DIPEPTIDYL PEPTIDASE 4 (DPP4) IRNA COMPOSITIONS AND METHODS OF USE THEREOF

20240067972 ยท 2024-02-29

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to RNAi agents, e.g., dsRNA agents, targeting the dipeptidyl peptidase 4 (DPP4) gene. The invention also relates to methods of using such RNAi agents to inhibit expression of a DPP4 gene and to methods of treating or preventing a DPP4-associated disease, such as metabolic diseases, e.g., diabetes or lipid metabolism diseases, in a subject.

    Claims

    1. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Dipeptidyl peptidase 4 (DPP4) in a cell, (a) wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides, with 0, 1, 2, or 3 mismatches, of a portion of the nucleotide sequence of any one of SEQ ID NOs:1-15, or a nucleotide sequence having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of any one of SEQ ID NOs:1-15, and the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides, with 0, 1, 2, or 3 mismatches, of the corresponding portion of the nucleotide sequence of any one of SEQ ID NOs:16-30, or a nucleotide sequence having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of an one of SEQ ID NOs:16-30; and wherein the sense strand or the antisense strand is conjugated to one or more lipophilic moieties; (b) wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a region complementary to part of an mRNA encoding a DPP4 gene (any one of SEQ ID NOs:1-15), wherein each strand independently is 14 to 30 nucleotides in length; and wherein the sense strand or the antisense strand is conjugated to one or more lipophilic moieties; or (c) wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense nucleotide sequences in any one of Tables 2-3 and 5-6, wherein each strand independently is 14 to 30 nucleotides in length; and wherein the sense strand or the antisense strand is conjugated to one or more lipophilic moieties; or (d) wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequence of nucleotides 1204-1226, 1208-1230, 1209-1231, 1210-1232, 1211-1233, 1212-1234, 1700-1722, 2223-2245, 2224-2246, 2225-2247, or 3232-3254 of SEQ ID NO:6, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:21, and wherein the sense strand or the antisense strand is conjugated to one or more lipophilic moieties; or (e) wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense nucleotide sequences in any one of Tables 2-3 and 5-6, wherein each strand independently is 14 to 30 nucleotides in length.

    2. (canceled)

    3. (canceled)

    4. The dsRNA agent of claim 1, (a) wherein the sense strand or the antisense strand is a sense strand or an antisense strand selected from the group consisting of any of the sense strands and antisense strands in any one of Tables 2-3 and 5-6; and/or (b) wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the antisense strand nucleotide sequences of a duplex selected from the group consisting of AD-1286365.1, AD-1286369.1, AD-1286370.1, AD-1286371.1, AD-1286372.1, AD-1286373.1, AD-1286829.1, AD-1287272.1, AD-1287273.1, AD-1287274.1, and AD-1288171.1; and/or (c) wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of nucleotides 2224-2246 of SEQ ID NO:6, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:21; and/or (d) wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from the antisense strand nucleotide sequences of duplex AD-1287273.1; and/or (e) wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of nucleotides 1211-1233 of SEQ ID NO:6, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:21; and/or (f) wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from the antisense strand nucleotide sequences of duplex AD-1286372.1.

    5.-16. (canceled)

    17. The dsRNA agent of claim 1, wherein the dsRNA agent comprises at least one modified nucleotide.

    18. (canceled)

    19. (canceled)

    20. The dsRNA agent of claim 17, wherein at least one of the modified nucleotides is selected from the group a deoxy-nucleotide, a 3-terminal deoxythimidine (dT) nucleotide, a 2-O-methyl modified nucleotide, a 2-fluoro modified nucleotide, a 2-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2-amino-modified nucleotide, a 2-O-allyl-modified nucleotide, 2-C-alkyl-modified nucleotide, a 2-methoxyethyl modified nucleotide, a 2-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a 5-phosphorothioate group, a nucleotide comprising a 5-methylphosphonate group, a nucleotide comprising a 5 phosphate or 5 phosphate mimic, a nucleotide comprising vinyl phosphonate, a nucleotide comprising adenosine-glycol nucleic acid (GNA), a nucleotide comprising thymidine-glycol nucleic acid (GNA)S-Isomer, a nucleotide comprising 2-hydroxymethyl-tetrahydrofurane-5-phosphate, a nucleotide comprising 2-deoxythymidine-3phosphate, a nucleotide comprising 2-deoxyguanosine-3-phosphate, a 2-0 hexadecyl nucleotide, a nucleotide comprising a 2-phosphate, a cytidine-2-phosphate nucleotide, a guanosine-2-phosphate nucleotide, a 2-O-hexadecyl-cytidine-3-phosphate nucleotide, a 2-O-hexadecyl-adenosine-3-phosphate nucleotide, a 2-O-hexadecyl-guanosine-3-phosphate nucleotide, a 2-O-hexadecyl-uridine-3-phosphate nucleotide, a a 5-vinyl phosphonate (VP), a 2-deoxyadenosine-3-phosphate nucleotide, a 2-deoxycytidine-3-phosphate nucleotide, a 2-deoxyguanosine-3-phosphate nucleotide, a 2-deoxythymidine-3-phosphate nucleotide, a 2-deoxyuridine nucleotide, and a terminal nucleotide linked to a cholesteryl derivative and a dodecanoic acid bisdecylamide group; and combinations thereof.

    21.-23. (canceled)

    24. The dsRNA agent of claim 20, further comprising at least one phosphorothioate internucleotide linkage.

    25. (canceled)

    26. The dsRNA agent of claim 1, wherein each strand is no more than 30 nucleotides in length.

    27.-37. (canceled)

    38. The dsRNA agent of claim 1, wherein one or more lipophilic moieties are conjugated to one or more internal positions on at least one strand.

    39.-47. (canceled)

    48. The dsRNA agent of claim 1, wherein the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5-end of each strand.

    49.-57. (canceled)

    58. The dsRNA agent of claim 1, wherein the lipophilic moiety contains a saturated or unsaturated C4-C30 hydrocarbon chain, and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne.

    59.-67. (canceled)

    68. The dsRNA agent of claim 1, further comprising a targeting ligand that targets a liver tissue.

    69.-74. (canceled)

    75. The dsRNA agent of claim 1, further comprising a phosphate or phosphate mimic at the 5-end of the antisense strand.

    76.-78. (canceled)

    79. An isolated cell containing the dsRNA agent of claim 1.

    80. A pharmaceutical composition for inhibiting expression of a DPP4 gene, comprising the dsRNA agent of claim 1.

    81. (canceled)

    82. A device for oral inhalative administration comprising the dsRNA agent of claim 1.

    83. (canceled)

    84. An in vitro method of inhibiting expression of a DPP4 gene in a cell, the method comprising: (a) contacting the cell with the dsRNA agent of claim 1; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the DPP4 gene, thereby inhibiting expression of the DPP4 gene in the cell.

    85.-87. (canceled)

    88. A method of treating a subject having a dipeptidyl peptidase 4-(DPP4-) associated disease or a subject at risk of developing a DPP4-associated disease, comprising administering to the subject a therapeutically effective amount of the dsRNA agent of claim 1.

    89. The method of claim 88, wherein the subject is a human.

    90. The method of claim 88, wherein the DPP4-associated disease is a metabolic disease.

    91.-96. (canceled)

    97. The method of claim 88, wherein the dsRNA agent is administered to the subject at a dose of about 0.01 mg/kg to about 50 mg/kg.

    98. The method of claim 88, wherein the dsRNA agent is administered to the subject subcutaneously: intravenously: orally: or by pulmonary system administration.

    99.-101. (canceled)

    102. The method of claim 88, further comprising administering to the subject an additional agent or a therapy suitable for treatment or prevention of a DPP4-associated disorder.

    103. (canceled)

    104. (canceled)

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0114] FIG. 1 is a graph showing mouse DPP4 mRNA levels in mice (n=3 per group) subcutaneously administered a single 10 mg/kg dose of the indicated dsRNA duplexes on day 16 post-dose. Mouse DPP4 mRNA levels are shown relative to control levels detected with PBS treatment.

    [0115] FIG. 2 is a graph showing the effect of AD-1287273 administration on insulin sensitivity in high fat diet fed mice.

    [0116] FIG. 3 is a graph showing the effect of AD-1286372 administration on insulin tolerance in high fat diet fed mice.

    [0117] FIG. 4 is a graph showing the effect of AD-1286372 knockdown on circulating DPP4 protein levels in high fat diet fed mice

    DETAILED DESCRIPTION OF THE INVENTION

    [0118] The present invention provides iRNA compositions which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a DPP4 gene. The DPP4 gene may be within a cell, e.g., a cell within a subject, such as a human. The use of these iRNAs enables the targeted degradation of mRNAs of the corresponding gene (a DPP4 gene) in mammals. The present disclosure also provides methods of using the RNAi compositions of the disclosure for inhibiting the expression of a DPP4 gene for treating a subject having a disorder that would benefit from inhibiting or reducing the expression of a DPP4 gene, e.g., a DPP4-associated disorder, e.g., a metabolic disease, e.g., a subject having diabetes or a lipid metabolism disorder, or a subject at risk of a metabolic disease, e.g., diabetes or a lipid metabolism disorder.

    [0119] The iRNAs of the invention include an RNA strand (the antisense strand) having a region which is up to about 30 nucleotides or less in length, e.g., 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of a DPP4 gene. In certain embodiments, the RNAi agents of the disclosure include an RNA strand (the antisense strand) having a region which is about 21-23 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of a DPP4 gene.

    [0120] In certain embodiments, one or both of the strands of the double stranded RNAi agents of the invention is up to 66 nucleotides in length, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, 27-53 nucleotides in length, with a region of at least 19 contiguous nucleotides that is substantially complementary to at least a part of an mRNA of a DPP4 gene. In some embodiments, such iRNA agents having longer length antisense strands can, for example, include a second RNA strand (the sense strand) of 20-60 nucleotides in length wherein the sense and antisense strands form a duplex of 18-30 contiguous nucleotides.

    [0121] The use of iRNAs of the invention enables the targeted degradation of the DPP4 mRNAs in mammals. Thus, methods and compositions including these iRNAs are useful for treating a subject having a DPP4-associated disorder, e.g., a metabolism disease, e.g., diabetes or a lipid disorder, or for treating a subject at risk of developing a metabolism disease, e.g., diabetes or a lipid disorder.

    [0122] The following detailed description discloses how to make and use compositions containing iRNAs to inhibit the expression of a DPP4 gene s as well as compositions, uses, and methods for treating subjects that would benefit from inhibition and/or reduction of the expression of a DPP4 gene, e.g., subjects susceptible to or diagnosed with a DPP4-associated disorder.

    I. Definitions

    [0123] In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention.

    [0124] The articles a and an are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, an element means one element or more than one element, e.g., a plurality of elements.

    [0125] The term including is used herein to mean, and is used interchangeably with, the phrase including but not limited to.

    [0126] The term or is used herein to mean, and is used interchangeably with, the term and/or, unless context clearly indicates otherwise.

    [0127] The term about is used herein to mean within the typical ranges of tolerances in the art. For example, about can be understood as about 2 standard deviations from the mean. In certain embodiments, about means10%. In certain embodiments, about means5%. When about is present before a series of numbers or a range, it is understood that about can modify each of the numbers in the series or range.

    [0128] The term at least, no less than or or more prior to a number or series of numbers is understood to include the number adjacent to the term at least, and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, at least 18 nucleotides of a 21 nucleotide nucleic acid molecule means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that at least can modify each of the numbers in the series or range.

    [0129] As used herein, no more than or or less is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex with an overhang of no more than 2 nucleotides has a 2, 1, or 0 nucleotide overhang. When no more than is present before a series of numbers or a range, it is understood that no more than can modify each of the numbers in the series or range. As used herein, ranges include both the upper and lower limit.

    [0130] As used herein, methods of detection can include determination that the amount of analyte present is below the level of detection of the method.

    [0131] In the event of a conflict between an indicated target site and the nucleotide sequence for a sense or antisense strand, the indicated sequence takes precedence.

    [0132] In the event of a conflict between a sequence and its indicated site on a transcript or other sequence, the nucleotide sequence recited in the specification takes precedence.

    [0133] As used herein, the term Dipeptidyl peptidase 4 (DPP4) refers to the well-known gene and polypeptide, also known in the art as Adenosine Deaminase Complexing Protein, Dipeptidylpeptidase IV (CD26, Adenosine Deaminase Complexing Protein 2), T-Cell Activation Antigen CD26 Dipeptidyl Peptidase IV, Post-Proline Dipeptidyl Aminopeptidase IV, Xaa-Pro-Dipeptidylaminopeptidase, Gly-Pro Naphthylamidase, CD26 Antigen, EC 3.4.14.5, ADCP-2, DPP IV, ADABP, ADCP2, DPPIV, TP103, and CD26. DPP4 is an intrinsic type II transmembrane glycoprotein and a serine exopeptidase that cleaves X-proline dipeptides from the N-terminus of polypeptides. Dipeptidyl peptidase 4 is highly involved in glucose and insulin metabolism, as well as in immune regulation.

    [0134] The term DPP4 includes human DPP4, the amino acid and nucleotide sequences of which may be found in, for example, GenBank Accession No. NM_001935.4 (GI: 1519314476; SEQ ID NO:1); GenBank Accession No. NM_001379604.1 (GI: 1829653633; SEQ ID NO:2); GenBank Accession No. NM_001379605.1 (GI: 1829653631; SEQ ID NO:3); GenBank Accession No. NM_001379606.1 (GI: 1829653629; SEQ ID NO:4); and GenBank Accession No. XM_005246371 (SEQ ID NO: 5); mouse DPP4, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. NM_010074.3 (GI: 227116290, SEQ ID NO: 6); GenBank Accession No. NM_001159543.1 (GI: 227116291, SEQ ID NO: 7); GenBank Accession No. XM_006498691 (SEQ ID NO: 8); GenBank Accession No. XM_006498692 (SEQ ID NO: 9); and GenBank Accession No. XM_011239274 (SEQ ID NO: 10); and rat DPP4, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No.: NM_012789.1 (GI: 6978772; SEQ ID NO: 11).

