Methods of Storing Information Using Nucleic Acids

20240070422 ยท 2024-02-29

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to methods of synthesizing de novo a polynucleotide storing data using a programmable template independent polymerase.

    Claims

    1. A method of synthesizing de novo a polynucleotide comprising synthesizing de novo a known polynucleotide using a programmable template independent polymerase to incorporate particular dNTPs to form the known polynucleotide.

    2. The method of claim 1 wherein the known polynucleotide is a naturally occurring polynucleotide.

    3. The method of claim 1 wherein the known polynucleotide is a synthetic polynucleotide.

    4. The method of claim 1 wherein the step of synthesizing comprises using a cyclic pattern of dNTP solutions and the template independent polymerase to incorporate the dNTPs.

    5. The method of claim 1 wherein the template independent polymerase is terminal deoxynucleotidyl transferase or poly(A) polymerase.

    6. The method of claim 1 wherein the polymerase function of the template independent polymerase is programmable by light.

    7. The method of claim 1 wherein the base-specificity of the template independent polymerase is programmable by light.

    8. The method of claim 1 wherein the known polynucleotide is synthesized on a support.

    9. The method of claim 8 wherein the support is a solid or semi-solid support.

    10. The method of claim 8 wherein the support comprises spatially defined sites.

    11. The method of claim 8 wherein the support comprises spatially defined addressable sites.

    12. The method of claim 8 wherein the support is a member selected from the group consisting of a slide, bead, chip, particle, strand, gel, sheet, tubing, sphere, container, capillary, pad, slice, film, and plate.

    13. The method of claim 8 wherein the support is a substantially planar support comprising tranches, grooves, wells or chemical barriers.

    14. The method of claim 8 wherein the known polynucleotide is covalently attached to the support.

    15. The method of claim 8 wherein the known polynucleotide is attached to the support with a cleavable linker.

    16. The method of claim 8 wherein the known polynucleotide is synthesized on the support using ink jet techniques.

    17. The method of claim 8 wherein the known polynucleotide is synthesized on the support using electrochemical techniques.

    18. The method of claim 8 wherein the known polynucleotide is synthesized on the support using microfluidic techniques.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0019] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. The foregoing and other features and advantages of the present invention will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawing in which:

    [0020] FIG. 1A is a schematic of DNA information storage. A 12-byte portion of a sentence within the encoded html book is converted to bits (blue) with a 19-bit barcode (red) that determines the location of the encoded bits within the overall book. The bit sequence is then encoded to DNA using a 1 bit per base encoding (ac=0; TG=1), while also avoiding 4 or more nucleotide repeats and balancing GC content. The entire 5.27 megabit html book used 54,898 oligonucleotides and was synthesized and eluted from a DNA microchip. After amplification (common primer sequences to all oligonucleotides are not shown), the oligonucleotide library was sequenced using next-generation sequencing. Individual reads with the correct barcode and length were screened for consensus, and then reconverted to bits obtaining the original book. In total, the writing, amplification, and reading resulted in 10 bit errors out of 5.27 megabits.

    [0021] FIG. 1B is a graphical comparison to other technologies. We plotted information density (log.sub.10 of bits/mm.sup.3) versus current scalability as measured by the logio of bits encoded in the report or commercial unit See 4. Information on materials and methods is available on Science Online.

    [0022] FIG. 2 is a histogram of the number of observations for each member of the designed library

    DETAILED DESCRIPTION

    [0023] The present invention is directed to methods of storing information using oligomers. Such oligomers can be formed from monomers. Exemplary monomers include nucleotides. Exemplary oligomers include oligonucleotides. According to one aspect, a method of encoding information is provided where a sequence of bits are converted to a sequence of nucleotides, where the sequence of nucleotides is an oligonucleotide. According to one aspect, commercially available methods of nucleic acid synthesis are used. According to one aspect, commercially available methods of nucleic acid amplification are used. According to one aspect, commercially available methods of nucleic acid sequencing are used.

    [0024] According to one aspect, a portion or portions of a format of information, such as an html format of information, such as an html book with text and/or images, is converted to bits, i.e. zeros and ones, and a bit barcode is added to form a bit sequence, i.e. a series of zeros and ones as commonly understood. Other formats of information that can be converted to bits are known to those of skill in the art. According to one aspect, the portion of an html format of information to be converted into bits may be referred to as a byte portion. The bit barcode can determine the location of the encoded bits within the overall html format of information. The bit sequence is then converted (encoded) to a sequence of nucleotides, i.e., an oligonucleotide or DNA using a 1 bit per base encoding (ac=0; TG=1) to form a corresponding encoded oligonucleotide sequence, i.e. the oligonucleotide sequence corresponds to or encodes for the bit sequence. According to one aspect, 4 or more nucleotide repeats are avoided and GC content is balanced. A plurality of bit sequences are created corresponding to a portion of or the entire html format of information. Accordingly, a plurality of corresponding encoded oligonucleotide sequences are created which together may be referred to as a library. The library of encoded oligonucleotide sequences represents the html format of information. The encoded oligonucleotide sequences are then synthesized using methods known to those of skill in the art, such as using a DNA microchip. The synthesized oligonucleotides are then amplified using methods known to those of skill in the art to form a library of oligonucleotides. The library of oligonucleotides is then sequenced using methods known to those of skill in the art, such as next-generation sequencing methods. The sequenced oligonucleotides are then converted into bit sequences corresponding to the html format of information. The bit sequences can be converted to the format of information using methods known to those of skill in the art. The format of information can be visualized or displayed using methods and devices known to those of skill in the art.

    [0025] Terms and symbols of nucleic acid chemistry, biochemistry, genetics, and molecular biology used herein follow those of standard treatises and texts in the field, e.g., Komberg and Baker, DNA Replication, Second Edition (W. H. Freeman, New York, 1992); Lehninger, Biochemistry, Second Edition (Worth Publishers, New York, 1975); Strachan and Read, Human Molecular Genetics, Second Edition (Wiley-Liss, New York, 1999); Eckstein, editor, Oligonucleotides and Analogs: A Practical Approach (Oxford University Press, New York, 1991); Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); and the like.

    [0026] As used herein, the term bit is to be understood according to its common meaning to one of skill in the art. The term bit may be a contraction of binary digit and may refer to a basic capacity of information in computing and telecommunications. A bit represents either 1 or 0 (one or zero) only. The representation may be implemented, in a variety of systems, by means of a two state device.

    [0027] As used herein, the terms nucleic acid molecule, nucleic acid sequence, nucleic acid fragment and oligomer are used interchangeably and are intended to include, but are not limited to, a polymeric form of nucleotides that may have various lengths, including either deoxyribonucleotides or ribonucleotides, or analogs thereof. Oligomers for use in the present invention can be fully designed, partially designed (i.e., partially randomized) or fully randomized. In certain aspects of the invention, a pool of nucleic acids contains single-stranded 90-mers of DNA.

    [0028] In general, amplifying includes the production of copies of a nucleic acid molecule via repeated rounds of primed enzymatic synthesis. In situ amplification indicated that the amplification takes place with the template nucleic acid molecule positioned on a support or a bead, rather than in solution. In situ amplification methods are described in U.S. Pat. No. 6,432,360.

