipid nanoparticles (LNPs), as discussed in Roberts et al. Nature Reviews Drug Discovery (2020), incorporated herein by reference.

[0212] According to one embodiment, the cell-targeting moiety is a sugar (for example, N-acetylgalactosamine (GalNAc)).

[0213] According to one embodiment, the cell-targeting moiety is an affinity binding moiety, i.e. any naturally occurring or artificially produced molecule or composition which binds to a specific molecule (e.g. antigen) with a higher affinity than to a non-specific molecule (e.g. antigen).

[0214] It should be noted that the affinity can be quantified using known methods such as, Surface Plasmon Resonance (SPR) (described in Scarano S, Mascini M, Turner A P, Minunni M. Surface plasmon resonance imaging for affinity-based biosensors. Biosens Bioelectron. 2010, 25: 957-66) using e.g. a captured or immobilized monoclonal antibody (MAb) format to minimize contribution of avidity, and can be calculated using, e.g., a dissociation constant, Kd, such that a lower Kd reflects a higher affinity.

[0215] An affinity binding moiety typically has a binding affinity (KD) of at least about 2 to about 200 M (i.e. as long as the binding is specific i.e., no background binding).

[0216] According to a specific embodiment, the affinity binding moiety is an aptamer or a lectin.

[0217] According to a specific embodiment, the affinity binding moiety is an antibody or an antibody fragment.

[0218] The term antibody as used in this invention includes intact molecules as well as functional fragments thereof, such as Fab, Fab, F(ab)2, Fv, linear antibodies, scFv antibodies, and multispecific antibodies formed from antibody fragments that are capable of binding to the antigen. These functional antibody fragments are defined as follows: (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule, can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab, the fragment of an antibody molecule that can be obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab fragments are obtained per antibody molecule; (3) (Fab)2, the fragment of the antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; F(ab)2 is a dimer of two Fab fragments held together by two disulfide bonds; (4) Fv, defined as a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; (5) Single chain antibody (SCA), a genetically engineered molecule containing the variable region of the light chain and the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule; (6) CDR peptide is a peptide coding for a single complementarity-determining region (CDR); and (7) Single domain antibodies (also called nanobodies), a genetically engineered single monomeric variable antibody domain which selectively binds to a specific antigen. Nanobodies have a molecular weight of only 12-15 kDa, which is much smaller than a common antibody (150-160 kDa).

[0219] According to one embodiment, the cell-targeting moiety binds to a senescent cell-specific cell surface polypeptide (e.g. marker of senescence with extracellular epitope/s). Exemplary senescent cell specific cell surface polypeptides include, but are not limited to, HSP90B1, DNAJB4, PI4K2A, DBN1, PRKCSH, SPTBN1, NPM1, ITGA3, CD58/ICAM1, ARMCX-3, B2MG, DCR2, DEP1, LANCL1, NOTCH3, PLD3, VPS26A, NTAL, EBP50, STX4, VAMP3, CD9, NOTCHI, OXIDIZED FORM OF MEMBRANE-BOUND VIMENTIN, TNFRSF10B, PLAUR, TSPAN2, ACTN1, ARL4C, OSBPL3, PHLDA3, THBS1, DPP4, REEP5, SQRDL, STOM, CAV1, SVIL, MGST1, WFS1, PTGS1, MBOAT7, PCYOX1, CNN1, F3, STIM1, SYNGRI, SLC6A15, THBD, TFPI2, NRG1, FLRT3, VAPB, SLC20A1, NTSR1, GPR68, ECSCR, NIM1, MCCC1, OSMR, TMEM132A, TNC, PCCA, LlCAM, PCDH9, TGM2, ANPEP, CCT7, HK2.

[0220] According to one embodiment, the cell-targeting moiety binds to a cancer cell-specific cell surface polypeptide (e.g. tumor antigen). Exemplary tumor antigens include, but are not limited to, A33, BAGE, Bcl-2, B cell maturation antigen (BCMA), BCR-ABL, R-catenin, cancer testis antigens (CTA e.g. MAGE-1, MAGE-A2/A3 and NY-ESO-1), CA 125, CA 19-9, CA 50, CA 27.29 (BR 27.29), CA 15-3, CD5, CD19, CD20, CD21, CD22, CD33, CD37, CD45, CD123, CEA, c-Met, CS-1, cyclin B1, DAGE, EBNA, EGFR, ELA2, ephrinB2, estrogen receptor, FAP, ferritin, folate-binding protein, GAGE, G250/CA IX, GD-2, GM2, gp75, gp100 (Pmel 17), HA-1, HA-2, HER-2/neu, HM1.24, HPV E6, HPV E7, hTERT, Ki-67, LRP, mesothelin, mucin-like cancer-associated antigen (MCA), MUC1, p53, PR1, PRAME, PRTN3, RHAMM (CD168), WT-1.

[0221] According to one embodiment, the DNAzyme molecule of some embodiments of the invention comprises at least one cell-penetrating moiety.

[0222] As used herein the term cell-penetrating moiety refers to a compound which mediates transfer of a substance (e.g. DNAzyme) from an extracellular space to an intracellular compartment of a cell (e.g. senescent cell). Cell-penetrating moieties shuttle a linked substance (e.g., a DNAzyme molecule) into the cytoplasm or to the cytoplasmic space of the cell membrane.

[0223] Cell-penetrating moieties include, without being limited to, lipidic moieties (i.e. naturally occurring or synthetically produced lipids) such as a cholesterol moiety (Letsinger et al, Proc. Natl. Acid. Sci. USA, 199, 86, 6553-6556), cholic acid (Manoharan et al, Biorg. Med. Chem. Let., 1994 4 1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al, Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al, Biorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al, Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al, EMBO J, 1991, 10, 11 11-1118; Kabanov et al, FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-Hphosphonate (Manoharan et al, Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al, Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides and Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et ai, Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a steroid, a sphingosine, a ceramide, or a fatty acid moiety. The fatty acid moiety can be, e.g., any fatty acid which contains at least eight carbons. For example, the fatty acid can be, e.g., a nonanoyl (C.sub.9); capryl (C.sub.10); undecanoyl (C.sub.11); lauroyl (C.sub.12); tridecanoyl (C.sub.13); myristoyl (C.sub.14); pentadecanoyl (C.sub.15); palmitoyl (C.sub.16); phytanoyl (methyl substituted C.sub.16); heptadecanoyl (C.sub.17); stearoyl (C.sub.18); nonadecanoyl (C.sub.19); arachidoyl (C.sub.20); heniecosanoyl (C.sub.21); behenoyl (C.sub.22); trucisanoyl (C.sub.23); or a lignoceroyl (C.sub.24) moiety. The cell-penetrating moiety can also include multimers (e.g., a composition containing more than one unit) of octyl-glycine, 2-cyclohexylalanine, or benzolylphenylalanine. The cell-penetrating moiety contains an unsubstituted or a halogen-substituted (e.g., chloro) biphenyl moiety. Substituted biphenyls are associated with reduced accumulation in body tissues, as compared to compounds with a non-substituted biphenyl. Reduced accumulation in bodily tissues following administration to a subject is associated with decreased adverse side effects in the subject.

[0224] According to one embodiment, the cell-penetrating moiety is a peptide (CPP). Suitable peptides typically include short (typically less than 30 amino acids) amphipathic or cationic peptide fragments that are typically derived from naturally occurring protein translocation motifs, as in the case of HIV-TAT (transactivator of transcription protein), Penetratin 1 (homeodomain of the Drosophila Antennapedia protein) and Transportan (a chimeric peptide consisting of part of the galanin neuropeptide fused to the wasp venom, mastoparan), or are based on polymers of basic amino acids (e.g. arginine and lysine). Additional examples are provided in Roberts et al. Nature Reviews Drug Discovery (2020), incorporated herein by reference.

[0225] It will be appreciated that the cell-targeting moiety may be used for cell penetration and likewise the cell-penetrating moiety may be used for cell targeting. Thus, it is to be understood that the moieties discussed herein above may be used interchangeably.

[0226] The DNAzyme molecule and the heterologous moiety (e.g. cell-targeting moiety or the cell-penetrating moiety) may be coupled directly or indirectly via an intervening moiety or moieties, such as a linker, a bridge, or a spacer moiety or moieties.

[0227] According to one embodiment, the DNAzyme molecule and the heterologous moiety (e.g. cell-targeting moiety or the cell-penetrating moiety) may be directly coupled. Alternatively, according to another embodiment, the moiety may be linked by a connecting group. The terms connecting group, linker, linking group and grammatical equivalents thereof are used herein to refer to an organic moiety that connects two parts of a compound.

[0228] The heterologous moiety (e.g. cell-targeting moiety or the cell-penetrating moiety) can be attached to any nucleotide in the DNAzyme molecule, but it can be preferably coupled through the 3 terminal nucleotide and/or 5 terminal nucleotide. An internal conjugate may be attached directly or indirectly through a linker to a nucleotide at a 2 position of the ribose group, or to another suitable position.

[0229] Thus, the heterologous moiety (e.g. cell-targeting moiety or the cell-penetrating moiety) can be attached to any nucleotide within the DNAzyme molecule as long as the silencing activity (e.g. mediating catalytic activity) of the DNAzyme is not compromised.

[0230] Any of the above described moieties (e.g. cell-targeting moiety or the cell-penetrating moiety) may be selected by the skilled person taking into consideration the target tissue, the target cell, the administration route, the pathway that the DNAzyme is expected to follow, etc.

[0231] According to one embodiment, when the moiety (e.g. cell-targeting moiety or the cell-penetrating moiety) is a peptide or peptide product, it may be subjected to in-vitro modification (e.g., PEGylation, lipid modification, etc.) so as to confer the peptide's amino acid sequence with stability (e.g., against protease activities) and/or solubility (e.g., within a biological fluid such as blood, digestive fluid) while preserving its biological activity and prolonging its half-life.

[0232] When the DNAzyme molecule is coupled to a heterologous moiety, synthesis can be carried out using standard procedures in organic synthesis. The skilled person will appreciate that the exact steps of the synthesis will depend on the exact structure of the molecule which has to be synthesized. For instance, if the molecule is attached to the heterologous moiety through its 5 end, then the synthesis is usually carried out by contacting an amino-activated oligonucleotide and a reactive activated heterologous moiety.

[0233] According to one embodiment, the DNAzyme is coupled to a heterologous moiety and to a protecting group (e.g. the heterologous moiety is coupled to the 5 end of the DNAzyme and the protecting group to the 3 end, or vice versa).

[0234] According to one embodiment, there is provided a method of eradicating a senescent cell or a cancer cell with the composition of matter of some embodiments of the invention.

[0235] The DNAzyme molecules of the invention are to be provided to the cells i.e., target cells (e.g. senescent cells, cancer cells) of the present invention in vivo (i.e., inside the organism or the subject), in vitro or ex vivo (e.g., in a tissue culture). It will be appreciated that the DNAzyme molecule may be provided directly to the target cells, or alternatively may be administered to a tissue or organ comprising the target cells, or to a subject in need of eradication of senescent cells or cancer cells.

[0236] The prior art teaches of a number of delivery strategies which can be used to efficiently deliver oligonucleotides into a wide variety of cell types [see, for example, Jaaskelainen et al. Cell Mol Biol Lett. (2002) 7(2):236-7; Gait, Cell Mol Life Sci. (2003) 60(5):844-53; Martino et al. J Biomed Biotechnol. (2009) 2009:410260; Grijalvo et al. Expert Opin Ther Pat. (2014) 24(7):801-19; Falzarano et al, Nucleic Acid Ther. (2014) 24(1):87-100; Shilakari et al. Biomed Res Int. (2014) 2014: 526391; Prakash et al. Nucleic Acids Res. (2014) 42(13):8796-807 and Asseline et al. J Gene Med. (2014) 16(7-8):157-65].

[0237] According to one embodiment, the present techniques relate to introducing the DNAzyme molecules using transient DNA or DNA-free methods (such as RNA transfection).

[0238] According to one embodiment, the DNAzyme molecule is delivered as a naked oligonucleotide, i.e. without the additional delivery vehicle. According to one embodiment, the naked oligonucleotide comprises a chemical modification to facilitate its tissue delivery (e.g. utilizing inverted nucleotides, phosphorothioate linkages, or integration of locked nucleic acids, as discussed above).

[0239] Any method known in the art for RNA or DNA transfection can be used in accordance with the present teachings, such as, but not limited to microinjection, electroporation, lipid-mediated transfection e.g. using liposomes, or using cationic molecules or nanomaterials (discussed below, and further discussed in Roberts et al. Nature Reviews Drug Discovery (2020) 19: 673-694, incorporated herein by reference).

[0240] According to one embodiment, and as mentioned above, in cases where the DNAzyme molecule does not comprise a chemical modification it may be administered to the target cell (e.g. senescent cell) as part of an expression construct. In this case, the DNAzyme molecule is ligated in a nucleic acid construct (also referred to herein as an expression vector) under the control of a cis-acting regulatory element (e.g. promoter) capable of directing an expression of the DNAzyme in the target cells (e.g. senescent cell) in a constitutive or inducible manner.

[0241] The expression constructs of the present invention may also include additional sequences which render it suitable for replication and integration in eukaryotes (e.g., shuttle vectors). Typical cloning vectors contain transcription and translation initiation sequences (e.g., promoters, enhances) and transcription and translation terminators (e.g., polyadenylation signals). The expression constructs of the present invention can further include an enhancer, which can be adjacent or distant to the promoter sequence and can function in up regulating the transcription therefrom. Polyadenylation sequences can also be added to the expression constructs of the present invention in order to increase the efficiency of expression.

[0242] In addition to the embodiments already described, the expression constructs of the present invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the DNAzyme. The expression constructs of the present invention may or may not include a eukaryotic replicon.

[0243] The nucleic acid construct may be introduced into the target cells (e.g. senescent cells or cancer cells) of the present invention using an appropriate gene delivery vehicle/method (transfection, transduction, etc.) and an appropriate expression system. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4 (6): 504-512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.

[0244] Additionally or alternatively, lipid-based systems may be used for the delivery of constructs or DNAzyme molecules into the target cells (e.g. senescent cells or cancer cells) of the present invention. Lipid bases systems include, for example, liposomes, lipoplexes and lipid nanoparticles (LNPs).

[0245] Liposomes include any synthetic (i.e., not naturally occurring) structure composed of lipid bilayers, which enclose a volume. Liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers and the like. The liposomes may be prepared by any of the known methods in the art [Monkkonen, J. et al., 1994, J. Drug Target, 2:299-308; Monkkonen, J. et al., 1993, Calcif. Tissue Int., 53:139-145; Lasic D D., Liposomes Technology Inc., Elsevier, 1993, 63-105. (chapter 3); Winterhalter M, Lasic D D, Chem Phys Lipids, 1993 September; 64(1-3):35-43]. Any method known in the art can be used to incorporate a polynucleotide agent (e.g. DNAzyme molecule) into a liposome. For example, the polynucleotide agent (e.g. DNAzyme molecule) may be encapsulated within the liposome. Alternatively, it may be adsorbed on the liposome's surface. Other methods that may be used to incorporate a pharmaceutical agent into a liposome of the present invention are those described by Alfonso et al., [The science and practice of pharmacy, Mack Publishing, Easton Pa 19th ed., (1995)] and those described by Kulkarni et al., [J. Microencapsul. 1995, 12 (3) 229-46].