    [0135] The term DPP4 also includes Macaca mulatta DPP4, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. NM_001039190.2 (GI: 589811490; SEQ ID NO:12) and Macacafascicularis DPP4, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. XM_005573317.2 (GI: 982285980; SEQ ID NO:13); GenBank Accession No. XM_005573318 (SEQ ID NO: 14); and GenBank Accession No. XM_015432296 (SEQ ID NO: 15).

    [0136] Additional examples of DPP4 mRNA sequences are readily available using, e.g., GenBank, UniProt, OMIM, and the Macaca genome project web site.

    [0137] Exemplary DPP4 nucleotide sequences may also be found in SEQ ID NOs:1-30. SEQ ID NOs:16-30 are the reverse complement sequences of SEQ ID NOs:1-15, respectively.

    [0138] Further information on DPP4 is provided, for example in the NCBI Gene database at https://www.ncbi.nlm.nih.gov/gene/1803.

    [0139] The entire contents of each of the foregoing GenBank Accession numbers and the Gene database numbers are incorporated herein by reference as of the date of filing this application.

    [0140] The terms Dipeptidyl peptidase 4 and DPP4, as used herein, also refers to naturally occurring DNA sequence variations of the DPP4 gene. Numerous sequence variations within the DPP4 gene have been identified and may be found at, for example, NCBI dbSNP and UniProt (see, e.g., https://www.ncbi.nlm.nih.gov/snp/?term=DPP4), the entire contents of which is incorporated herein by reference as of the date of filing this application.

    [0141] As used herein, target sequence refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a DPP4 gene, including mRNA that is a product of RNA processing of a primary transcription product. In one embodment, the target portion of the sequence will be at least long enough to serve as a substrate for RNAi-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a DPP4 gene. In one embodiment, the target sequence is within the protein coding region of the DPP4 gene. In another embodiment, the target sequence is within the 3 UTR of the DPP4 gene.

    [0142] The target sequence may be from about 9-36 nucleotides in length, e.g., about 15-30 nucleotides in length. For example, the target sequence can be about 15-30 nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. In some embodiments, the target sequence is about 19 to about 30 nucleotides in length. In other embodiments, the target sequence is about 19 to about 25 nucleotides in length. In still other embodiments, the target sequence is about 19 to about 23 nucleotides in length. In some embodiments, the target sequence is about 21 to about 23 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

    [0143] As used herein, the term strand comprising a sequence refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.

    [0144] G, C, A, T, and U each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine, and uracil as a base, respectively. However, it will be understood that the term ribonucleotide or nucleotide can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 1). The skilled person is well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. It is understood that when a cDNA sequence is provided, the corresponding mRNA or RNAi agent would include a U in place of a T. For example, without limitation, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of dsRNA featured in the invention by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention. Further, one of skill in the art that a T is a target gene sequence, or reverse complement thereof, would often be replaced by a U in an RNAi agent of the invention.

    [0145] The terms iRNA, RNAi agent, iRNA agent, RNA interference agent as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. RNA interference (RNAi) is a process that directs the sequence-specific degradation of mRNA. RNAi modulates, e.g., inhibits, the expression of a DPP4 gene in a cell, e.g., a cell within a subject, such as a mammalian subject.

    [0146] In one embodiment, an RNAi agent of the disclosure includes a single stranded RNAi that interacts with a target RNA sequence, e.g., a DPP4 mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory it is believed that long double stranded RNA introduced into cells is broken down into double-stranded short interfering RNAs (siRNAs) comprising a sense strand and an antisense strand by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease-III-like enzyme, processes these dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3 overhangs (Bernstein, et al., (2001) Nature 409:363). These siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Thus, in one aspect the disclosure relates to a single stranded RNA (ssRNA) (the antisense strand of a siRNA duplex) generated within a cell and which promotes the formation of a RISC complex to effect silencing of the target gene. Accordingly, the term siRNA is also used herein to refer to an RNAi as described above.

    [0147] In another embodiment, the RNAi agent may be a single-stranded RNA that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind to the RISC endonuclease, Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded RNAs are described in U.S. Pat. No. 8,101,348 and in Lima et al., (2012) Cell 150:883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150:883-894.

    [0148] In another embodiment, a RNAi agent for use in the compositions and methods of the disclosure is a double stranded RNA and is referred to herein as a double stranded RNAi agent, double stranded RNA (dsRNA) molecule, dsRNA agent, or dsRNA. The term dsRNA refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having sense and antisense orientations with respect to a target RNA, i.e., a DPP4 mRNA sequence. In some embodiments of the disclosure, a double stranded RNA (dsRNA) triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.

    [0149] In general, a dsRNA molecule can include ribonucleotides, but as described in detail herein, each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide, a modified nucleotide. In addition, as used in this specification, an RNAi agent may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides.

    [0150] As used herein, the term modified nucleotide refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, or a modified nucleobase. Thus, the term modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases. The modifications suitable for use in the agents of the disclosure include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by RNAi agent for the purposes of this specification and claims.

    [0151] In certain embodiments of the instant disclosure, inclusion of a deoxy-nucleotidewhich is acknowledged as a naturally occurring form of nucleotideif present within a RNAi agent can be considered to constitute a modified nucleotide.

    [0152] The duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 9 to 36 base pairs in length, e.g., about 15-30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

    [0153] The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3-end of one strand and the 5-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a hairpin loop. A hairpin loop can comprise at least one unpaired nucleotide. In some embodiments, the hairpin loop can comprise at at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides or nucleotides not directed to the target site of the dsRNA. In some embodiments, the hairpin loop can be 10 or fewer nucleotides. In some embodiments, the hairpin loop can be 8 or fewer unpaired nucleotides. In some embodiments, the hairpin loop can be 4-10 unpaired nucleotides. In some embodiments, the hairpin loop can be 4-8 nucleotides.

    [0154] In certain embodiment, the two strands of double-stranded oligomeric compound can be linked together. The two strands can be linked to each other at both ends, or at one end only. By linking at one end is meant that 5-end of first strand is linked to the 3-end of the second strand or 3-end of first strand is linked to 5-end of the second strand. When the two strands are linked to each other at both ends, 5-end of first strand is linked to 3-end of second strand and 3-end of first strand is linked to 5-end of second strand. The two strands can be linked together by an oligonucleotide linker including, but not limited to, (N)n; wherein N is independently a modified or unmodified nucleotide and n is 3-23. In some embodiments, n is 3-10, e.g., 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the oligonucleotide linker is selected from the group consisting of GNRA, (G)4, (U)4, and (dT)4, wherein N is a modified or unmodified nucleotide and R is a modified or unmodified purine nucleotide. Some of the nucleotides in the linker can be involved in base-pair interactions with other nucleotides in the linker. The two strands can also be linked together by a non-nucleosidic linker, e.g. a linker described herein. It will be appreciated by one of skill in the art that any oligonucleotide chemical modifications or variations describe herein can be used in the oligonucleotide linker.

    [0155] Hairpin and dumbbell type oligomeric compounds will have a duplex region equal to or at least 14, 15, 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, or 25 nucleotide pairs. The duplex region can be equal to or less than 200, 100, or 50, in length. In some embodiments, ranges for the duplex region are 15-30, 17 to 23, 19 to 23, and 19 to 21 nucleotides pairs in length.

    [0156] The hairpin oligomeric compounds can have a single strand overhang or terminal unpaired region, in some embodiments at the 3, and in some embodiments on the antisense side of the hairpin. In some embodiments, the overhangs are 1-4, more generally 2-3 nucleotides in length. The hairpin oligomeric compounds that can induce RNA interference are also referred to as shRNA herein.

    [0157] Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3-end of one strand and the 5-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a linker. The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, an RNAi may comprise one or more nucleotide overhangs.

    [0158] In one embodiment, an RNAi agent of the invention is a dsRNA, each strand of which is 24-30 nucleotides in length, that interacts with a target RNA sequence, e.g., a DPP4 mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory, long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3 overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188).

    [0159] In one embodiment, an RNAi agent of the invention is a dsRNA agent, each strand of which comprises 19-23 nucleotides that interacts with a DPP4 mRNA sequence to direct the cleavage of the target RNA. Without wishing to be bound by theory, long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3 overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). In one embodiment, an RNAi agent of the invention is a dsRNA of 24-30 nucleotides that interacts with a DPP4 mRNA sequence to direct the cleavage of the target RNA.

    [0160] As used herein, the term nucleotide overhang refers to at least one unpaired nucleotide that protrudes from the duplex structure of a RNAi agent, e.g., a dsRNA. For example, when a 3-end of one strand of a dsRNA extends beyond the 5-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; alternatively, the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5-end, 3-end or both ends of either an antisense or sense strand of a dsRNA.

    [0161] In one embodiment of the dsRNA, at least one strand comprises a 3 overhang of at least 1 nucleotide. In another embodiment, at least one strand comprises a 3 overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In other embodiments, at least one strand of the RNAi agent comprises a 5 overhang of at least 1 nucleotide. In certain embodiments, at least one strand comprises a 5 overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In still other embodiments, both the 3 and the 5 end of one strand of the RNAi agent comprise an overhang of at least 1 nucleotide.

    [0162] In one embodiment, the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., 0-3, 1-3, 2-4, 2-5, 4-10, 5-10, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3-end or the 5-end.

    [0163] In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3-end or the 5-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.

    [0164] In certain embodiments, the overhang on the sense strand or the antisense strand, or both, can include extended lengths longer than 10 nucleotides, e.g., 1-30 nucleotides, 2-30 nucleotides, 10-30 nucleotides, or 10-15 nucleotides in length. In certain embodiments, an extended overhang is on the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 3end of the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 5end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 3end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate. In certain embodiments, the overhang includes a self-complementary portion such that the overhang is capable of forming a hairpin structure that is stable under physiological conditions.

    [0165] The terms blunt or blunt ended as used herein in reference to a dsRNA mean that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a dsRNA, i.e., no nucleotide overhang. One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt ended. To be clear, a blunt ended dsRNA is a dsRNA that is blunt at both ends, i.e., no nucleotide overhang at either end of the molecule. Most often such a molecule will be double stranded over its entire length.

    [0166] The term antisense strand or guide strand refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., a DPP4 mRNA sequence.

    [0167] As used herein, the term region of complementarity refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., a DPP4 nucleotide sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5- or 3-terminus of the RNAi agent.

    [0168] In some embodiments, a double stranded RNA agent of the invention includes a nucleotide mismatch in the antisense strand. In some embodiments, the antisense strand of the double stranded RNA agent of the invention includes no more than 4 mismatches with the target mRNA, e.g., the antisense strand includes 4, 3, 2, 1, or 0 mismatches with the target mRNA. In some embodiments, the antisense strand double stranded RNA agent of the invention includes no more than 4 mismatches with the sense strand, e.g., the antisense strand includes 4, 3, 2, 1, or 0 mismatches with the sense strand. In some embodiments, a double stranded RNA agent of the invention includes a nucleotide mismatch in the sense strand. In some embodiments, the sense strand of the double stranded RNA agent of the invention includes no more than 4 mismatches with the antisense strand, e.g., the sense strand includes 4, 3, 2, 1, or 0 mismatches with the antisense strand. In some embodiments, the nucleotide mismatch is, for example, within 5, 4, 3 nucleotides from the 3-end of the iRNA. In another embodiment, the nucleotide mismatch is, for example, in the 3-terminal nucleotide of the iRNA agent. In some embodiments, the mismatch(s) is not in the seed region.

    [0169] Thus, an RNAi agent as described herein can contain one or more mismatches to the target sequence. In one embodiment, a RNAi agent as described herein contains no more than 3 mismatches (i.e., 3, 2, 1, or 0 mismatches). In one embodiment, an RNAi agent as described herein contains no more than 2 mismatches. In one embodiment, an RNAi agent as described herein contains no more than 1 mismatch. In one embodiment, an RNAi agent as described herein contains 0 mismatches. In certain embodiments, if the antisense strand of the RNAi agent contains mismatches to the target sequence, the mismatch can optionally be restricted to be within the last 5 nucleotides from either the 5- or 3-end of the region of complementarity. For example, in such embodiments, for a 23 nucleotide RNAi agent, the strand which is complementary to a region of a DPP4 gene, generally does not contain any mismatch within the central 13 nucleotides. The methods described herein or methods known in the art can be used to determine whether an RNAi agent containing a mismatch to a target sequence is effective in inhibiting the expression of a DPP4 gene. Consideration of the efficacy of RNAi agents with mismatches in inhibiting expression of a DPP4 gene is important, especially if the particular region of complementarity in a DPP4 gene is known to vary.

    [0170] The term sense strand or passenger strand as used herein, refers to the strand of a RNAi agent that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.

    [0171] As used herein, substantially all of the nucleotides are modified are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides.

    [0172] As used herein, the term cleavage region refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13.

    [0173] As used herein, and unless otherwise indicated, the term complementary, when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can be, for example, stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 C. or 70 C. for 12-16 hours followed by washing (see, e.g., Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.

    [0174] Complementary sequences within a RNAi agent, e.g., within a dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as fully complementary with respect to each other herein. However, where a first sequence is referred to as substantially complementary with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3, or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression, in vitro or in vivo. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as fully complementary for the purposes described herein.

    [0175] Complementary sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogsteen base pairing.

    [0176] The terms complementary, fully complementary and substantially complementary herein can be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between two oligonucleotides or polynucleotides, such as the antisense strand of a RNAi agent and a target sequence, as will be understood from the context of their use.

    [0177] As used herein, a polynucleotide that is substantially complementary to at least part of a messenger RNA (mRNA) or target sequence refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest or target sequence (e.g., an mRNA encoding DPP4). For example, a polynucleotide is complementary to at least a part of a DPP4 RNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding DPP4.