    [0029] Varied choices of polymerases exist with different properties, such as temperature, strand displacement, and proof-reading. Amplification can be isothermal, as described above and in similar adaptation such as multiple displacement amplification (MDA) described by Dean et al., Comprehensive human genome amplification using multiple displacement amplification, Proc. Natl. Acad. Sci. U.S.A., vol. 99, p. 5261-5266. 2002; also Dean et al., Rapid amplification of plasmid and phage DNA using phi29 DNA polymerase and multiply-primed rolling circle amplification, Genome Res., vol. 11, p. 1095-1099. 2001; also Aviel-Ronen et al., Large fragment Bst DNA polymerase for whole genome amplification of DNA formalin-fixed paraffin-embedded tissues, BMC Genomics, vol. 7, p. 312. 2006. Amplification can also cycle through different temperature regiments, such as the traditional polymerase chain reaction (PCR) popularized by Mullis et al., Specific enzymatic amplification of DNA in vitro: The polymerase chain reaction. Cold Spring Harbor Symp. Quant. Biol., vole 51, p. 263-273. 1986. Variations more applicable to genome amplification are described by Zhang et al., Whole genome amplification from a single cell: implications for genetic analysis, Proc. Natl. Acad. Sci. U.S.A., vol. 89, p. 5847-5851. 1992; and Telenius et al., Degenerate oligonucleotide-primed PCR: general amplification of target DNA by a single degenerate primer, Genomics, vol. 13, p. 718-725. 1992. Other methods include Polony PCR described by Mitra and Church, In situ localized amplification and contact replication of many individual DNA molecules, Nuc. Acid. Res., vole 27, pages e34. 1999; emulsion PCR (ePCR) described by Shendure et al., Accurate multiplex polony sequencing of an evolved bacterial genome, Science, vol. 309, p. 1728-32. 2005; and Williams et al., Amplification of complex gene libraries by emulsion PCR, Nat. Methods, vol. 3, p. 545-550. 2006. Any amplification method can be combined with a reverse transcription step, a priori, to allow amplification of RNA. According to certain aspects, amplification is not absolutely required since probes, reporters and detection systems with sufficient sensitivity can be used to allow detection of a single molecule using template non-hybridizing nucleic acid structures described. Ways to adapt sensitivity in a system include choices of excitation sources (e.g. illumination) and detection (e.g. photodetector, photomultipliers). Ways to adapt signal level include probes allowing stacking of reporters, and high intensity reporters (e.g. quantum dots) can also be used.

    [0030] Amplification methods useful in the present disclosure may comprise contacting a nucleic acid with one or more primers that specifically hybridize to the nucleic acid under conditions that facilitate hybridization and chain extension. Exemplary methods for amplifying nucleic acids include the polymerase chain reaction (PCR) (see, e.g., Mullis et al. (1986) Cold Spring Harb. Symp. Quant. Biol. 51 Pt 1:263 and Cleary et al. (2004) Nature Methods 1:241; and U.S. Pat. Nos. 4,683,195 and 4,683,202), anchor PCR, RACE PCR, ligation chain reaction (LCR) (see, e.g., Landegran et al. (1988) Science 241:1077-1080; and Nakazawa et al. (1994) Proc. Natl. Acad. Sci. U.S.A. 91:360-364), self sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. U.S.A. 87:1874), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. U.S.A. 86:1173), Q-Beta Replicase (Lizardi et al. (1988) BioTechnology 6:1197), recursive PCR (Jaffe et al. (2000) J. Biol. Chem. 275:2619; and Williams et al. (2002) J. Biol. Chem. 277:7790), the amplification methods described in U.S. Pat. Nos. 6,391,544, 6,365,375, 6,294,323, 6,261,797, 6,124,090 and 5,612,199, or any other nucleic acid amplification method using techniques well known to those of skill in the art. In exemplary embodiments, the methods disclosed herein utilize PCR amplification.

    [0031] In certain exemplary embodiments, methods for amplifying nucleic acid sequences are provided. Exemplary methods for amplifying nucleic acids include the polymerase chain reaction (PCR) (see, e.g., Mullis et al. (1986) Cold Spring Harb. Symp. Quant. Biol. 51 Pt 1:263 and Cleary et al. (2004) Nature Methods 1:241; and U.S. Pat. Nos. 4,683,195 and 4,683,202), anchor PCR, RACE PCR, ligation chain reaction (LCR) (see, e.g., Landegran et al. (1988) Science 241:1077-1080; and Nakazawa et al. (1994) Proc. Natl. Acad. Sci. U.S.A. 91:360-364), self sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. U.S.A. 87:1874), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. U.S.A. 86:1173), Q-Beta Replicase (Lizardi et al. (1988) BioTechnology 6:1197), recursive PCR (Jaffe et al. (2000) J. Biol. Chem. 275:2619; and Williams et al. (2002) J. Biol. Chem. 277:7790), the amplification methods described in U.S. Pat. Nos. 6,391,544, 6,365,375, 6,294,323, 6,261,797, 6,124,090 and 5,612,199, isothermal amplification (e.g., rolling circle amplification (RCA), hyperbranched rolling circle amplification (HRCA), strand displacement amplification (SDA), helicase-dependent amplification (HDA), PWGA) or any other nucleic acid amplification method using techniques well known to those of skill in the art.

    [0032] Polymerase chain reaction, or PCR, refers to a reaction for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary strands of DNA. In other words, PCR is a reaction for making multiple copies or replicates of a target nucleic acid flanked by primer binding sites, such reaction comprising one or more repetitions of the following steps: (i) denaturing the target nucleic acid, (ii) annealing primers to the primer binding sites, and (iii) extending the primers by a nucleic acid polymerase in the presence of nucleoside triphosphates. Usually, the reaction is cycled through different temperatures optimized for each step in a thermal cycler instrument. Particular temperatures, durations at each step, and rates of change between steps depend on many factors well-known to those of ordinary skill in the art, e.g., exemplified by the references: McPherson et al., editors, PCR: A Practical Approach and PCR2: A Practical Approach (IRL Press, Oxford, 1991 and 1995, respectively). For example, in a conventional PCR using Taq DNA polymerase, a double stranded target nucleic acid may be denatured at a temperature greater than 90 C., primers annealed at a temperature in the range 50-75 C., and primers extended at a temperature in the range 68-78 C.

    [0033] The term PCR encompasses derivative forms of the reaction, including but not limited to, RT-PCR, real-time PCR, nested PCR, quantitative PCR, multiplexed PCR, assembly PCR and the like. Reaction volumes range from a few hundred nanoliters, e.g., 200 nL, to a few hundred microliters, e.g., 200 L. Reverse transcription PCR, or RT-PCR, means a PCR that is preceded by a reverse transcription reaction that converts a target RNA to a complementary single stranded DNA, which is then amplified, e.g., Tecott et al., U.S. Pat. No. 5,168,038. Real-time PCR means a PCR for which the amount of reaction product, i.e., amplicon, is monitored as the reaction proceeds. There are many forms of real-time PCR that differ mainly in the detection chemistries used for monitoring the reaction product, e.g., Gelfand et al., U.S. Pat. No. 5,210,015 (Taqman); Wittwer et al., U.S. Pat. Nos. 6,174,670 and 6,569,627 (intercalating dyes); Tyagi et al., U.S. Pat. No. 5,925,517 (molecular beacons). Detection chemistries for real-time PCR are reviewed in Mackay et al., Nucleic Acids Research, 30:1292-1305 (2002). Nested PCR means a two-stage PCR wherein the amplicon of a first PCR becomes the sample for a second PCR using a new set of primers, at least one of which binds to an interior location of the first amplicon. As used herein, initial primers in reference to a nested amplification reaction mean the primers used to generate a first amplicon, and secondary primers mean the one or more primers used to generate a second, or nested, amplicon. Multiplexed PCR means a PCR wherein multiple target sequences (or a single target sequence and one or more reference sequences) are simultaneously carried out in the same reaction mixture, e.g. Bernard et al. (1999) Anal. Biochem., 273:221-228 (two-color real-time PCR). Usually, distinct sets of primers are employed for each sequence being amplified. Quantitative PCR means a PCR designed to measure the abundance of one or more specific target sequences in a sample or specimen. Techniques for quantitative PCR are well-known to those of ordinary skill in the art, as exemplified in the following references: Freeman et al., Biotechniques, 26:112-126 (1999); Becker-Andre et al., Nucleic Acids Research, 17:9437-9447 (1989); Zimmerman et al., Biotechniques, 21:268-279 (1996); Diviacco et al., Gene, 122:3013-3020 (1992); Becker-Andre et al., Nucleic Acids Research, 17:9437-9446 (1989); and the like.