[0246] Furthermore, lipid nanoparticles (LNPs), also known as stable nucleic acid lipid particles, may be used in accordance with the present teachings. These are typically liposomes that contain ionizable lipid, phosphatidylcholine, cholesterol and PEG-lipid conjugates, as discussed in Roberts et al. Nature Reviews Drug Discovery (2020), incorporated herein by reference.

[0247] The lipid bases systems (e.g. liposomes) used in the methods of the present invention may cross the blood barriers. Thus, according to an embodiment the lipid bases systems (e.g. liposomes) of the present invention do not comprise a blood barrier targeting polysaccharide (e.g. mannose) in their membrane portion. In order to determine lipid bases systems (e.g. liposomes) that are especially suitable in accordance with the present invention a screening assay can be performed such as the assays described in U.S. Pat. Appl. No. 20040266734 and U.S. Pat. Appl. No. 20040266734; and in Danenberg et al., Journal of cardiovascular pharmacology 2003, 42:671-9; Circulation 2002, 106:599-605; Circulation 2003, 108:2798-804.

[0248] For in vivo therapy, the composition of matter of some embodiments of the invention comprising a DNAzyme molecule is administered to the subject per se or as part of a pharmaceutical composition.

[0249] As used herein a pharmaceutical composition refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

[0250] Herein the term active ingredient refers to the DNAzyme molecule accountable for the biological effect.

[0251] Hereinafter, the phrases physiologically acceptable carrier and pharmaceutically acceptable carrier which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.

[0252] Herein the term excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.

[0253] Techniques for formulation and administration of drugs may be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.

[0254] Suitable routes of administration may, for example, include systemic, oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, intraperitoneal, intranasal, intratumoral or intraocular injections.

[0255] According to a specific embodiment, the composition is for pulmonary route of administration.

[0256] According to a specific embodiment, the composition is for inhalation mode of administration. Exemplary inhalers which can be used in accordance with some embodiments of the invention include pressurized metered-dose inhalers (pMDIs), breath-actuated metered dose inhalers (bMDIs), dry powder inhalers (DPIs, single or multidose), and soft mist inhalers.

[0257] According to a specific embodiment, the composition is for intranasal administration.

[0258] According to a specific embodiment, the composition is for intracerebroventricular administration.

[0259] According to a specific embodiment, the composition is for intrathecal administration.

[0260] According to a specific embodiment, the composition is for intratumoral administration.

[0261] According to a specific embodiment, the composition is for oral administration.

[0262] According to a specific embodiment, the composition is for local injection.

[0263] According to a specific embodiment, the composition is for systemic administration.

[0264] According to a specific embodiment, the composition is for intravenous administration.

[0265] Conventional approaches for drug delivery to the central nervous system (CNS) include: neurosurgical strategies (e.g., intracerebral injection or intracerebroventricular infusion); molecular manipulation of the agent (e.g., production of a chimeric fusion protein that comprises a transport peptide that has an affinity for an endothelial cell surface molecule in combination with an agent that is itself incapable of crossing the BBB) in an attempt to exploit one of the endogenous transport pathways of the BBB; pharmacological strategies designed to increase the lipid solubility of an agent (e.g., conjugation of water-soluble agents to lipid or cholesterol carriers); and the transitory disruption of the integrity of the BBB by hyperosmotic disruption (resulting from the infusion of a mannitol solution into the carotid artery or the use of a biologically active agent such as an angiotensin peptide). However, each of these strategies has limitations, such as the inherent risks associated with an invasive surgical procedure, a size limitation imposed by a limitation inherent in the endogenous transport systems, potentially undesirable biological side effects associated with the systemic administration of a chimeric molecule comprised of a carrier motif that could be active outside of the CNS, and the possible risk of brain damage within regions of the brain where the BBB is disrupted, which renders it a suboptimal delivery method.

[0266] Alternatively, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient.

[0267] Pharmaceutical compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

[0268] Pharmaceutical compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

[0269] For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

[0270] For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

[0271] Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

[0272] Pharmaceutical compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.

[0273] For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

[0274] For administration by nasal inhalation, the active ingredients for use according to some embodiments of the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

[0275] The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

[0276] Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.

[0277] Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.

[0278] The pharmaceutical composition of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.

[0279] Pharmaceutical compositions suitable for use in context of some embodiments of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (e.g. DNAzyme molecule) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., senescent cell-related condition or cancer) or prolong the survival of the subject being treated.

[0280] According to an embodiment of the present invention, administration of the DNAzyme molecule has a senolytic effect (i.e. induces death of a senescent cell).

[0281] Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0282] For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

[0283] Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in The Pharmacological Basis of Therapeutics, Ch. 1 p. 1).

[0284] Dosage amount and interval may be adjusted individually to provide sufficient levels of the active ingredient to induce or suppress the biological effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.

[0285] Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.

[0286] The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.

[0287] It will be appreciated that animal models exist by which the DNAzyme molecules of the present invention may be tested prior to human treatment. For example, animal models for testing senolytic agents include mice with pulmonary fibrosis induced by solubilized bleomycin, and guinea pigs developing a condition similar to human osteoarthritis, as discussed in Kirkland and Tchkonia, Exp Gerontol. (2015) 68: 19-25, incorporated herein by reference. Furthermore, animal models for testing anti-cancer drugs are well known in the art and are discussed in Chavan, International Journal of Pharmaceutical Sciences and Research (2013) 4(1):19-28, incorporated herein by reference.

[0288] Compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above.

[0289] According to one embodiment, there is provided an article of manufacture comprising the composition of matter of some embodiments of the invention, being packaged in a packaging material and identified in print, in or on the packaging material for use in the treatment of senescence-associated disease or disorder, a cancer or a fibrotic disease or disorder.

[0290] It will be appreciated that the therapeutic compositions of the invention may comprise, in addition to the DNAzyme molecule, other known medications for the treatment of senescence, e.g. senolytic agents (e.g., senolytic drugs). Exemplary senolytic agents which can be used in accordance with some embodiments of the invention include, but are not limited to, Dasatinib, Quercetin, Piperlongumine, Tocotrienols, Navitoclax, Bcl2-family inhibitors such as ABT-263 and ABT-737, PF-573228, JFD00244, Ouabain, Bufalin, Digoxin, K-Strophanthin, Strophanthidin, Cyclosporine, Tyrphostin AG879, Cantharidin, Diphenyleneiodonium chloride, Rottlerin, 2,3-Dimethoxy-1,4-naphthoquinone, LY-367,265, Rotenone, Idarubicin, Dequalinium chloride, Vincristine, Atorvastatin calcium, Fluvastatin sodium, Lovastatin, Pitavastatin calcium, Simvastatin, Nitazoxanide, Nitrofurazone, Temsirolimus, Eltrombopag, Adapalene, Azacyclonol, Enoxacin, Raltegravir, NSC 677249, Defactinib and HSP90 inhibitors (e.g. 17-DMAG and 17-AAG) (as discussed in U.S. Patent Application No. 2020/0121620, incorporated herein by reference).

[0291] It will be appreciated that the therapeutic compositions of the invention may comprise, in addition to the DNAzyme molecule, chemotherapeutic agents which may be affected concomitantly or separately to eliminate cancer cells such as those which have been pushed to senescence, and/or to eliminate or reduce certain side effects produced by senescent cells such as inflammation, promotion of cancer growth, promotion of metastasis and other side effects of chemotherapy, and/or to reduce or eliminate precancerous lesions. Non-limiting examples of chemotherapeutic agents include, but are not limited to, platinum-based drugs (e.g., oxaliplatin, cisplatin, carboplatin, spiroplatin, iproplatin, satraplatin, etc.), alkylating agents (e.g., cyclophosphamide, ifosfamide, chlorambucil, busulfan, melphalan, mechlorethamine, uramustine, thiotepa, nitrosoureas, etc.), anti-metabolites (e.g., 5-fluorouracil, azathioprine, 6-mercaptopurine, methotrexate, leucovorin, capecitabine, cytarabine, floxuridine, fludarabine, gemcitabine (Gemzar?), pemetrexed (ALIMTA?), raltitrexed, etc.), plant alkaloids (e.g., vincristine, vinblastine, vinorelbine, vindesine, podophyllotoxin, paclitaxel (Taxol?), docetaxel (Taxotere?), etc.), topoisomerase inhibitors (e.g., irinotecan, topotecan, amsacrine, etoposide (VP16), etoposide phosphate, teniposide, etc.), antitumor antibiotics (e.g., doxorubicin, adriamycin, daunorubicin, epirubicin, idarubicin, actinomycin, bleomycin, mitomycin, mitoxantrone, plicamycin, etc.), anti-angiogenic agents (e.g. thalidomide or pomalidomide, e.g. Pomalyst and Imnovid), and other agents such as Palbociclib (e.g. Ibrance?), Lenalidomide (e.g. Revlimid?) or Lurbinectedin (e.g. Zepzelca?), and combinations thereof.

[0292] Additionally or alternatively, the therapeutic compositions of the invention may comprise, in addition to the DNAzyme molecule, biological therapy e.g., immunotherapy (e.g. antibody immunotherapy), cytokines/chemokines, hormonal therapy, which may be affected concomitantly or separately to eliminate senescence cells, cancer cells and/or to eliminate or reduce certain side effects produced by senescent cells such as inflammation, promotion of cancer growth, promotion of metastasis and other side effects of chemotherapy, and/or to reduce or eliminate precancerous lesions.

[0293] Any of the above described compositions may be packed together or separately (e.g. in a single container or in separate containers): e.g., DNAzyme packed separately from the chemotherapeutic agent or senolytic agent; or DNAzyme and the chemotherapeutic agent or senolytic agent in a single container.

[0294] According to another aspect of the present invention, there is provided a method of treating a senescence-associated disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the composition of matter of some embodiments of the invention, thereby treating the senescence-associated disease or disorder.

[0295] According to another aspect of the present invention, there is provided a therapeutically effective amount of the composition of matter of some embodiments of the invention for use in treating a senescence-associated disease or disorder in a subject in need thereof.

[0296] According to another aspect of the present invention, there is provided a method of treating a cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the composition of matter of some embodiments of the invention, thereby treating the cancer.

[0297] According to another aspect of the present invention, there is provided a therapeutically effective amount of the composition of matter of some embodiments of the invention for use in treating cancer in a subject in need thereof.

[0298] According to another aspect of the present invention, there is provided a method of treating a fibrotic disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the composition of matter of some embodiments of the invention, thereby treating the fibrotic disease or disorder.

[0299] According to another aspect of the present invention, there is provided a therapeutically effective amount of the composition of matter of some embodiments of the invention for use in treating a fibrotic disease or disorder in a subject in need thereof.

[0300] The term treating refers to inhibiting, preventing or arresting the development of a pathology (disease, disorder or condition) and/or causing the reduction, remission, or regression of the pathology. Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology.

[0301] As used herein, the term subject or subject in need thereof includes mammals, such as human beings, male or female, at any age which suffers from the pathology or is at risk to develop the pathology.

[0302] The term senescence-associated disease or disorder refers to any disease or condition in which senescent cells are involved in the pathogenesis of the disease, resistance to treatment, or side effects associated with a disease.

[0303] Exemplary senescence-associated disease or disorder include, but are not limited to, inflammatory or autoimmune diseases or disorders (e.g. osteoarthritis (OA), osteoporosis, oral mucositis, inflammatory bowel disease, kyphosis and herniated intervertebral disc), neurological diseases or disorders (e.g. Alzheimer's disease, Parkinson's disease, Huntington's disease, dementia, ataxia, mild cognitive impairment, macular degeneration and motor neuron dysfunction, e.g. amyotrophic lateral sclerosis (ALS)), metabolic diseases or disorder (e.g. diabetes, diabetic ulcer, metabolic syndrome, non-alcoholic fatty liver disease (NAFLD) and obesity), pulmonary diseases or disorder (e.g. chronic obstructive pulmonary disease (COPD), idiopathic pulmonary fibrosis (IPF), pulmonary fibrosis, chronic obstructive pulmonary disease, asthma, cystic fibrosis, emphysema, bronchiectasis, hyperoxic lung damage, and age-related loss of pulmonary function), eye diseases or disorders (e.g. macular degeneration, glaucoma, cataracts, presbyopia and vision loss), age-related diseases or disorders (e.g. renal disease, renal failure, frailty, hearing loss, muscle fatigue, age-related muscle loss, skin conditions, skin wound healing, liver fibrosis, pancreatic fibrosis, oral submucosa fibrosis, sarcopenia, age-related intervertebral disc disease, and age-related cognitive dysfunction), renal diseases or disorders (e.g. renal dysfunction, urinary incontinence), hepatic diseases or disorders (e.g. hepatic steatosis, cirrhosis, primary biliary cirrhosis, idiopathic non-alcoholic steatohepatitis (NASH)), dermatological diseases or disorders (e.g. eczema, psoriasis, hyperpigmentation, nevi, rashes, atopic dermatitis, urticaria, diseases and disorders related to photosensitivity or photoaging, rhytides, pruritis, dysesthesia, eczematous eruptions, eosinophilic dermatosis, reactive neutrophilic dermatosis, pemphigus, pemphigoid, immunobullous dermatosis, fibrohistocytic proliferations of skin, cutaneous lymphomas and cutaneous lupus), cardiac disease or disorder (e.g. cardiac dysfunction), vascular disease or disorder (e.g. vascular hyporeactivity/calcification, arteriovenous (AV) fistula), cardiovascular diseases or disorders (e.g. atherosclerosis) or other diseases or disorders such as pre-eclampsia, progeria, obesity-related neuropsychiatric dysfunction or prostatic hypertrophy.

[0304] According to a specific embodiment, the cell senescence is associated with drug-induced senescence (e.g. chemotherapy, e.g. chemotherapy complications).

[0305] According to a specific embodiment, the cell senescence is associated with irradiation-induced senescence (e.g. irradiation therapy, e.g. radiation complications).

[0306] According to a specific embodiment, the cell senescence is associated with transplantation of a cell, tissue or organ (e.g. bone marrow transplant or solid-organ transplant, e.g. transplant related complications such as graft rejection or graft versus host disease).

[0307] According to a specific embodiment, the cell senescence is associated with chronic wounds, such as non-healing chronic wounds.

[0308] According to a specific embodiment, the cell senescence is associated with environmental factors (e.g. smoking e.g. tobacco, radiation, pollution).

[0309] According to a specific embodiment, the cell senescence is associated with healthspan and/or lifespan.

[0310] Those of skill in the art will understand that various methodologies and assays can be used to assess the efficiency of treatment, for example, by detecting the levels of senescent cells in biological samples (e.g. blood, serum, cerebrospinal fluid (CSF), tissue sample) by using senescence associated markers such as, senescence-associated ?-galactosidase, p16INK4a, p21, PAI-1, or one or more senescence associated secretory phenotype (SASP) factors (IL-8, IL-1alpha, IL-1beta, IL-6, MMP10, MCP1, CXCL1, MMP1, STC1, GDF15, MMP9, CCL5, TNF, TGF-beta, SERPINE1), or by assessing the levels of senescent cell biomarkers including, e.g. DEP1, NTAL, EBP50, STX4, VAMP3, ARMCX-3, LANCL1, B2MG, PLD3 and VPS26A, using well known methodologies (e.g. RT-PCR, FACS, ELISA, or immunostaining).