    [0178] Accordingly, in some embodiments, the antisense strand polynucleotides disclosed herein are fully complementary to the target DPP4 sequence.

    [0179] In other embodiments, the antisense strand polynucleotides disclosed herein are substantially complementary to the target DPP4 sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NOs: 1-15 for DPP4, or a fragment of SEQ ID NOs: 1-15, such as about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% complementary.

    [0180] In other embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target DPP4 sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to any one of the sense strand nucleotide sequences in any one of Tables 2-3 and 5-6, or a fragment of any one of the sense strand nucleotide sequences in any one of Tables 2-3 and 5-6, such as about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% complementary.

    [0181] In some embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target DPP4 sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to a fragment of SEQ ID NO: 6 selected from the group of nucleotides 1204-1226, 1208-1230, 1209-1231, 1210-1232, 1211-1233, 1212-1234, 1700-1722, 2223-2245, 2224-2246, 2225-2247, or 3232-3254 of SEQ ID NO:6, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.

    [0182] In some embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target DPP4 sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to nucleotides 2224-2246 of SEQ ID NO:6, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.

    [0183] In some embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target DPP4 sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to nucleotides 1211-1233 of SEQ ID NO:6, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.

    [0184] In one embodiment, an RNAi agent of the disclosure includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is the same as a target DPP4 sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NOs: 16-30, or a fragment of any one of SEQ ID NOs: 16-30, such as about 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% complementary.

    [0185] In some embodiments, an iRNA of the invention includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is complementary to a target DPP4 sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to any one of the antisense strand nucleotide sequences in any one of any one of Tables 2-3 and 5-6, or a fragment of any one of the antisense strand nucleotide sequences in any one of Tables 2-3 and 5-6, such as about 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% complementary.

    [0186] In some embodiments, the sense and antisense strands are selected from any one of duplexes AD-1286365.1, AD-1286369.1, AD-1286370.1, AD-1286371.1, AD-1286372.1, AD-1286373.1, AD-1286829.1, AD-1287272.1, AD-1287273.1, AD-1287274.1, and AD-1288171.1.

    [0187] In some embodiments, the sense and antisense strands are from duplex AD-1287273.1.

    [0188] In some embodiments, the sense and antisense strands are from duplex AD-1286372.1.

    [0189] In some embodiments, the double-stranded region of a double-stranded iRNA agent is equal to or at least, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotide pairs in length.

    [0190] In some embodiments, the antisense strand of a double-stranded iRNA agent is equal to or at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.

    [0191] In some embodiments, the sense strand of a double-stranded iRNA agent is equal to or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.

    [0192] In one embodiment, the sense and antisense strands of the double-stranded iRNA agent are each independently 15 to 30 nucleotides in length.

    [0193] In one embodiment, the sense and antisense strands of the double-stranded iRNA agent are each independently 19 to 25 nucleotides in length.

    [0194] In one embodiment, the sense and antisense strands of the double-stranded iRNA agent are each independently 21 to 23 nucleotides in length.

    [0195] In one embodiment, the sense strand of the iRNA agent is 21-nucleotides in length, and the antisense strand is 23-nucleotides in length, wherein the strands form a double-stranded region of 21 consecutive base pairs having a 2-nucleotide long single stranded overhangs at the 3-end.

    [0196] In one aspect of the invention, an agent for use in the methods and compositions of the invention is a single-stranded antisense nucleic acid molecule that inhibits a target mRNA via an antisense inhibition mechanism. The single-stranded antisense RNA molecule is complementary to a sequence within the target mRNA. The single-stranded antisense oligonucleotides can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically obstructing the translation machinery, see Dias, N. et al., (2002) Mol Cancer Ther 1:347-355. The single-stranded antisense RNA molecule may be about 15 to about 30 nucleotides in length and have a sequence that is complementary to a target sequence. For example, the single-stranded antisense RNA molecule may comprise a sequence that is at least about 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from any one of the antisense sequences described herein.

    [0197] In one embodiment, at least partial suppression of the expression of a DPP4 gene, is assessed by a reduction of the amount of DPP4 mRNA which can be isolated from or detected in a first cell or group of cells in which a DPP4 gene is transcribed and which has or have been treated such that the expression of a DPP4 gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells). The degree of inhibition may be expressed in terms of:

    [00001] ( mRNA in control cells ) - ( mRNA in treated cells ) ( mRNA in control cells ) .Math. 100 %

    [0198] In one embodiment, inhibition of expression is determined by the dual luciferase method wherein the RNAi agent is present at 10 nM.

    [0199] The phrase contacting a cell with an RNAi agent, such as a dsRNA, as used herein, includes contacting a cell by any possible means. Contacting a cell with an RNAi agent includes contacting a cell in vitro with the RNAi agent or contacting a cell in vivo with the RNAi agent. The contacting may be done directly or indirectly. Thus, for example, the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.

    [0200] Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent. Contacting a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, or to the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the RNAi agent may contain or be coupled to a ligand, e.g., a lipophilic moiety or moieties as described below and further detailed, e.g., in PCT Publication No. WO 2019/217459, the entire contents of which is incorporated herein by reference, that directs or otherwise stabilizes the RNAi agent at a site of interest, e.g., the liver. In some embodiments, the RNAi agent may contain or be coupled to a ligand, e.g., one or more GalNAc derivatives as described below, that directs or otherwise stabilizes the RNAi agent at a site of interest, e.g., the liver. In other embodiments, the RNAi agent may contain or be coupled to a lipophilic moiety or moieties and one or more GalNAc derivatives. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject.

    [0201] In one embodiment, contacting a cell with an RNAi agent includes introducing or delivering the RNAi agent into the cell by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of a RNAi agent can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing a RNAi agent into a cell may be in vitro or in vivo. For example, for in vivo introduction, a RNAi agent can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below or are known in the art.

    [0202] The term lipophile or lipophilic moiety broadly refers to any compound or chemical moiety having an affinity for lipids. One way to characterize the lipophilicity of the lipophilic moiety is by the octanol-water partition coefficient, log K.sub.ow, where K.sub.ow is the ratio of a chemical's concentration in the octanol-phase to its concentration in the aqueous phase of a two-phase system at equilibrium. The octanol-water partition coefficient is a laboratory-measured property of a substance. However, it may also be predicted by using coefficients attributed to the structural components of a chemical which are calculated using first-principle or empirical methods (see, for example, Tetko et al., J. Chem. Inf Comput. Sci. 41:1407-21 (2001), which is incorporated herein by reference in its entirety). It provides a thermodynamic measure of the tendency of the substance to prefer a non-aqueous or oily milieu rather than water (i.e. its hydrophilic/lipophilic balance). In principle, a chemical substance is lipophilic in character when its log K.sub.ow exceeds 0. Typically, the lipophilic moiety possesses a log K.sub.ow exceeding 1, exceeding 1.5, exceeding 2, exceeding 3, exceeding 4, exceeding 5, or exceeding 10. For instance, the log K.sub.ow of 6-amino hexanol, for instance, is predicted to be approximately 0.7. Using the same method, the log K.sub.ow of cholesteryl N-(hexan-6-ol) carbamate is predicted to be 10.7.

    [0203] The lipophilicity of a molecule can change with respect to the functional group it carries. For instance, adding a hydroxyl group or amine group to the end of a lipophilic moiety can increase or decrease the partition coefficient (e.g., log K.sub.ow) value of the lipophilic moiety.

    [0204] Alternatively, the hydrophobicity of the double-stranded RNAi agent, conjugated to one or more lipophilic moieties, can be measured by its protein binding characteristics. For instance, in certain embodiments, the unbound fraction in the plasma protein binding assay of the double-stranded RNAi agent could be determined to positively correlate to the relative hydrophobicity of the double-stranded RNAi agent, which could then positively correlate to the silencing activity of the double-stranded RNAi agent.

    [0205] In one embodiment, the plasma protein binding assay determined is an electrophoretic mobility shift assay (EMSA) using human serum albumin protein. An exemplary protocol of this binding assay is illustrated in detail in, e.g., PCT Publication No. WO 2019/217459. The hydrophobicity of the double-stranded RNAi agent, measured by fraction of unbound siRNA in the binding assay, exceeds 0.15, exceeds 0.2, exceeds 0.25, exceeds 0.3, exceeds 0.35, exceeds 0.4, exceeds 0.45, or exceeds 0.5 for an enhanced in vivo delivery of siRNA.

    [0206] Accordingly, conjugating the lipophilic moieties to the internal position(s) of the double-stranded RNAi agent provides optimal hydrophobicity for the enhanced in vivo delivery of siRNA.

    [0207] The term lipid nanoparticle or LNP is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., a RNAi agent or a plasmid from which a RNAi agent is transcribed. LNPs are described in, for example, U.S. Pat. Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are hereby incorporated herein by reference.

    [0208] As used herein, a subject is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), or a non-primate (such as a a cow, a pig, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, or a mouse), or a bird that expresses the target gene, either endogenously or heterologously. In one embodiment, the subject is a human, such as a human being treated or assessed for a disease, disorder, or condition that would benefit from reduction in DPP4 expression; a human at risk for a disease, disorder, or condition that would benefit from reduction in DPP4 expression; a human having a disease, disorder, or condition that would benefit from reduction in DPP4 expression; or human being treated for a disease, disorder, or condition that would benefit from reduction in DPP4 expression as described herein. In some embodiments, the subject is a female human. In other embodiments, the subject is a male human. In one embodiment, the subject is an adult subject. In another embodiment, the subject is a pediatric subject.

    [0209] As used herein, the terms treating or treatment refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more signs or symptoms associated with DPP4 expression or DPP4 protein production, e.g., a DPP4-associated disease, e.g., a metabolic disease, e.g., diabetes, or lipid metabolism disorders, or symptoms associated with unwanted DPP4 expression; diminishing the extent of unwanted DPP4 activation or stabilization; amelioration or palliation of unwanted DPP4 activation or stabilization. Treatment can also mean prolonging survival as compared to expected survival in the absence of treatment.

    [0210] The term lower in the context of the level of DPP4 in a subject or a disease marker or symptom refers to a statistically significant decrease in such level. The decrease can be, for example, at least 10%, 15%, 20%, 25%, 30%, %, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more. In certain embodiments, a decrease is at least 20%. In certain embodiments, the decrease is at least 50% in a disease marker, e.g., protein or gene expression level. Lower in the context of the level of DPP4 in a subject is a decrease to a level accepted as within the range of normal for an individual without such disorder. In certain embodiments, the expression of the target is normalized, i.e., decreased towards or to a level accepted as within the range of normal for an individual without such disorder, e.g., blood glucose level, blood lipid level, blood oxygen level, white blood cell count, kidney function, spleen function, liver function. As used here, lower in a subject can refer to lowering of gene expression or protein production in a cell in a subject does not require lowering of expression in all cells or tissues of a subject. For example, as used herein, lowering in a subject can include lowering of gene expression or protein production in a subject.

    [0211] The term lower can also be used in association with normalizing a symptom of a disease or condition, i.e. decreasing the difference between a level in a subject suffering from a DPP4-associated disease towards or to a level in a normal subject not suffering from a DPP4-associated disease. As used herein, if a disease is associated with an elevated value for a symptom, normal is considered to be the upper limit of normal. If a disease is associated with a decreased value for a symptom, normal is considered to be the lower limit of normal.

    [0212] As used herein, prevention or preventing, when used in reference to a disease, disorder, or condition thereof, that would benefit from a reduction in expression of a DPP4 gene or production of a DPP4 protein, refers to a reduction in the likelihood that a subject will develop a symptom associated with such a disease, disorder, or condition, e.g., a symptom of a DPP4-associated disease, e.g., a metabolic disease, e.g., diabetes, or lipid metabolism disorders. The failure to develop a disease, disorder, or condition, or the reduction in the development of a symptom associated with such a disease, disorder, or condition (e.g., by at least about 10% on a clinically accepted scale for that disease or disorder), or the exhibition of delayed symptoms delayed (e.g., by days, weeks, months or years) is considered effective prevention.

    [0213] As used herein, the term DPP4-associated disease, is a disease or disorder that would benefit from reduction in the expression or activity of DPP4. The term DPP4-associated disease, is a disease or disorder that is caused by, or associated with, DPP4 expression or DPP4 protein production. The term DPP4-associated disease includes a disease, disorder or condition that would benefit from a decrease in DPP4 expression or DPP4 protein activity. Non-limiting examples of DPP4-associated diseases include, for example, metabolic diseases, e.g., diabetes (type I or type II diabetes) or lipid metabolism disorders.

    [0214] As used herein, a metabolic disease refers to any disease or disorder that disrupts normal metabolism, the process of converting food to energy on a cellular level. Metabolic diseases affect the ability of the cell to perform critical biochemical reactions that involve the processing or transport of proteins (amino acids), carbohydrates (sugars and starches), or lipids (fatty acids). Non-limiting examples of metabolic diseases include disorders of carbohydrates, e.g., diabetes, galactosemia, hereditary fructose intolerance, fructose 1,6-diphosphatase deficiency, glycogen storage disorders, congenital disorders of glycosylation, insulin resistance, insulin insufficiency, hyperinsulinemia, impaired glucose tolerance (IGT), abnormal glycogen metabolism; disorders of amino acid metabolism, e.g., maple syrup urine disease (MSUD), or homocystinuria; disorder of organic acid metabolism, e.g., methylmalonic aciduria, 3-methylglutaconic aciduriaBarth syndrome, glutaric aciduria or 2-hydroxyglutaric aciduriaD and L forms; disorders of faccy acid beta-oxidation, e.g., medium-chain acyl-CoA dehydrogenase deficiency (MCAD), long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency (LCHAD), very-long-chain acyl-CoA dehydrogenase deficiency (VLCAD); disorders of lipid metabolism, e.g., GM1 Gangliosidosis, Tay-Sachs Disease, Sandhoff Disease, Fabry Disease, Gaucher Disease, Niemann-Pick Disease, Krabbe Disease, Mucolipidoses, or Mucopolysaccharidoses; mitochondrial disorders, e.g., mitochondrial cardiomyopathies; Leigh disease; mitochondrial encephalopathy, lactic acidosis, and stroke-like episodes (MELAS); myoclonic epilepsy with ragged-red fibers (MERRF); neuropathy, ataxia, and retinitis pigmentosa (NARP); Barth syndrome; or peroxisomal disorders, e.g., Zellweger Syndrome (cerebrohepatorenal syndrome), X-Linked Adrenoleukodystrophy or Refsum Disease.

