AAV-MEDIATED EXPRESSION USING A SYNTHETIC PROMOTER AND ENHANCER
20240066147 ยท 2024-02-29
Inventors
Cpc classification
A61K47/55
HUMAN NECESSITIES
C12N2750/14143
CHEMISTRY; METALLURGY
C12N2750/14041
CHEMISTRY; METALLURGY
A61K48/0066
HUMAN NECESSITIES
C12N2750/14043
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
Abstract
An isolated recombinant parvovirus vector comprising a synthetic enhancer comprising plurality of enhancer sequences operably linked to a promoter, and methods of using the vector, are provided.
Claims
1. A method to express a transgene in a cell, comprising: introducing a composition comprising a recombinant parvovirus vector comprising a synthetic enhancer comprising a plurality of enhancer sequences operably linked to a promoter operably linked to a transgene to a eukaryotic cell so as to express the transgene in the cell.
2. The method of claim 1, wherein the cell is in a mammal.
3. The method of claim 1, wherein the expression of the transgene is enhanced by at least 2-, 5-, 10-, or 15-fold or more relative to a corresponding parvovirus vector that lacks the synthetic enhancer.
4. The method of claim 1, wherein the plurality of enhancer sequences has 2 up to 20, 2 up to 15 or 2 up to 10, of the enhancer sequences in tandem.
5. The method of claim 1, wherein the synthetic enhancer comprises F1, F5 or F10, the synthetic enhancer has at least one enhancer sequence with at least 80% nucleotide sequence identity to F1, F5 or F10, the synthetic enhancer has at least one enhancer sequence with at least 90% nucleotide sequence identity to F1, F5 or F10 or the synthetic enhancer has at least one enhancer sequence with at least 95% nucleotide sequence identity to F1, F5 or F10.
6. The method of claim 1, wherein the synthetic enhancer and promoter have at least 80%, 85%, 90%, 95%, 98%, 99% or more nucleotide sequence identity to one of SEQ ID NOs. 24-30.
7. The method of claim 1, wherein the synthetic enhancer and promoter have a sequence having at least 90% nucleotide sequence identity to SEQ ID NO:27.
8. The method of claim 7, wherein the synthetic enhancer and promoter have at least 95%, 98%, 99%, or more nucleotide sequence identity to SEQ ID NO:27.
9. The method of claim 8, wherein the synthetic enhancer and promoter comprise the sequence of SEQ ID NO:27.
10. The method of claim 1, wherein the recombinant parvovirus vector is a bocavirus or an adeno-associated virus vector.
11. The method of claim 10, wherein the recombinant parvovirus vector is an adeno-associated virus vector.
12. The method of claim 1, wherein the promoter is operably linked to an open reading frame that encodes a prophylactic or therapeutic gene product.
13. The method of claim 12, wherein the therapeutic gene product is cystic fibrosis transmembrane conductance regulator (CFTR) or CFTRR.
14. The method of claim 13, wherein the CFTR or CFTRR is human CFTR or human CFTRR.
15. The method of claim 14, wherein the CFTRR is human CFTRR.
16. A method to express a human CFTRR transgene in a cell, comprising: introducing a composition comprising a recombinant parvovirus vector to a eukaryotic cell so as to express the human CFTRR transgene in the cell, wherein the recombinant parvovirus vector comprises (i) an enhancer operably linked to a promoter, wherein the enhancer and promoter comprise the sequence of SEQ ID NO.:27; and (ii) the human CFTRR transgene operably linked to the promoter.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
DETAILED DESCRIPTION
[0021] Gene therapy has been widely used in clinical trials since 1990s with many successful cases reported using viral or non-viral vectors to deliver therapeutic genes. rAAV is the most widely used one proven of high safety profile, broad tissue/organ tropism and persistence transgene expression. AAV is a small single stranded DNA virus of an inherently small 4.679 kb genome, thus the application of rAAV for gene therapy is restricted to delivering relative small transgenes. Although AAV capsid can house a rAAV genome slightly larger than its original size, 4.95 kb appears to be the maximal size for efficient transgene expression. Since a 300-bp sequence of an AAV essential cis element (terminal repeats at both termini) Is included in a rAAV vector, the actual insertion of an exogenous gene expression cassette cannot exceed 4.6 kb. This is a challenge for delivering effective expression of a large gene whose size approaches to this limit.
[0022] One typical example is to deliver the CFTR gene (cystic fibrosis transmembrane conductance regulator) for cystic fibrosis (CF) gene therapy using rAAV vector. The coding sequence for CFTR gene is as large as 4.443 kb. To construct a CFTR expressing AAV vector, with the necessity of minimal 5 and 3 UTR and the cloning sites, there is a room of less than 200 bp to incorporate promoter and polyadenylation signal to direct the transcription of full-length CFTR cDNA.
[0023] Recently, a CFTR knockout ferret model was established that spontaneously develops a lung phenotype that mirrors key features of human CF disease, including spontaneous bacterial infection of the lung, defective secretion from submucosal glands, diabetes, and gastrointestinal disease (Sun et al., 2008; Sun et al., 2010; Oliver et al., 2012; Sun et al., 2014; Yan et al., 2013. It has been demonstrated that the airways of newborn ferrets can be efficiently transduced by rAAV1 in the presence of proteasome inhibitors (Yan et al., 2013). Thus, preclinical studies in the CF ferret model can be initiated as soon as a rAAV vector that effectively expresses CFTR in airway epithelium is generated. rAAV inherently small 4.679 kb genome necessitates the use of a short but robust transcription regulatory element to effectively express a large transgene whose size approaches to the package limit. cassette was generated that efficiently expresses the ferret CFTR (fCFTR) gene.