[0311] According to one embodiment, an efficient senolytic treatment is determined when there is a decrease of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% or more in the number of senescent cells, as compared to the number of senescent cells in the subject being treated but prior to the treatment.

[0312] According to a specific embodiment, the disease is a fibrotic disease or disorder.

[0313] The term fibrotic disease or disorder, also referred to as fibrosis or fibro proliferative disease, as used herein refers to the formation of excess fibrous connective tissue in a reparative process upon injury or damage. Scarring is a result of continuous fibrosis that obliterates the affected organs or tissues architecture. As a result of abnormal reparative processes, which do not clear the formed scar tissue, fibrosis progresses further. Fibrosis can be found in various tissues, including the heart, the lungs, the liver, the skin, blood vessels and the kidneys.

[0314] An individual may be identified as having fibrosis by determining if a subject has organ dysfunction, scarring, alteration of normal extracellular matrix balance, increase in collagen deposition, increased collagen volume fraction, differentiation of fibroblasts to myofibroblasts, reduction in the level of matrix metalloproteinases and increase in the level of tissue Inhibitors of matrix metalloproteinases, increased levels of either N-terminal or C-terminal propeptide of type I procollagen (PINP or PICP) and decreased levels of C-terminal telopeptide of Type I Collagen (CTP or CITP), increased collagen deposition and impaired cardiac function measured by various noninvasive imaging techniques, impaired renal function measured by increased proteinurea and albuminurea, decreased glomerular filtration rate, doubling of plasma creatinine levels.

[0315] Exemplary fibrotic diseases include, but are not limited to, pulmonary fibrosis, (e.g. idiopathic pulmonary fibrosis (IPF), sarcoidosis, cystic fibrosis, familial pulmonary fibrosis, silicosis, asbestosis, coal worker's pneumoconiosis, carbon pneumoconiosis, hypersensitivity pneumonitides, pulmonary fibrosis caused by inhalation of inorganic dust, pulmonary fibrosis caused by an infectious agent, pulmonary fibrosis caused by inhalation of noxious gases, aerosols, chemical dusts, fumes or vapours, radiation-induced lung fibrosis, drug-induced lung fibrosis, e.g. drug-induced interstitial lung disease, autoimmune lung fibrosis (also referred to as connective tissue disease-related) or pulmonary hypertension), liver fibrosis (e.g., liver fibrosis resulting from a chronic liver disease, hepatitis B virus infection, hepatitis C virus infection, hepatitis D virus infection, schistosomiasis, alcoholic liver disease or non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, obesity, diabetes, protein malnutrition, coronary artery disease, auto-immune hepatitis, cystic fibrosis, alpha-1-antitrypsin deficiency, liver cirrhosis, primary biliary cirrhosis, drug reaction and exposure to toxins, or bridging fibrosis), kidney fibrosis (e.g. progressive kidney disease, chronic kidney disease), pancreatic fibrosis, cardiac fibrosis (e.g. associated with various cardiovascular diseases, myocardial fibrosis, endomyocardial fibrosis), scleroderma or systemic sclerosis, oral submucosa fibrosis, intestinal fibrosis (e.g. Crohn's disease), eosinophilic esophagitis, hypereosinophilic syndromes (HES), Loeffler's endomyocarditis or skin fibrosis (e.g. scarring, hypertrophic scarring, keloid scarring, dermal fibrotic disorder, psoriasis or scleroderma. Scarring may be derived from a burn, a trauma, a surgical injury, a radiation or an ulcer. The ulcer can be a diabetic foot ulcer, a venous leg ulcer or a pressure ulcer).

[0316] According to a specific embodiment, the fibrosis is pulmonary fibrosis. Pulmonary fibrosis can result from different factors including, for example, drugs (e.g. amiodarone, nitrofurantoin, chemotherapy, methotrexate, or other drugs known to affect the lungs), radiation (e.g. prior or current radiation treatment to the chest), environmental factors (e.g. exposure to mold, animals), and occupational factors (e.g. exposure to dusts, fibers, fumes, or vapors such as asbestos, coal and silica). Lung fibrosis can also be autoimmune related (e.g. associated with joint inflammation) or idiopathic.

[0317] According to one embodiment, the fibrosis is organ fibrosis related to tissue injury including, but not limited to, fibrosis associated with cardiovascular disease, fibrosis associated with pulmonary disease, fibrosis associated with kidney disease, and fibrosis that has occurred following an organ transplant, such as a kidney, lung, heart or liver transplant.

[0318] According to a specific embodiment, the fibrosis is associated with a pulmonary disease, such as an idiopathic pulmonary fibrosis (IPF).

[0319] According to a specific embodiment, the fibrosis is associated with a kidney disease, such as a chronic kidney disease.

[0320] According to one embodiment, the fibrosis is associated with a chronic damage or injury.

[0321] According to one embodiment, an efficient anti-fibrotic treatment is determined when there is a decrease of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% or more in the number of fibrotic cells, or in the fibrotic tissue mass, as compared to the number of fibrotic cells, or fibrotic tissue mass, in the subject being treated but prior to the treatment.

[0322] Those of skill in the art will understand that various methodologies and assays can be used to assess the efficiency of anti-fibrotic treatment, e.g. imaging and blood tests (as discussed above).

[0323] According to one embodiment, the senescence-associated disease or disorder is associated with a cancerous disease.

[0324] According to one embodiment, the senescence-associated disease or disorder comprises an inflammation, precancerous lesions, promotion of cancer growth and/or of metastasis.

[0325] According to one embodiment, the cancer is therapy-resistant cancer (e.g. resistant to chemotherapy, radiation therapy, phototherapy/photodynamic therapy, or a combination thereof).

[0326] According to a specific embodiment, the cell senescence is associated with oncogene-induced senescence.

[0327] According to one embodiment, the cancer is not associated with cell senescence.

[0328] Types of cancerous diseases amenable to treatment by the methods of some embodiments of the invention include benign tumors, warts, polyps, pre-cancers, malignant tumors/cancers and cancer metastasis.

[0329] Examples of cancer include but are not limited to, carcinoma, blastoma, sarcoma and lymphoma. More particular examples of such cancers include, but are not limited to, tumors of the gastrointestinal tract (colon carcinoma, rectal carcinoma, colorectal carcinoma, colorectal cancer, colorectal adenoma, hereditary nonpolyposis type 1, hereditary nonpolyposis type 2, hereditary nonpolyposis type 3, hereditary nonpolyposis type 6; colorectal cancer, hereditary nonpolyposis type 7, small and/or large bowel carcinoma, esophageal carcinoma, tylosis with esophageal cancer, stomach carcinoma, pancreatic carcinoma, pancreatic endocrine tumors), endometrial carcinoma, dermatofibrosarcoma protuberans, gallbladder carcinoma, Biliary tract tumors, prostate cancer, prostate adenocarcinoma, renal cancer (e.g., Wilms' tumor type 2 or type 1), liver cancer (e.g., hepatoblastoma, hepatocellular carcinoma, hepatocellular cancer), bladder cancer, embryonal rhabdomyosarcoma, germ cell tumor, trophoblastic tumor, testicular germ cells tumor, immature teratoma of ovary, uterine, epithelial ovarian, sacrococcygeal tumor, choriocarcinoma, placental site trophoblastic tumor, epithelial adult tumor, ovarian carcinoma, serous ovarian cancer, ovarian sex cord tumors, cervical carcinoma, uterine cervix carcinoma, small-cell and non-small cell lung carcinoma, nasopharyngeal, breast carcinoma (e.g., ductal breast cancer, invasive intraductal breast cancer, sporadic; breast cancer, susceptibility to breast cancer, type 4 breast cancer, breast cancer-1, breast cancer-3; breast-ovarian cancer), squamous cell carcinoma (e.g., in head and neck), neurogenic tumor, astrocytoma, ganglioblastoma, neuroblastoma, lymphomas (e.g., Hodgkin's disease, non-Hodgkin's lymphoma, B cell, Burkitt, cutaneous T cell, histiocytic, lymphoblastic, T cell, thymic), gliomas, adenocarcinoma, adrenal tumor, hereditary adrenocortical carcinoma, brain malignancy (tumor), various other carcinomas (e.g., bronchogenic large cell, ductal, Ehrlich-Lettre ascites, epidermoid, large cell, Lewis lung, medullary, mucoepidermoid, oat cell, small cell, spindle cell, spinocellular, transitional cell, undifferentiated, carcinosarcoma, choriocarcinoma, cystadenocarcinoma), ependimoblastoma, epithelioma, erythroleukemia (e.g., Friend, lymphoblast), fibrosarcoma, giant cell tumor, glial tumor, glioblastoma (e.g., multiforme, astrocytoma), glioma hepatoma, heterohybridoma, heteromyeloma, histiocytoma, hybridoma (e.g., B cell), hypernephroma, insulinoma, islet tumor, keratoma, leiomyoblastoma, leiomyosarcoma, leukemia (e.g., acute lymphatic, acute lymphoblastic, acute lymphoblastic pre-B cell, acute lymphoblastic T cell leukemia, acutemegakaryoblastic, monocytic, acute myelogenous, acute myeloid, acute myeloid with eosinophilia, B cell, basophilic, chronic myeloid, chronic, B cell, eosinophilic, Friend, granulocytic or myelocytic, hairy cell, lymphocytic, megakaryoblastic, monocytic, monocytic-macrophage, myeloblastic, myeloid, myelomonocytic, plasma cell, pre-B cell, promyelocytic, subacute, T cell, lymphoid neoplasm, predisposition to myeloid malignancy, acute nonlymphocytic leukemia), lymphosarcoma, melanoma, mammary tumor, mastocytoma, medulloblastoma, mesothelioma, metastatic tumor, monocyte tumor, multiple myeloma, myelodysplastic syndrome, myeloma, monoclonal gammopathy of undetermined significance (MGUS), nephroblastoma, nervous tissue glial tumor, nervous tissue neuronal tumor, neurinoma, neuroblastoma, oligodendroglioma, osteochondroma, osteomyeloma, osteosarcoma (e.g., Ewing's), papilloma, transitional cell, pheochromocytoma, pituitary tumor (invasive), plasmacytoma, retinoblastoma, rhabdomyosarcoma, sarcoma (e.g., Ewing's, histiocytic cell, Jensen, osteogenic, reticulum cell), schwannoma, subcutaneous tumor, teratocarcinoma (e.g., pluripotent), teratoma, testicular tumor, thymoma and trichoepithelioma, gastric cancer, fibrosarcoma, glioblastoma multiforme; multiple glomus tumors, Li-Fraumeni syndrome, liposarcoma, lynch cancer family syndrome II, male germ cell tumor, mast cell leukemia, medullary thyroid, multiple meningioma, endocrine neoplasia myxosarcoma, paraganglioma, familial nonchromaffin, pilomatricoma, papillary, familial and sporadic, rhabdoid predisposition syndrome, familial, rhabdoid tumors, soft tissue sarcoma, and Turcot syndrome with glioblastoma.

[0330] According to a specific embodiment, the cancer is lung cancer.

[0331] According to one embodiment, treating a cancerous disease may be further effected by administering to the subject an additional medicament (or any combination of medicaments) for the treatment of the cancerous disease. Such medicaments may include, without being limited to, radiation therapy, chemotherapy, biological therapy, e.g., immunotherapy (e.g. antibody immunotherapy), phototherapy/photodynamic therapy, surgery, nutritional therapy, or combinations thereof. Such medicaments may be affected prior to, concomitantly with, or following the DNAzyme molecules of some embodiments of the invention.

[0332] It will be appreciated that the use of the DNAzymes of some embodiments of the invention can reduce the amount of chemotherapy administered to a subject needed to achieve a therapeutic effect (i.e. elimination of cancer cells). Such a therapy is specifically beneficial in order to reduce harm to healthy cells.

[0333] According to one embodiment, an efficient anti-cancer treatment is determined when there is a decrease of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% or more in tumor mass or there is a halt in tumor growth, as compared to a subject not treated by the composition of the invention, or compared to the same subject being treated but prior to the treatment.

[0334] Those of skill in the art will understand that various methodologies and assays can be used to assess the efficiency of cancer treatment, e.g. CT scan, MRI, X-ray, ultrasound, blood tests etc.

[0335] According to one embodiment the DNAzyme molecules of some embodiments of the invention may be administered to the subject as a single DNAzyme molecule treatment. Alternatively, the DNAzyme molecules of some embodiments of the invention may be administered to the subject in combination (e.g. 2, 3, 4, 5 or more DNAzymes) in order to mediate cleavage of two or more target sites in p21 mRNA thereby increasing efficiency of RNA silencing. Such a determination is well within the capability of one of skill in the art.

[0336] According to another aspect, there is provided a method of determining the senolytic effect of a DNAzyme molecule, the method comprising contacting senescent cells with the composition of matter of some embodiments of the invention, wherein a reduction in the number of senescent cells as compared to a number of senescent cells prior to the contacting is indicative of the DNAzyme molecule having the senolytic effect.

[0337] According to one embodiment, an efficient senolytic effect is determined when there is a reduction of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% or more in the number of senescent cells, as compared to the number of senescent cells prior to contacting.

[0338] According to another aspect, there is provided a method of determining the anti-cancer effect of a DNAzyme molecule, the method comprising contacting cancer cells with the composition of matter of some embodiments of the invention, wherein a reduction in the number of cancer cells as compared to a number of cancer cells prior to the contacting is indicative of the DNAzyme molecule having the anti-cancer effect.

[0339] According to one embodiment, an efficient anti-cancer effect is determined when there is a reduction of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% or more in the number of cancer cells, as compared to the number of cancer cells prior to contacting.

[0340] According to one embodiment, the method is affected in vitro or ex-vivo (e.g. in a cell culture).

[0341] According to one embodiment, the method is affected in vivo.

[0342] According to one embodiment, the in vivo method is affected in an animal model for a senescence-associated disease or for a cancer-associated disease. Suitable animals include, but are not limited to, porcines (e.g. pig), bovines (e.g., cow), equines (e.g., horse), ovines (e.g., goat, sheep), felines (e.g., Felis domestica), canines (e.g., Canis domestica), rodents (e.g., mouse, rat, rabbit, guinea pig, gerbil, hamster), and primates (e.g., chimpanzee, rhesus monkey, macaque monkey, marmoset).

[0343] According to a specific embodiment, the in vivo method is affected in a mouse model for a senescence-associated disease.

[0344] As mentioned above, various animal models exist by which the DNAzyme molecules of the present invention may be tested prior to human treatment. These include, for example, mice with pulmonary fibrosis induced by solubilized bleomycin and mice exhibiting chronic obstructive pulmonary disease (COPD) induced by chronic LPS exposure or by cigarette smoke.

[0345] In order to assess the efficiency of treatment with DNAzymes, the present inventors generated a DNAzyme molecule capable of mediating cleavage of p21 mRNA corresponding to mouse p21 mRNA (as set forth in SEQ ID NO: 3).