    [0215] As used herein, a lipid metabolism disorder or disorder of lipid metabolism refers to any disorder associated with or caused by a disturbance in lipid metabolism. This term also includes any disorder, disease or condition that can lead to hyperlipidemia, or condition characterized by abnormal elevation of levels of any or all lipids and/or lipoproteins in the blood. This term refers to an inherited disorder, such as familial hypertriglyceridemia, familial partial lipodystrophy type 1 (FPLD1), or an induced or acquired disorder, such as a disorder induced or acquired as a result of a disease, disorder or condition (e.g., renal failure), a diet, or intake of certain drugs (e.g., as a result of highly active antiretroviral therapy (HAART) used for treating, e.g., AIDS or HIV).

    [0216] Additional examples of disorders of lipid metabolism include, but are not limited to, atherosclerosis, dyslipidemia, hypertriglyceridemia (including drug-induced hypertriglyceridemia, diuretic-induced hypertriglyceridemia, alcohol-induced hypertriglyceridemia, -adrenergic blocking agent-induced hypertriglyceridemia, estrogen-induced hypertriglyceridemia, glucocorticoid-induced hypertriglyceridemia, retinoid-induced hypertriglyceridemia, cimetidine-induced hypertriglyceridemia, and familial hypertriglyceridemia), acute pancreatitis associated with hypertriglyceridemia, chylomicron syndrome, familial chylomicronemia, Apo-E deficiency or resistance, LPL deficiency or hypoactivity, hyperlipidemia (including familial combined hyperlipidemia), hypercholesterolemia, gout associated with hypercholesterolemia, xanthomatosis (subcutaneous cholesterol deposits), hyperlipidemia with heterogeneous LPL deficiency, hyperlipidemia with high LDL and heterogeneous LPL deficiency, fatty liver disease, or nonalcoholic steatohepatitis (NASH).

    [0217] Cardiovascular diseases are also considered metabolic disorders, as defined herein. These diseases may include coronary artery disease (also called ischemic heart disease), hypertension, inflammation associated with coronary artery disease, restenosis, peripheral vascular diseases, and stroke.

    [0218] Disorders related to body weight are also considered metabolic disorders, as defined herein. Such disorders may include obesity, metabolic syndrome including independent components of metabolic syndrome (e.g., central obesity, FBG/pre-diabetes/diabetes, hypercholesterolemia, hypertriglyceridemia, and hypertension), hypo-metabolic states, hypothyroidism, uremia, and other conditions associated with weight gain (including rapid weight gain), weight loss, maintenance of weight loss, or risk of weight regain following weight loss.

    [0219] Blood sugar disorders are further considered metabolic disorders, as defined herein. Such disorders may include diabetes, hypertension, and polycystic ovarian syndrome related to insulin resistance. Other exemplary disorders of metabolic disorders may also include renal transplantation, nephrotic syndrome, Cushing's syndrome, acromegaly, systemic lupus erythematosus, dysglobulinemia, lipodystrophy, glycogenosis type I, and Addison's disease.

    [0220] Additional diseases or conditions related to metabolic disorders that would be apparent to the skilled artisan and are within the scope of this disclosure.

    [0221] The symptoms for a DPP4-associated disease, e.g., a metabolic disease, include, for example, a loss of fat-free or lean muscle mass, an excess of fat mass, a lower metabolic rate, insulin resistance, lack of ability to regulate blood sugar, weight gain, and/or increase in body mass index. Further details regarding signs and symptoms of the various diseases or conditions are provided herein and are well known in the art.

    [0222] As used herein, the term diabetes refers to a group of metabolic diseases characterized by high blood sugar (glucose) levels which result from defects in insulin secretion or action, or both. There are two most common types of diabetes, namely type 1 diabetes and type 2 diabetes, which both result from the body's inability to regulate insulin. Insulin is a hormone released by the pancreas in response to increased levels of blood sugar (glucose) in the blood.

    [0223] The term type 1 diabetes, as used herein, refers to a chronic disease that occurs when the pancreas produces too little insulin to regulate blood sugar levels appropriately. Type 1 diabetes is also referred to as insulin-dependent diabetes mellitus, IDDM, and juvenile onset diabetes. People with type I diabetes (insulin-dependent diabetes) produce little or no insulin at all. Although about 6 percent of the United States population has some form of diabetes, only about 10 percent of all diabetics have type I disorder. Most people who have type I diabetes developed the disorder before age 30. Type 1 diabetes represents is the result of a progressive autoimmune destruction of the pancreatic f-cells with subsequent insulin deficiency. More than 90 percent of the insulin-producing cells (beta cells) of the pancreas are permanently destroyed. The resulting insulin deficiency is severe, and to survive, a person with type I diabetes must regularly inject insulin.

    [0224] In type II diabetes (also referred to as noninsulin-dependent diabetes mellitus, NDDM), the pancreas continues to manufacture insulin, sometimes even at higher than normal levels. However, the body develops resistance to its effects, resulting in a relative insulin deficiency. Type II diabetes may occur in children and adolescents but usually begins after age 30 and becomes progressively more common with age: about 15 percent of people over age 70 have type II diabetes. Obesity is a risk factor for type II diabetes, and 80 to 90 percent of the people with this disorder are obese.

    [0225] In some embodiments, diabetes includes pre-diabetes. Pre-diabetes refers to one or more early diabetic conditions including impaired glucose utilization, abnormal or impaired fasting glucose levels, impaired glucose tolerance, impaired insulin sensitivity and insulin resistance. Prediabetes is a major risk factor for the development of type 2 diabetes mellitus, cardiovascular disease and mortality. Much focus has been given to developing therapeutic interventions that prevent the development of type 2 diabetes by effectively treating prediabetes.

    [0226] Diabetes can be diagnosed by the administration of a glucose tolerance test. Clinically, diabetes is often divided into several basic categories. Primary examples of these categories include, autoimmune diabetes mellitus, non-insulin-dependent diabetes mellitus (type 1 NDDM), insulin-dependent diabetes mellitus (type 2 IDDM), non-autoimmune diabetes mellitus, non-insulin-dependent diabetes mellitus (type 2 NIDDM), and maturity-onset diabetes of the young (MODY). A further category, often referred to as secondary, refers to diabetes brought about by some identifiable condition which causes or allows a diabetic syndrome to develop. Examples of secondary categories include, diabetes caused by pancreatic disease, hormonal abnormalities, drug- or chemical-induced diabetes, diabetes caused by insulin receptor abnormalities, diabetes associated with genetic syndromes, and diabetes of other causes. (see e.g., Harrison's (1996) 14th ed., New York, McGraw-Hill).

    [0227] Therapeutically effective amount, as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject having a DPP4-associated disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating, or maintaining the existing disease or one or more symptoms of disease). The therapeutically effective amount may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated.

    [0228] Prophylactically effective amount, as used herein, is intended to include the amount of a RNAi agent that, when administered to a subject having a DPP4-associated disorder, e.g., a metabolic disease, e.g., diabetes or lipid metabolism disorders, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The prophylactically effective amount may vary depending on the RNAi agent, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

    [0229] A therapeutically-effective amount or prophylacticaly effective amount also includes an amount of a RNAi agent that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. A RNAi agent employed in the methods of the present disclosure may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.

    [0230] The phrase pharmaceutically acceptable is employed herein to refer to those compounds, materials, compositions, or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

    [0231] The phrase pharmaceutically-acceptable carrier as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be acceptable in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations. Pharmaceutically acceptable carriers for pulmonary delivery are known in the art and will vary depending on the desired location for deposition of the agent, e.g., upper or lower respiratory system, and the type of device to be used for delivery, e.g., sprayer, nebulizer, dry powder inhaler.

    [0232] As used herein, respiratory system is understood as the structures through which air moves from outside the body into the lungs and back out, e.g., the mouth, nose and nasal cavity, sinus, trachea, pharynyx, larynx, bronchial tubes/bronchi, bronchioles, alveoli, and vasculature, e.g., capillaries, hematopoietic cells, lymphatics, and lungs, and the cells, tissues, and fluids present therein.

    [0233] As used herein, delivery by inhalation and the like include delivery by inhalation through the nose or mouth, including intratracheal administration. Delivery by inhalation typically is performed using a device, e.g., inhaler, sprayer, nebulizer, that is selected, in part, based on the location that the agent is to be delivered, e.g., nose, mouth, lungs, and the type of material to be delivered, e.g., drops, mist, dry powder.

    [0234] The term sample, as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, bronchial fluids, sputum, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, sputum, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs.

    II. RNAi Agents of the Disclosure

    [0235] Described herein are RNAi agents which inhibit the expression of a DPP4 gene. In one embodiment, the RNAi agent includes double stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of a DPP4 gene in a cell, such as a cell within a subject, e.g., a mammal, such as a human, e.g., a subject having a DPP4-associated disorder, e.g., a metabolic disease, e.g., diabetes or lipid metabolism disorders, or a subject at risk of a DPP4-associated disease.

    [0236] The dsRNA includes an antisense strand having a region of complementarity which is complementary to at least a part of a target RNA, e.g., an mRNA formed in the expression of a DPP4 gene. The region of complementarity is about 15-30 nucleotides or less in length. Upon contact with a cell expressing the DPP4 gene, the RNAi agent inhibits the expression of the DPP4 gene (e.g., a human gene, a primate gene, a non-primate gene) by at least 50% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, western blotting or flowcytometric techniques. In certain embodiments, inhibition of expression is by at least 50% as assayed by the Dual-Glo lucifierase assay in Example lwhere the siRNA is at a 10 nM concentration.

    [0237] A dsRNA includes two RNA strands that are complementary and hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence. For example, the target sequence can be derived from the sequence of an mRNA formed during the expression of a DPP4 gene. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. As described elsewhere herein and as known in the art, the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides.

    [0238] Generally, the duplex structure is 15 to 30 base pairs in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. In certain embodiments, the duplex structure is 18 to 25 base pairs in length, e.g., 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-25, 20-24,20-23, 20-22, 20-21, 21-25, 21-24, 21-23, 21-22, 22-25, 22-24, 22-23, 23-25, 23-24 or 24-25 base pairs in length, for example, 19-21 basepairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.

    [0239] Similarly, the region of complementarity to the target sequence is 15 to 30 nucleotides in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, for example 19-23 nucleotides in length or 21-23 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.

    [0240] In some embodiments, the dsRNA is 15 to 23 nucleotides in length, or 25 to 30 nucleotides in length. In general, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNAs longer than about 21-23 nucleotides can serve as substrates for Dicer. As the ordinarily skilled person will also recognize, the region of an RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule. Where relevant, a part of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to allow it to be a substrate for RNAi-directed cleavage (i.e., cleavage through a RISC pathway).

    [0241] One of skill in the art will also recognize that the duplex region is a primary functional portion of a dsRNA, e.g., a duplex region of about 15 to 36 base pairs, e.g., 15-36, 15-35, 15-34, 15-33, 15-32, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs, for example, 19-21 base pairs. Thus, in one embodiment, to the extent that it becomes processed to a functional duplex, of e.g., 15-30 base pairs, that targets a desired RNA for cleavage, an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA. Thus, an ordinarily skilled artisan will recognize that in one embodiment, a miRNA is a dsRNA. In another embodiment, a dsRNA is not a naturally occurring miRNA. In another embodiment, a RNAi agent useful to target DPP4 expression is not generated in the target cell by cleavage of a larger dsRNA.

    [0242] A dsRNA as described herein can further include one or more single-stranded nucleotide overhangs e.g., 1, 2, 3, or 4 nucleotides. A nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5-end, 3-end or both ends of either an antisense or sense strand of a dsRNA. In certain embodiments, longer, extended overhangs are possible.

    [0243] A dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.

    [0244] iRNA compounds of the invention may be prepared using a two-step procedure. First, the individual strands of the double stranded RNA molecule are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide strands comprising unnatural or modified nucleotides can be easily prepared. Single-stranded oligonucleotides of the invention can be prepared using solution-phase or solid-phase organic synthesis or both.

    [0245] An siRNA can be produced, e.g., in bulk, by a variety of methods. Exemplary methods include: organic synthesis and RNA cleavage, e.g., in vitro cleavage.

    [0246] An siRNA can be made by separately synthesizing a single stranded RNA molecule, or each respective strand of a double-stranded RNA molecule, after which the component strands can then be annealed.

    [0247] A large bioreactor, e.g., the OligoPilot II from Pharmacia Biotec AB (Uppsala Sweden), can be used to produce a large amount of a particular RNA strand for a given siRNA. The OligoPilotII reactor can efficiently couple a nucleotide using only a 1.5 molar excess of a phosphoramidite nucleotide. To make an RNA strand, ribonucleotides amidites are used. Standard cycles of monomer addition can be used to synthesize the 21 to 23 nucleotide strand for the siRNA. Typically, the two complementary strands are produced separately and then annealed, e.g., after release from the solid support and deprotection.

    [0248] Organic synthesis can be used to produce a discrete siRNA species. The complementary of the species to a DPP4 gene can be precisely specified. For example, the species may be complementary to a region that includes a polymorphism, e.g., a single nucleotide polymorphism. Further the location of the polymorphism can be precisely defined. In some embodiments, the polymorphism is located in an internal region, e.g., at least 4, 5, 7, or 9 nucleotides from one or both of the termini.