    [0034] Sequencing methods useful in the present disclosure include Shendure et al., Accurate multiplex polony sequencing of an evolved bacterial genome, Science, vol. 309, p. 1728-32. 2005; Drmanac et al., Human genome sequencing using unchained base reads on self-assembling DNA nanoarrays, Science, vol. 327, p. 78-81. 2009; McKernan et al., Sequence and structural variation in a human genome uncovered by short-read, massively parallel ligation sequencing using two-base encoding, Genome Res., vol. 19, p. 1527-41. 2009; Rodrigue et al., Unlocking short read sequencing for metagenomics, PLoS One, vol. 28, e11840. 2010; Rothberg et al., An integrated semiconductor device enabling non-optical genome sequencing, Nature, vol. 475, p. 348-352. 2011; Margulies et al., Genome sequencing in microfabricated high-density picolitre reactors, Nature, vol. 437, p. 376-380. 2005; Rasko et al. Origins of the E. coli strain causing an outbreak of hemolytic-uremic syndrome in Germany, N. Engl. J. Med., Epub. 2011; Hutter et al., Labeled nucleoside triphosphates with reversibly terminating aminoalkoxyl groups, Nucleos. Nucleot. Nucl., vol. 92, p. 879-895. 2010; Seo et al., Four-color DNA sequencing by synthesis on a chip using photocleavable fluorescent nucleotides, Proc. Natl. Acad. Sci. USA., Vol. 102, P. 5926-5931 (2005); Olejnik et al.; Photocleavable biotin derivatives: a versatile approach for the isolation of biomolecules, Proc. Natl. Acad. Sci. U.S.A., vol. 92, p. 7590-7594. 1995; U.S. Pat. No. 5,750,34; US 2009/0062129 and US 2009/0191553.

    [0035] In general, the terms nucleic acid molecule, nucleic acid sequence, nucleic acid fragment, oligonucleotide and polynucleotide are used interchangeably and are intended to include, but not limited to, a polymeric form of nucleotides that may have various lengths, either deoxyribonucleotides (DNA) or ribonucleotides (RNA), or analogs thereof. A oligonucleotide is typically composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); and thymine (T) (uracil (U) for thymine (T) when the polynucleotide is RNA). Thus, the term oligonucleotide sequence is the alphabetical representation of a polynucleotide molecule; alternatively, the term may be applied to the polynucleotide molecule itself. This alphabetical representation can be input into databases in a computer having a central processing unit and used for bioinformatics applications such as functional genomics and homology searching. Oligonucleotides may optionally include one or more non-standard nucleotide(s), nucleotide analog(s) and/or modified nucleotides.

    [0036] Embodiments of the present disclosure include naturally occurring or synthetic oligomers known to those of skill in the art. Such oligomers include oligonucleotides or polynucleotides (such as DNA or RNA), polypeptides (like collagen and vancomycin), polyketides (like fats and tetracycline), polysaccharides (like cellulose and starch), polyterpenes (like cholesterol and rubber), polyamino-acids (like lignin and polyalkaloids), polypyrroles (like heme and vitamin B12), and polyesters (like PHA, PHV). Oligomers include those having bio-inspired classes of bonds. See table 1 of US2008/0096253. Additional oligomers include non-biological polymers, such as linear polymers including polysiloxanes, polyacrylamides, and the like. Such oligomers may have sufficient thermal stability or ease of detection in nanopores or other polymer sequencing devices.

    [0037] Examples of modified nucleotides include, but are not limited to diaminopurine, S.sup.2T, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylc yto sine, 5-(c arbo xyhydroxylmethyl)uracil, 5-c arboxymethylaminomethyl-2-thiouridine, 5-c arboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5-methoxyc arboxymethyluracil, 5-methoxyuracil, 2-methylthio-D46-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, 2,6-diaminopurine and the like. Nucleic acid molecules may also be modified at the base moiety (e.g., at one or more atoms that typically are available to form a hydrogen bond with a complementary nucleotide and/or at one or more atoms that are not typically capable of forming a hydrogen bond with a complementary nucleotide), sugar moiety or phosphate backbone. Nucleic acid molecules may also contain amine-modified groups, such as aminoallyl-dUTP (aa-dUTP) and aminohexhylacrylamide-dCTP (aha-dCTP) to allow covalent attachment of amine reactive moieties, such as N-hydroxy succinimide esters (NHS).

    [0038] Alternatives to standard DNA base pairs or RNA base pairs in the oligonucleotides of the present disclosure can provide higher density in bits per cubic mm, higher safety (resistant to accidental or purposeful synthesis of natural toxins), easier discrimination in photo-programmed polymerases, or lower secondary structure. Such alternative base pairs compatible with natural and mutant polymerases for de novo and/or amplification synthesis are described in Betz K, Malyshev D A, Lavergne T, Welte W, Diederichs K, Dwyer T J, Ordoukhanian P, Romesberg F E, Marx A (2012) KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry, Nature Chem. Biol. 8:612-614; Seo Y J, Malyshev D A, Lavergne T, Ordoukhanian P, Romesberg F E. J Am Chem Soc. 2011 Dec. 14;133(49):19878-88, Site-specific labeling of DNA and RNA using an efficiently replicated and transcribed class of unnatural base pairs; Switzer CY, Moroney SE, Benner SA. (1993) Biochemistry. 32(39):10489-96. Enzymatic recognition of the base pair between isocytidine and isoguanosine; Yamashige R, Kimoto M, Takezawa Y, Sato A, Mitsui T, Yokoyama S, Hirao I. Nucleic Acids Res. 2012 Mar.;40(6):2793-806. Highly specific unnatural base pair systems as a third base pair for PCR amplification; and Yang Z, Chen F, Alvarado JB, Benner SA. J Am Chem Soc. 2011 Sep. 28;133(38):15105-12, Amplification, mutation, and sequencing of a six-letter synthetic genetic system.

    [0039] The 6 pairs below (A-T, G-C, Z-P, Ds-Px, NAM-SSICS, isoC-isoG) have been shown to be compatible with polymerases and orthogonal to each other (i.e. low levels of cross-pairing).

    ##STR00001##

    [0040] In certain exemplary embodiments, oligonucleotide sequences may be prepared using one or more of the phosphoramidite linkers and/or sequencing by ligation methods known to those of skill in the art. Oligonucleotide sequences may also be prepared by any suitable method, e.g., standard phosphoramidite methods such as those described herein below as well as those described by Beaucage and Carruthers ((1981) Tetrahedron Lett. 22: 1859) or the triester method according to Matteucci et al. (1981) J. Am. Chem. Soc. 103:3185), or by other chemical methods using either a commercial automated oligonucleotide synthesizer or high-throughput, high-density array methods known in the art (see U.S. Pat. Nos. 5,602,244, 5,574,146, 5,554,744, 5,428,148, 5,264,566, 5,141,813, 5,959,463, 4,861,571 and 4,659,774, incorporated herein by reference in its entirety for all purposes). Pre-synthesized oligonucleotides may also be obtained commercially from a variety of vendors.