[0024] The first-generation rAAV-CFTR vector (AV2.tgCF), relied on the cryptic promoter activity of the AAV2 ITR, inefficiently expressed CFTR in clinical trials. To overcome this problem, another rAAV vector, AV2.tg83-CFTR, which uses an 83-bp synthetic promoter (tg83) was used to improve expression. Although this vector produced a 3-fold higher in cAMP-mediated Cl.sup. currents in CF HAE ALI cultures than AV2.tgCF, this level of expression remains suboptimal for application in CF gene therapy. So, there is an immediate need for a strong short promoter to direct the CFTR expression in the AAV vector for CF gene therapy. Similarly, to express the 4.3 kb B-domain deleted Factor-VIII in muscle and/or liver for hemophilia gene therapy using rAAV, short promoter effective in muscle and liver is also needed.
[0025] Another example is to deliver the CRISPR/Cas9 system for gene editing. The recent development of CRISPR/Cas9 gene editing technique promotes a new human gene therapy strategy by correcting a defect gene at pre-chosen sites without altering the endogenous regulation of gene of interest. This system consists of two key components: Cas9 protein and sgRNA, as well as a correction template when needed. rAAV can be used to deliver these elements in vivo to various target organs, but the co-delivery of Cas9 protein and the a chimeric sgRNA in the same cell is required while the dual-AAV vector delivery system is low efficient. Because the size of the expression cassette for Streptococcus pyogenes (SpCas9) and the transcription cassette sgRNA together exceeds 4.2 kb, to use a single rAAV vector to deliver the efficient expression SpCas9 protein, it necessitates the use of small but robust promoter/enhance sequence to direct the SpCas9 expression, thus, ubiquitous and/or tissue-specific enhancers are desired. Although Staphylococcus aureus Cas9 (SaCas9), which is about 1.0 kb smaller in size, fits together with its sgRNA and relevant expression cassettes within a single AAV vector, using short synthetic promoter allows for the additional incorporation of the gene correction template for an all-in-one rAAV vector in the application of gene editing-based gene therapy.
[0026] As described below, short (less than 0.2 kb) synthetic enhancer/promoters provide a solution to solve the current problem of rAAV vector in delivering a large transgene cassette. This disclosure, in one embodiment, relates to the use of a 183-bp F5tg83 synthetic enhancer/promoter to rAAV vectors to deliver effective CFTR expression in lung airway tissue for CF gene therapy. This disclosure, in one embodiment, also provides an effective approach to screen and identify tissue-specific or ubiquitous synthetic promoter/enhancer combinations.
[0027] Since enhancer activity differs by cell lines and state of cell differentiation, as well as is influenced by the AAV ITRs and by the sequence of gene of interest, the screening was conducted in a step-wise fashion, e.g., in plasmids, proviral vectors, and rAAV vectors.
[0028] In one embodiment, the screening system includes a defined 83-mer synthetic core promoter (tg83p) and a set of random 100-mer synthetic sequence of potent enhancer activity. The screening approach can be used to screen the 100-mer synthetic sequences for their enhancer activity to enhance promoter transcription, e.g., the 83 bp tg83p promoter transcription, in different organ/tissue for different gene of interests, in a similar in a step-wise fashion: such as to direct the Factor Villi expression in muscle or liver, as well as to direct the Cas9 protein expression in any specific tissues or stem cells. Besides tissue-specific expression, the approach also can be used to identify an enhancer of ubiquitous effect to improve the tg83p promoter activity in a wide range of tissue/organ, through testing rAAV derived reporter gene expressions at a multi-organ level.
[0029] Specifically, a set of vectors containing the synthetic tg83 promoter linked with different synthetic sequences (about 100 bp) of potent enhancer activity, was constructed for initial screening in monolayer (non-polarized) cultures of human airway cell lines and primary ferret airway cells, which as discussed below revealed that three of these synthetic enhancers (F1, F5, and F10) significantly promoted transcription of a luciferase transgene from tg83p in the context of plasmid transfection. The next was to construct rAAV reporter vectors with pre-chosen candidates (F1-, F5-, or F5-tg83p enhancer/prompter combination). These vectors also incorporated a partial sequence of the gene of interest (CFTR here) that can maximally fit into the rAAV genome; this approach allows for the screening of cDNA sequences that will ultimately reside in the recombinant virus and also influences enhancer/promoter activity through unknown processes (likely secondary structure of the DNA). Analysis in polarized cultures of human and ferret airway epithelia at an air-liquid interface (ALI) in the context of AAV vector infection found that the combination of F5tg83 (183 bp in length) was the most efficient promoter in both ALI cultures, leading to 19.6-fold and 57.5-fold increases in reporter (firefly luciferase) expression, respectively, over the enhancer-less counterpart. The F5tg83 promoter also produced the highest level of transgene expression in the ferret airway in vivo. Finally, the F5tg83 promoter was used the rAAV-CFTR vector to direct the CFTR expression, the vector (AV.F5tg83CFTRR) yielded an about 17-fold increase related to the enhancer-less vector (AV.tg83CFTRR) in vector derived CFTR mRNA transcription and significantly improved Cl.sup. currents in human CF ALI cultures.
[0030] Thus, expression from rAAV vectors having a large transgene was enhanced using small synthetic enhancer/promoter combinations having from a defined 83-mer synthetic core promoter and a set of random synthetic 100-mer synthetic enhancers. In particular, several short 183 bp synthetic promoter/enhancer combinations (F5tg83, F1tg83 and F10tg83) were capable to direct strong transgene expression in human as well as non-human mammalian (such as ferret) airway cells. In one embodiment, the robust F5tg83 promoter can be used in rAAV vector to deliver the 4.4 kb cystic fibrosis transmembrane conductance regulator (CFTR) for cystic fibrosis gene therapy.
[0031] The invention will be further described by the following non-limiting examples.