[0346] According to one embodiment, the DNAzymes targeting p21 mRNA corresponding to SEQ ID NO: 3 comprise a nucleic acid sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 83-85.

[0347] According to one embodiment, the DNAzyme molecule comprises a nucleic acid sequence at least 85% identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 83-85.

[0348] According to one embodiment, the DNAzyme molecule comprises a nucleic acid sequence at least 90% identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 83-85.

[0349] According to one embodiment, the DNAzyme molecule comprises a nucleic acid sequence at least 95% identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 83-85.

[0350] According to one embodiment, the DNAzyme molecule comprises a nucleic acid sequence at least 98% identical to the nucleic acid sequence set forth in any one of SEQ ID NOs: 83-85.

[0351] According to one embodiment, the DNAzyme molecule comprises a nucleic acid sequence as set forth in any one of SEQ ID NOs: 83-85.

[0352] As used herein the term about refers to ?10%.

[0353] The terms comprises, comprising, includes, including, having and their conjugates mean including but not limited to.

[0354] The term consisting of means including and limited to.

[0355] The term consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.

[0356] As used herein, the singular form a, an and the include plural references unless the context clearly dictates otherwise. For example, the term a compound or at least one compound may include a plurality of compounds, including mixtures thereof.

[0357] Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0358] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases ranging/ranges between a first indicate number and a second indicate number and ranging/ranges from a first indicate number to a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

[0359] As used herein the term method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

[0360] As used herein, the term treating includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.

[0361] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

[0362] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

[0363] It is understood that any Sequence Identification Number (SEQ ID NO) disclosed in the instant application can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format. For example, SEQ ID NO: 1 is expressed in a DNA sequence format (e.g., reciting T for thymine), but it can refer to either a DNA sequence that corresponds to an p21 nucleic acid sequence, or the RNA sequence of an RNA molecule nucleic acid sequence. Similarly, though some sequences are expressed in a RNA sequence format (e.g., reciting U for uracil), depending on the actual type of molecule being described, it can refer to either the sequence of a RNA molecule comprising a dsRNA, or the sequence of a DNA molecule that corresponds to the RNA sequence shown. In any event, both DNA and RNA molecules having the sequences disclosed with any substitutes are envisioned.

EXAMPLES

[0364] Reference is now made to the following examples, which together with the above descriptions, illustrate the invention in a non-limiting fashion.

[0365] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, Molecular Cloning: A laboratory Manual Sambrook et al., (1989); Current Protocols in Molecular Biology Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989); Perbal, A Practical Guide to Molecular Cloning, John Wiley & Sons, New York (1988); Watson et al., Recombinant DNA, Scientific American Books, New York; Birren et al. (eds) Genome Analysis: A Laboratory Manual Series, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; Cell Biology: A Laboratory Handbook, Volumes I-III Cellis, J. E., ed. (1994); Current Protocols in Immunology Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), Basic and Clinical Immunology (8th Edition), Appleton & Lange, Norwalk, C T (1994); Mishell and Shiigi (eds), Selected Methods in Cellular Immunology, W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; Oligonucleotide Synthesis Gait, M. J., ed. (1984); Nucleic Acid Hybridization Hames, B. D., and Higgins S. J., eds. (1985); Transcription and Translation Hames, B. D., and Higgins S. J., Eds. (1984); Animal Cell Culture Freshney, R. I., ed. (1986); Immobilized Cells and Enzymes IRL Press, (1986); A Practical Guide to Molecular Cloning Perbal, B., (1984) and Methods in Enzymology Vol. 1-317, Academic Press; PCR Protocols: A Guide To Methods And Applications, Academic Press, San Diego, C A (1990); Marshak et al., Strategies for Protein Purification and CharacterizationA Laboratory Course Manual CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

General Materials and Experimental Procedures

[0366] Cell Culture

[0367] Human IMR-90, BJ, WI-38 fibroblasts and REC epithelial cells were obtained from ATCC and grown at 5% oxygen. IMR-90 and REC cells were maintained in DMEM medium comprising 100 units per ml of penicillin, 100 mg/ml of streptomycin and 10% fetal bovine serum. BJ and WI-38 cells were maintained in EMEM medium comprising 100 units per ml of penicillin, 100 mg/ml of streptomycin, 10% fetal bovine serum, 1% Pyruvate, 1% L-Glutamine. mLFs were isolated according to standard procedures [Seluanov, A., et al. J Vis Exp (2010) (44):2033] and grown at 5% oxygen. Cells were maintained in EMEM medium comprising 100 units per ml of penicillin, 100 mg/ml of streptomycin and 15% fetal bovine serum.

[0368] DNA damage induced senescence (DIS) was induced by etoposide treatment (E1383, Sigma) at a concentration of 1000 ?M for IMR-90, BJ, and WI-38, 16 ?M for mLF and 12.5 ?M for REC for a duration of 48 hours. Cells acquired the senescence phenotype 7 days post treatment (determined by SA-beta-gal staining).

[0369] PANC-1 cells were maintained in DMEM medium supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin and 1% sodium pyruvate. HCT116 cells were maintained in McCoy's 5A medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. A549 cells were maintained in F-12K Medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. HepG2 cell were maintained Eagle's Minimum Essential Medium, supplemented in 10% fetal bovine serum, 1% penicillin-streptomycin and 1% sodium pyruvate. All cancer cell lines were incubated in 5% CO.sub.2 at 37? C.

[0370] Oncogene Induced Senescence (OIS) was induced by means of retroviral infection with H-RasG12 (pLNCX2) at 5% oxygen. Retroviruses were packaged, and infections were performed as described below.

[0371] Phoenix-AMPHO cells were plated in a 6 well dish, incubated for 24 hours, and then transfected using Lipofectamine? 2000 (Invitrogen) with 1 mg of a retroviral plasmid. After 48 hours, the virus-containing medium was filtered (0.45 mm filter, Millipore) and supplemented with 4 mg/ml polybrene (Sigma) (first supernatant). Viruses were collected for an additional 24 hours as before (second supernatant). IMR-90 cells were plated at 1.2?106 cells per 10 cm dish and incubated for 48 hours. For infections, the culture medium was replaced with the first supernatant for 24 hours. The infection process was repeated using the second supernatant. Two days following infection, selection was carried out using 400 ?g/ml G418 for a duration of 3-4 days. By 7 days post-infection, the cells were used for viability assay.

[0372] Replicative Induced Senescence (RIS) was induced by long-term passaging of the cells in tissue culture. Cells acquired the senescence phenotype after 40 population doublings.

[0373] Viability Assay

[0374] Primary target cells (IMR-90, BJ, WI- and 38 and REC) were plated in 24-well plates at 100,000 cells per well. Cells were transfected with different concentrations of DNAzymes (as depicted in Table 2, below) using Lipofectamine? 2000 (Invitrogen) according to manufacturer instructions. The percentage of survival was determined based on quantification of remaining adherent cells using PrestoBlue? reagent (A13262, Life Technologies Ltd.) relative to Lipofectamine? only control and compared to Scramble DNAzyme (Dz_Scramble) [Scramble Arm (Scr A) sequence: ATCTTCCTTggctagctacaacgaCGCCTCTCC, SEQ ID NO: 5, or Scramble catalytic core (Scr B) sequence: AGGAGAACAacagtaactggcgacGGGATGAGG, SEQ ID NO: 86] treated cells, 3-6 days following transfection.

[0375] In some of the experiments, the following control Scramble DNAzymes were utilized: sequence: ATCTTCCTTggctagctacaacgaCGCCTCTCC, SEQ ID NO: 5, and GTGTGGCGcccgagccggacgaGAGTGGAGG, SEQ ID NO: 125, for 10-23 and 8-17 DNAzymes respectively.

[0376] Chemotherapy and DNAzyme Treatments

[0377] Cancer cell lines were seeded in 96 well plates 24 hours before treatment. Chemotherapies were applied at indicated concentrations either alone or as combination with DNAzyme-lipofectamine complex. 72 hours following treatment, cell viability was measured using Prestoblue? reagent. Chemotherapies were diluted in cell medium to the indicated concentrations. 24 hours following seeding, culture medium was replaced with chemotherapy containing medium, immediately followed by transfection of DNAzyme as described above. 72 hours following treatment, cell viability was measured using Prestoblue? reagent.

[0378] The following chemotherapies were used: Etoposide (Sigma), Palbociclib (Sigma), Doxorubicin (Sigma), Cisplatin (Sigma), ABT-263 (Selleckchem). All compounds were dissolved and stored according to manufacturer instructions.

[0379] Concentrations of Chemotherapy and DNAzyme

TABLE-US-00001 Clinical dose Sub-clinical dose DNAzyme Cell line Chemotherapy (mM) (mM) (mM) HepG2 Etoposide 150 10 40 Doxorubicin 40 20 40 Palbociclib 31.2 7.8 40 Cisplatin 16 2 40 A549 Etoposide 50 5 12.5 Panc1 Etoposide 50 1 25 HCT-116 Etoposide 150 5 25

[0380] DNAzymes

[0381] DNAzymes containing either the 10-23 or 8-17 catalytic domains were designed for the selected mRNA targets and the oligonucleotides were ordered from Axolabs or Integrated DNA Technologies Syntezza (including all modified oligonucleotides). Control DNAzymes with scrambled arms were designed using an online software tool (GenScript?).

[0382] mRNA Target Preparation

[0383] Total RNA was isolates from senescent IMR-90 cells using Nucleospin? RNA kit (Macherey-Nagel?). cDNA was synthesized with gene-specific reverse primers using M-MLV Reverse Transcriptase (Promega), according to the manufacturer's protocol. To generate template for in vitro transcription (IVT) reaction, the cDNA was PCR amplified using KAPA Taq EXtra HotStart? ReadyMix? PCR Kit (R&D). PCR product was run on 1.5% agarose TAE gel, the correct band size was cut and DNA was cleaned using Wizard? SV Gel and PCR Clean-Up System kit (Promega). IVT was performed using HiScribe? T7 High Yield RNA Synthesis Kit (NEB). Samples were then treated with DNase I (New England Biolabs) and incubated for 15 minutes at 37? C. IVT product was run on 1.5% agarose TBE gel, the correct band size was cut and RNA was cleaned using QIAquick? Gel Extraction Kit (Qiagen). See primer sequences in Table 1, below.

TABLE-US-00002 TABLE1 Primerlist Human T7CDKNIA TAATACGACTCACTATAGATGTTGAGCTCTGGCA CDNA+ FORWARD TAGAAGAGGCTGGTGGCTATTTTGTCCTTGGGCT PCR GCCTGTTTTCAG(SEQIDNO:79) Human CDKNIA TAAAGTCACTAAGAATCATTTATTGAGCACCTGC PCR REVERSE TGTATATTCAGCATTGTGGGAGGAGCTGTGAAAG ACACAGAACAGT(SEQIDNO:80) Mouse Mouse AATCATCGAGAAGTATTTATTGAGCACCAGCTTT CDNA+ cdkn1a_ GGGGTCGGGTGTGAGGACTCGGGACAATGCAGG PCR REVERSE (SEQIDNO:81) Mouse MouseT7_ TAATACGACTCACTATAGTGCAGCAGCCGAGAG PCR cdkn1a GTGTGAGCCGCC(SEQIDNO:82) FORWARD Human GAPDH TGGTATCGTGGAAGGACTCA RT-PCT Forward (SEQIDNO:95) Human GAPDH CCAGTAGAGGCAGGGATGAT RT-PCT Reverse (SEQIDNO:96) Human p21Dz387 TCAAAGGCCCGCTCTACATC RT-PCT Forward (SEQIDNO:97) Human p21Dz387 TGCCCAGCACTCTTAGGAAC RT-PCT Reverse (SEQIDNO:98) Mouse GAPDH TCAAGCTCATTTCCTGGTATGACA RT-PCT Forward (SEQIDNO:99) Mouse GAPDH TAGGGCCTCTCTTGCTCAGT RT-PCT Reverse (SEQIDNO:100) Mouse p21 GTGTGCCGTTGTCTCTTCGG RT-PCT Forward (SEQIDNO:101) Mouse p21 CTCAGGTAGACCTTGGGCAG RT-PCT Reverse (SEQIDNO:102) Mouse p16 CATCTGGAGCAGCATGGAGTC RT-PCT Forward (SEQIDNO:103) Mouse p16 GTTGCCCATCATCATCACCTGAAT RT-PCT Reverse (SEQIDNO:104) Mouse IL-6 TCCTTAGCCACTCCTTCTGT RT-PCT Forward (SEQIDNO:105) Mouse IL-6 AGCCAGAGTCCTTCAGAGA RT-PCT Reverse (SEQIDNO:106) Mouse MCP1 TCCCAAAGAAGCTGTAGTTTTTGTC RT-PCT Forward (SEQIDNO:107) Mouse MCP1 CCCATTCCTTCTTGGGGTCA RT-PCT Reverse (SEQIDNO:108) Mouse COL1A CCAACAAGCATGTCTGGTTAGGAG RT-PCT Forward (SEQIDNO:109) Mouse COL1A GCAATGCTGTTCTTGCAGTGGTA RT-PCT Reverse (SEQIDNO:110) Mouse HPRT AGCAGGTCAGCAAAGAACT RT-PCT Forward (SEQIDNO:111) Mouse HPRT CCTCATGGACTGATTATGGACA RT-PCT Reverse (SEQIDNO:112) Mouse RPLPO TTCCAGGCTTTGGGCATCA RT-PCT Forward (SEQIDNO:113) Mouse RPLPO ATGTTCAGCATGTTCAGCAGTGTG RT-PCT Reverse (SEQIDNO:114) Mouse MMP12 GCTCCTGCCTCACATCATAC RT-PCT Forward (SEQIDNO:115) Mouse MMP12 GGCTTCTCTGCATCTGTGAA RT-PCT Reverse (SEQIDNO:116) Mouse TIMP1 GAGACACACCAGAGCAGATACC RT-PCT Forward (SEQIDNO:117) Mouse TIMP1 GGGGAACCCATGAATTTAGCC RT-PCT Reverse (SEQIDNO:118) Human p21off-site TATGGGGCTGGGAGTAGTTGT RT-PCT 3Forward (SEQIDNO:119) Human p21off-site GGGAGCCGAGAGAAAACAGTC RT-PCT 3Reverse (SEQIDNO:120) Human p21_offsite GACAGCAGAGGAAGACCATGTGGAC RT-PCT 5_Forward (SEQIDNO:121) Human p21_offsite GAGTGGTAGAAATCTGTCATGCTG RT-PCT 5_Reverse (SEQIDNO:122) Human p21_DNZ199_ TTGGCTCCCCTGTACCTTTTG RT-PCT Onsite_ (SEQIDNO:123) Forward Human p21_DNZ199_ TGGAGCTGAGAGGGTACTGA RT-PCT Onsite_ (SEQIDNO:124) Reverse

[0384] In Vitro Cleavage Assay

[0385] RNA substrate was diluted with Molecular Biology Grade Water (Biological Industries) and used in in vitro cleavage assay. A 20 ?l reaction system comprising RNA substrate (final concentration 500 nM), 2 ?l 10? reaction buffer (50 mM Tris-HCl pH 7.4, 100 mM NaCl, 10 mM MgCl2) and 1 ?l DNAzyme (10 ?M) (as depicted in Table 2, below) was mixed. Reactions were incubated at 37? C. for 60 min. 2? RNA L.D. (Thermo Fisher) was added to each sample. Samples were heated at 70? C. for 30 sec, centrifuged and loaded onto 1.5% agarose TBE gels. Quantification was performed using Image Lab software (Bio Rad).