    [0041] In certain exemplary embodiments, oligonucleotide sequences may be prepared using a variety of microarray technologies known in the art. Pre-synthesized oligonucleotide and/or polynucleotide sequences may be attached to a support or synthesized in situ using light-directed methods, flow channel and spotting methods, inkjet methods, pin-based methods and bead-based methods set forth in the following references: McGall et al. (1996) Proc. Natl. Acad. Sci. U.S.A. 93:13555; Synthetic DNA Arrays In Genetic Engineering, Vol. 20:111, Plenum Press (1998); Duggan et al. (1999) Nat. Genet. S21:10; Microarrays: Making Them and Using Them In Microarray Bioinformatics, Cambridge University Press, 2003; U.S. Patent Application Publication Nos. 2003/0068633 and 2002/0081582; U.S. Pat. Nos. 6,833,450, 6,830,890, 6,824,866, 6,800,439, 6,375,903 and 5,700,637; and PCT Application Nos. WO 04/031399, WO 04/031351, WO 04/029586, WO 03/100012, WO 03/066212, WO 03/065038, WO 03/064699, WO 03/064027, WO 03/064026, WO 03/046223, WO 03/040410 and WO 02/24597.

    [0042] In certain exemplary embodiments, one or more oligonucleotide sequences described herein are immobilized on a support (e.g., a solid and/or semi-solid support). In certain aspects, an oligonucleotide sequence can be attached to a support using one or more of the phosphoramidite linkers described herein. Suitable supports include, but are not limited to, slides, beads, chips, particles, strands, gels, sheets, tubing, spheres, containers, capillaries, pads, slices, films, plates and the like. In various embodiments, a solid support may be biological, nonbiological, organic, inorganic, or any combination thereof. When using a support that is substantially planar, the support may be physically separated into regions, for example, with trenches, grooves, wells, or chemical barriers (e.g., hydrophobic coatings, etc.). In certain exemplary embodiments, a support is a microarray. As used herein, the term microarray refers in one embodiment to a type of assay that comprises a solid phase support having a substantially planar surface on which there is an array of spatially defined non-overlapping regions or sites that each contain an immobilized hybridization probe. Substantially planar means that features or objects of interest, such as probe sites, on a surface may occupy a volume that extends above or below a surface and whose dimensions are small relative to the dimensions of the surface. For example, beads disposed on the face of a fiber optic bundle create a substantially planar surface of probe sites, or oligonucleotides disposed or synthesized on a porous planar substrate creates a substantially planar surface. Spatially defined sites may additionally be addressable in that its location and the identity of the immobilized probe at that location are known or determinable.

    [0043] Oligonucleotides immobilized on microarrays include nucleic acids that are generated in or from an assay reaction. Typically, the oligonucleotides or polynucleotides on microarrays are single stranded and are covalently attached to the solid phase support, usually by a 5-end or a 3-end. In certain exemplary embodiments, probes are immobilized via one or more of the cleavable linkers described herein. The density of non-overlapping regions containing nucleic acids in a microarray is typically greater than 100 per cm.sup.2, and more typically, greater than 1000 per cm.sup.2. Microarray technology relating to nucleic acid probes is reviewed in the following exemplary references: Schena, Editor, Microarrays: A Practical Approach (IRL Press, Oxford, 2000); Southern, Current Opin. Chem. Biol., 2: 404-410 (1998); Nature Genetics Supplement, 21:1-60 (1999); and Fodor et al, U.S. Pat. Nos. 5,424,186; 5,445,934; and 5,744,305.

    [0044] Methods of immobilizing oligonucleotides to a support are known in the art (beads: Dressman et al. (2003) Proc. Natl. Acad. Sci. USA 100:8817, Brenner et al. (2000) Nat. Biotech. 18:630, Albretsen et al. (1990) Anal. Biochem. 189:40, and Lang et al. Nucleic Acids Res. (1988) 16:10861; nitrocellulose: Ranki et al. (1983) Gene 21:77; cellulose: Goldkorn (1986) Nucleic Acids Res. 14:9171; polystyrene: Ruth et al. (1987) Conference of Therapeutic and Diagnostic Applications of Synthetic Nucleic Acids, Cambridge U.K.; teflon-acrylamide: Duncan et al. (1988) Anal. Biochem. 169:104; polypropylene: Polsky-Cynkin et al. (1985) Clin. Chem. 31:1438; nylon: Van Ness et al. (1991) Nucleic Acids Res. 19:3345; agarose: Polsky-Cynkin et al., Clin. Chem. (1985) 31:1438; and sephacryl: Langdale et al. (1985) Gene 36:201; latex: Wolf et al. (1987) Nucleic Acids Res. 15:2911).

    [0045] As used herein, the term attach refers to both covalent interactions and noncovalent interactions. A covalent interaction is a chemical linkage between two atoms or radicals formed by the sharing of a pair of electrons (i.e., a single bond), two pairs of electrons (i.e., a double bond) or three pairs of electrons (i.e., a triple bond). Covalent interactions are also known in the art as electron pair interactions or electron pair bonds. Noncovalent interactions include, but are not limited to, van der Waals interactions, hydrogen bonds, weak chemical bonds (i.e., via short-range noncovalent forces), hydrophobic interactions, ionic bonds and the like. A review of noncovalent interactions can be found in Alberts et al., in Molecular Biology of the Cell, 3d edition, Garland Publishing, 1994.

    [0046] Sequencing primers according to the present disclosure are those that are capable of binding to a known binding region of the target polynucleotide and facilitating ligation of an oligonucleotide probe of the present disclosure. Sequencing primers may be designed with the aid of a computer program such as, for example, DNAWorks, or Gene2Oligo. The binding region can vary in length but it should be long enough to hybridize the sequencing primer. Target polynucleotides may have multiple different binding regions thereby allowing different sections of the target polynucleotide to be sequenced. Sequencing primers are selected to form highly stable duplexes so that they remain hybridized during successive cycles of ligation. Sequencing primers can be selected such that ligation can proceed in either the 5 to 3 direction or the 3 to 5 direction or both. Sequencing primers may contain modified nucleotides or bonds to enhance their hybridization efficiency, or improve their stability, or prevent extension from a one terminus or the other.

    [0047] According to one aspect, single stranded DNA templates (ssDNA) are prepared by RCA as described above to be used with sequencing primers. Alternatively single stranded template is attached to beads or nanoparticles in an emulsion and amplified through ePCR. The result is clonal beads with a single amplified ssDNA template.

    [0048] For the purpose of identifying several template nucleotide sequences in parallel, the templates are diluted in PBS buffer pH 7.4, and either bound to a patterned or non-patterned substrate utilizing various attachment methods, such as Biotin-Strepavidin, azide-alkyle (e.g. click chemistry), NHS-ester or Silanization (e.g. aldehyde-, epoxy-, amino-silane). According to one aspect, rolonies are attached to a patterned surface, such as a SiO.sub.2 solid surface, treated with 1% aminosilane (v/v) and let to interact for a period of time (typically between 5 minutes to 2 hours). Any unbound templates are then washed away using Wash 1 buffer.

    [0049] Next, a sequencing primer is prepared and hybridized to the sequencing primer hybridizing site. According to certain aspects, sequencing primers can be prepared which can hybridize to a known sequence of the template. Alternatively, during template preparation, adapters with a known nucleic acid sequence are added to the unknown nucleic acid sequence by way of ligation, amplification, transposition or recombination according to methods known to those of skill in the art and described herein. Still alternatively, sequencing primers having a certain level of degeneracy could be used to hybridize to certain positions along the template. According to one aspect, primer degeneracy is used to allow primers to hybridize semi-randomly along the template. Primer degeneracy is selected based on statistical methods known to those of skill in the art to facilitate primers hybridizing at certain intervals along the length of the template. According to this aspect, primers can be designed having a certain degeneracy which facilitates binding every N bases, such as every 100 bases, every 200 bases, every 2000 bases, every 100,000 bases. The binding of the primers along the length of the template is based on the design of the primers and the statistical likelihood that a primer design will bind about every N bases along the length of the template. Since the sequencing primer P1 will be extended by ligation, the terminal group of the sequencing primer is typically synthesized to be ready to be covalently joined to the oligonucleotide probe by the DNA ligase. If the ligation occurs between the 5end of the sequencing primer and the 3end of the oligonucleotide probe, a phosphate group (5-PO.sub.4) must be present on the sequencing primer while a hydroxyl group (3-OH) on the oligonucleotide probe, and vice-versa. To hybridize the sequencing primer to the sequencing primer hybridizing site, 1 uM of the sequencing primer diluted in 5X SSPE buffer is used. The mixture is then incubated for a few minutes above room temperature to encourage proper annealing (typically between 1 to 5 minutes, at temperature between 25 and 55 C.).