    [0249] In one embodiment, RNA generated is carefully purified to remove endsiRNA is cleaved in vitro into siRNAs, for example, using a Dicer or comparable RNAse III-based activity. For example, the dsiRNA can be incubated in an in vitro extract from Drosophila or using purified components, e.g., a purified RNAse or RISC complex (RNA-induced silencing complex). See, e.g., Ketting et al. Genes Dev 2001 Oct. 15; 15(20):2654-9 and Hammond Science 2001 Aug. 10; 293(5532):1146-50.

    [0250] dsiRNA cleavage generally produces a plurality of siRNA species, each being a particular 21 to 23 nucleotide fragment of a source dsiRNA molecule. For example, siRNAs that include sequences complementary to overlapping regions and adjacent regions of a source dsiRNA molecule may be present.

    [0251] Regardless of the method of synthesis, the siRNA preparation can be prepared in a solution (e.g., an aqueous or organic solution) that is appropriate for formulation. For example, the siRNA preparation can be precipitated and redissolved in pure double-distilled water, and lyophilized. The dried siRNA can then be resuspended in a solution appropriate for the intended formulation process.

    [0252] In one aspect, a dsRNA of the disclosure includes at least two nucleotide sequences, a sense sequence and an antisense sequence. The sense strand sequence for DPP4 may be selected from the group of sequences provided in any one of Tables 2-3 and 5-6, and the corresponding nucleotide sequence of the antisense strand of the sense strand may be selected from the group of sequences of any one of Tables 2-3 and 5-6. In this aspect, one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of a DPP4 gene. As such, in this aspect, a dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand (passenger strand) in any one of Tables 2-3 and 5-6, and the second oligonucleotide is described as the corresponding antisense strand (guide strand) of the sense strand in any one of Tables 2-3 and 5-6 for DPP4.

    [0253] In one embodiment, the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides. In another embodiment, the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.

    [0254] It will be understood that, although the sequences provided herein are described as modified or conjugated sequences, the RNA of the RNAi agent of the disclosure e.g., a dsRNA of the disclosure, may comprise any one of the sequences set forth in any one of Tables 2-3 and 5-6 that is un-modified, un-conjugated, or modified or conjugated differently than described therein. One or more lipophilic ligands or one or more GalNAc ligands can be included in any of the positions of the RNAi agents provided in the instant application.

    [0255] The skilled person is well aware that dsRNAs having a duplex structure of about 20 to 23 base pairs, e.g., 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., (2001) EMBO J., 20:6877-6888). However, others have found that shorter or longer RNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided herein, dsRNAs described herein can include at least one strand of a length of minimally 21 nucleotides. It can be reasonably expected that shorter duplexes minus only a few nucleotides on one or both ends can be similarly effective as compared to the dsRNAs described above. Hence, dsRNAs having a sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides derived from one of the sequences provided herein, and differing in their ability to inhibit the expression of a DPP4 gene by not more than 10, 15, 20, 25, or 30% inhibition from a dsRNA comprising the full sequence using the in vitro assay with Cos 7 and a 10 nM concentration of the RNA agent and the PCR assay as provided in the examples herein, are contemplated to be within the scope of the present disclosure.

    [0256] In addition, the RNAs described herein identify a site(s) in a DPP4 transcript that is susceptible to RISC-mediated cleavage. As such, the present disclosure further features RNAi agents that target within this site(s). As used herein, a RNAi agent is said to target within a particular site of an RNA transcript if the RNAi agent promotes cleavage of the transcript anywhere within that particular site. Such a RNAi agent will generally include at least about 15 contiguous nucleotides, such as at least 19 nucleotides, from one of the sequences provided herein coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in a DPP4 gene.

    [0257] An RNAi agent as described herein can contain one or more mismatches to the target sequence. In one embodiment, an RNAi agent as described herein contains no more than 3 mismatches (i.e., 3, 2, 1, or 0 mismatches). In one embodiment, an RNAi agent as described herein contains no more than 2 mismatches. In one embodiment, an RNAi agent as described herein contains no more than 1 mismatch. In one embodiment, an RNAi agent as described herein contains 0 mismatches. In certain embodiments, if the antisense strand of the RNAi agent contains mismatches to the target sequence, the mismatch can optionally be restricted to be within the last 5 nucleotides from either the 5- or 3-end of the region of complementarity. For example, in such embodiments, for a 23 nucleotide RNAi agent, the strand which is complementary to a region of a DPP4 gene generally does not contain any mismatch within the central 13 nucleotides. The methods described herein or methods known in the art can be used to determine whether an RNAi agent containing a mismatch to a target sequence is effective in inhibiting the expression of a DPP4 gene. Consideration of the efficacy of RNAi agents with mismatches in inhibiting expression of a DPP4 gene is important, especially if the particular region of complementarity in a DPP4 gene is known to mutate.

    III. Modified RNAi Agents of the Disclosure

    [0258] In one embodiment, the RNA of the RNAi agent of the disclosure e.g., a dsRNA, is un-modified, and does not comprise, e.g., chemical modifications or conjugations known in the art and described herein. In certain embodiments, the RNA of an RNAi agent of the disclosure, e.g., a dsRNA, is chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the disclosure, substantially all of the nucleotides of an RNAi agent of the disclosure are modified. In other embodiments of the disclosure, all of the nucleotides of an RNAi agent of the disclosure are modified. RNAi agents of the disclosure in which substantially all of the nucleotides are modified are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides. In still other embodiments of the disclosure, RNAi agents of the disclosure can include not more than 5, 4, 3, 2 or 1 modified nucleotides.

    [0259] The nucleic acids featured in the disclosure can be synthesized or modified by methods well established in the art, such as those described in Current protocols in nucleic acid chemistry, Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5-end modifications (phosphorylation, conjugation, inverted linkages) or 3-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2-position or 4-position) or replacement of the sugar; or backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of RNAi agents useful in the embodiments described herein include, but are not limited to, RNAs containing modified backbones or no natural internucleoside linkages. RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified RNAi agent will have a phosphorus atom in its internucleoside backbone.

    [0260] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3-5 linkages, 2-5-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3-5 to 5-3 or 2-5 to 5-2. Various salts, e.g., sodium salts, mixed salts and free acid forms are also included.

    [0261] Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Pat. RE39464, the entire contents of each of which are hereby incorporated herein by reference.

    [0262] Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH.sub.2 component parts.

    [0263] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.

    [0264] In other embodiments, suitable RNA mimetics are contemplated for use in RNAi agents, in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the RNAi agents of the disclosure are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

    [0265] Some embodiments featured in the disclosure include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular CH.sub.2NHCH.sub.2, CH.sub.2N(CH.sub.3)OCH.sub.2 [known as a methylene (methylimino) or MMI backbone], CH.sub.2ON(CH.sub.3)CH.sub.2, CH.sub.2N(CH.sub.3)N(CH.sub.3)CH.sub.2 and N(CH.sub.3)CH.sub.2CH.sub.2 of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the RNAs featured herein have morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506. The native phosphodiester backbone can be represented as 0-P(O)(OH)OCH2-.

    [0266] Modified RNAs can also contain one or more substituted sugar moieties. The RNAi agents, e.g., dsRNAs, featured herein can include one of the following at the 2-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).Math..sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2 position: C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of a RNAi agent, or a group for improving the pharmacodynamic properties of a RNAi agent, and other substituents having similar properties. In some embodiments, the modification includes a 2-methoxyethoxy (2-OCH.sub.2CH.sub.2OCH.sub.3, also known as 2-O-(2-methoxyethyl) or 2-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2-dimethylaminooxyethoxy, i.e., a O(CH.sub.2)20N(CH.sub.3).sub.2 group, also known as 2-DMAOE, as described in examples herein below, and 2-dimethylaminoethoxyethoxy (also known in the art as 2-O-dimethylaminoethoxyethyl or 2-DMAEOE), i.e., 2-OCH.sub.2OCH.sub.2N(CH.sub.3)2. Further exemplary modifications include: 5-Me-2-F nucleotides, 5-Me-2-OMe nucleotides, 5-Me-2-deoxynucleotides, (both R and S isomers in these three families); 2-alkoxyalkyl; and 2-NMA (N-methylacetamide).

    [0267] Other modifications include 2-methoxy (2-OCH.sub.3), 2-aminopropoxy (2-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), 2-O-hexadecyl, and 2-fluoro (2-F). Similar modifications can also be made at other positions on the RNA of a RNAi agent, particularly the 3 position of the sugar on the 3 terminal nucleotide or in 2-5 linked dsRNAs and the 5 position of 5 terminal nucleotide. RNAi agents can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference.

    [0268] An RNAi agent of the disclosure can also include nucleobase (often referred to in the art simply as base) modifications or substitutions. As used herein, unmodified or natural nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2-O-methoxyethyl sugar modifications.

    [0269] Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

    [0270] An RNAi agent of the disclosure can also be modified to include one or more bicyclic sugar moities. A bicyclic sugar is a furanosyl ring modified by a ring formed by the bridging of two carbons, whether adjacent or non-adjacent. A bicyclic nucleoside (BNA) is a nucleoside having a sugar moiety comprising a ring formed by bridging two carbons, whether adjacent or non-adjacent, of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4-carbon and the 2-carbon of the sugar ring, optionally, via the 2-acyclic oxygen atoms. Thus, in some embodiments an agent of the disclosure may include one or more locked nucleic acids (LNA). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2 and 4 carbons. In other words, an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4-CH2-O-2 bridge. This structure effectively locks the ribose in the 3-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the disclosure include without limitation nucleosides comprising a bridge between the 4 and the 2 ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agents of the disclosure include one or more bicyclic nucleosides comprising a 4 to 2 bridge.

    [0271] A locked nucleoside can be represented by the structure (omitting stereochemistry),

    ##STR00003## [0272] wherein B is a nucleobase or modified nucleobase and L is the linking group that joins the 2-carbon to the 4-carbon of the ribose ring. Examples of such 4 to 2 bridged bicyclic nucleosides, include but are not limited to 4-(CH2)-O-2 (LNA); 4-(CH2)-S-2; 4-(CH2)2-O-2 (ENA); 4-CH(CH3)-O-2 (also referred to as constrained ethyl or cEt) and 4-CH(CH2OCH3)-O-2 (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4-C(CH3)(CH3)-O-2 (and analogs thereof; see e.g., U.S. Pat. No. 8,278,283); 4-CH2-N(OCH3)-2 (and analogs thereof; see e.g., U.S. Pat. No. 8,278,425); 4-CH2-ON(CH3)-2 (see, e.g., U.S. Patent Publication No. 2004/0171570); 4-CH2-N(R)O-2, wherein R is H, C1-C12 alkyl, or a nitrogen protecting group (see, e.g., U.S. Pat. No. 7,427,672); 4-CH2-C(H)(CH3)-2 (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4-CH2-C(CH2)-2 (and analogs thereof; see, e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.

    [0273] Additional representative US patents and US patenttent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008/0039618; and US 2009/0012281, the entire contents of each of which are hereby incorporated herein by reference.

    [0274] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example -L-ribofuranose and -D-ribofuranose (see WO 99/14226).

    [0275] An RNAi agent of the disclosure can also be modified to include one or more constrained ethyl nucleotides. As used herein, a constrained ethyl nucleotide or cEt is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4-CH(CH3)-O-2 bridge (i.e., L in the preceding structure). In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as S-cEt.

    [0276] An RNAi agent of the disclosure may also include one or more conformationally restricted nucleotides (CRN). CRN are nucleotide analogs with a linker connecting the C2 and C4 carbons of ribose or the C3 and C5 carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.

    [0277] Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, US 2013/0190383; and WO 2013/036868, the entire contents of each of which are hereby incorporated herein by reference.

    [0278] In some embodiments, a RNAi agent of the disclosure comprises one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked sugar residue. In one example, UNA also encompasses monomer with bonds between C1-C4 have been removed (i.e. the covalent carbon-oxygen-carbon bond between the C1 and C4 carbons). In another example, the C2-C3 bond (i.e. the covalent carbon-carbon bond between the C2 and C3 carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference).

    [0279] Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Pat. No. 8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.

    [0280] Potentially stabilizing modifications to the ends of RNA molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3-phosphate, inverted base dT (idT) and others. Disclosure of this modification can be found in WO 2011/005861.

    [0281] Other modifications of a RNAi agent of the disclosure include a 5 phosphate or 5 phosphate mimic, e.g., a 5-terminal phosphate or phosphate mimic on the antisense strand of a RNAi agent. Suitable phosphate mimics are disclosed in, for example US 2012/0157511, the entire contents of which are incorporated herein by reference.

    [0282] A. Modified RNAi Agents Comprising Motifs of the Disclosure

    [0283] In certain aspects of the disclosure, the double-stranded RNAi agents of the disclosure include agents with chemical modifications as disclosed, for example, in WO 2013/075035, the entire contents of which are incorporated herein by reference. As shown herein and in WO 2013/075035, one or more motifs of three identical modifications on three consecutive nucleotides may be introduced into a sense strand or antisense strand of an RNAi agent, particularly at or near the cleavage site. In some embodiments, the sense strand and antisense strand of the RNAi agent may otherwise be completely modified. The introduction of these motifs interrupts the modification pattern, if present, of the sense or antisense strand. The RNAi agent may be optionally conjugated with a lipophilic ligand, e.g., a C16 ligand, for instance on the sense strand. The RNAi agent may be optionally modified with a (S)-glycol nucleic acid (GNA) modification, for instance on one or more residues of the antisense strand.

    [0284] Accordingly, the disclosure provides double stranded RNAi agents capable of inhibiting the expression of a targetgenome or gene (i.e., a DPP4 gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent may be 15-30 nucleotides in length. For example, each strand may be 16-30 nucleotides in length, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length. In certain embodiments, each strand is 19-23 nucleotides in length.