[0386] Quantitative RT-PCR

[0387] Total RNA was extracted from IMR-90 cells using NucleoSpin? RNA (Macherey-Nagel?), according to the manufacturer protocol. Complementary DNA was prepared using the M-MLV Reverse Transcriptase (Promega), according to the manufacturer protocol. Quantitative real-time PCR was performed using the SYBR Green PCR master-mix (Applied Biosystems) on a CFX96 Real-Time PCR System (Bio Rad). See primer sequences in Table 1, above.

[0388] Total RNA from lung samples (post-caval lobe) was extracted using RNAiso (Takara Bio, Japan) according to manufacturer protocol. Reverse transcription was performed using MMLV-RT (Invitrogen). Real-time PCR was performed using TB Green? Premix Ex Taq??(Takara Bio). To calculate the relative mRNA expression level, the expression of each gene (Collagen Type 1) were be normalized to that of reference gene 36B4 (gene symbol: Rplp0).

[0389] P21 ELISA Kit

[0390] p21 protein quantification was analyzed using (Human p21 ELISA Kitab214658, Abcam), according to the manufacturer's instructions. The cell pellets were incubated with Cell Extraction Buffer PTR on ice for 20 minutes. Following Centrifuge at 18,000?g for 20 minutes, the sample protein concentrations were quantified using a BCA protein assay. The samples and Antibody Cocktail were added to appropriate wells and incubated for one hour at room temperature (RT), followed by three washes with Wash Buffer and incubation with TMB Development Solution for 15 minutes at RT. Then, the Stop Solution was added, the samples were incubated for 1 minute, and the samples were read by absorbance at 450 nm using plate reader.

[0391] Immunofluorescence

[0392] 48 hours following transfection, IMR-90 cells were fixed by PFA 4% following the indicated treatments. Cells were blocked and incubated with antibodies against human p21 (CST) in blocking solution. Cells were then incubated with Dylight-549-conjugated secondary antibody (Jackson ImmunoResearch) and counterstained with DAPI (Sigma). Images were acquired using Nikon Eclipse Ti2 microscope at ?10 magnification.

[0393] Alternatively, cells were fixed with 4% Formaldehyde for 15 minutes, permeabilized in 0.2% Triton X-10 for 5 minutes and blocked with 2% bovine serum albumin (BSA) for 30 min in room temperature. Cells were then incubated with a primary or with a conjugated antibody over-night or for 3 hours respectively. For unconjugated antibodies, a corresponding fluorescently-labelled secondary antibody was added for 1 hour, followed by Hoechst counterstaining. Cells were washed with PBS three times following each step. Images were acquired using Nikon Eclipse Ti2 microscope at ?10 magnification.

[0394] Antibodies

[0395] Antibodies were diluted in blocking solution as indicated below: 53BP1 antibody (Novus biologicals NB100-304, 1:800), Phospho-histone H2AX antibody (Cell signaling #2577, 1:800), p21 Waf1/Cip1 antibody (Cell signaling #8865, 1:500), p16 antibody (Santa Cruz sc-56330, 1:200), Alexa Fluor-488 goat anti mouse (Thermo Fisher A11029, 1:1000).

[0396] Apoptosis Assay

[0397] Apoptosis was measured by quantification of Cleaved Caspase-3/7 (CC3/7) signal, obtained following incubation of CellEvent? Caspase-3/7 Green Detection Reagent (Invitrogen) with DNAzyme treated IMR-90 senescent cell. IMR-90 senescent cells were plated in 24 well plate, 100 k cells per well. Growth media containing 2 ?l of CellEvent? Caspase-3/7 Green Detection Reagent and Nucblue? (Invitrogen) was added to the cells prior to DNAzyme treatment. Cells were scanned with Nikon Eclipse Ti2 microscope (4? magnification) 0, 24, 48, 72, 96 hours following transfection. Images were analyzed using NIS elements software. Caspase 3/7 intensity was measured and normalized to cell number.

[0398] Flow Cytometry (FACS)

[0399] Stained cells were lifted using TrypLE? (Thermo Fisher scientific), washed and filtered through 100 ?m cell strainer. Cells were analyzed using MA900 multi-application cell sorter (Sony), and Kaluza V2.1 (Beckman Coulter).

[0400] DNAzyme Stability Analysis

[0401] DNAzyme stability was assessed by incubation with PBS, plasma and BALF (Bronchoalveolar Lavage Fluid). A comparison between unmodified and 3Inverted dT modification was made. Following incubation for the indicated time points, samples were analyzed using gel electrophoresis. Quantification compared to time 0 was performed using Image Lab software (Bio Rad).

[0402] Animal Studies

[0403] All animal studies were performed under the approval of the council for experiments on animal subjects, Israel. Animals used in the study were housed and cared for in accordance with the international standards and the ILAR guide (the Institute for Laboratory Animal Research, Guide for the Care and Use of Laboratory Animals). Mice were obtained from ENVIGO CRS (ISRAEL) LTD. or from Japan SLC, Inc. (Japan).

[0404] In-Vivo Biodistribution and Kinetics of DNAzyme Mice

[0405] 8 weeks old female C57/BL6 were treated intratracheally with Bleomycin (1.5 mg/kg, Enzo) to induce pulmonary fibrosis or with PBS as control. 7 days following disease induction mice were intratracheally treated with 200 ?g of Cy5.5 fluorescently labelled DNAzyme 1670 (Cy5.5-DNAzyme 1670-3InvdT, Syntezza) or PBS as control. Total body imaging was performed in the following time points: 30 min, 1, 2, 4, 8, 24, 48 and 72 hours. Mice were anesthetized using Isoflurane and imaging was performed using Ami HT spectral instrument imaging. Satellite mice were sacrificed at 30 min, 2 and 8 hours, organs were excised and imaged. Quantification was performed using Aura imaging software.

[0406] Kinetics of DNAzyme Uptake in Mouse Lungs after Intranasal Administration

[0407] 8 weeks old female C57/BL6 were treated intratracheally with Bleomycin (1.5 mg/kg, Enzo) to induce pulmonary fibrosis or with PBS as control. 7 days following disease induction mice were intranasally administered with 200 ?g of Rhodamine 6G labelled DNAzyme 1670 (Rho-DNAzyme 1670-3InvdT, Syntezza) or PBS as control. Mice were sacrificed at the following time points: 30 min, 2, 4, 8, 24, and 48 hours. Lungs were inflated and fixed with 4% PFA. 3 mm histological sections were sliced using counter stained with DAPI. Samples were analyzed using Nikon Eclipse Ti2 microscope.

[0408] In-Vivo Safety of DNAzyme in Mice

[0409] 8 weeks old male and female C57/BL6 were treated intranasally with DNAzyme 1670 for 14 days. DNAzyme was administered in three concentrations: 40, 200 and 1000 ?g. PBS treated mice served as control. Body weight, viability, clinical signs and behavior were monitored daily. On day 14, blood was collected using cardiac puncture and mice were sacrificed thereafter. Blood analyses were performed by AML (Central Lab Services). Hematology was performed using Advia-2120 (Siemens Healthineers). Biochemistry was performed using COBAS? 6000 (Roche Diagnostics).

[0410] Idiopathic Pulmonary Fibrosis (IPF) in an Animal Model

[0411] C57/B6 mice were induced to develop pulmonary fibrosis by a single intra-tracheal administration of Bleomycin hydrochloride (Nippon Kayaku, Japan) in saline at a dose of 3.0 mg/kg, in a volume of 50 ?L per animal using Microsprayer? (Penn-Century, USA). Mice that served as the Sham control group were intratracheally administered with saline, instead of the Bleomycin. Mice were initially randomized based on body weight before Bleomycin instillation. At second randomization, Bleomycin-induced pulmonary fibrosis model mice were divided based on the body weight changes on the day before the start of treatment at Day 7. DNAzyme treatment was performed intranasally with 200 ?g of DNAzyme resuspended in 50 ?L PBS per treatment. PBS intra-nasal treatment served as control. Mice were treated daily following Bleomycin instillation with either DNAzyme or control from day 1 to 20 (prophylactic regimen) or from day 7 to 20 (therapeutic regimen). Body weight, viability, clinical signs and behavior were monitored daily. Mice were sacrificed three weeks following Bleomycin instillation.

[0412] Unilateral Ureteral Obstruction (UUO) Animal Model

[0413] UUO surgery was performed under three types of mixed anesthetic agents (medetomidine, midazolam, butorphanol). After shaving the hair, the abdomen was cut open and the left ureter was exteriorized. The ureter was ligated by 4-0 silk sutures at two points. The peritoneum and the skin were closed with sutures, and the mice were transferred to a clean cage and kept until recovery from anesthesia. Mice were divided into groups of 8 mice based on the body weight on the day before disease induction. P21-targeting DNAzyme (DNZ_p21) was administered intravenously at a dose level of 10 mg/kg in a volume of 5 mL/kg at Days 0, 2, 4, 7, 9 and 11. The animals were sacrificed by exsanguination through direct cardiac puncture under isoflurane anesthesia (Pfizer Inc.) at Day 14. The ligated left kidney and right kidney weights were measured at sacrifice. To visualize collagen deposition, kidney sections were stained using Picro-Sirius red solution (Waldeck, Germany). For quantification of interstitial fibrosis area, bright field images in the corticomedullary region were captured using a digital camera (DFC295) at 200-fold magnification, and the positive areas in 5 fields/section were measured using ImageJ software (National Institute of Health, USA).

[0414] Histological Analysis

[0415] Right lung tissues prefixed in 10% neutral buffered formalin were embedded in paraffin and sectioned at 4 ?m.

[0416] For immunohistochemistry (IHC) staining, sections were subjected to heat induced epitope retrieval (HIER) Following HIER, the sections were incubated rabbit monoclonal anti-p21 antibody [EPR18021] (Abcam) 1:2000 or rabbit monoclonal anti-?-SMA antibody [EPR5368] (Abcam) 1:2000. Section bound primary antibody was detected employing horseradish peroxidase labeled anti-rabbit IgG polymeric reagent.

[0417] For Masson's Trichrome staining, the sections were deparaffinized and rehydrated, followed by re-fixation with Bouin's solution for 15 minutes. The sections were stained in Weigert's iron Hematoxylin working solution (Sigma-Aldrich), Biebrich scarlet-Acid fuchsin solution (Sigma-Aldrich), Phosphotungstic/phosphomolybdic Acid solution, Aniline blue solution and 1% Acetic Acid solution (Sigma-Aldrich). For quantitative analysis of lung fibrosis area, bright field images of Masson's Trichrome-stained sections were randomly captured using a digital camera (DFC295; Leica, Germany) at 100-fold magnification, and the subpleural regions in 20 fields/mouse were evaluated according to the criteria for grading lung fibrosis [Ashcroft, T. et al., Simple method of estimating severity of pulmonary fibrosis on a numerical scale. J. Clin. Pathol. (1988) 41: 467-470]. All sections were blindly analyzed by an experimenter.

[0418] Image Analysis

[0419] Digital images were analyzed by a custom MATLAB algorithm, using Image Processing Toolbox. First, a binary image was calculated, in order to distinguish background pixels from the lobe pixels. Next, a morphological close operation on the image was preformed, fill of the holes, and extraction of the largest connected component, in order to detect all lobe area, including alveoli. The density of the lobe was defined by the ratio between the stained pixels to the total pixels in the lobe area. For Masson's Trichrome staining, blue pixels were detected and separated from purple staining by specifying RGB (red, green, and blue) constraints. The Collagen percentage in each image was defined by the ratio between the blue pixels to the total pixels in the lobe area.

[0420] For p21 staining, an image segmentation algorithm was performed to identify all nuclei in image. Next, cells positive to p21 were detected by RGB and size constraints.

[0421] Hydroxyproline Analysis

[0422] To quantify lung hydroxyproline content, frozen left lung samples were processed by an acid hydrolysis method as follows. Lung samples were acid-hydrolyzed with 300 ?L of 6N HCl at 121? C. for 20 minutes, and neutralized with 300 ?L of 4N NaOH containing 10 mg/mL activated carbon. AC buffer (2.2 M acetic acid/0.48 M citric acid, 300 ?L) was added to the samples, followed by centrifugation to collect the supernatant. A standard curve of hydroxyproline was constructed with 16, 8, 4, 2, 1 and 0.5 ?g/mL of trans-4-hydroxy-L-proline (Sigma-Aldrich Co. LLC., USA). The prepared samples and standards (each 400 ?L) were mixed with 400 ?L chloramine T solution (NACALAI TESQUE, INC., Japan) and incubated for 25 minutes at room temperature. The samples were then mixed with Ehrlich's solution (400 ?L) and heated at 65? C. for 20 minutes to develop the color. After samples were cooled on ice and centrifuged to remove precipitates, the optical density of each supernatant was measured at 560 nm. The concentrations of hydroxyproline were calculated from the hydroxyproline standard curve. Lung hydroxyproline levels were expressed as p g per left lung.

[0423] Statistical Analysis

[0424] Data are presented as means?s.d. unless otherwise noted. Comparisons between two groups were performed by an unpaired two-tailed Student's t-test, and analysis of variance (ANOVA) with Dunnett's or Tukey's multiple comparisons post hoc test or a Fisher's LSD test. For consistency in comparisons, significance in all figures is denoted as follows: *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Example 1

[0425] Specific Human p21 mRNA Targeting DNAzymes

[0426] Various DNAzymes were defined that target human p21 mRNA (as set forth in SEQ ID NO: 1, and presented in FIG. 3). The DNAzyme sequences and the location of the cleavage sites in p21 mRNA are presented in Table 2, below (the DNAzyme names relate to their cleavage site position on the p21 mRNA). The DNAzymes were shown to be effective in mediating in vitro cleavage of p21 mRNA (FIGS. 4A-B). This effect was time and concentration dependent as shown, for example, for DNAzyme 1670 (FIGS. 4C-D). Results from examination of DNAzymes in vitro cleavage of p21 mRNA are depicted in Table 2, below.