    [0050] According to certain aspects, oligonucleotide sequences may be prepared using ink jet techniques known to those of skill in the art, electrochemical techniques known to those of skill in the art, microfluidic techniques known to those of skill in the art, photogenerated acids known to those of skill in the art, or photodeprotected monomers known to those of skill in the art. Such techniques have the advantage of making oligonucleotides at high speed, low cost, fewer toxic chemicals, enhanced portability and ability to interleave DNA biochemistry (e.g. modifications, polymerases, hybridization etc.) with de novo (digital or analog) synthesis. For example, spatially patterned light, either directly from camera optics or from Digital Micromirror Display devices (DMD), can be used with aqueous chemistry. See US2003/0228611. For example, a template-independent polymerase like Terminal deoxynucleotidyl Transferase (TdT) or poly(A) polymerasealternatively, a template-dependent polymerase like Taq or Phi29 derivatives, can have their basic polymerase function, base-specificity or fidelity programmable by light by incorporating an azobenzene amino acid (see Hoppmann C, Schmieder P, Heinrich N, Beyermann M. (2011) Chembiochem.12(17):2555-9. doi: 10.1002/cbic.201100578. Epub 2011 Oct. 13, Photoswitchable click amino acids: light control of conformation and bioactivity) into the active site of the polymerase or 5.fwdarw.3 exonuclease domains (if present).

    [0051] Light sensitive neurons (optogenetics) can trigger ion-sensitive polymerases (see Zamft B, Marblestone A, Kording K, Schmidt D, Martin-Alarcon D, Tyo K, Boyden E, Church GM(2012) Measuring Cation Dependent DNA Polymerase Fidelity Landscapes by Deep Sequencing. PLoS One, in press) or, for some applications, the ion flux patterns themselves can constitute the stored datasets.

    [0052] The de novo polymers can be stored and read with or without polymerase amplification. Amplification can be via thermal cycling or isothermal. The amplicons can be short (100 to 200 mers as is convenient for current chemical synthesis or up to 1 Mbp as might be achievable with polymerases.

    [0053] The nucleotide type incorporated can be determined by: a) the intersection of a light pulse coincident with a particular dNTP (or rNTP or other monomer class) present at that time point in a cyclic pattern of dNTP solutions. b) caged (i.e. photo-activatable or photo-inactivatable) dNTPs, rNTPs or cations. c) base-specific, light-modulated steric or conformational selectivity (see Hoppmann C, Schmieder P, Heinrich N, Beyermann M. (2011) Chembiochem.12(17):2555-9. doi: 10.1002/cbic.201100578. Epub 2011 Oct. 13. Photoswitchable click amino acids: light control of conformation and bioactivity). Poly(A) polymerase is particularly useful since its specificity for ATp relative to other rNTPs is due to a conformational change which can be mimicked by a photo-sensitive amino acid linkage (like azobenzene, with or without crosslinking).

    [0054] This invention is further illustrated by the following example, which should not be construed as limiting. The contents of all references, patents and published patent applications cited throughout this application are hereby incorporated by reference in their entirety for all purposes.

    EXAMPLE I

    Written Information to be Stored Using DNA

    [0055] An HTML version of a draft book called Regenesis (Church G M and Regis E) to be published by Basic Books (New York, NY) was selected to demonstrate modern formatting, images, and javascript. As with typical web pages, Universal Character Set Transformation Format, 8-bit (UTF-8), a variable-width encoding, which is backwards compatible with ASCII and UNICODE for special characters and fonts were used. There were 11 images that are black-and-white and JPEG encoded (typically a 10:1 data compression with little loss in quality). These were embedded inline (i.e. not separate files) in the html in base64 format. A consensus bit error in the middle of any of these JPEG segments would only affect data downstream within that segment. A bit error in the text will affect at most the 12 characters in that oligonucleotide containing the error. The javascript is a simple display of a 37-byte text string (mnemonic encoding of the genetic code) that can curve dynamically to follow the cursor position. According to the present disclosure, DNA (like other digital media) can encode executable directives for digital machines.

    EXAMPLE II

    Encoding the Written Information into DNA

    [0056] The book was converted to html format (with embedded jpg images). The book was read in bit form and then individual bits were converted to A or C for 0 and T or G for 1. Bases were chosen randomly while disallowing homopolymer runs greater than three. Addresses of the bitstream were 19 bits long and numbered consecutively, starting from 0000000000000000001. The script Bits2DNA.pl (see code section) is the program used for encoding the html file into DNA segments.

    EXAMPLE III

    Synthesis and Amplification

    [0057] 54,898 oligonucleotides were synthesized on an Agilent Oligo Library Synthesis microarray platform. DNA was eluted by Agilent to give an 10 picomole pool of oligonucleotides in 100 L TE (10 mM Tris-Cl pH 7.5, 0.1 mM EDTA).

    [0058] The libraries were amplified as follows. 1L (10 femtomole expected) of library was used in a 50 L PCR amplification reaction using 200 nM each of primers MD-Test-1F and MD-Test-1R for 6 cycles using Sybr Fast Master Mix (Kapa Biosystems) in a BioRad CFX96 Real-Time PCR machine and monitored the Sybr Green channel during amplification. [0059] 95 C. for 3 min [0060] 95 C. for 10 sec [0061] 60 C. for 30 sec [0062] Read Sybr Green Channel [0063] Goto Step 2 for a total of 10 cycles [0064] 68 C. for 30 sec [0065] Hold at 4 C.

    [0066] The resulting PCR product was purified using Qiagen MinElute PCR cleanup column according to manufacturer's instructions into 10 L of Buffer EB (10 mM Tris-Cl, pH 8.5). The eluted DNA gave a concentration of 36.8 ng/L (A260/A280=1.85) as measured by a NanoDrop 2000 c spectrophotometer.

    [0067] Two tubes of 1 L of 1:11 diluted (in water) amplification reaction were amplified for nine cycles using the same conditions but this time using 200 nM of PE-PCR Primer 1.0-F and PE-PCR Primer 2.0-R. PCR reactions were cleaned up using Ampure beads per manufacturer's suggestion (Agencourt) to remove residual primers and resuspended in 50 L of TE. The final product was 22 ng/L as quantified both through NanoDrop and agarose gel imaging. Primers used are as follows with * denoting phosphorothioate linkage.