    [0285] The sense strand and antisense strand typically form a duplex double stranded RNA (dsRNA), also referred to herein as an RNAi agent. The duplex region of an RNAi agent may be 15-30 nucleotide pairs in length. For example, the duplex region can be 16-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17-23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length. In certain embodiments, the duplex region is 19-21 nucleotide pairs in length.

    [0286] In one embodiment, the RNAi agent may contain one or more overhang regions or capping groups at the 3-end, 5-end, or both ends of one or both strands. The overhang can be 1-6 nucleotides in length, for instance 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length. In certain embodiments, the nucleotide overhang region is 2 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence. The first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers.

    [0287] In one embodiment, the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2-sugar modified, such as, 2-F, 2-O-methyl, thymidine (T), and any combinations thereof.

    [0288] For example, TT can be an overhang sequence for either end on either strand. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.

    [0289] The 5- or 3-overhangs at the sense strand, antisense strand or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different. In one embodiment, the overhang is present at the 3-end of the sense strand, antisense strand, or both strands. In one embodiment, this 3-overhang is present in the antisense strand. In one embodiment, this 3-overhang is present in the sense strand.

    [0290] The RNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability. For example, the single-stranded overhang may be located at the 3-terminal end of the sense strand or, alternatively, at the 3-terminal end of the antisense strand. The RNAi may also have a blunt end, located at the 5-end of the antisense strand (i.e., the 3-end of the sense strand) or vice versa. Generally, the antisense strand of the RNAi has a nucleotide overhang at the 3-end, and the 5-end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5-end of the antisense strand and 3-end overhang of the antisense strand favor the guide strand loading into RISC process.

    [0291] In one embodiment, the RNAi agent is a double blunt-ended of 19 nucleotides in length, wherein the sense strand contains at least one motif of three 2-F modifications on three consecutive nucleotides at positions 7, 8, and 9 from the 5end. The antisense strand contains at least one motif of three 2-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5end.

    [0292] In another embodiment, the RNAi agent is a double blunt-ended of 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2-F modifications on three consecutive nucleotides at positions 8, 9, and 10 from the 5end. The antisense strand contains at least one motif of three 2-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5end.

    [0293] In yet another embodiment, the RNAi agent is a double blunt-ended of 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2-F modifications on three consecutive nucleotides at positions 9, 10, and 11 from the 5end. The antisense strand contains at least one motif of three 2-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5end.

    [0294] In one embodiment, the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2-F modifications on three consecutive nucleotides at positions 9, 10, and 11 from the 5end; the antisense strand contains at least one motif of three 2-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang. In one example, the two nucleotide overhang is at the 3-end of the antisense strand. When the 2 nucleotide overhang is at the 3-end of the antisense strand, there may be two phosphorothioate internucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. In one embodiment, the RNAi agent additionally has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5-end of the sense strand and at the 5-end of the antisense strand. In one embodiment, every nucleotide in the sense strand and the antisense strand of the RNAi agent, including the nucleotides that are part of the motifs are modified nucleotides. In one embodiment each residue is independently modified with a 2O-methyl or 2-fluoro, e.g., in an alternating motif. Optionally, the RNAi agent further comprises a ligand (e.g., a lipophilic ligand, optionally a C16 ligand).

    [0295] In one embodiment, the RNAi agent comprises a sense and an antisense strand, wherein the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5 terminal nucleotide (position 1) positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; the antisense strand is 36-66 nucleotide residues in length and, starting from the 3 terminal nucleotide, comprises at least 8 ribonucleotides in the positions paired with positions 1-23 of sense strand to form a duplex; wherein at least the 3 terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3 terminal nucleotides are unpaired with sense strand, thereby forming a 3 single stranded overhang of 1-6 nucleotides; wherein the 5 terminus of antisense strand comprises from 10-30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10-30 nucleotide single stranded 5 overhang; wherein at least the sense strand 5 terminal and 3 terminal nucleotides are base paired with nucleotides of antisense strand when sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplexed region between sense and antisense strands; and antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when the double stranded nucleic acid is introduced into a mammalian cell; and wherein the sense strand contains at least one motif of three 2-F modifications on three consecutive nucleotides, where at least one of the motifs occurs at or near the cleavage site. The antisense strand contains at least one motif of three 2-O-methyl modifications on three consecutive nucleotides at or near the cleavage site.

    [0296] In one embodiment, the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucleotides and a second strand having a length which is at most 30 nucleotides with at least one motif of three 2-O-methyl modifications on three consecutive nucleotides at position 11, 12, and 13 from the 5 end; wherein the 3 end of the first strand and the 5 end of the second strand form a blunt end and the second strand is 1-4 nucleotides longer at its 3 end than the first strand, wherein the duplex region region which is at least 25 nucleotides in length, and the second strand is sufficiently complementary to a target mRNA along at least 19 nucleotide of the second strand length to reduce target gene expression when the RNAi agent is introduced into a mammalian cell, and wherein dicer cleavage of the RNAi agent results in an siRNA comprising the 3 end of the second strand, thereby reducing expression of the target gene in the mammal. Optionally, the RNAi agent further comprises a ligand.

    [0297] In one embodiment, the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand.

    [0298] In one embodiment, the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand.

    [0299] For an RNAi agent having a duplex region of 17-23 nucleotide in length, the cleavage site of the antisense strand is typically around the 10, 11 and 12 positions from the 5-end. Thus the motifs of three identical modifications may occur at the 9, 10, and 11 positions; 10, 11, and 12 positions; 11, 12, and 13 positions; 12, 13, and 14 positions; or 13, 14, and 15 positions of the antisense strand, the count starting from the first nucleotide from the 5-end of the antisense strand, or, the count starting from the first paired nucleotide within the duplex region from the 5-end of the antisense strand. The cleavage site in the antisense strand may also change according to the length of the duplex region of the RNAi from the 5-end.

    [0300] The sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand. When the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.

    [0301] In one embodiment, the sense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides. The first motif may occur at or near the cleavage site of the strand and the other motifs may be a wing modification. The term wing modification herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand. The wing modification is either adajacent to the first motif or is separated by at least one or more nucleotides. When the motifs are immediately adjacent to each other then the chemistry of the motifs are distinct from each other and when the motifs are separated by one or more nucleotide than the chemistries can be the same or different. Two or more wing modifications may be present. For instance, when two wing modifications are present, each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif.

    [0302] Like the sense strand, the antisense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides, with at least one of the motifs occurring at or near the cleavage site of the strand. This antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications that may be present on the sense strand.

    [0303] In one embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3-end, 5-end or both ends of the strand.

    [0304] In another embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3-end, 5-end or both ends of the strand.

    [0305] When the sense strand and the antisense strand of the RNAi agent each contain at least one wing modification, the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two or three nucleotides.

    [0306] When the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications, the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex region, having an overlap of one, two or three nucleotides; two modifications each from one strand fall on the other end of the duplex region, having an overlap of one, two or three nucleotides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two, or three nucleotides in the duplex region.

    [0307] In one embodiment, the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mismatch may occur in the overhang region or the duplex region. The base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.

    [0308] In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5-end of the antisense strand independently selected from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5-end of the duplex.

    [0309] In one embodiment, the nucleotide at the 1 position within the duplex region from the 5-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5-end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5-end of the antisense strand is an AU base pair.

    [0310] In another embodiment, the nucleotide at the 3-end of the sense strand is deoxythimidine (dT). In another embodiment, the nucleotide at the 3-end of the antisense strand is deoxythimidine (dT). In one embodiment, there is a short sequence of deoxythimidine nucleotides, for example, two dT nucleotides on the 3-end of the sense or antisense strand.

    [0311] In one embodiment, the sense strand sequence may be represented by formula (I):


    5n.sub.p-N.sub.a-(X X X).sub.i-N.sub.b-Y Y Y-N.sub.b-(Z Z Z).sub.j-N.sub.a-n.sub.q3(I) [0312] wherein: [0313] i and j are each independently 0 or 1; [0314] p and q are each independently 0-6; [0315] each N.sub.a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; [0316] each N.sub.b independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; [0317] each n.sub.p and n.sub.q independently represent an overhang nucleotide; [0318] wherein N.sub.b and Y do not have the same modification; and [0319] XXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides. In one embodiment, YYY is all 2-F modified nucleotides.

    [0320] In one embodiment, the N.sub.a or N.sub.b comprise modifications of alternating pattern.

    [0321] In one embodiment, the YYY motif occurs at or near the cleavage site of the sense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotides in length, the YYY motif can occur at or the vicinity of the cleavage site (e.g.: can occur at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11, 12 or 11, 12, 13) ofthe sense strand, the count starting from the 1 nucleotide, from the 5-end; or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5-end.

    [0322] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. The sense strand can therefore be represented by the following formulas:


    5n.sub.p-N.sub.a-YYYN.sub.b-ZZZN.sub.a-n.sub.q3(Ib);


    5n.sub.p-N.sub.a-XXXN.sub.b-YYYN.sub.a-n.sub.q3(Ic); or


    5n.sub.p-N.sub.a-XXXN.sub.b-YYYN.sub.b-ZZZN.sub.a-n.sub.q3(Id).

    [0323] When the sense strand is represented by formula (Ib), N.sub.b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.

    [0324] Each N.sub.a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0325] When the sense strand is represented as formula (Ic), N.sub.b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0326] When the sense strand is represented as formula (Id), each N.sub.b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. In one embodiment, N.sub.b is 0, 1, 2, 3, 4, 5 or 6. Each N.sub.a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0327] Each of X, Y and Z may be the same or different from each other.

    [0328] In other embodiments, i is 0 and j is 0, and the sense strand may be represented by the formula:


    5n.sub.p-N.sub.a-YYY-N.sub.a-n.sub.q3(Ia).

    [0329] When the sense strand is represented by formula (Ia), each N.sub.a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0330] In one embodiment, the antisense strand sequence of the RNAi may be represented by formula (II):


    5n.sub.q-N.sub.a-(ZZZ).sub.k-N.sub.b-YYY-N.sub.b-(XXX).sub.l-N.sub.a-n.sub.p3(II) [0331] wherein: [0332] k and l are each independently 0 or 1; [0333] p and q are each independently 0-6;
    each N.sub.a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides,
    each sequence comprising at least two differently modified nucleotides;
    each N.sub.b independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;

    [0334] each n.sub.p and n.sub.q independently represent an overhang nucleotide;

    wherein N.sub.b and Y do not have the same modification; and
    XXX, YYY and ZZZeach independently represent one motif of three identical modifications on three consecutive nucleotides.

    [0335] In one embodiment, the N.sub.a or N.sub.b comprise modifications of alternating pattern.

    [0336] The YYY motif occurs at or near the cleavage site of the antisense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotide in length, the YYY motif can occur at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, with the count starting from the 1 nucleotide, from the 5-end; or optionally, the count starting at the 1 paired nucleotide within the duplex region, from the 5-end. In one embodiment, the YYY motif occurs at positions 11, 12, 13.

    [0337] In one embodiment, YYY motif is all 2-OMe modified nucleotides.

    [0338] In one embodiment, k is 1 and l is 0, or k is 0 and 1 is 1, or both k and l are 1.

    [0339] The antisense strand can therefore be represented by the following formulas:


    5n.sub.q-N.sub.a-ZZZ-N.sub.b-YYY-N.sub.a-n.sub.p,3(IIb);


    5n.sub.q-N.sub.a-YYY-N.sub.b-XXX-n.sub.p,3(IIc); or


    5n.sub.q-N.sub.a-ZZZ-N.sub.b-YYY-N.sub.b-XXX-N.sub.a-n.sub.p3(IId).

    [0340] When the antisense strand is represented by formula (IIb), N.sub.b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0341] When the antisense strand is represented as formula (IIc), N.sub.b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0342] When the antisense strand is represented as formula (IId), each N.sub.b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. In one embodiment, N.sub.b is 0, 1, 2, 3, 4, 5 or 6.

    [0343] In other embodiments, k is 0 and 1 is 0 and the antisense strand may be represented by the formula:


    5n.sub.p-N.sub.a-YYY-N.sub.a-n.sub.q,3(Ia).

    [0344] When the antisense strand is represented as formula (IIa), each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0345] Each of X, Y and Z may be the same or different from each other.

    [0346] Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, glycol nucleic acid (GNA), hexitol nucleic acid (HNA), 2-methoxyethyl, 2-O-methyl, 2-O-allyl, 2-C-allyl, 2-hydroxyl, or 2-fluoro. For example, each nucleotide of the sense strand and antisense strand is independently modified with 2-O-methyl or 2-fluoro. Each X, Y, Z, X, Y and Z, in particular, may represent a 2-O-methyl modification or a 2-fluoro modification.

    [0347] In one embodiment, the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex region is 21 nt, the count starting from the 1.sup.st nucleotide from the 5-end, or optionally, the count starting at the 1 paired nucleotide within the duplex region, from the 5-end; and Y represents 2-F modification. The sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2-OMe modification or 2-F modification.

    [0348] In one embodiment the antisense strand may contain YYY motif occurring at positions 11, 12, 13 of the strand, the count starting from the 1 nucleotide from the 5-end, or optionally, the count starting at the 1 paired nucleotide within the duplex region, from the 5-end; and Y represents 2-O-methyl modification. The antisense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2-OMe modification or 2-F modification.

    [0349] The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with a antisense strand being represented by any one of formulas (IIa), (IIb), (IIc), and (IId), respectively.

    [0350] Accordingly, the RNAi agents for use in the methods of the disclosure may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, the RNAi duplex represented by formula (III):


    sense: 5n.sub.p-N.sub.a-(X X X).sub.i-N.sub.b-Y Y Y-N.sub.b-(Z Z Z).sub.j-N.sub.a-n.sub.q3


    antisense: 3n.sub.p-N.sub.a-(XXX).sub.k-N.sub.b-YYY-N.sub.b-(ZZZ).sub.lN.sub.a-n.sub.q5(III) [0351] wherein: [0352] i, j, k, and 1 are each independently 0 or 1; [0353] p, p, q, and q are each independently 0-6; [0354] each N.sub.a and N.sub.a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; [0355] each N.sub.b and N.sub.b independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; [0356] wherein [0357] each n.sub.p, n.sub.p, n.sub.q, and n.sub.q, each of which may or may not be present, independently represents an overhang nucleotide; and [0358] XXX, YYY, ZZZ, XXX, YYY, and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides.