Example 1
Materials and Methods
[0032] Production of rAAV Vectors. All rAAV vector stocks were generated in HEK293 cells by triple plasmid co-transfection using an adenovirus-free system, and purified with two rounds of CsCl ultracentrifugation as reported in Yan et al. (2004). For all viral vectors and proviral plasmids, rAAV2 genomes were used and packaged into AAV2 or AAV1 capsid to generate rAAV2/2 and rAAV2/1 viruses, respectively. TaqMan real-time PCR was used to quantify the physical titer (DNase resistant particles, DRP) of the purified viral stocks as described in Yan et al. (2006) and Ding et al. (2006). The PCR primer/probe set used to titer luciferase vectors was: 5-TTTTTGAAGCGAAGGTTGTGG-3 (forward primer) (SEQ ID NO:1), 5-CACACACAGTTCGCCTCTTTG-3 (reverse primer) (SEQ ID NO:2) and 5-FAM-ATCTGGATACCGGGAAAACGCTGGGCGTTAAT-TAMRA-3 probe) (SEQ ID NO:3); the primer/probe set used for ferret CFTR vectors was 5-GACGATGTTGAAAGCATACCAC-3 (forward primer) (SEQ ID NO:4), 5-CACAACCAAAGAAATAGCCACC-3 (reverse primer) (SEQ ID NO:5) and 5-FAM-AGTGACAACATGGAACACATACCTCCG-TAMRA-3 (probe) (SEQ ID NO:6). All primers and probes were synthesized by IDT (Coralville, IA). The PCR reaction was performed and analyzed using a Bio-Rad My IQ Real-time PCR detection system and software.
[0033] Analysis of Integrity of Viral Genomes. Viral DNA was extracted from 10.sup.9 DRP of AAV-CFTR vectors and resolved in 0.9% alkaline denatured agarose gel at 20 volts overnight in 50 mM NaOH/1 mM EDTA buffer. Following transfer to a Nylon membrane, Southern blotting was performed with a .sup.32P-labeled CFTR probe to visualize the viral DNA. For examination of 5 end genome deletions in the oversized rAAV vectors, 3.3310.sup.8 DRP of each virus (quantitated by TaqMan PCR with probe/primer set against fCFTR cDNA) was loaded into a slot blotting Nylon membrane. The blots were first hybridized to a set of three .sup.32P-labeled oligonucleotide probes against the minus strand of the rAAV genome: at the 5 sequence of the tg83 promoter taccctcgagaacggtgacgtg (SEQ ID NO:7); the center of ferret CFTR cDNA: ggagatgcgcctgtctcctggaatg (SEQ ID NO:8); and the 3 sequence of the synthetic polyA: gcatcgatcagagtgtgttggttttttgtgtg (SEQ ID NO:9). After exposure to X-film, the membranes were stripped of probe and hybridized again to another set of three .sup.32P-labeled oligonucleotide probes complimentary to the positive strand. NIH ImageJ software was used to quantify the signal intensity of hybridization to determine the corresponding number of genomes detected by each probe with serial dilutions of the proviral plasmid as standards.
[0034] Cell Culture and Conditions for Transfections and Infections. Human airway cell lines A549 and IB3, as well as HEK 293 cells, were cultured as monolayers in Dulbecco's modified Eagle medium (DMEM), supplemented with 10% fetal bovine serum and penicillin-streptomycin, and maintained in a 37 C. incubator at 5% CO.sub.2. Primary ferret airway cells were isolated and cultured as non-polarized monolayer or at an ALI to generate polarized epithelia as described in Liu et al. (2007). Polarized primary HAE were generated from lung transplant airway tissue as described in Karp et al. (2002) by the Cells and Tissue Core of The Center for Gene Therapy at the University of Iowa. Polarization of cells of the CuFi8 line, a conditionally transformed cell line that was generated from F508/F508 CF airway cells (Zabner et al., 2003), were polarized at an ALI using conditions similar to those used for primary HAE (Yan et al., 2013). Ferret and human airway epithelia were grown on 12 mm Millicell membrane inserts (Millipore) and differentiated with USG medium of 2% Ultroser G supplement (Pall BioSepra, SA, France) at an ALI prior to use. Cell lines and primary monolayer cultures of airway cells were transfected with plasmids using lipofectamine and 1.0 g of plasmid. For rAAV infections of A549 cells, polarized human or ferret airway epithelial cells, vectors were typically left in the culture medium for 24 hours (A549 cells) or 16 hours (polarized cells). For apical infection of the polarized HAE ALI cultures, vectors were diluted in USG medium to a final volume of 50 L and applied to the upper chamber of the Millicell insert. For basolateral infections, vectors were directly added to the culture medium in the bottom chamber. Proteasome inhibitors were supplied in the culture medium throughout the period of infection to polarized cells, at 40 M LLnL (N-Acetyl-L-leucine-L-leucine-L-norleucine) and 5 M doxorubicin in the case of polarized human, and 10 M LLnL and 2 M doxorubicin in the case of CuFl ALI cultures and ferret ALI cultures. Epithelia were exposed to the viruses and chemicals for 16 hours and then removed. At this time, the Millicell inserts were briefly washed with a small amount USG medium and fresh USG medium was added to the bottom chamber only. Doxorubicin was from Sigma (St, Louis, MO) and LLnL was from Boston Biochem (Cambridge, MA).
[0035] rAAV Infection of Ferret Lunas. All animal experimentation was performed according to protocols approved by the Institutional Animal Care and Use Committee of the University of Iowa. In vivo infection of ferret lungs was performed by intra-tracheal injection of a 300 l inoculum containing 210.sup.11 DRP of rAAV2/1 and 250 M doxorubicin. Prior to infection at 5 days of age, ferret kits were anesthetized by inhalation of a mixture of isofluorane and oxygen. At 8-day post-infection, the animals were euthanized with an overdose sodium pentobarbital intraperitoneal injection. For luciferase expression assays, the ferret trachea and lung cassette was immediately frozen in liquid nitrogen and then pulverized using a cryogenic tissue pulverizer. 1 ml of Passive Lysis Buffer (Promega, Madison, WI) was added to the pulverized tissue to extract protein. After four freeze-thaw cycles, the tissue extract was centrifuged at 15,000 rpm for 5 minutes, and the clarified tissue extract was used for luciferase assays with a luciferase assay kit from Promega.