    TABLE-US-00001 >MDTest1-F (SEQIDNO:1) ACACTCTTTCCCTACACGACGCTCTTCCGATC*T >MDTest1-R (SEQIDNO:2) CTCGGCATTCCTGCTGAACCGCTCTTCCGATC*T >PEPCRPrimer1.0-F (SEQIDNO:3) AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC TTCCGATC*T >PEPCRPrimer2.0-R (SEQIDNO:4) CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCG CTCTTCCGATC*T

    EXAMPLE IV

    Sequencing and Processing

    [0068] The amplified library was sequenced by loading 1 mL of 14 pM library (14 fmoles; 1:1000 of the amplified library) on a single lane of a HiSeq 2000 using paired end 100 reads. From the lane we got 346,151,426 million paired reads with 87.14% >=Q30 and mean Q score of 34.16. Since a 115 bp construct with paired 100 bp reads was being sequenced, SeqPrep See 11 J. St. John, SeqPrep https://github.com/jstjohn/SeqPrep (2011) was used to combine overlapping reads into a single contig using the following command (for a single tile of the HiSeq lane): SeqPrep-f MTMC2_NoIndex_L006_R1_002.fastq.gz -r MTMC2 NoIndex L006 R2 002.fastq.gz-1 tile2rl.fastq.gz-2 ti1e2r2.fastq.gz-s ti1e2-merged.fastq.gz-E ti1e2-align.txt.gz-o 50-m 0.1-n 0.8.

    [0069] After SeqPrep, 292,371,030 contigs were formed. The contigs were aligned to the reference using Bowtie2 version 2.0.0-beta5 See 17 B. Langmead, S. L. Salzberg, Nature Methods 9, 357-360 (2012) and SamTools version 0.1.18 See 18 H. Li et al., Bioinformatics 25, 2078-2079 (2009) using the following command: zcat *merged*|bowtie2-p 10-end-to-end-x . . . / . . . / . . . /agilentlib-U-|samtools view-bS->alltiles-merged.bam.

    [0070] After alignment, 267,993,389 (92%) aligned to one member of the synthetic library giving average coverage of 48821261 (1 standard deviation). SeqPrepped contigs that give the full-length 115 bp contig were filtered, resulting in 190,284,472 reads and 3419998 average coverage. On average for each member of the library, 69.5% 0.4 of the reads were of full length. The construct with the fewest number of reads was an oligo md-37545, which had 94 and 9 reads before and after 115 bp filtering; the resulting consensus was still correct for this oligo.

    [0071] FIG. 2 is a histogram of the number of observations for each member of the designed library. All reads that formed contigs from SeqPrep (i.e., had overlaps between reads) were aligned against the synthesized library using Bowtie2, binned and plotted (red). The same information is displayed in green for only contigs 115 bp in length. Insets show zoomed in views of the distribution tails.

    EXAMPLE V

    Errors

    [0072] From the consensus library, discrepancies were found between designed and read sequences that are summarized in Table 1 below. As shown, 22 discrepancies were found, 10 of which resulted in bit errors (bolded). Most of the errors (20/22) were located within the last 15 bases of the sequence where there was only single coverage during sequencing. In addition, most of the errors (18/22) resulted in runs of at least 3 consecutive repeated nucleotides. Screening out homopolymer reads of 4 or more repeated nucleotides (greyed boxes) would result in 12 discrepancies, 7 of which are bit errors.

    TABLE-US-00002 TABLE1 Error Error Bit Reference Read Homo- Barcode Position Type Error Context Context polymer AACTGTCGCTATTC 115 A->G yes CAC-A- CAC-G- no ACTCA(SEQID NO:5) ACTAACGCACCTG 106 A->C no CTT-A- CTT-C- no GAATCA(SEQID CCT CCT NO:6) ACTTTCGGCATGAG 103 A->C no CGC-A- CGC-C- yes TACCC(SEQID CCC CCC NO:7) AGCGGCTCGTCGGT 40 T->C yes GGT-T- GGT-C- no GTCCC(SEQID CCG CCG NO:8) ATACGGCTCATTAC 105 G->C yes TCT-G- TCT-C- yes AAACC(SEQID CCC CCC NO:9) ATGCGGGCAAATC 106 A->C no AAC-A- AAC-C- yes ACAGCA(SEQID CCT CCT NO:10) ATGGCCGTAATGG 102 C->A no TAG-C- TAG-A- no AGAAAC(SEQID AAG AAG NO:11) ATGTTCTGAATTAG 108 C->G yes CAA-C- CAA-G- no CGCCC(SEQID GAG GAG NO:12) CAATGTAGATCCTC 106 A->C no CAG-A- CAG-C- yes GAAAC(SEQID CCC CCC NO:13) CCGGCCTAAACGG 106 A->C no CTC-A- CTC-C- yes CACGCC(SEQID CCT CCT NO:14) CGATATTCGGGAA 102 G->C yes AAC-G- AAC-C- yes CACCCA(SEQID CCC CCC NO:15) CGATATTCGGGAA 106 A->C no CCC-A- CCC-C- yes CACCCA(SEQID CCT CCT NO:16) CGGCGGAGCGGAG 106 C->A no AGG-C- AGG-A- no ACGCCA(SEQID AAG AAG NO:17) CTGCTCTTCAACCG 115 T->G no CGA-T- CGA-G- no CTACA(SEQID NO:18) GGTAATTTCTAGTA 105 A->C no GCA-A- GCA-C- yes CAGCC(SEQID CCC CCC NO:19) GGTCGCATAAACTT 105 A->G yes CGC-A- CGC-G- no GACCC(SEQID CGA GGA NO:20) GGTCGCATAAACTT 106 C->G yes GCA-C- GCG-G- no GACCC(SEQID GAG GAG NO:21) GTGCCAATAAAGT 102 T->C yes TCG-T- TCG-C- no GGTCCC(SEQID CCG CCG NO:22) GTGCCAATAAAGT 106 C->A no CCG-C- CCG-A- no GGTCCC(SEQID AAG AAG NO:23) GTGTCCCACCCACC 83 A->G yes ACA-A- ACA-G- no CACCC(SEQID CTG CTG NO:24) TCCCAGGCAGCTAC 102 T->C yes GCG-T- GCG-C- yes CCGCA(SEQID CCC CCC NO:25) TGACGCGCCGGTTG 106 A->C no ACC-A- ACC-C- yes GGCCC(SEQID CCT CCT NO:26)

    [0073] Table 1 indicates discrepancies between designed and read library. Each error is one row, displaying the barcode the error is associated with, the position in the oligo (out of 115), the error type, whether or not the error resulted in a bit change, the original context, and the new context (error position is in the middle of dashes), and finally whether or not the error resulted in a run of 4 bases that could have been filtered out. Lines that resulted in bit errors are bolded, and lines that could have been filtered based on runs of 4 consecutive bases are shaded.

    EXAMPLE VI

    Calculations on Data Density

    [0074] Theoretical DNA density was calculated by using 2 bits per nucleotide of single stranded DNA. The molecular weight of DNA we used was based on an average of 330.95 g/mol/nucleotide of anhydrous weight for the sodium salt of an ATGC balanced library. This results in a weight density of 1 bit per 2.7510.sup.22 g, and thus 1.810.sup.21 bytes can be stored in 3.96 g. Of course, practical maximums would be several orders of magnitude less dense depending the types of redundancy, barcoding, and encoding schemes desired. This theoretical maximum calculation is not used in FIG. 1B.

    [0075] Data plotted on FIG. 1B is a comparison between very different technologies. In cases of planar density calculations where thickness was not reported, 100 m was chosen as depth (this is 10 smaller than a hard drive platter, and 33% smaller than current Flash memory stacking). Current information encoding density (96 bits per 159 bp), and 100 synthesized coverage of the DNA in storage was assumed. An approximate volume of 1 g/cm.sup.3, the density of pure water, which is probably a slight underestimate for dry DNA was assumed.