TABLE-US-00003 TABLE2 DNAzymestargetinghumanp21mRNA DNAzymeName SEQ Validated Validated (Dz) DNAzymesequence IDNO: cleavage cytotoxicity 16 CCTCTTCTAggctagctacaacgaGCCAGAGCT 6 ? + 75 CTCCTACCAggctagctacaacgaCCCCTTCCT 7 NT + 78 TGTCTCCTAggctagctacaacgaCATCCCCTT 8 NT + 100 TCTGGGGTtccgagccggacgaTTAGAGGTC 9 NT + 111 CATCCTTTAggctagctacaacgaTTCTGGGGT 10 NT + 174 GCAAAGAAAggctagctacaacgaGACTATAGT 11 NT + 185 CAGATCATGggctagctacaacgaAGCAAAGAA 12 NT + 224 TGGGGAAAtccgagccggacgaGGGGCTCAG 13 NT + 225 CTGGGGAAAggctagctacaacgaTGGGGCTCA 14 NT + 236 CGTATACAtccgagccggacgaGCTGGGGAA 15 NT + 237 CCGTATACAggctagctacaacgaTGCTGGGGA 16 NT + 252 TACTCCCCAggctagctacaacgaATAGCCCGT 17 NT + 266 GTCTGTCTtccgagccggacgaTGAATACTC 18 NT + 290 AGGGGAGGAggctagctacaacgaTTGACGAGT 19 NT + 304 TTTGTTGGtccgagccggacgaAGGAAGGGG 20 NT + 317 TGGTTGCAGggctagctacaacgaAGCTTTGTT 21 NT + 352 GTTCTGACAggctagctacaacgaGGCGCCTGA 22 ? + 354 CGGTTCTGAggctagctacaacgaATGGCGCCT 23 + + 364 TGACGGACAggctagctacaacgaCCCCAGCCG 24 ? + 377 GGGTTCTGAggctagctacaacgaGGACATCCC 25 ? + 387 GCTGCCGCAggctagctacaacgaGGGTTCTGA 26 ? + 394 AGGCctTGtccgagccggacgaGCCGCATGG 27 ? + 442 AGTCGCGGtccgagccggacgaCAGCTGCTC 28 ? + 495 GAAGTTCCAggctagctacaacgaCGCTCACGG 29 + + 541 GCUCCCAGGggctagctacaacgaGAAGUCACC 30 + ? 603 ATCCCGGCtccgagccggacgaCGCCGGGGC 31 ? + 835 AGGGCTTCtccgagccggacgaCTTGGAGAA 32 ? + 846 GTGGGCGGAggctagctacaacgaTAGGGCTTC 33 + + 857 GCAGGCTTtccgagccggacgaTGTGGGCGG 34 + + 974 GGGTATGTAggctagctacaacgaATGAGGAGG 35 + + 985 GGGGGCGGtccgagccggacgaAGGGTATGT 36 + + 1003 GCCAGAGGtccgagccggacgaGGGGGGCAG 37 + + 1013 TAATTCTAAggctagctacaacgaGCCAGAGGC 38 + + 1089 TAAATAGTAggctagctacaacgaTTCATAAAA 39 ? + 1114 AGGAGAACAggctagctacaacgaGGGAUGAGG 40 + + 1116 AAAGGAGAAggctagctacaacgaACGGGAUGA 41 + ? 1252 GGGGGTGAAggctagctacaacgaTTCATAACC 42 + + 1417 GCTCAGCCtccgagccggacgaAGGCTGTGC 43 ? + 1418 AGCTCAGCtccgagccggacgaTAGGCTGTG 44 ? + 1455 AGGGGGGTAggctagctacaacgaCAAGAGCCA 45 + + 1467 TTCACAAGAggctagctacaacgaAGAGGGGGG 46 + + 1504 GGGGTGGTtccgagccggacgaGCTCCAGGA 47 + + 1524 GAGGGGCCAggctagctacaacgaGAGGGCAGG 48 + + 1582 CAGGGGAGtccgagccggacgaAAAGAGGGA 49 ? + 1591 CAAAAGGTAggctagctacaacgaAGGGGAGCC 50 ? + 1602 CTGGGGCTtccgagccggacgaTCAAAAGGT 51 ? + 1610 AAGGGTAGtccgagccggacgaGGGGCTCCT 52 ? + 1641 AGAGGGGAAggctagctacaacgaTGCAGAGCC 53 + + 1670 GGGAAAGGAggctagctacaacgaAAGGGGGAG 54 + + 1683 AGAGGGTAtccgagccggacgaGAAGGGAAA 55 + + 1684 GAGAGGGTAggctagctacaacgaTGAAGGGAA 56 1 + 1719 GGGGTGGGAggctagctacaacgaAGGCACCTC 57 + + 1736 CCATTGAGtccgagccggacgaGGGGGTGGG 58 + + 1742 TCCAGTCCAggctagctacaacgaTGAGCTGGG 59 + + 1786 GAGGTAGAAggctagctacaacgaTAGGGTGCC 60 + + 1791 UGCCUGAGGggctagctacaacgaAGAACUAGG 61 ? + 1800 UGCUUGAGtccgagccggacgaGCCUGAGGU 62 ? + 1838 GGACCCTCAggctagctacaacgaCCCCACAGC 63 + + 1851 GTGCCACCAggctagctacaacgaATGGGACCC 64 + + 1854 CCTGTGCCAggctagctacaacgaCACATGGGA 65 + + 1872 TAACCCCAtccgagccggacgaCAAGGGGGC 66 ? + 1873 ATAACCCCAggctagctacaacgaTCAAGGGGG 67 ? + 1938 TTTGAGGGGggctagctacaacgaCAGTGTCTC 68 ? + 1947 GCTGGACGAggctagctacaacgaTTGAGGGGC 69 1 + 1967 TGGGGTGGAggctagctacaacgaGAGGAAGGT 70 + + 1976 GGGGAGGGAggctagctacaacgaGGGGTGGAT 71 1 + 1986 GCAATGAAtccgagccggacgaGGGGAGGGA 72 1 + 1987 TGCAATGAAggctagctacaacgaTGGGGAGGG 73 + + 1991 AAAGTGCAAggctagctacaacgaGAACTGGGG 74 + + 2200 AGGCCAGTAggctagctacaacgaGTTACAGGA 75 ? + 2215 GAGAGAAAAggctagctacaacgaAGTCCAGGC 76 ? + 2235 ACCAGGACAggctagctacaacgaATGGGGAGC 77 ? + 2266 AGAGGTTTAggctagctacaacgaAGTCTAGGT 78 + + Of note: high case letters pertain to the two recognition arms of DNAzyme that bind the mRNA sequence and the low case letters pertain to the catalytic core which cleaves the target mRNA. DNAzyme names relate to their cleavage site position on the p21 mRNA (as set forth in SEQ ID NO: 1)

[0427] Both fluorescent microscopy and flow-cytometry were next utilized to trace the action of p21-targeting DNAzymes (e.g. DNAzyme 1114, DNAzyme 1670 and DNAzyme 985) from cellular uptake, through p21 mRNA and protein downregulation, and up to induction of senescent cell death (FIGS. 5A-J and 11A-C). Specifically, p21 mRNA levels were significantly reduced over time following treatment with DNAzymes, reaching a knockdown of 57% and 73% for DNAzyme 1670 and DNAzyme 985, respectively (FIG. 5D). Following 48 hour treatment, p21 protein levels were significantly reduced following treatment with DNAzyme 1670 as compared to control scramble (FIG. 5G).

[0428] It has been shown that upon p21 knockdown, senescent cells acquired multiple DNA lesions that activated ataxia telangiectasia mutated (ATM) and nuclear factor (NF)-?B kinase, leading to decreased cell survival. Wherein NF-?B activation induces TNF-? secretion and JNK activation to mediate death of senescent cells in a caspase- and JNK-dependent manner [Yosef, R. et al. EMBO J. (2017) 36: 2280-2295]. As expected, following p21-targeting DNAzyme treatment, the senescent cells acquired DNA damage foci as can be seen by significantly elevated levels of ?H2AX and p53BP1 staining (FIGS. 11A-C). Accumulation of DNA damage forced the cells into death by apoptosis involving significant activation of cleaved caspase-3 (CC3, FIG. 5J).

[0429] These results validated that senescent cells could be eliminated by targeting p21 mRNA using the specific DNAzymes. Of the 72 DNAzymes tested, 34 were found to target p21 mRNA for cleavage in vitro and showed senolytic activity (see Table 2, above).

[0430] Namely, DNAzyme 354 (SEQ ID NO: 23), DNAzyme 495 (SEQ ID NO: 29), DNAzyme 541 (SEQ ID NO: 30), DNAzyme 846 (SEQ ID NO: 33), DNAzyme 857 (SEQ ID NO: 34), DNAzyme 974 (SEQ ID NO: 35), DNAzyme 985 (SEQ ID NO: 36), DNAzyme 1003 (SEQ ID NO: 37), DNAzyme 1013 (SEQ ID NO: 38), DNAzyme 1114 (SEQ ID NO: 40), DNAzyme 1116 (SEQ ID NO: 41), DNAzyme 1252 (SEQ ID NO: 42), DNAzyme 1455 (SEQ ID NO: 45), DNAzyme 1467 (SEQ ID NO: 46), DNAzyme 1504 (SEQ ID NO: 47), DNAzyme 1524 (SEQ ID NO: 48), DNAzyme 1641 (SEQ ID NO: 53), DNAzyme 1670 (SEQ ID NO: 54), DNAzyme 1683 (SEQ ID NO: 55), DNAzyme 1684 (SEQ ID NO: 56), DNAzyme 1719 (SEQ ID NO: 57), DNAzyme 1736 (SEQ ID NO: 58), DNAzyme 1742 (SEQ ID NO: 59), DNAzyme 1786 (SEQ ID NO: 60), DNAzyme 1838 (SEQ ID NO: 63), DNAzyme 1851 (SEQ ID NO: 64), DNAzyme 1854 (SEQ ID NO: 65), DNAzyme 1947 (SEQ ID NO: 69), DNAzyme 1967 (SEQ ID NO: 70), DNAzyme 1976 (SEQ ID NO: 71), DNAzyme 1986 (SEQ ID NO: 72), DNAzyme 1987 (SEQ ID NO: 73), DNAzyme 1991 (SEQ ID NO: 74), and DNAzyme 2266 (SEQ ID NO: 78), were validated for mediating cleavage of p21 mRNA.

[0431] Of these 34 DNAzymes, 32 also showed senolytic activity (as illustrated by cytotoxicity). Specifically, DNAzymes 541 and 1116 did not show senolytic activity. Moreover, DNAzymes 1114, 1670, 985 and 1987 showed exceptional capabilities in both mediating cleavage of p21 mRNA and in senolytic activity.

Example 2

[0432] Efficacy and Selectivity of p21-Targeting DNAzymes

[0433] To demonstrate that induction of cell death by p21-targeting DNAzymes is indeed selective to senescent cells, DNAzymes were incubated with Human IMR-90 fibroblast cells and showed that these were effectively killed only when induced to senesce (FIGS. 6A-C). Furthermore, time course killing analysis validated this effect as selective for senescent cells (FIG. 12A). Off target nonspecific effects or other causes of toxicity are often dose related. To assess the optimal dosing window, killing assays were performed with increasing concentrations of the DNAzyme 1670 and DNAzyme 985. After five days in culture, both DNAzymes demonstrated a wide range of selective doses which could be utilized for safe and effective killing of senescent cells (FIGS. 12B-C).

[0434] Cellular senescence has been implicated in a variety of age-related diseases and therefore cell types from different organs are relevant for therapeutic applications. In addition to IMR-90 lung fibroblasts, p21-targeting DNAzymes showed a cell type independent senolytic activity as their action on senescent lung fibroblasts (WI-38) (FIG. 6D), on senescent BJ foreskin fibroblasts (FIG. 12D), and on senescent epithelial kidney cells (REC) (FIG. 6D) was both effective and selective.

[0435] In addition, cellular senescence can be induced by various stress mechanisms such as DNA damage, replicative exhaustion, oncogene activation, and more. Using these different stimuli and conditions the significant relevance of the p21-targeting DNAzymes was demonstrated in both replicative induced senescence (RIS) and oncogene induced senescence (OIS) (FIG. 12E). To explore the applicability of p21-targeting DNAzymes in therapy induced senescence (TIS), the combination treatment of sub-clinical chemotherapy dose with DNAzyme 1670 on several cancer cell lines was evaluated (FIG. 12F). The efficacy of sub-clinical Etoposide in combination with DNAzyme 1670 was comparable to that of clinical Etoposide dose enabling chemotherapy to be equally effective in-vitro at 1/10th to 1/100th of its nominal effective original dose (FIG. 12F). Combination treatment of Etoposide and DNAzyme 1670 yielded good synergistic results in the liver cancer cell line HepG2 (FIG. 12F). Next, sub-clinical doses of various chemotherapies in combination with DNAzyme 1670 were tested (FIG. 12G) and illustrated synergistic activity in HepG2 cells. Taken together, p21-targeting DNAzymes showed broad spectrum senolytics which display multipotency in various cell contexts.

[0436] To validate that the senolytic efficacy was exerted by downregulation in p21 levels, HepG2 cells were stained immuno-fluorescently for p21 protein. As evident in FIGS. 15A-B, there was a significant decrease in staining in HepG2 cells treated with DNAzyme 1670. These results were further validated in a more quantitative analysis using p21 ELISA (FIG. 15C). In addition, other DNAzymes were demonstrated to have a strong senolytic effect in HepG2 cells induced to senescence by chemotherapy induced senescence (CIS) (FIG. 16A). Furthermore, one of the tested DNAzymes, i.e. DNAzyme 1670, exerted senolytic effect in a wide range of doses while control scramble did not (FIG. 16B).

Example 3

[0437] Stability and Biodistribution of p21-Targeting DNAzymes

[0438] Oligonucleotide therapy is notoriously prone to circulating exonuclease-mediated degradation. Therefore, protecting DNAzyme, such as in the serum and in lung compartments, would have a major pharmacological relevance for clinical applications. Unmodified DNAzyme 1670 was degraded over time in serum and Bronchoalveolar lavage fluid (BALF, FIG. 13A). Whereas in BALF, a reduction in the size of the DNAzyme was observed (below full length starting 24 hours from the start of incubation), in serum, the DNAzyme was completely degraded 48 hours from the start of incubation (FIG. 13A). One solution to increase the in vivo stability of DNAzymes is to add a 3 protective modification.

[0439] To improve the stability and efficacy of the specific DNAzymes, the effect of an increase in the length of the DNA recognition arms was tested. Indeed, elongation by 1-2 nucleotides showed a concomitant increase in cleavage in vitro of the p21 mRNA (FIG. 7A). Stability in bronchoalveolar lavage fluid (BALF) was also increased by the addition of a 3-3 inverted dT modification which protects the DNAzyme from the 3 exonuclease activity of serum-borne exonucleases (FIG. 7B). Kinetics in stability assays showed that the incorporation of a 3 inverted dT modification significantly increased the time to degradation of DNAzyme 1670 in both serum and BALF (FIGS. 13B-C, respectively). The stability of DNAzyme 1670 in BALF from diseased bleomycin induced mice, an accepted pre-clinical efficacy mouse model for idiopathic pulmonary fibrosis (IPF), was also tested. As expected, stability in BALF of diseased mice was lower compared to naive BALF (FIG. 13C).

[0440] A key aspect of the applicability of any drug is its capacity to reach the target organ with minimal off-target distribution, and its mode of clearance from the body. Mice were treated with Cy5.5-labeled DNAzyme 1670 comprising a 3Inverted dT (200 ?g) via the intratracheal route and Cy5.5-labeling was monitored in the mice lungs. Image intensity in the lung over time showed an essentially identical profile for both naive and bleomycin-treated mice (FIG. 13D).