[0036] Measurement of Expression of the Firefly Luciferase Reporter. At the indicated times post-infection or transfection, cells were lysed with luciferase cell lysis buffer and luciferase enzyme activity in cell lysates was determined using the Luciferase Assay System (Promega) in a 20/20 luminometer equipped with an automatic injector (Turner Biosystems, Sunnyvale. CA).
[0037] Measurement of Short-Circuit Currents. Transepithelial short circuit currents (Isc) were measured using an epithelial voltage clamp (Model EC-825) and a self-contained Ussing chamber system (both purchased from Warner Instruments, Inc., Hamden, CT) as described in Liu et al. (2007). Throughout the experiment the chamber was kept at 37 C., and the chamber solution was aerated. The basolateral side of the chamber was filled with buffered Ringer's solution containing 135 mM NaCl, 1.2 mM CaCl.sub.2, 1.2 mM MgCl.sub.2, 2.4 mM KH.sub.2PO.sub.4, 0.2 mM K.sub.2HPO.sub.4, and 5 mM Hepes, pH 7.4. The apical side of the chamber was filled with a low-chloride Ringer's solution in which 135 mM Na-gluconate was substituted for NaCl. Transepithelial voltage was clamped at zero, with current pulses applied every 5 seconds and the short-circuit current recorded using a VCC MC8 multichannel voltage/current clamp (Physiologic Instruments) with Quick DataAcq software. The following chemicals were sequentially added to the apical chamber: (1) amiloride (100 M), to inhibit epithelial sodium conductance by ENaC; (2) 4,4-diisothiocyanato-stilbene-2,2-disulfonic acid (DIDS) (100 M), to inhibit non-CFTR chloride channels; (3) the cAMP agonists forskolin (10 M) and 3-Isobutyl-I-methylxanthine (IBMX) (100 M) to activate CFTR chloride channels; and (4) the CFTR inhibitor GlyH-101 (N-(2-naphthalenyl)-[(3,5-dibromo-2,4-dihydroxyphenyl) methylene] glycine hydrazide) (10 M) to block Cl.sup. secretion through CFTR. Isc was calculated by taking the difference of the plateau measurement average over 45 seconds before and after each change in conditions (chemical stimulus).
[0038] Quantitative Analysis of Vector-Derived CFTR mRNA Following Transduction with rAAV. The total RNA from rAAV-Infected cells was prepared using the RNeasy Mini plus Kit (Qiagen). Since the residual ssDNA rAAV genome in the RNA sample can be an undesirable template for traditional Real Time PCR, a modified RNA-specific method for PCR of the rAAV vector.sup.46 was used to detect the vector-derived ferret CFTR mRNA. In brief, the 1.sup.st-strand cDNA synthesis was primed with an adapter (lower case)-inked, vector-specific primer that targets the synthetic polyadenylation signal sequence (upper cases). The sequence of this primer is 5-gcacgagggcgacugucaUGAUCGAUGCAUCUGAGCUCUUUAUUA-3 (SEQ ID NO:10), in which all dTs are replaced with dU. After RNase H digestion was carried out to eliminate the RNA templates, a ferret CFTR-specific primer (5-TGCAGATGAGGTTGGACTCA-3; SEQ ID NO:11) was used for synthesis of the 2.sup.nd strand. In order to avoid false amplification from cDNA produced from the single-stranded viral DNA, all of the dU components in the 1.sup.st- and 2.sup.nd-strand cDNA products, as well as the excess adapter primers, were degraded by applying uracyl-N-glycosylase (UNG). Thus, a 2.sup.nd-strand cDNA product linked to the complementary sequence of the adapter derived exclusively from rAAV transcripts was produced. The primer set for TaqMan PCR contained the ferret CFTR sequence 5-CAAGTCTCGCTCTCAAATTGC-3 (SEQ ID NO:12), and the adapter sequence 5-GCACGAGGGCGACTGTCA-3 (SEQ ID NO:13). The TaqMan probe used was 5-FAM-ACCTCTTCTTCCGTCTCCTCCTTCA-TAMRA-3 (SEQ ID NO:14).
Results
[0039] Synthetic Oligonucleotide Enhancers that Increase Tg83 Promoter-Driven Transcription in Airway Cells.
[0040] A previous unbiased screen evaluating short synthetic enhancers from a library containing 52,429 unique sequence identified enhancer elements capable of activating transcription from the 128 bp minimal cytomegalovirus (CMV) IE promoter (53 to +75) in HeLa cells (Schlabach et al., 2010). This library comprised all possible 10-mer DNA sequences, printed on microarrays as 10 tandem repeats (for a total length of 100 bases each). The best-performing 100-mer oligonucleotides enhanced the transcription of this 128 bp CMV IE minimal promoter to 75%-137% of that induced by the 600 bp wild type CMV IE promoter (Schlabach et al., 2010). In previous studies, a 83 bp synthetic promoter sequence (tg83) was used to express the full-length CFTR gene from a rAAV vector (AV2.tg83-CFTR), and it was found to produce higher transgene expression in CF HAE cultures than the cryptic promoter of the AAV2 ITR (Zhang et al., 2009). The tg83 promoter consists of an ATF-1/CREB site and an Sp1-binding site from the promoter of the Na,K-ATPase 1 subunit, and the TATA box and transcription start site from the CMV IE promoter. It was hypothesized that combining the tg83 promoter with a synthetic enhancer identified through this library screen would produce transcriptional units of greater efficiency in polarized human and/or ferret airway epithelia in vitro and in vivo. To test this possibility, the top eight enhancer sequences identified by Schlabach et al. (F1, F4, F5, F10, C9, D3, CREB6 and CREB8; Schlabach et al., 2010) were evaluated for their ability to enhance tg83 transcription in human and ferret airway epithelium.