    TABLE-US-00003 TABLE 2 Type Label Date Ref Bits Bits/mm3 Comments Commercial CD 1982 (19) 5.6e9 4.13e5 1.2 mm thick CD; 120 mm diameter Commercial DVD-SL 1996 (20) 3.76e10 2.77e6 1.2 mm thick DVD-SS- SL; 120 mm diameter Commercial DVD-QL 2000 (20) 1.37e11 1.01e7 1.2 mm thick DVD-DS- DL; 120 mm diamter Commercial BluRay 2002 (21) 2.00e11 1.47e7 1.2 mm thick Blu-ray SL disk (1 layer) Commercial BluRay 2010 (21) 1.02e12 7.52e7 1.2 mm thick Blu-ray QL disk (XL 4 layer) Commercial Magenetic 2010 (22) 4.00e13 5.59e8 Oracle StorageTek Tape T10000 T2 - 5TB 5.2 m thickness, 1147 m length, ~12 mm wide Commercial Flash 2012 (23, 24) 1.02e12 5.02e9 NAND Flash; Sandisk Memory for density of a single chip (22) 128 Gbits in 170 mm2; 150 m depth taken from Toshiba chip stacking (23) Commercial Hard Disk 2012 (25) 4.80e13 3.10e9 Hard Drive > Seagate 1 Terabit/inch2 = 1.55e9 bits/mm2 = 1.55e9 bits/mm2 assuming ds1 mm platter Demonstration 12-atom 2012 (26) 8 1.11e12 9 nm2/bit (assuming memory 100 m thickness) low temperature non- volative memory Demonstration Xe 1991 (27) 70 1E13 Spelled IBM with Xe positioning atoms spaced 1 nm apart on a 14 5 nm2 lattice; 1 bit/nm2; assuming 100 m thickness Demonstration Quantum 2008 (28) 3.5E+1 1.38e13 35 bit image pair, 17 17 Holography nm2 overhead atoms and 4 5 read space = ((4 5)/(17 17)) * 20 bits/nm2 = 1.38 bits/nm2 = 1.38e12 bits/mm2; assuming 100 m thickness Biological Super- 2011 (29) 27 4.0E10 9 3 3 bit fields (81 bits); resolution 250 nm center-to-center GFP spacing; 1 bit/250 nm2; assuming 100 m thickness Biological DNA in 1988 (7, 30) 35 5.0e10 E. coli, 0.7 m3 from E. coli (29) Biological DNA in 2001 (3, 30) 561 8.01e11 E. coli 0.7 m3 - 118 E. coli characters (27 possibilities) = 27118 = 2x; x = 561 Biological DNA in 2005 (8, 30) 1007 1.44e12 E. coli, 0.7 m3 233 E. coli characters (20 possibilities) = 20233 = 2x; x = 1007 Biological Mycoplasma 2010 (9) 7920 8.80E+13 Mycoplasma, volume of ~0.09 m3; Biological This Work 2012 5.27e6 5.49e15 Assuming 1e3 g/mm3; 330.95 g/mol/nucleotide; 96 bits per 159 bp; 100x fold coverage; 330.95*2*159 = 105242.1 g/mol = 1.748e19 g/molecule = 1.748e16 g per 1000 molecules = 1.748e13 mm3

    [0076] Table 2 shows data used in FIG. 1B to compare data densities in different media. In order to compare vastly different technologies for information encoding, all data density information was converted into volumetric data densities by making various assumptions. For commercial technologies, available information was used about substrate thickness where available. In the case of flash memory, best in class data density was combined with chip-stacking thickness from different manufacturers. For demonstration data storage technologies, substrate thicknesses were not reported. Therefore 100 m thickness was assumed, which is .sup.rd the current thickness of stacked flash storage technologies. This may be unrealistic for those technologies as published as all the demonstrations were performed at 4 K and in vacuum. The density of dried DNA was approximated to water's density, which may be an underestimation. For other biological demonstrations using cloned DNA, volumes of individual cells was used as volume. Finally, greyed rows are not shown in FIG. 1B as they were obscured by other data points, but are included here for completeness.

    EXAMPLE VII

    [0077]

    TABLE-US-00004 Code Bits2DNA.pl # cd \Perl\gmc\Bin_DNA # \Perl\bin\perl Bits2DNA.pl GMC Jul-2011 & 27-May-2012 # docstore.mik.ua/orelly/perl/cookbook/ch02_05.htm (bin) ch01_05.htm (char) # http://perldoc.perl.org/functions/pack.html rand.html # Each oligo is L(19)+8N(12)= 115 bp, long flanked by 22-mer amplification primers. #DNA Encoded Artifacts Registry (DEAR) to coordinate global standards. open IN,in.html; open OUT,>Bits2DNA.txt; binmode IN; $t{0}=a; $t{1}=G; # lowercase a,c = zero bit. $t{a}=c; $t{G}=T; $t{c}=a; $t{T}=G; $u1=; $u2=; $u3=; # Initialize; keep homopolymer runs <4 $N=12; # Length of segment in bytes (not including segment number) $L=19; # 2{circumflex over ()}19 = 524,288 = max number of oligos L=00010011 $seed=2; srand($seed); # remove this line to get a random seed print int2bp(262144), ,int2bp(262145); $f=CTACACGACGCTCTTCCGATCT; # forward universal sequencing & amplification primer (SEQ ID NO:27) $r=AGATCGGAAGAGCGGTTCAGCA; # reverse 22-mer primer (SEQ ID NO:28) $n=0; print OUT $f,int2bp(0),; ### while (read (IN, $text, 65536)) { @ascii_num = unpack(C*, $text); foreach $val (@ ascii_num) { print OUT byt2bp($val); ### $n++; if($n%$N==0){ print OUT $r,\n,$f,int2bp($n/$N),; ### } # N bases per output line } # each byte } # 65 Kbytes for ($k=$n%$N; $k<$N; $k++){ print OUT byt2bp(int(rand(256))); ### } # pad last data line to keep all oligos same size. print OUT $r\n; ### sub byt2bp { # convert rightmost 8 bits (MSB first byte) to 8 bp my $b = unpack(B32, pack(N, shift)); $p=; for ($i=24; $i<=31; $i++){ $x=substr($b,$i,1); # bits 24 to 31 inclusive $u=$t{$x}; if(rand(2)<1){$u=$t{$u};} # pick synonym a=c; G=T if(($u eq $u1) && ($u eq $u2) && ($u eq $u3)){$u=$t{$u};} $u1=$u2; $u2=$u3; $u3=$u; # Shift previous base string $p = $p.$u; } return $p; } sub int2bp { # convert rightmost $L bits of 32 bit integers to $L bp my $b = unpack(B32, pack(N, shift)); $p=; for ($i=31; $i>=32-$L; $i--){ $x=substr($b,$i,1); # bits 31 to $L $u=$t{$x}; if(rand(2)<1){$u=$t{$u};} # pick synonym a=c; G=T if(($u eq $u1) && ($u eq $u2) && ($u eq $u3)){$u=$t{$u};} $u1=$u2; $u2=$u3; $u3=$u; # Shift previous base string $p = $p.$u; } return $p; } buildConsensus.py import sys #builds consensus sequence from individual base counts def getConsensus(finalbuckets): sequence = for i in range(len(finalbuckets)): letterindex = finalbuckets[i].index(max(finalbuckets[i])) if letterindex == 0: sequence += A elif letterindex == 1: sequence += C elif letterindex == 2: sequence += G elif letterindex == 3: sequence += T return sequence oligolength = 115 currentbarcode = #initialize vector to building consensus buckets = [[0 for col in range(4)]for row in range(oligolength)] for line in sys.stdin: splitline = line.split( ) count = int(splitline[0]) barcode = splitline[1] sequence = splitline[2] if not barcode == currentbarcode: if not currentbarcode ==: print getConsensus(buckets) buckets = [[0 for col in range(4)] for row in range(oligolength)] currentbarcode = barcode for i in range(oligolength): if sequence[i] == A: buckets[i][0] += count elif sequence[i] == C: buckets[i][1] += count elif sequence[i] == G: buckets[i][2] += count elif sequence[i] == T: buckets[i][3] += count #print final consensus print getConsensus(buckets)