Example 4

[0441] Safety of p21-Targeting DNAzymes

[0442] A preclinical safety experiment was performed with DNAzyme 1670. In this experiment, healthy mice of both sexes (female n=3, male n=3) were intranasally treated with 40, 200, and 1000 micrograms of DNAzyme 1670 comprising a 3Inverted dT daily for a time period of 2 weeks (FIG. 13E). There were no significant differences in body weight between groups (FIG. 13F) and no obvious signs of pain or distress. Blood tests were performed at the 2 week endpoint and these demonstrated a safe profile associated with the administration of the DNAzyme in both complete blood count (CBC, FIGS. 13G-O) and biochemistry parameters (data not shown).

Example 5

[0443]

TABLE-US-00004 TABLE3 DNAzymestargetingmousep21 DNAzyme SEQ Validated Validated name(Dz) DNAzymesequence IDNO: cleavage cytotoxicity 557 GAAGACCAAggctagctacaacgaCTGCGCTTG 83 + + 291 GCTCCCAGAggctagctacaacgaGAAGTTGCC 84 + + 639 GGCCGAAGAggctagctacaacgaGGGGAAGAG 85 + + Of note: high case letters pertain to the two recognition arms of DNAzyme that bind the mRNA sequence and the low case letters pertain to the catalytic core which cleaves the target mRNA. DNAzyme names relate to their cleavage site position on the p21 mRNA (as set forth in SEQ ID NO: 3)

Example 6

[0444] In Vivo Treatment of Idiopathic Pulmonary Fibrosis (IPF) in a Mouse Model Using p21-Targeting DNAzymes

[0445] Senescent cells are implicated in various pathological processes, one of the most researched being tissue fibrosis. Idiopathic pulmonary fibrosis (IPF) is a fatal disease characterized by interstitial remodeling, leading to compromised lung function. For evaluation of the therapeutic potential of p21-targeting senolytic DNAzymes in-vivo, a commonly used and accepted mouse model of IPF was utilized wherein intratracheal injection of bleomycin induces lung fibrosis in mice. The mice were treated with either PBS (Sham, i.e. healthy mice), bleomycin alone (Vehicle), or bleomycin followed by intranasal treatment with Dz_639 in both therapeutic and prophylactic regimens (FIG. 10A). Two different treatment regimens were applied approximating prevention and therapeutic modalities. The difference being that the preventative regimen was initiated one day following bleomycin administration whereas the therapeutic regimen was initiated at day 7 following bleomycin administration, at a point when the fibrotic phase of the model has already initiated (FIG. 10A).

[0446] As illustrated in FIG. 10C, the damage created in the lungs upon bleomycin insult was accompanied by a reduction in body weight. p21-targeting DNAzyme treatments (also referred to as Dnz_p21 or Dz_p21) were able to rescue the reduction in body weight following bleomycin administration, and the difference in body weights between the prophylactic group and the vehicle group was statistically significant at 21 days post-induction (p=0.0159). At 21 days, the mice were sacrificed and histological analysis (Aschcroft scoring of fibrosis) was performed on lung sections. The p21 mRNA-targeting DNAzyme treated mice displayed lower Aschroft fibrosis scores (p=0.0206) compared to the bleomycin treated group (FIG. 10B). Further analysis illustrated that oxygen saturation in the blood was significantly elevated following treatment with p21-targeting DNAzyme (FIG. 14A). Furthermore, treatment with p21-targeting DNAzyme significantly protected the mice from death as survival rates were increased from 75% in the vehicle group to 100% over 21 days both in the therapeutic and preventative regimens (FIG. 10D).

[0447] Treatment with p21-targeting DNAzyme showed a reduction in the number of p21 expressing cells in the lung tissue, in both treatment regimens as evident by expression analysis and IHC analysis of lung slices (FIG. 14B). Moreover, expression levels of senescence related genes and SASP factors were significantly reduced (FIG. 14C).

[0448] Accumulation of extracellular matrix components, such as collagen produced by fibroblasts, leads to the formation of a permanent fibrotic scar in IPF patients. Collagens play central roles in maintaining the organization and structural integrity of the lungs. Perturbation of collagen homeostasis is a major contributor to IPF development and maintenance. Evaluation of the levels of collagen and fibrosis were performed using several methods.

[0449] Evaluation of collagen levels was carried out using Masson's Trichrome staining of lung slices. As expected, bleomycin treated vehicle mice showed a significant increase in collagen levels, these levels were significantly reduced by both therapeutic and preventive regimens of p21-targeting DNAzyme treatments (FIG. 14D). Additionally, the levels of Hydroxyproline, a major component of fibrillar collagen of all types, were analyzed. Hydroxyproline levels were significantly increased as expected in bleomycin treated mice. Both therapeutic and preventative p21-targeting DNAzyme treatments reduced Hydroxyproline levels (FIG. 14E).

[0450] The accumulation of fibrotic content in the lungs can also be demonstrated by a tissue density which can lead to devastating consequences on lung function. Treatment with therapeutic and preventative p21-targeting DNAzyme reduced the tissue density (FIG. 14F) in both therapeutic and preventive treatment groups. Taken together these data demonstrate that a p21-targeting DNAzyme can ameliorate IPF in a mouse disease model.

Example 7

[0451] In Vivo Treatment of Unilateral Ureteral Obstruction (UUO) in a Mouse Model Using p21-Targeting DNAzymes

[0452] Chronic kidney disease (CKD) is a common fibrotic age-related disease which creates increasing health burden. The accumulation of senescent cells has been implicated in the establishment of kidney fibrosis by inhibiting regeneration, activating fibroblasts and promoting inflammation. Clearance of senescent cells results in improved kidney function in aged animals, highlighting senolytic as a promising approach for CKD treatment.

[0453] The Unilateral Ureteral Obstruction (UUO) model is utilized to cause renal fibrosis, activated by obstructed urine flow and tubular injury. Experimental UUO in rodents is believed to mimic human chronic obstructive nephropathy in an accelerated manner. Utilizing this model it was shown that p21-targeting DNAzymes (DNZ_p21) not only significantly reduced the weight of the obstructed kidney (FIG. 17A) but also reduced the fibrotic extent in the kidney (FIG. 17B). This data further illustrated the therapeutic benefit that can be achieved by p21-targeting DNAzymes as senolytics.

[0454] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

[0455] It is the intent of the applicant(s) that all publications, patents and patent applications referred to in this specification are to be incorporated in their entirety by reference into the specification, as if each individual publication, patent or patent application was specifically and individually noted when referenced that it is to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, any priority document(s) of this application is/are hereby incorporated herein by reference in its/their entirety.

Example 8

Updated Results

[0456] The present example provides updated results for the findings discussed in the above Examples.

[0457] Results

[0458] The approach for discovering senolytic DNAzymes (DZs) was based on identifying efficient cleavers of full-length p21 RNA, as well as selective killers of senescent vs growing cells, with only molecules scoring high on both metrics investigated further (FIG. 18A). Screening was performed using an in-vitro transcribed, full-length (2,126 nt) p21 RNA (FIG. 18B), and etoposide-induced senescent IMR-90 cells with validated senescence-associated ?-Galactosidase (SA-?-Gal) activity and expression of p21 protein (FIGS. 18B, 18C). Of 242 screened DZs, 16 hits were identified (FIG. 18D), yielding a DZ (targeting position 1670 on the p21 RNA, termed DZ p21) which showed potent, selective, and highly reproducible performance (FIGS. 18E, 18F, 18G). Molecular dynamics simulation of DZ p21 with its target sequence has predicted a consequential interaction aligned with 10-23 DZ mechanism of action involving target recognition, catalytic conformation, cleavage, and release of products (FIG. 18H). Under physiological conditions and in multiple turnover settings (150 mM NaCl, 1 mM Mg2+, pH 7.5, 37? C.), DZ p21 cleaved a 19-nt RNA substrate at a Kobs=0.038 min-1 (FIG. 18I). Importantly, DZ p21 retained its multiple turnover activity on a full-length RNA substrate, supporting evidence for accessibility of the cleavage site (FIGS. 18J, 18K).

[0459] A prominent feature of the autonomous mechanism of DZ action is the potentially high precision of RNA targeting. To directly measure this feature, RNA representing the entire human transcriptome was subjected to cleavage by the DZ p21 in physiological conditions. RNA was then sequenced and analyzed in order to identify sites of DZ activity regions across the sample, with emphasis on off-target cleavage events. DZ bearing a catalytic core inactivating mutation was used as a negative control. An analysis algorithm was built, taking into account the signal vs control across 3 independent repeats, specific activity pattern, etc. At the actual target site of the p21 DZ, a clear and reproducible activity was observed in the form of a valley-like pattern, resulting from the decrease in read abundance immediately around the GU pair forming the cleavage site (FIG. 18L). Strikingly, within approximately 8?107 purine-pyrimidine pairs representing potential cleavage sites for a 10-23 DZ, the GU pair which the DZ was designed to target (position 1670 in p21 mRNA) was the only site that received a perfect score of 100 by the algorithm (FIG. 18M). NUPACK (Fornace et al. (2022) NUPACK: analysis and design of nucleic acid structures, devices, and systems. ChemRxiv. Cambridge: Cambridge Open Engage; Zadeh (2011) NUPACK: analysis and design of nucleic acid systems. J Comput Chem, 32:170-173) was used to approximate the local interaction between the p21 DZ and 5,000 sites that received the highest scores. In terms of formation probability, complex minimal free energy, and the simulated shape of the formed complex, this examination shows that binding and cleavage at these sites is highly unlikely (FIG. 18N). Manual sampling of highly ranked sites clearly showed no cleavage pattern. This strengthens the possibility that the DZ cleaves solely at its cognate target site within the entire range of human RNA. To corroborate the accurate, nonrandom nature of DZ cleavage as expected from its mechanism of action, nanopore sequencing was used to visualize the full-length p21 RNA transcript before and after treatment with the p21 DZ. This analysis showed a clear, sharp cleavage pattern (FIG. 18O), with an approximately 50% reduction in the number of full length transcripts over the background pattern of transcript length distribution. These results support the identification of a potent p21-targeting DZ with a remarkably accurate mechanism of action in terms of both cleavage pattern and target site discrimination.

[0460] The next step was aimed at dissecting the pathway leading to DZ-driven biological effect. In contrast to normal cells, knocking down the expression of p21 in senescent cells leads to mitotic catastrophe and cell death. The first step of DZ activity is entry into the cell. While the precise pathways through which DZs enter mammalian cells are not yet fully understood, it is nevertheless clear that naked DZs can enter certain cells and tissues (ex-vivo and in-vivo) efficiently, for example the lungs, liver, and various leukocyte types. DZ entry into target cells in culture via transfection is rapid and efficient, with DZs persisting in the cells for a minimum of 24 h (FIG. 19A). The DZ knocks down p21 mRNA at an approximately 50% efficiency over this period (FIG. 19B). At 48 h post DZ treatment, p21 protein knockdown induced cell death with an approximate Emax of 50% (FIG. 19C). It has been shown that upon p21 knockdown, senescent cells acquired multiple DNA lesions that activated ataxia telangiectasia mutated (ATM) and nuclear factor (NF)-?B, leading to decreased cell survival. NF-?B activation induced tumor necrosis factor (TNF)-? secretion and c-jun N-terminal kinase (JNK) activation to mediate death of senescent cells in a caspase- and JNK-dependent manner. As expected, 72 h following p21 DZ treatment, senescent cells acquired DNA damage foci as observed by significantly elevated levels of ?H2AX and p53BP1 expression (FIGS. 19D, 19E). At the same time, RNA sequencing of cells treated with DZ revealed a gene expression pattern significantly different from control-treated cells (FIG. 19F). No significant pattern of gene downregulation that may have resulted from cleavage events at off-target sites was observed (see FIG. 18M). Pathway enrichment analysis confirmed up-regulated NF-?B and TNF-? pathways, as well as Ferroptosis (FIG. 19G), and down-regulated focal adhesion and extracellular matrix (ECM)-receptor interaction pathways (FIG. 19G), all well correlating with previous reports. Accumulation of DNA damage forced the cells into death and involved significant activation of cleaved caspase-3 (FIG. 19H). Cell death reached maximum and plateau within 72 to 96 h post DZ treatment, and was selective to senescent vs the growing cells (FIG. 19I), which is likely due to p21 being elevated in SA-?-Gal positive senescent cells, but low to nonexistent in growing ones (see FIG. 18C). Finally, co-staining for p21 and p16 validated a significant reduction in the proportion of p21 positive cells corresponding with an elevated proportion of p16 positive cells (FIG. 19J). Taken together, these effects draw a picture of the cascade driven forward by the initial DZ treatment and subsequent p21 knockdown (FIG. 19K).

[0461] The next step was to investigate the effectiveness and selectivity of DZ p21 across a variety of cellular models. The DZ showed effective and selective killing of senescent IMR-90, WI-38, and BJ cells (primary adult lung fibroblasts, embryonic lung fibroblasts, and neonatal foreskin fibroblasts, respectively) induced to senescence by DNA damage, replicative exhaustion (RIS), and oncogene-induced senescence (OIS), with EC50 values ranging from 20 to 2,000 nM and a maximal effect ranging between 40-80% killing (FIGS. 20A-20E). DZ p21 demonstrated a senolytic index on the order of 80, meaning it is 80-fold more potent against senescent cells than growing cells (FIG. 20F). Cellular senescence is a common outcome of various anticancer interventions. Therapy-induced senescence eventually causes cancer metastasis and relapse, and several adverse reactions to cancer treatments, highlighting senotherapeutics in general, and p21 therapy specifically, as promising approaches in combination with classical chemotherapies. It was confirmed that etoposide treatment induces p21 expression in a dose-dependent manner by nearly 90-fold (FIG. 20G), in agreement with previous reports, and found that DZ p21 treatment counteracts this effect (FIGS. 20H-20J). Blocking p21 upregulation on a scale of concentrations, significantly sensitized these cells to the DNA damage and stress induced by etoposide, and dramatically led to death in HepG2 liver cells (FIGS. 20K, 20L). Similar effects were observed by exposing additional cell lines to etoposide-DZ p21 combination, or by alternatively exposing HepG2 to doxorubicin, palbociclib, or cisplatin, together with DZ p21 (FIGS. 20M, 20N). Taken together, these findings show that the p21 DZ has a significant and selective effect across multiple settings and cell types characterized by marked upregulation of p21.

[0462] Cellular senescence has been implicated in a variety of age-related diseases, many of which represent serious unmet medical needs such as idiopathic pulmonary fibrosis (IPF) and non-alcoholic steatohepatitis (NASH). The next aim was thus to evaluate the efficacy of the p21 DZ as a selective senolytic in animal models of some of these diseases. For this purpose, specific sequence mutations were introduced into the DZ arms to improve its binding to the murine p21 RNA while maintaining its activity (FIGS. 21A, 21B), and modified it with a 3-terminal inverted deoxythymidine, to protect its 3 end from exonuclease-mediated degradation. The modified DZ retained its function and selectivity (FIG. 21C), and was indeed significantly more stable in mouse serum and bronchoalveolar lavage fluid taken from either naive or bleomycin-induced mice (FIGS. 21E, 21F, 21G), which was in agreement with previous reports. The DZ was detected in the lungs and the lung parenchyma already at 30 min post intranasal instillation (FIGS. 21F, 21H-21J) and remained detectable until t=24 h post instillation (FIGS. 21H-21J), which correlated well with previous studies on DZ biodistribution. Outside the lungs, the DZ was observed mostly in the liver, kidneys, and gastrointestinal tract, resulting in a gradual clearance of the DZ (FIG. 21J). This biodistribution profile supported the potential efficacy of p21 DZ in an animal model of IPF, which was investigated first.