TABLE-US-00001 F1 (SEQIDNO:15) AGTCAGGGCAAGTCAGTGGCAAGTCAGGGCAGTCAGGGCAGTCAGGGCAA GTCAGGGCAAGTCAGGGCAAGTCAGGGCAAGTCAGGGCAAGTCAGGGCA F10 (SEQIDNO:16) gaattgacgcatatattgacgcatattgacgcaaattgacgcaaatgaca gcaagattgacgcaaattgagcgcaaattgacgcaaattaattgacgcat F4 (SEQIDNO:17) CTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAAT CTGAGCAATCTGATGCAATCTGATGCAATATGATGAATGTGATGCAAT F5 (SEQIDNO:18) TGGTGAGCGTCTGGGCATGTCTGGGCATGTCTGGGCATGTCTGGGCATGT CGGGCATTCTGGGCGTCTGGGCATGTCTGGGCATGTCTGGGCA C3 (SEQIDNO:19) GCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAA TCTGAGCAATCTGATGCAATCTGATGCAATATGATGAATGTGATGCAATT D9 (SEQIDNO:20) GCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAA TCTGAGCAATCTGATGCAATCTGATGCAATATGATGAATGTGATGCAATT CREB6 (SEQIDNO:21) ATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGG ATTGACGCGG CREB8 (SEQIDNO:22) ATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGA TTGACGCGGATTGACGCGGATTGACGCG
Enhancer/Promoter Combinations:
[0041]
TABLE-US-00002 tg83 (SEQIDNO:23) ctcgagaacggtgacgtgcacgcgtgggcggagccatcacgcaggttgct atataagcagagctcgtttagtgaaccgtcaga F1tg83 (SEQIDNO:24) AGTCAGGGCAAGTCAGTGGCAAGTCAGGGCAGTCAGGGCAGTCAGGGCAA GTCAGGGCAAGTCAGGGCAAGTCAGGGCAAGTCAGGGCAAGTCAGGGCAc tcgagaacggtgacgtgcacgcgtgggcggagccatcacgcaggttgcta tataagcagagctcgtttagtgaaccgtcaga F10tg83 (SEQIDNO:25) GAATTGACGCATATATTGACGCATATTGACGCAAATTGACGCAAATGACA GCAAGATTGACGCAAATTGAGCGCAAATTGACGCAAATTAATTGACctcg agaacggtgacgtgcacgcgtgggcggagccatcacgcaggttgctatat aagcagagctcgtttagtgaaccgtcaga F4tg83 (SEQIDNO:26) CTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAAT CTGAGCAATCTGATGCAATCTGATGCAATATGATGAATGTGATGCAATct cgagaacggtgacgtgcacgcgtgggcggagccatcacgcaggttgctat ataagcagagctcgtttagtgaaccgtcaga F5tg83 (SEQIDNO:27) GTGGTGAGCGTCTGGGCATGTCTGGGCATGTCTGGGCATGTCTGGGCATG TCGGGCATTCTGGGCGTCTGGGCATGTCTGGGCATGTCTGGGCATctcga gaacggtgacgtgcacgcgtgggcggagccatcacgcaggttgctatata agcagagctcgtttagtgaaccgtcaga C3tg83 (SEQIDNO:28) GCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAA TCTGAGCAATCTGATGCAATCTGATGCAATATGATGAATGTGATGCAATT ctcgagaacggtgacgtgcacgcgtgggcggagccatcacgcaggttgct atataagcagagctcgtttagtgaaccgtcaga D9tg83 (SEQIDNO:29) GCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAA TCTGAGCAATCTGATGCAATCTGATGCAATATGATGAATGTGATGCAATT ctcgagaacggtgacgtgcacgcgtgggcggagccatcacgcaggttgct atataagcagagctcgtttagtgaaccgtcaga CREB6tg83 (SEQIDNO:30) ATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGG ATTGACGCGGctcgagaacggtgacgtgcacgcgtgggcggagccatcac gcaggttgctatataagcagagctcgtttagtgaaccgtcaga
[0042] The tg83 promoter was cloned into the promoter-less luciferase reporter plasmid pGL3-Basic Vector (Promega) to generate pGL3-tg83. Next a series of luciferase reporter expression plasmids were constructed, in which one of the eight 100-mer enhancers was placed in front of the tg83 promoter of pGL3-tg83 (
The F5 Element Most Efficiently Enhances Tg83-Driven Transcription in Polarized Human and Ferret Airway Epithelia In Vitro, as Well as in the Ferret Airway In Vivo.
[0043] Since the F1, F5 and F10 enhancers were the most effective in activating tg83-driven transcription in airway-cell monolayer cultures, the abilities of these elements to promote transcription in the context of rAAV vector genomes was evaluated. Four rAAV proviral vectors harboring a luciferase expression cassette were constructed, with expression driven by tg83 (enhancer-less), F1tg83, F5tg83 or F10tg83. The pAV2-tg83-fCFTR proviral plasmid was used as the template vector for cloning, its promoter and the 5 portion of the fCFTR coding region were replaced with the 2.1 or 2.2 kb luciferase expression cassette. The genome size was 4.75 kb in the case of rAV2.tg83luc, and 4.85 kb for the enhancer-containing vectors. This design was used for two reasons. First, retaining as much of the fCFTR sequence as possible ensured that the vector genome size would be similar to those of the rAAV-CFTR expression vectors that would ultimately be generated. Second, retaining regions of the fCFTR cDNA maximized the potential influences of the ferret CFTR sequence on enhancer function.