    [0359] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k is 1 and l is 0; k is 0 and 1 is 1; or both k and 1 are 0; or both k and 1 are 1.

    [0360] Exemplary combinations of the sense strand and antisense strand forming a RNAi duplex include the formulas below:


    5n.sub.p-N.sub.a-Y Y Y-N.sub.a-n.sub.q3


    3n.sub.p-N.sub.a-YYY-N.sub.an.sub.q5(IIIa)


    5n.sub.p-N.sub.a-Y Y Y-N.sub.b-Z Z Z-N.sub.a-n.sub.q3


    3n.sub.p-N.sub.a-YYY-N.sub.b-ZZZ-N.sub.an.sub.q5(IIIb)


    5n.sub.p-N.sub.a-X X X-N.sub.b-Y Y Y-N.sub.a-n.sub.q3


    3n.sub.p-N.sub.a-XXX-N.sub.b-YYY-N.sub.a-n.sub.q5(IIc)


    5n.sub.p-N.sub.a-X X X-N.sub.b-Y Y Y-N.sub.b-Z Z Z-N.sub.a-n.sub.q3


    3n.sub.p-N.sub.a-XXX-N.sub.b-YYY-N.sub.b-ZZZ-N.sub.a-n.sub.q5(IIId)

    [0361] When the RNAi agent is represented by formula (IIIa), each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0362] When the RNAi agent is represented by formula (IIIb), each N.sub.b independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucleotides. Each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0363] When the RNAi agent is represented as formula (IIIc), each N.sub.b, N.sub.b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.

    [0364] Each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

    [0365] When the RNAi agent is represented as formula (IIId), each N.sub.b, N.sub.b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a, N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Each of N.sub.a, N.sub.a, N.sub.b and N.sub.b independently comprises modifications of alternating pattern.

    [0366] In one embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2-O-methyl or 2-fluoro modifications. In another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2-O-methyl or 2-fluoro modifications and n.sub.p>0 and at least one n.sub.p is linked to a neighboring nucleotide a via phosphorothioate linkage. In yet another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2-O-methyl or 2-fluoro modifications, n.sub.p>0 and at least one n.sub.p is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense strand is conjugated to one or more C16 (or related) moieties attached through a bivalent or trivalent branched linker (described below). In another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2-O-methyl or 2-fluoro modifications, n.sub.p>0 and at least one n.sub.p is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more lipophilic, e.g., C16 (or related) moieties, optionally attached through a bivalent or trivalent branched linker.

    [0367] In one embodiment, when the RNAi agent is represented by formula (IIIa), the N.sub.a modifications are 2-O-methyl or 2-fluoro modifications, n.sub.p>0 and at least one n.sub.p is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more lipophilic, e.g., C16 (or related) moieties attached through a bivalent or trivalent branched linker.

    [0368] In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.

    [0369] In one embodiment, the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (III), (IIIa), (IIIb), (IIc), and (1 IId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.

    [0370] In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIc), and (IIId) are linked to each other at the 5 end, and one or both of the 3 ends and are optionally conjugated to to a ligand. Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites.

    [0371] Various publications describe multimeric RNAi agents that can be used in the methods of the disclosure. Such publications include WO2007/091269, WO2010/141511, WO2007/117686, WO2009/014887, and WO2011/031520; and U.S. Pat. No. 7,858,769, the entire contents of each of which are hereby incorporated herein by reference.

    [0372] In certain embodiments, the compositions and methods of the disclosure include a vinyl phosphonate (VP) modification of an RNAi agent as described herein. In exemplary embodiments, a 5-vinyl phosphonate modified nucleotide of the disclosure has the structure:

    ##STR00004##

    wherein X is O or S; [0373] R is hydrogen, hydroxy, fluoro, or C.sub.1-20alkoxy (e.g., methoxy or n-hexadecyloxy); [0374] R.sup.5 is C(H)P(O)(OH).sub.2 and the double bond between the C5 carbon and R.sup.5 is in the E or Z orientation (e.g., E orientation); and [0375] B is a nucleobase or a modified nucleobase, optionally where B is adenine, guanine, cytosine, thymine, or uracil.

    [0376] A vinyl phosphonate of the instant disclosure may be attached to either the antisense or the sense strand of a dsRNA of the disclosure. In certain embodiments, a vinyl phosphonate of the instant disclosure is attached to the antisense strand of a dsRNA, optionally at the 5 end of the antisense strand of the dsRNA.

    [0377] Vinyl phosphonate modifications are also contemplated for the compositions and methods of the instant disclosure. An exemplary vinyl phosphonate structure includes the preceding structure, where R5 is C(H)OP(O)(OH)2 and the double bond between the C5 carbon and R5 is in the E or Z orientation (e.g., E orientation).

    [0378] E. Thermally Destabilizing Modifications

    [0379] In certain embodiments, a dsRNA molecule can be optimized for RNA interference by incorporating thermally destabilizing modifications in the seed region of the antisense strand (i.e., at positions 2-9 of the 5-end of the antisense strand or at positions 2-8 of the 5-end of the antisense strand) to reduce or inhibit off-target gene silencing.

    [0380] The term thermally destabilizing modification(s) includes modification(s) that would result with a dsRNA with a lower overall melting temperature (Tm) than the Tm of the dsRNA without having such modification(s). For example, the thermally destabilizing modification(s) can decrease the Tm of the dsRNA by 1-4 C., such as one, two, three or four degrees Celcius. And, the term thermally destabilizing nucleotide refers to a nucleotide containing one or more thermally destabilizing modifications.

    [0381] It has been discovered that dsRNAs with an antisense strand comprising at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5 end, of the antisense strand have reduced off-target gene silencing activity. Accordingly, in some embodiments, the antisense strand comprises at least one (e.g., one, two, three, four, five or more) thermally destabilizing modification of the duplex within the first 9 nucleotide positions of the 5 region of the antisense strand. In some embodiments, one or more thermally destabilizing modification(s) of the duplex is/are located in positions 2-9, such as positions 4-8, from the 5-end of the antisense strand. In some further embodiments, the thermally destabilizing modification(s) of the duplex is/are located at position 6, 7 or 8 from the 5-end of the antisense strand. In still some further embodiments, the thermally destabilizing modification of the duplex is located at position 7 from the 5-end of the antisense strand. In some embodiments, the thermally destabilizing modification of the duplex is located at position 2, 3, 4, 5 or 9 from the 5-end of the antisense strand.

    [0382] The thermally destabilizing modifications can include, but are not limited to, abasic modification; mismatch with the opposing nucleotide in the opposing strand; and sugar modification such as 2-deoxy modification or acyclic nucleotide, e.g., unlocked nucleic acids (UNA) or glycol nucleic acid (GNA).

    [0383] Exemplified abasic modifications include, but are not limited to the following:

    ##STR00005##

    [0384] Wherein RH, Me, Et or OMe; RH, Me, Et or OMe; R=H, Me, Et or OMe

    ##STR00006##

    wherein B is a modified or unmodified nucleobase.

    [0385] Exemplified sugar modifications include, but are not limited to the following:

    ##STR00007##

    wherein B is a modified or unmodified nucleobase.

    [0386] In some embodiments the thermally destabilizing modification of the duplex is selected from the group consisting of:

    ##STR00008##

    wherein B is a modified or unmodified nucleobase and the asterisk on each structure represents either R, S or racemic.

    [0387] The term acyclic nucleotide refers to any nucleotide having an acyclic ribose sugar, for example, where any of bonds between the ribose carbons (e.g., C1-C2, C2-C3, C3-C4, C4-O4, or C1-O4) is absent or at least one of ribose carbons or oxygen (e.g., C1, C2, C3, C4, or O4) are independently or in combination absent from the nucleotide. In some embodiments, acyclic nucleotide

    ##STR00009##

    wherein B is a modified or unmodified nucleobase, R.sup.1 and R.sup.2 independently are H, halogen, OR.sub.3, or alkyl; and R.sub.3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar). The term UNA refers to unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked sugar residue. In one example, UNA also encompasses monomers with bonds between C1-C4 being removed (i.e. the covalent carbon-oxygen-carbon bond between the C1 and C4 carbons). In another example, the C2-C3 bond (i.e. the covalent carbon-carbon bond between the C2 and C3 carbons) of the sugar is removed (see Mikhailov et. al., Tetrahedron Letters, 26 (17): 2059 (1985); and Fluiter et al., Mol. Biosyst., 10: 1039 (2009), which are hereby incorporated by reference in their entirety). The acyclic derivative provides greater backbone flexibility without affecting the Watson-Crick pairings. The acyclic nucleotide can be linked via 2-5 or 3-5 linkage.

    [0388] The term GNA refers to glycol nucleic acid which is a polymer similar to DNA or RNA but differing in the composition of its backbone in that is composed of repeating glycerol units linked by phosphodiester bonds:

    ##STR00010##

    [0389] The thermally destabilizing modification of the duplex can be mismatches (i.e., noncomplementary base pairs) between the thermally destabilizing nucleotide and the opposing nucleotide in the opposite strand within the dsRNA duplex. Exemplary mismatch base pairs include G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, U:T, or a combination thereof. Other mismatch base pairings known in the art are also amenable to the present invention. A mismatch can occur between nucleotides that are either naturally occurring nucleotides or modified nucleotides, i.e., the mismatch base pairing can occur between the nucleobases from respective nucleotides independent of the modifications on the ribose sugars of the nucleotides. In certain embodiments, the dsRNA molecule contains at least one nucleobase in the mismatch pairing that is a 2-deoxy nucleobase; e.g., the 2-deoxy nucleobase is in the sense strand.

    [0390] In some embodiments, the thermally destabilizing modification of the duplex in the seed region of the antisense strand includes nucleotides with impaired Watson-Crick hydrogen-bonding W-C H-bonding to the complementary base on the target mRNA, such as modified nucleobases:

    ##STR00011##

    [0391] More examples of abasic nucleotide, acyclic nucleotide modifications (including UNA and GNA), and mismatch modifications have been described in detail in WO 2011/133876, which is herein incorporated by reference in its entirety.

    [0392] The thermally destabilizing modifications may also include universal base with reduced or abolished capability to form hydrogen bonds with the opposing bases, and phosphate modifications.

    [0393] In some embodiments, the thermally destabilizing modification of the duplex includes nucleotides with non-canonical bases such as, but not limited to, nucleobase modifications with impaired or completely abolished capability to form hydrogen bonds with bases in the opposite strand. These nucleobase modifications have been evaluated for destabilization of the central region of the dsRNA duplex as described in WO 2010/0011895, which is herein incorporated by reference in its entirety. Exemplary nucleobase modifications are:

    ##STR00012##

    [0394] In some embodiments, the thermally destabilizing modification of the duplex in the seed region of the antisense strand includes one or more -nucleotide complementary to the base on the target mRNA, such as:

    ##STR00013##

    wherein R is H, OH, OCH.sub.3, F, NH.sub.2, NHMe, NMe.sub.2 or O-alkyl.

    [0395] Exemplary phosphate modifications known to decrease the thermal stability of dsRNA duplexes compared to natural phosphodiester linkages are:

    ##STR00014##

    [0396] The alkyl for the R group can be a C.sub.1-C.sub.6alkyl. Specific alkyls for the R group include, but are not limited to methyl, ethyl, propyl, isopropyl, butyl, pentyl and hexyl.

    [0397] As the skilled artisan will recognize, in view of the functional role of nucleobases is defining specificity of a RNAi agent of the disclosure, while nucleobase modifications can be performed in the various manners as described herein, e.g., to introduce destabilizing modifications into a RNAi agent of the disclosure, e.g., for purpose of enhancing on-target effect relative to off-target effect, the range of modifications available and, in general, present upon RNAi agents of the disclosure tends to be much greater for non-nucleobase modifications, e.g., modifications to sugar groups or phosphate backbones of polyribonucleotides. Such modifications are described in greater detail in other sections of the instant disclosure and are expressly contemplated for RNAi agents of the disclosure, either possessing native nucleobases or modified nucleobases as described above or elsewhere herein.

    [0398] In addition to the antisense strand comprising a thermally destabilizing modification, the dsRNA can also comprise one or more stabilizing modifications. For example, the dsRNA can comprise at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications. Without limitations, the stabilizing modifications all can be present in one strand. In some embodiments, both the sense and the antisense strands comprise at least two stabilizing modifications. The stabilizing modification can occur on any nucleotide of the sense strand or antisense strand. For instance, the stabilizing modification can occur on every nucleotide on the sense strand or antisense strand; each stabilizing modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both stabilizing modification in an alternating pattern. The alternating pattern of the stabilizing modifications on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the stabilizing modifications on the sense strand can have a shift relative to the alternating pattern of the stabilizing modifications on the antisense strand.

    [0399] In some embodiments, the antisense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications. Without limitations, a stabilizing modification in the antisense strand can be present at any positions. In some embodiments, the antisense comprises stabilizing modifications at positions 2, 6, 8, 9, 14, and 16 from the 5-end. In some other embodiments, the antisense comprises stabilizing modifications at positions 2, 6, 14, and 16 from the 5-end. In still some other embodiments, the antisense comprises stabilizing modifications at positions 2, 14, and 16 from the 5-end.

    [0400] In some embodiments, the antisense strand comprises at least one stabilizing modification adjacent to the destabilizing modification. For example, the stabilizing modification can be the nucleotide at the 5-end or the 3-end of the destabilizing modification, i.e., at position 1 or +1 from the position of the destabilizing modification. In some embodiments, the antisense strand comprises a stabilizing modification at each of the 5-end and the 3-end of the destabilizing modification, i.e., positions 1 and +1 from the position of the destabilizing modification.