[0463] IPF is a fatal disease characterized by interstitial remodeling leading to compromised lung function. The bleomycin-induced rodent lung fibrosis model is frequently used to evaluate therapeutic effects in human IPF, despite its known limitations, as it captures pathological and molecular aspects observed in patients. To test the efficacy of the p21 DZ in this model, mice were subjected to a single dose of intratracheal bleomycin (3 mg/kg) followed by intranasal administration of a 1/day dose of 200 ?g of the p21 DZ (FIG. 22A). Two different treatment regimens were applied, approximating preventive and therapeutic modalities, with the former initiated at day 1 and the latter at day 7 following bleomycin administration (FIG. 22A). Survival in the bleomycin-treated group was reduced compared with the healthy group, with approximately 25% mortality observed across independent experiments (n=3). Strikingly, both DZ-treated groups were completely rescued (FIG. 22B). A similar trend was observed in weights of surviving animals, whereas the vehicle-treated group lost approximately 13% of their body weight within 3 weeks, the therapeutic and preventive DZ-treated groups lost approximately 7% and 0%, respectively (FIGS. 22C, 22D). DZ treatment in both groups improved running performance on a treadmill (FIG. 22E), as well as oxygen saturation (FIG. 22F).

[0464] The lungs of DZ p21-treated groups exhibited reduced p21 mRNA levels (FIG. 22G) and a marked reduction in the number of p21+ cells (FIGS. 22H, 22I). Aligned with these observations, expression levels of senescence-related genes and SASP factors were significantly reduced (FIG. 22J). Senescent cells are known to drive the production of extracellular matrix molecules, factors important for the formation of IPF fibrotic scars. Here it is reported that DZ p21 reduce the levels of alpha-smooth muscle actin (?-SMA), an indicator of fibrotic activation (FIGS. 22K, 22L). An additional major component of tissue scarring is collagen deposits. As observed by Masson's trichrome staining and by Hydroxyproline assay, DZ p21 treatments significantly reduced collagen content in the lungs (FIGS. 22M-22O), which strongly affected lung density (FIG. 22P). The most clinically relevant measurement for the severity of pulmonary fibrosis is the Ashcroft score, which provides a standardized grading of the fibrosis levels. DZ p21 treatments were able to reduce the Ashcroft score of bleomycin-treated mice from 3.54 on average, to 3.03 and 2.21 for Therapeutic and Preventive regimen, respectively, with the preventative regimen achieving statistical significance (FIG. 22Q). In line with the results from mice, DZ p21 was able to induce a dose-dependent knockdown of p21 mRNA in precision cut lung slices (PCLS) from an IPF patient, which also led to reduction in the expression levels of COL1A1 and ACTA2 (FIG. 22R). Taken together, by showing an effective KD of the target RNA within the target tissue, which ultimately is being translated into a senolytic effect and amelioration of the pathological condition, these findings demonstrate proof of pharmacodynamics for the DZ.

[0465] The effect of DZ p21 treatment in other animal models of fibrotic diseases is continuing to be explored. Importantly, it was observed that the naked DZ accumulates in the liver and kidney following intrapulmonary delivery, which is in agreement with previous reports, as well as following systemic delivery (FIGS. 23A, 23B). Liver fibrosis was first induced in mice by CCl4 injections, a process involving early p21 upregulation in the liver. Treatment with DZ p21 was able to counteract the upregulation of p21 mRNA 3 days following CCl4 insult (FIGS. 23C, 23D). After 4 weeks of bi-weekly chronic exposure to CCl4, and daily treatment with DZ p21 injection, mice had retained a normal liver-body ratio, and significant reduction in their fibrosis was observed (FIGS. 23E, 23F). Next DZ p21 impact on fibrosis was tested in STAMTM mice, a model which resembles an actual human disease of non-alcoholic steatohepatitis (NASH). p21 expression gradually increased during progression of NASH in these mice (FIG. 23G). Despite the fact that the DZ treatment started 6 weeks after induction of the disease, restricted to a period of 6 weeks where fibrosis is evident in the model, DZ p21 was able to achieve a marked improvement is several key parameters of the disease, including liver-body ratio, triglyceride and ALT levels in the blood, and fibrosis in the livers (FIGS. 23H-23L). Finally, DZ impact on UUO-associated kidney fibrosis was evaluated, where DZ was able to significantly reduce kidney-body ratio, blood urea nitrogen (BUN), and kidney fibrosis (FIGS. 23M-23P). In summary, the data point to the conclusion that a DZ targeting p21 expression could be a viable therapeutic modality for fibrotic conditions such as liver and kidney fibrosis.

DISCUSSION

[0466] In this work the feasibility and potential of a p21-targeting DZ is demonstrated for use as a senolytic agent for the treatment of fibrosis and possibly additional age-related diseases. Recent years have seen a rapid evolution of senolytics from repurposed drugs (First-generation senolytics) to drugs identified for specific targeting of senescent cells (Second-generation senolytics). Still, the field has yet to yield strong candidates for clinical applications. Unfortunately, successful targeting of key proteins in the senolytic pathways while avoiding significant toxicity has proven elusive. The first senolytic drug to reach phase 2, a small molecule inhibitor of p53/MDM2 interactions, was unsuccessful in reducing pain in osteoarthritic patients as its primary endpoint. This result highlights the challenge to deliver a clinically meaningful benefit while maintaining a superior safety profile.

[0467] Oligonucleotide therapeutics such as siRNA, antisense oligonucleotides (ASO), and DZs, have several advantages compared with small molecules or biologics. For example, they can be readily designed to target virtually any gene of interest, and are not limited to targets with druggable structural features. DZs, in particular, have a remarkably accurate mechanism of action and single-base specificity, potentially contributing to lower toxicity compared with small molecules, such as the toxicity that has limited the use of the senolytic small molecules NAVITOCLAX and DASATINIB. In the senolytic context, this could enable a significant expansion of the range of senescent cell targets, including targets that have been so far hard to address.

[0468] Although DZs were described nearly three decades ago, and despite specific DZs showing promise in therapeutic contexts, these molecules have only recently gained renewed attention as a therapeutic platform owing to some important gap-bridging works. Particularly, the structure of a 10-23 DZ has been determined, for the first time shedding light on the molecule's mechanism of catalysis. Importantly, analog nucleotide chemistries have given rise to DZs with drastically-improved stability and activity, while reducing or completely eliminating the involvement of RNase H in target RNA destruction. These works now grant credence to DZs as a reliable platform for therapeutic applications. It is worth noting that additional cores exist apart from the 10-23 type, for example the 8-17 DZs, which have also shown impressive efficiency at physiological conditions. This work successfully recapitulated some of the key findings on p21 knockdown reported here, using a 8-17 DZ targeting p21 (FIGS. 24A-24F).

[0469] In particular, the uniquely autonomous mechanism of DZ action could play a contributory role in their pharmacokinetics (PK), which is a major challenge in oligonucleotide therapeutics in general. Apart from within specific sites, such as the central nervous system and the eyes, it is generally accepted that short nucleic acids need to be protected and/or carried in order to prevent their clearance by rapid enzymatic degradation and renal filtration. Many encapsulation systems that protect nucleic acids, such as lipid nanoparticles, end up reaching the liver almost exclusively, which has led to significant work invested into extrahepatic delivery. In this context, DZs could offer a unique differentiating advantage over other nucleic acid therapeutics. Stability- and targeting-promoting modifications and conjugations, such as analog bases, aptamers, and terminal ligands, could be applied in general to nucleic acids, but beyond a certain level they might render DNA and RNA unrecognizable as substrates for the cellular machineries they rely on for activity. Because DZs do not rely on such mechanisms, they can be modified with relative freedom compared with other technologies.

[0470] On the other hand, a potential disadvantage of the mechanism of action of DNAzymes is that they must persist within their target cells long enough to generate the desired effect, likely necessitating stabilizing modifications. Yet, disclosure presented herein demonstrates that, in some instances, this is not the case. As has been shown, a transient activity of the p21-targeting DZ drives an irreversible cascade of events because of the specific biological mechanism of p21-dependent senescent cell survival. Subsequently, the death of even a fraction of tissue senescent cells is sufficient to set the desired therapeutic effect in motion. The findings demonstrate this principle in multiple settings. Unlike in cancer for instance, new senescent cells are generated at much slower rate, and the senescence load rises gradually over years. Therefore, modifications for prolonging the duration of action might not be required in the case of senolytic DZs, and their safety may potentially be higher as a result of this transience.

[0471] The science of senolytics was fueled by new studies using genetic models to elucidate the therapeutic potential in eliminating p16+ cells. Although p21 was part of the first senolytic targets discovered, similar genetic models have been developed for p21 only recently, further establishing p21 as an attractive target for treatment of senescent cells. p21 is predominantly known for its tumor suppressor function, but also, counterintuitively, as an oncogene, depending on the cellular context. The fact that p21-deficient mice are viable and develop cancers only during late stages of life, may imply that such effect is less likely upon transient administration. RNA-targeting approaches have already been applied to p21-highly expressing malignancies.

[0472] Targeting p21 at the mRNA level could offer an attractive senolytic approach due to several biological properties of the protein. Lacking a defined tertiary structure, p21 protein appears to act through a folding-on-binding mechanism with prominent binding promiscuity, making it a highly evasive target. Moreover, p21 is a short-lived protein that is degraded via different ubiquitin-dependent and-independent pathways 99,100. Interestingly, a specific variant of p21 has been identified as a strong marker of aging in mice. The human p21 locus also encodes a set of variants, and it is possible that future studies will identify specific variants of p21 which are more relevant to the dark side of this gene. In such a scenario, development of DZs for specific variants could represent an attractive approach.

[0473] The selected p21 DZ has a guanine-rich sequence (5 and 3 arm compositions of the human p21-targeting DZ (SEQ ID NO:54), G content 61%; mouse-targeting DZ variant (SEQ ID NO:85), G content 55%). This raised the question whether the lethal activity that was observed is associated with structural features outside the catalytic core, particularly G-quadruplexes that could form. It has been previously reported that some DZs exhibit off-target toxicity which is independent of their catalytic activity. However, a definitive link and mechanism underlying this observation have not yet been established. For example, some guanine-rich cytotoxic DZs were found not to produce G-quadruplex by circular dichroism spectroscopy; binding of proteins to guanine-rich oligonucleotides only partially correlated with their cytotoxicity; and the cytotoxic effect did not seem to be universal. In this work, reproducible selectivity of the p21 DZ against senescent vs growing cells was observed. Moreover and importantly, no nonspecific cytotoxicity was observed in treated mouse blood and tissues in both DZ variants (FIGS. 25A-25D). The animal data is in agreement with previous reports, on a well-studied DZ targeting human GATA-3, which is also guanine-rich (arm composition, G content 50%) but did not show nonspecific toxicity in both animal models and clinical trials. The selective senolytic effect we report is thus not likely to be driven by nonspecific toxicity that may or may not be related to the guanine content of the DZ.

[0474] The findings highlight a novel use for p21-targeting DZs, as potential chemotherapy-sparing agents. It has long been observed that p21 is associated with resistance to chemotherapy in human tumors as well as with poor prognosis in various cancers (FIG. 26). Moreover, various chemotherapies drive p21 upregulation, emphasizing the functional complexity of this protein outside of its traditionally-viewed role as a tumor suppressor and highlighting it as a target for cancer therapy. In addition to chemotherapy, p21 is also upregulated following irradiation treatment, suggesting that the p21-targeting DZ could act in combination with irradiation to potentiate its effectiveness and possibly to attenuate the fibrosis resulting from radiation therapy for cancer.

[0475] So far, oligonucleotide therapeutics have suffered from PK limitations which small molecules generally do not have. In some animal models reported in this study, it was still necessary to administer the DZ daily, as the focus here has been to show the effects of p21 knockdown, while leaving DZ pharmacology optimization out of the scope of this work. Nevertheless, it has recently become much clearer how this optimization might be achieved. New sugar and backbone chemistries and terminal modifications are constantly being assimilated into nucleic acid therapeutics, improving their pharmacology. There is no reason to assume that oligonucleotides will remain categorically inferior to small molecules in terms of PK, delivery, and bioavailability in the near future.

[0476] In summary, this work highlights a novel selective senolytic DZ with promising potential in several models of fibrosis, as a member of a class of senolytics, with remarkable features that merit further investigation and development as therapeutics in age-related diseases.

TABLE-US-00005 TABLE4 DNAzymestargetinghumanp21mRNA DNAzymeName (Dz) DNAzymesequence SEQIDNO: Dz_p21_1 AGGAGAACAGGCTAGCTACAACGAGGGATGAGG 126 Dz_p21_103_7arms ACAGAGAGGCTAGCTACAACGAAACCCCA 127 Dz_p21_103_8arms CACAGAGAGGCTAGCTACAACGAAACCCCAC 128 Dz_p21_103_9arms ACACAGAGAGGCTAGCTACAACGAAACCCCACT 129 Dz_p21_103_10arms AACACAGAGAGGCTAGCTACAACGAAACCCCACTC 130 Dz_p21_103_11arms TAACACAGAGAGGCTAGCTACAACGAAACCCCACTCA 131 Dz_p21_106 ACTCCCCCAGGCTAGCTACAACGACATATACCC 132 Dz_p21_112 CGCTGCTAAGGCTAGCTACAACGACAAAGTGCA 133 Dz_p21_113 ATCTTAAAAGGCTAGCTACAACGAGTCTGACTC 134 Dz_p21_199_7arms GAAAGGAGGCTAGCTACAACGAAAGGGGG 135 Dz_p21_199_8arms GGAAAGGAGGCTAGCTACAACGAAAGGGGGA 136 Dz_p21_199_10arms AGGGAAAGGAGGCTAGCTACAACGAAAGGGGGAGG 137 Dz_p21_199_11arms AAGGGAAAGGAGGCTAGCTACAACGAAAGGGGGAGGG 138 Dz_p21_212 CATCATATAGGCTAGCTACAACGACCCTAACAC 139 Dz_p21_213_7arms AGATCTAGGCTAGCTACAACGATCCCCCA 140 Dz_p21_213_8arms AAGATCTAGGCTAGCTACAACGATCCCCCAT 141 Dz_p21_213_9arms AAAGATCTAGGCTAGCTACAACGATCCCCCATC 142 Dz_p21_213_10arms GAAAGATCTAGGCTAGCTACAACGATCCCCCATCA 143 Dz_p21_213_11arms AGAAAGATCTAGGCTAGCTACAACGATCCCCCATCAT 144 Dz_p21_216 AATGTCTGAGGCTAGCTACAACGATCCTTGTTC 145 Dz_p21_217 CTACTGCCAGGCTAGCTACAACGACATCTTAAA 146 Dz_p21_218 TAGCCTCTAGGCTAGCTACAACGATGCCACCAT 147 Dz_p21_10- ATCTTCCTTGGCTAGCTACAACGACGCCTCTCC 148 23_scramblearm