[0044] As a first step in investigating whether AAV ITRs and the portion of fCFTR transgene sequence to be tested (i.e., 3 half of the fCFTR cDNA) influence transcription from the tg83 promoter, reporter expression from pGL3-tg83 and pAV2-tg83luc plasmids was compared following transfection into monolayer cultures of A549 and primary ferret airway cells. pAV2-tg83luc plasmid was found to be 2.5-fold (in A549) and 2-fold (in primary ferret airway cells) more transcriptionally active than the pGL3-based plasmids (
[0045] Next expression from the various enhancer elements was evaluated in the context of rAAV2/2 vectors. In A549 cells, similar increases in expressions from the enhancer/tg83 promoter combination were observed following the transfection with the proviral plasmid and infection with the corresponding rAAV vector (
[0046] Lastly, the in vivo activities of the F5tg83 and F10tg83 promoters were compared in the airways of newborn ferrets, using intratracheal injection of two rAAV1 capsid pseudotyped vectors (AV2/1.F5tg83luc and AV2/1.F10tg83luc; equal particle titers injected). This capsid serotype had previously been shown to be effective at transducing the ferret airways in the presence of a proteasome inhibitor (Yan et al., 2013). Luciferase activity was measured in extracts prepared from tracheal and lung tissue at 8-day post-infection, and F5tg83 was found to be more effective than F10tg3 In transducing both ferret lung and trachea (
A Narrow Limit for rAAV Genome Size Significantly Influences Functionality of rAAV-CFTR Vectors while not Altering Packaging Efficiency.
[0047] The size of the expected AV.tg83fCFTR genome if fully packaged is 4.937 kb (
[0048] This question was addressed by constructing a 5.038 kb AV2.tg83-fCFTR(HA) vector in which the CFTR expression cassette was expanded by the addition of a 3HA epitope tag (99 nucleotides) in the region encoding the fourth extracellular loop (ECL4) of ferret CFTR (previous studies had revealed that this insertion has no impact on chloride-channel function (Glozman et al., 2009; Fisher et al., 2012)). This vector allowed us to interrogate how size of the genome influences CFTR functionality in the absence of changes to transcription of the transgene. Two rAAV2 vectors were produced (AV2/2.tg83-fCFTR and AV2/2.tg83-fCFTR-HA;
Effective Packaging of a Functional Ferret CFTR Mini Gene into rAAV
[0049] Next, the possibility of using a shortened ferret CFTR minigene was explored, to further reduce the genome size of a rAAV-CFTR vector, and to allow for incorporation of the F5 enhancer. A human CFTR minigene (CFTRR) with a 158 bp partial deletion of the R-domain (encoding amino acids 708-759) has been reported to retain most of the chloride-channel activity of the full-length protein (Ostedgaard et al., 2002; Ostedgaard et al., 2011). A fCFTRR minigene was created by deleting the 159 bp homologous sequence encoding amino acids 708-760 at the corresponding position of the human protein, and produced two additional vectors: AV2/2.tg83-fCFTRR (4.778 kb) and AV2/2.tg83-fCFTRR(HA) (4.877 kb). This pair of vectors allowed for the examination not only the function of the fCFTR minigene in CF HAE ALI cultures, but also the impact of the HA-tag insertion in the fCFTR gene. Analysis of Isc.sub.IBMX & Forsk and Isc.sub.glyH responses for these two viruses demonstrated that both AV2/2.tg83-fCFTR and AV2/2.tg83-fCFTR(HA) produced substantial CFTR-mediated Cl.sup. currents following infection of the CF HAE ALI cultures (
[0050] To establish the impact of genome length on packaging of the rAAV vectors tested, the integrity of the viral genome was examined, using alkaline-denatured agarose gel electrophoresis followed by Southern blotting (
[0051] The notion that deletion occurs in the context of longer genomes was further supported by the hybridization of viral genomes with two sets of plus and minus strand oligonucleotide probes at the center of CFTR cDNA, the tg83 promoter, and synthetic poly-A sequences (
The synthetic F5tg83 promoter improves rAAV-Mediated CFTR Complementation.
[0052] Next, the pAV2.F5tg83-fCFTRR proviral plasmid was generated and AV2/2.F5tg83-fCFTRR virus with a genome size of 4.87 kb was produced. The efficiency of this virus for complementing function of the CFTR channel following infection of polarized CF HAE was compared to that of the enhancer-less counterpart vector (AV2.tg83-fCFTRR). Results from this analysis demonstrated that incorporation of the F5 enhancer greatly improved the CFTR-mediated Cl.sup. currents (
[0053] Given the apparent saturation of CFTR currents at the highest MOI (510.sup.4 DRP/cell) following basolateral infection with AV2/2.F5tg83fCFTRR, the kinetics of CFTR expression were evaluated at an intermediate MOI (210.sup.4 DRP/cell). Measurements were carried out 3 and 10 days following infection of CF HAE with AV2/2.F5tg83-fCFTRR and AV2/2.tg83-fCFTRR. Results from this analysis demonstrated that, in the context of the F5 enhancer, the onset of CFTR-mediated Cl.sup. currents was more rapid than in its absence (
Discussion
[0054] rAAV vectors have attracted considerable interest with respect to human gene therapy, but its inherently small genome (4.679 kb) is a significant challenge for the delivery of large genes such as CFTR. Although several laboratories have attempted to rationally design short enhancers and promoters for use in rAAV vectors, this approach has yet to yield robust expression of CFTR in the airway. In the present study, an entirely empirical approach was taken by screening synthetic enhancers for their effectiveness in the delivery of reporter gene expression in step-wise fashionin plasmids, proviral vectors, and viral vectors. While the main goal was to develop rAAV vectors for delivering CFTR to the airway, a similar approach may prove useful for gene therapy efforts tackling the delivery of other large genes (e.g., Factor VIII and dystrophin) that necessitate the use of short promoters.
[0055] Production of an oversized rAAV genome is known to lead to random deletions at the 5 end of the encapsidated single stranded genomes (Kapranov et al., 2012), but the functional integrity of rAAV vector genomes that approach the accepted maximum capacity of rAAV (about 5.0 kb) has not been thoroughly investigated. The current study provides, in the context of CFTR-expressing rAAV vectors, evidence that functionality of the rAAV genome begins to decline well below this 5.0 kb cut off. Evidence in support of this includes a reduction in CFTR function for 4.877 kb vs. 4.778 kb genomes (
[0056] The present findings seem inconsistent with previous observations of an only 4-fold change in transgene expression between rAAV vectors that are 4.7 kb and 5.2 kb in size (Wu et al., 2010). However, in this earlier study the stuffer sequence used to expand the vector was positioned between the expression cassette and the ITR, and deletions of the stuffer sequence would likely have less of an impact on the transcriptional activity of the transgene. The current study of the AAV-CFTR vector instead employed a short synthetic promoter and poly-A signal, and small deletions within these short transcriptional regulatory elements would be expected to greatly influence gene expression. Since DNase resistant particle titer is typically used to confirm effective packaging of rAAV genomes, small 5-end deletions could have a significant impact on functionality of oversized rAAV vectors.