    EXAMPLE VIII

    Process Summary

    [0078] According to one aspect, html-coded draft of a book that included 53,426 words, 11 JPG images and 1 Javascript program was converted into 5.27 megabits See 4. Information on materials and methods is available on Science Online. The bits were then encoded onto 54,898 159 nt oligonucleotides each encoding a 96-bit data block (96 nt), a 19-bit address specifying the location of the data block in the bit stream (19 nt), and flanking 22 nt common sequences for amplification and sequencing. The oligonucleotide library was synthesized by ink-jet printed, high-fidelity DNA microchips See 10. E. M. LeProust et al., Nucleic Acids Research 38, 2522-2540 (2010). To read the encoded book, the library was amplified by limited-cycle PCR and then sequenced on a single lane of an Illumina HiSeq. Overlapping paired-end 100 nt reads were joined to reduce the effect of sequencing error See 11. J. St. John, SeqPrep https://github.com/jstjohn/SeqPrep (2011). Then using only reads that gave the expected 115 nt length and perfect barcode sequences, consensus was generated at each base of each data block at an average of about 3000-fold coverage. All data blocks were recovered with a total of 10 bit errors (out of 5.27 million), which were predominantly located within homo-polymer runs at the end of the oligo where we only had single sequence coverage See 4. Information on materials and methods is available on Science Online.

    [0079] The density of the embodiments disclosed herein was about 5.5 petabits/mm.sup.3 at 100 synthetic coverage. The scale of the embodiments disclosed herein was about 5.27 megabits. The method steps described herein were carried out using commercially available materials and instruments. FIG. 1B is a comparison of information density showing that the embodiments of the present disclosure (This work) provided a higher information density compared with other storage media. According to certain aspects, embodiments include the use of compression, redundant encodings, parity checks, and error correction to improve density, distribution, and error rate. According to certain aspects, DNA libraries can also be stored without physical isolation by using unique priming sites that allow for orthogonal amplification See 12. S. Kosuri et al., Nature Biotechnology 28, 1295-1299 (2010). According to certain aspects, polymers other than DNA or DNA modifications can also be used to maximize reading, writing, and storage capabilities See 13. S. A. Benner, Z. Yang, F. Chen, Comptes Rendus Chimie 14, 372-387 (2011). According to one aspect, a hand-held, single-molecule DNA sequencer may be used to read DNA-encoded information See 15. E. Pennissi, Science 336, 534-537 (2012). According to one aspect, the general approach of using addressed data blocks combined with library synthesis and consensus sequencing is compatible with commercially available DNA sequencing and synthesis technologies. According to one aspect, alternative consumer-level uses of DNA such as information storage could accelerate development of new technologies for improving synthesis and sequencing technologies See 16. S. Kosuri, A. M. Sismour, ACS Synth Biol 1, 109-110 (2012).

    [0080] References identified herein and the following references are hereby incorporated by reference in their entireties for all purposes and are referred to throughout the present disclosure by the corresponding number. [0081] 1. Extracting Value from Chaos (IDC, Framingham, MA 2011); world wide web site emc.com/collateral/analyst-reports/idc-extracting-value-from-chaos-ar.pdf. [0082] 2. J. Rothenberg, Scientific American 272, 42-47 (1995). [0083] 3. C. Bancroft, T. Bowler, B. Bloom, C. T. Clelland, Science 293, 1763-1765 (2001). [0084] 4. lnformation on materials and methods is available on Science Online [0085] 5. J. Bonnet et al., Nucleic Acids Research 38, 1531-1546 (2010). [0086] 6. S. Pbo et al., M. A. Uyterlinde et al., Eds. Annual Review of Genetics 38, 645-679 (2004). [0087] 7. J. Davis, Art Journal 55, 70-74 (1996). [0088] 8. C. Gustafsson, Nature 458, 703 (2009). [0089] 9. D. G. Gibson et al., Science 329, 52-56 (2010). [0090] 10. E. M. LeProust et al., Nucleic Acids Research 38, 2522-2540 (2010). [0091] 11. J. St. John, SeqPrep https://github.com/jstjohn/SeqPrep (2011) [0092] 12. S. Kosuri et al., Nature Biotechnology 28, 1295-1299 (2010). [0093] 13. S. A. Benner, Z. Yang, F. Chen, Comptes Rendus Chimie 14, 372-387 (2011). [0094] 14. P. A. Carr, G. M. Church, Nature Biotechnology 27, 1151-62 (2009). [0095] 15. E. Pennissi, Science 336, 534-537 (2012) [0096] 16. S. Kosuri, A. M. Sismour, ACS Synth Biol 1, 109-110 (2012) [0097] 17. B. Langmead, S. L. Salzberg, Nature Methods 9, 357-360 (2012). [0098] 18. H. Li et al., Bioinformatics 25, 2078-2079 (2009). [0099] 19. Ecma International, Data interchange on read-only 120 mm optical data disks (CD-ROM), (ECMA Standard 130, Geneva, Switzerland 1996, world wide website ecma-international.org/publications/files/ECMA-ST/Ecma-130.pdf.) [0100] 20. Ecma International, 120 mm DVD-Read-Only Disk, (ECMA Standard 267, Geneva, Switzerland 2001, world wide website ecma-international.org/publications/files/ECMA-ST/Ecma-267.pdf.) [0101] 21. Blu-Ray Disc Association, White PaperBlu-Ray Disc Format (2.sup.nd Edition, Universal City, CA 2010, world wide website blu-raydisc.com/Assets/Downloadablefile/general bluraydiscformat-15263.pdf.) [0102] 22. Oracle, StorageTek T10000 Family Tape Cartridge (Oracle, Redwood Shores, CA 2010, world wide website oracle.com/us/products/servers-storage/storage/tape-storage/033617.pdf.) [0103] 23. SanDisk, SanDisk Develops Smallest 128Gb NAND Flash Memory Chip (SanDisk, Milipitas, CA 2012, world wide website www.sandisk.com/about-sandisk/press-room/press-releases/2012/sandisk-develops-worlds-smallest-128gb-nand-flash-memory-chip.) [0104] 24. Toshiba, NAND Flash Memory in Multi Chip Package (Toshiba, Tokyo, Japan, 2011, world wide website toshiba-components.com/memory/mcp.html.) [0105] 25. Seagate, Seagate Reaches 1 Terabit Per Square Inch Milestone In Hard Drive Storage With New Technology Demonstration (Seagate, Cupertino, CA 2012, world wide website seagate.com/about/newsroom/press-releases/terabit-milestone-storage-seagate-pr/?paramChannelName=newsroom.) [0106] 26. S. Loth et al., Science 335, 196-199 (2010). [0107] 27. D. M. Eigler, E. K. Schweizer, Nature 344, 524-526 (1990). [0108] 28. C. R. Moon, L. S. Mattos, B. K. Foster, G. Zeltzer, H. C. Manoharan, Nature Nanotechnology 4, 167-172 (2009). [0109] 29. T. Grotjohann et al., Nature 478, 204-208 (2011). [0110] 30. H. E. Kubitschek, J Bacteriol 172, 94-101 (1990). [0111] 31. Screening Framework Guidance for Providers of Synthetic Double-Stranded DNA Federal Registrar 75, 62820-62832 (2010) FR Doc No: 2010-25728.

    EQUIVALENTS

    [0112] Other embodiments will be evident to those of skill in the art. It should be understood that the foregoing description is provided for clarity only and is merely exemplary. The spirit and scope of the present invention are not limited to the above example, but are encompassed by the claims. All publications, patents and patent applications cited above are incorporated by reference herein in their entirety for all purposes to the same extent as if each individual publication or patent application were specifically indicated to be so incorporated by reference.