[0057] The empirical approach that was used to screen synthetic 100 bp enhancers for the ability to improve rAAV-mediated transgene expression in the airway yielded several important observations: 1) Enhancer activity differed by cell lines and also the state of cell differentiation. 2) Enhancer activity was influenced by the AAV ITRs and might also be influenced by the sequence of gene of interest (in this study, the 3 half of the ferret CFTR cDNA coding region). 3) Enhancer activity in the case of rAAV infection was generally similar to that in the context of proviral vector, though with subtle differences. 4) Infection of human and ferret airways with viral vectors revealed some differences in enhancer function (most notably for AV2/2.F1tg83luc,
[0058] Through this screen, a 100 bp synthetic enhancer (F5) was identified that significantly improves the transcriptional activity of an 83 bp synthetic promoter (tg83), in polarized cultures of both primary human and ferret airway epithelial cells, as well as in ferret lung and trachea in vivo. The ferret CFTR minigene lacking a 53 amino acid portion of the R domain (fCFTRR) retained about 70% of wild type fCFTR function, similar to the 80% function retained by a previously reported, analogous hCFTRR construct (Ostedgaard et al., 2002). Nevertheless, this was greatly compensated by the increased transgene expression from AV2.F5tg83-fCFTRR, as the use of the shortened minigene spares 150 bp space to allow for the incorporation of the F5 enhancer. In the context of a rAAV vector, the F5 enhancer significantly improved tg83-driven CFTR mRNA expression (17.1-fold) at 10 days post-Infection of CF HAE relative to the AV212.tg83-fCFTRR vector, which lacks this enhancer. This increase in CFTR mRNA expression from AV2/2.F5tg83-fCFTRR correlated well with the 19.6-fold improvement in CFTR-mediated currents made possible by this vector, and resulted in production of about 89% of the cAMP-mediated Cl.sup. currents observed in non-CF HAE. Of note, a ceiling on the level of functional correction that can be achieved with respect to the changes in Isc was found. In the time-course studies, maximal correction of Isc in CF HAE was achieved by 3 days post-infection, with the about 10 fold increase in CFTR mRNA by 10 days post-infection yielding no improvement in CF currents (
[0059] In summary, a rAAV-CFTR vector was generated that provides high-level expression suitable for use in lung gene therapy studies in the CF ferret model. Moreover, the present findings suggest that small synthetic enhancers and promoters may be useful tools for optimizing the design of rAAV vectors for the delivery of large transgenes.
Summary
[0060] As discussed herein, small synthetic enhancer/promoter combination, sized about or less than 200 bp, can be used in rAAV vector to deliver effective transgene expression of a large transgene expression: in this study, the gene is CFTR. As also discussed herein, empirical approach to screen a set of 100-mer synthetic enhancer elements for their ability to augment reporter expression from a short 83-bp synthetic promoter (tg83p) in lung airway tissue. Partial sequence of the gene of interest (in the study is CFTR) Is included to the reporter vector to maximize the effect to screen the best enhancer sequence. The screening was conducted in step-wise fashionin plasmids, proviral vectors, and rAAV vectors, and in different cell/tissue levelsin monolayer (non-polarized) cultures of human airway cell lines and primary ferret airway cell, in polarized cultures of human and ferret airway epithelia at an air-liquid interface (ALI) and ferret airway in vivo. The enhancer activity differs by cell lines and state of cell differentiation, as well as is influenced by the AAV ITRs and by the sequence of gene of interest. Thus, the effects of an enhancer in the context of plasmid transfection may be different from that in the context of rAAV transduction. The in vivo effects of a particular enhancer may not be predictable from its behaviors demonstrated in culture cell lines. This, the screening needs to be conducted in different cell/tissue levels and in a step-wise fashionin plasmids, proviral vectors, and rAAV vectors to warrant the success.
[0061] Three of synthetic enhancers (F1, F5, and F10) were found significantly increase the transcription of tg83p for luciferase transgene in the context of plasmid transfection. The F5tg83 promoter, the 183 bp combination of F5 enhancer and tg83p, was the most efficient promoter in human and ferret ALI cultures, leading to 19.6-fold and 57.5-fold increases reporter expression, respectively, over the enhancer-less counterpart. The F5tg83 promoter also produced the highest level of transgene expression in the ferret airway in vivo. When the F5tg83 promoter was used to transcribe the 4.2 kb CFTR minigene (CFTRR) in a rAAV vector, it yielded an about 17-fold increase in vector derived CFTR mRNA transcription and significantly improved Cl.sup. currents in human CF ALI cultures, compared to the vector using tg83p only.
[0062] The enhancer/promoter combinations for lung epithelium (e.g., F5tg83) may not necessarily be as useful for other organs/tissue. For example, when AAV vectors harboring a luciferase reporter gene driven by F5tg83 or F10tg83 were used to infect different tissues/organs of the digestive system, F5tg83 demonstrated the strongest promoter activity in pancreas, gallbladder and liver, whereas F10tg83 outperformed F5tg83 in small intestine (
[0063] Although the studies were focused on identifying strong synthetic enhancer/promoter sequence using for efficiently expressing CFTR in lung/airway tissue, the screen approach can be used for any desired cell types, tissues and organs
In Vitro and In Vivo.
[0064] Thus, the use of short enhancer elements (about 100-mer synthetic oligonucleotide sequences consisting of 10-mer repeats) was found to enhance gene expression from a minimal promoter in rAAV vectors. These 100 bp enhancer elements were previously identified for their ability to activate transcription directed by the CMV immediate-early (IE) minimal promoter in cell lines (Schlabach et al., 2010). It was hypothesized that enhancers that are most potent in activating transcription could be used to enhance activity of the synthetic tg83 promoter in airway cells in the context of rAAV vectors. Eight combinations of the tg83 promoter and 100 bp synthetic enhancers were tested, and one designated as F5 efficiently was found to enhance the transcription from the tg83 promoter in polarized airway cells (in vitro) derived from both humans and ferrets, as well as in the ferret airway (in vivo). Using the F5tg83 promoter and the ferret CFTR minigene of partial deletion at R domain (fCFTRR), a rAAV vector (AV2/2.F5tg83-fCFTRR) was found and its ability to correct CFTR-mediated C1-transport in CF ALI cultures tested.
Example 2
[0065] AV.F5Tg83-hCFTRR was tested for hCFTR expression in the newborn and mature ferret airway. An endpoint of these analyses was the ratio of transgene-derived human CFTR (hCFTR) to that of endogenous ferret CFTR (fCFTR) mRNA. In 3 day old newborn ferrets (
[0066] Given that the phenotype of ferret airway epithelia and the secretions in the airway change as the lungs mature, it was evaluated whether AV.F5Tg83-CFTRR transduces the mature ferret airway and the promoter remains active. To this end, the ability of AV.F5Tg83-CFTRR to transduce the lung of 1 month old ferrets was evaluated. In 1 month old mature ferrets (
REFERENCES
[0067] Aitken et al., Chest, 123:792 (2003). [0068] Aitken et al., Hum Gene Ther., 12:1907 (2001). [0069] Carter, Hum Gene Ther., 16:541 (2005). [0070] Conrad et al., Gene Ther., 3:658 (1996). [0071] Daya & Berns, Clin. Microb. Rev., 21:583 (2008). [0072] Ding et al., Gene Ther., 12:873 (2005). [0073] Ding et al., Mol. Ther., 12:671 (2006). [0074] Dong et al., Hum. Gene Ther., 7:2101 (1996). [0075] Duan et al., Hum. Gene Ther., 2:2761 (1998). [0076] Duan et al., J. Clin. Invest., 105:1573 (2000). [0077] Farmen et al., Am. J. Physiol. Lung Cell Mol. Physiol., 289:1123 (2005). [0078] Fisher et al., J. Biol. Chem., 287:21673 (2012). [0079] Flotte et al., J. Biol. Chem., 268:3781 (1993). [0080] Flotte, Curr. Opin. Mol. Ther., 3: 497 (2001). [0081] Flotte, et al., J. Biol. Chem., 268:3781 (1993). [0082] Gerard et al., Gene Ther., 10:1744 (2003). [0083] Glozman et al., J. Cell Biol., 184:847 (2009). [0084] Griesenbach et al., Virus Adapt. Treat., 2:159, (2010). [0085] Griesenback & Alton, Adv. Drug Deliv. Rev., 61:128 (2009). [0086] Kapranov et al., Hum. Gene Ther., 23:46 (2012). [0087] Karp et al., Methods Mol. Biol., 188:115 (2002). [0088] Li et al., Mol. Ther., 17:2067 (2009). [0089] Liu et al., Am. J. Respir. Cell Mol. Biol., 36:313 (2007). [0090] Liu et al., Gene Ther., 14:1543 (2007). [0091] Liu et al., Mol. Ther., 15:2114 (2007). [0092] Moss et al., Hum. Gene Ther., 18:726 (2007). [0093] Mueller & Flotte, Clin. Rev. Allergy Immunol., 35:164 (2008). [0094] Olivier et al., J. Clin. Invest., 122:3755 (2012). [0095] Ostedgaard et al., Proc. Natl. Acad. Sci. USA, 102:2952 (2005). [0096] Ostedgaard et al., Proc. Natl. Acad. Sci. USA, 108:2921 (2011). [0097] Ostedgaard et al., Proc. Natl. Acad. Sci. USA, 99:3093 (2002). [0098] O'Sullivan & Freedman, Lancet, 373:1891 (2009). [0099] Riordan et al., Science, 245:1068 (1989). [0100] Rommens et al., Science, 245:1059 (1989). [0101] Rowe et al., N. Engl. J. Med., 352:1992 (2005). [0102] Schlabach et al., Proc. Natl. Acad. Sci. USA, 107:2538 (2010). [0103] Summer-Jones et al., Gene Therapy for Cystic Fibrosis Lung Disease, Birkhauser Basel, Basel (2010). [0104] Sun et al., Am. J. Pathol., 184:1309 (2014). [0105] Sun et al., Am. J. Respir. Cell Mol. Biol., 50:502 (2014). [0106] Sun et al., J. Clin. Invest., 118:1578 (2008). [0107] Sun et al., J. Clin. Invest., 120:3149 (2010). [0108] Wagner et al., Hum. Gene Ther., 13:1349 (2002). [0109] Welsch, FASEB. J., 4:2718 (1990). [0110] Welsh et al., In The Metabolic and Molecular Bases of Inherited Disease, eds. McGraw-Hill, New York, p. 3799 (1995). [0111] Wu et al., Mol. Ther., 14:316 (2006). [0112] Wu et al., Mol. Ther., 18:80 (2010). [0113] Yan et al., Hum. Gene Ther., 24:786 (2013). [0114] Yan et al., Hum. Gene Ther., 26:334 (2015). [0115] Yan et al., J. Virol., 76:2043 (2002). [0116] Yan et al., J. Virol., 78:2863 (2004). [0117] Yan et al., Mol. Ther., 21:2181 (2013). [0118] Zabner et al., Am J. Physiol. Lung Cell Mol. Physiol., 284:844 (2003). [0119] Zhang et al., Mol. Ther., 10:990 (2004). [0120] Zhang et al., Proc. Natl. Acad. Sci. USA, 95:10158 (1998).
[0121] All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification, this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details herein may be varied considerably without departing from the basic principles of the invention.