    [0401] In some embodiments, the antisense strand comprises at least two stabilizing modifications at the 3-end of the destabilizing modification, i.e., at positions+1 and +2 from the position of the destabilizing modification.

    [0402] In some embodiments, the sense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications. Without limitations, a stabilizing modification in the sense strand can be present at any positions. In some embodiments, the sense strand comprises stabilizing modifications at positions 7, 10, and 11 from the 5-end. In some other embodiments, the sense strand comprises stabilizing modifications at positions 7, 9, 10, and 11 from the 5-end. In some embodiments, the sense strand comprises stabilizing modifications at positions opposite or complimentary to positions 11, 12, and 15 of the antisense strand, counting from the 5-end of the antisense strand. In some other embodiments, the sense strand comprises stabilizing modifications at positions opposite or complimentary to positions 11, 12, 13, and 15 of the antisense strand, counting from the 5-end of the antisense strand. In some embodiments, the sense strand comprises a block of two, three, or four stabilizing modifications.

    [0403] In some embodiments, the sense strand does not comprise a stabilizing modification in position opposite or complimentary to the thermally destabilizing modification of the duplex in the antisense strand.

    [0404] Exemplary thermally stabilizing modifications include, but are not limited to, 2-fluoro modifications. Other thermally stabilizing modifications include, but are not limited to, LNA.

    [0405] In some embodiments, the dsRNA of the disclosure comprises at least four (e.g., four, five, six, seven, eight, nine, ten, or more) 2-fluoro nucleotides. Without limitations, the 2-fluoro nucleotides all can be present in one strand. In some embodiments, both the sense and the antisense strands comprise at least two 2-fluoro nucleotides. The 2-fluoro modification can occur on any nucleotide of the sense strand or antisense strand. For instance, the 2-fluoro modification can occur on every nucleotide on the sense strand or antisense strand; each 2-fluoro modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both 2-fluoro modifications in an alternating pattern. The alternating pattern of the 2-fluoro modifications on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the 2-fluoro modifications on the sense strand can have a shift relative to the alternating pattern of the 2-fluoro modifications on the antisense strand.

    [0406] In some embodiments, the antisense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) 2-fluoro nucleotides. Without limitations, a 2-fluoro modification in the antisense strand can be present at any positions. In some embodiments, the antisense comprises 2-fluoro nucleotides at positions 2, 6, 8, 9, 14, and 16 from the 5-end. In some other embodiments, the antisense comprises 2-fluoro nucleotides at positions 2, 6, 14, and 16 from the 5-end. In still some other embodiments, the antisense comprises 2-fluoro nucleotides at positions 2, 14, and 16 from the 5-end.

    [0407] In some embodiments, the antisense strand comprises at least one 2-fluoro nucleotide adjacent to the destabilizing modification. For example, the 2-fluoro nucleotide can be the nucleotide at the 5-end or the 3-end of the destabilizing modification, i.e., at position 1 or +1 from the position of the destabilizing modification. In some embodiments, the antisense strand comprises a 2-fluoro nucleotide at each of the 5-end and the 3-end of the destabilizing modification, i.e., positions 1 and +1 from the position of the destabilizing modification.

    [0408] In some embodiments, the antisense strand comprises at least two 2-fluoro nucleotides at the 3-end of the destabilizing modification, i.e., at positions+1 and +2 from the position of the destabilizing modification.

    [0409] In some embodiments, the sense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) 2-fluoro nucleotides. Without limitations, a 2-fluoro modification in the sense strand can be present at any positions. In some embodiments, the antisense comprises 2-fluoro nucleotides at positions 7, 10, and 11 from the 5-end. In some other embodiments, the sense strand comprises 2-fluoro nucleotides at positions 7, 9, 10, and 11 from the 5-end. In some embodiments, the sense strand comprises 2-fluoro nucleotides at positions opposite or complimentary to positions 11, 12, and 15 of the antisense strand, counting from the 5-end of the antisense strand. In some other embodiments, the sense strand comprises 2-fluoro nucleotides at positions opposite or complimentary to positions 11, 12, 13, and 15 of the antisense strand, counting from the 5-end of the antisense strand. In some embodiments, the sense strand comprises a block of two, three or four 2-fluoro nucleotides.

    [0410] In some embodiments, the sense strand does not comprise a 2-fluoro nucleotide in position opposite or complimentary to the thermally destabilizing modification of the duplex in the antisense strand.

    [0411] In some embodiments, the dsRNA molecule of the disclosure comprises a 21 nucleotides (nt) sense strand and a 23 nucleotides (nt) antisense, wherein the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide occurs in the seed region of the antisense strand (i.e., at position 2-8 of the 5-end of the antisense strand or at position 2-9 of the 5-end of the antisense strand), wherein one end of the dsRNA is blunt, while the other end is comprises a 2 nt overhang, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 6 2-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4, or 5 2-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2-fluoro modifications; and (vii) the dsRNA comprises a blunt end at 5-end of the antisense strand. in one embodiment, the two nucleotide overhang is at the 3-end of the antisense.

    [0412] In some embodiments, the dsRNA molecule of the disclosure comprising a sense and antisense strands, wherein: the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5 terminal nucleotide (position 1), positions 1 to 23 of said sense strand comprise at least 8 ribonucleotides; antisense strand is 36-66 nucleotide residues in length and, starting from the 3 terminal nucleotide, at least 8 ribonucleotides in the positions paired with positions 1-23 of sense strand to form a duplex; wherein at least the 3 terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3 terminal nucleotides are unpaired with sense strand, thereby forming a 3 single stranded overhang of 1-6 nucleotides; wherein the 5 terminus of antisense strand comprises from 10-30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10-30 nucleotide single stranded 5 overhang; wherein at least the sense strand 5 terminal and 3 terminal nucleotides are base paired with nucleotides of antisense strand when sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplexed region between sense and antisense strands; and antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when said double stranded nucleic acid is introduced into a mammalian cell; and wherein the antisense strand contains at least one thermally destabilizing nucleotide, where at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. at position 2-8 of the 5-end of the antisense strand or at position 2-9 of the 5-end of the antisense strand). For example, the thermally destabilizing nucleotide occurs between positions opposite or complimentary to positions 14-17 of the 5-end of the sense strand, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 6 2-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4, or 5 2-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2-fluoro modifications; and (vii) the dsRNA comprises a duplex region of 12-30 nucleotide pairs in length.

    [0413] In some embodiments, the dsRNA molecule of the disclosure comprises a sense and antisense strands, wherein said dsRNA molecule comprises a sense strand having a length which is at least 25 and at most 29 nucleotides and an antisense strand having a length which is at most 30 nucleotides with the sense strand comprises a modified nucleotide that is susceptible to enzymatic degradation at position 11 from the 5end, wherein the 3 end of said sense strand and the 5 end of said antisense strand form a blunt end and said antisense strand is 1-4 nucleotides longer at its 3 end than the sense strand, wherein the duplex region which is at least 25 nucleotides in length, and said antisense strand is sufficiently complementary to a target mRNA along at least 19 nt of said antisense strand length to reduce target gene expression when said dsRNA molecule is introduced into a mammalian cell, and wherein dicer cleavage of said dsRNA results in an siRNA comprising said 3 end of said antisense strand, thereby reducing expression of the target gene in the mammal, wherein the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. at position 2-8 of the 5-end of the antisense strand or at position 2-9 of the 5-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 6 2-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4, or 5 2-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2-fluoro modifications; and (vii) the dsRNA has a duplex region of 12-29 nucleotide pairs in length.

    [0414] In some embodiments, every nucleotide in the sense strand and antisense strand of the dsRNA molecule may be modified. Each nucleotide may be modified with the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2 hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with dephospho linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone.

    [0415] As nucleic acids are polymers of subunits, many of the modifications occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate moiety, or a non-linking O of a phosphate moiety. In some cases, the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not. By way of example, a modification may only occur at a 3 or 5 terminal position, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand. A modification may occur in a double strand region, a single strand region, or in both. A modification may occur only in the double strand region of an RNA or may only occur in a single strand region of an RNA. e.g., a phosphorothioate modification at a non-linking O position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini. The 5 end or ends can be phosphorylated.

    [0416] It may be possible, e.g., to enhance stability, to include particular bases in overhangs, or to include modified nucleotides or nucleotide surrogates, in single strand overhangs, e.g., in a 5 or 3 overhang, or in both. E.g., it can be desirable to include purine nucleotides in overhangs. In some embodiments all or some of the bases in a 3 or 5 overhang may be modified, e.g., with a modification described herein. Modifications can include, e.g., the use of modifications at the 2 position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, 2-deoxy-2-fluoro (2-F) or 2-O-methyl modified instead of the ribosugar of the nucleobase, and modifications in the phosphate group, e.g., phosphorothioate modifications. Overhangs need not be homologous with the target sequence.

    [0417] In some embodiments, each residue of the sense strand and antisense strand is independently modified with LNA, glycol nucleic acid (GNA), hexitol nucleic acid (HNA), 2-methoxyethyl, 2-O-methyl, 2-O-allyl, 2-C-allyl, 2-deoxy, or 2-fluoro. The strands can contain more than one modification. In some embodiments, each residue of the sense strand and antisense strand is independently modified with 2-O-methyl or 2-fluoro. It is to be understood that these modifications are in addition to the at least one thermally destabilizing modification of the duplex present in the antisense strand.

    [0418] At least two different modifications are typically present on the sense strand and antisense strand. Those two modifications may be the 2-deoxy, 2-O-methyl or 2-fluoro modifications, acyclic nucleotides or others. In some embodiments, the sense strand and antisense strand each comprises two differently modified nucleotides selected from 2-O-methyl or 2-deoxy. In some embodiments, each residue of the sense strand and antisense strand is independently modified with 2-O-methyl nucleotide, 2-deoxy nucleotide, 2-deoxy-2-fluoro nucleotide, 2-O-N-methylacetamido (2-O-NMA, 2O-CH2C(O)N(Me)H) nucleotide, a 2-O-dimethylaminoethoxyethyl (2-O-DMAEOE) nucleotide, 2-O-aminopropyl (2-O-AP) nucleotide, or 2-ara-F nucleotide. Again, it is to be understood that these modifications are in addition to the at least one thermally destabilizing modification of the duplex present in the antisense strand.

    [0419] In some embodiments, the dsRNA molecule of the disclosure comprises modifications of an alternating pattern. The term alternating motif or alternative pattern as used herein refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of one strand. The alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern. For example, if A, B and C each represent one type of modification to the nucleotide, the alternating motif can be ABABABABABAB . . . , AABBAABBAABB . . . , AABAABAABAAB . . . , AAABAAABAAAB . . . , AAABBBAAABBB . . . , or ABCABCABCABC . . . , etc.

    [0420] The type of modifications contained in the alternating motif may be the same or different. For example, if A, B, C, D each represent one type of modification on the nucleotide, the alternating pattern, i.e., modifications on every other nucleotide, may be the same, but each of the sense strand or antisense strand can be selected from several possibilities of modifications within the alternating motif such as ABABAB . . . , ACACAC . . . BDBDBD . . . or CDCDCD . . . , etc.

    [0421] In some embodiments, the dsRNA molecule of the disclosure comprises the modification pattern for the alternating motif on the sense strand relative to the modification pattern for the alternating motif on the antisense strand is shifted. The shift may be such that the modified group of nucleotides of the sense strand corresponds to a differently modified group of nucleotides of the antisense strand and vice versa. For example, the sense strand when paired with the antisense strand in the dsRNA duplex, the alternating motif in the sense strand may start with ABABAB from 5-3 of the strand and the alternating motif in the antisense strand may start with BABABA from 3-5 of the strand within the duplex region. As another example, the alternating motif in the sense strand may start with AABBAABB from 5-3 of the strand and the alternating motif in the antisense strand may start with BBAABBAA from 3-5 of the strand within the duplex region, so that there is a complete or partial shift of the modification patterns between the sense strand and the antisense strand.

    [0422] The dsRNA molecule of the disclosure may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. The phosphorothioate or methylphosphonate internucleotide linkage modification may occur on any nucleotide of the sense strand or antisense strand or both in any position of the strand. For instance, the internucleotide linkage modification may occur on every nucleotide on the sense strand or antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both internucleotide linkage modifications in an alternating pattern. The alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the internucleotide linkage modification on the antisense strand.

    [0423] In some embodiments, the dsRNA molecule comprises the phosphorothioate or methylphosphonate internucleotide linkage modification in the overhang region. For example, the overhang region comprises two nucleotides having a phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides. Internucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within duplex region. For example, at least 2, 3, 4, or all the overhang nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate internucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide. For instance, there may be at least two phosphorothioate internucleotide linkages between the terminal three nucleotides, in which two of the three nucleotides are overhang nucleotides, and the third is a paired nucleotide next to the overhang nucleotide. In one embodiment, these terminal three nucleotides may be at the 3-end of the antisense strand.

    [0424] In some embodiments, the sense strand of the dsRNA molecule comprises 1-10 blocks of two to ten phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said sense strand is paired with an antisense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

    [0425] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of two phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

    [0426] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of three phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

    [0427] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of four phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

    [0428] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of five phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

    [0429] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of six phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

    [0430] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of seven phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, or 8 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

    [0431] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of eight phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, or 6 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

    [0432] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of nine phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, or 4 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

    [0433] In some embodiments, the dsRNA molecule of the disclosure further comprises one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1-10 nucleotides of the termini position(s) of the sense or antisense strand. For example, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage at one end or both ends of the sense or antisense strand.

    [0434] In some embodiments, the dsRNA molecule of the disclosure further comprises one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1-10 nucleotides of the internal region of the duplex of each of the sense or antisense strand. For example, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage at position 8-16 of the duplex region counting from the 5-end of the sense strand; the dsRNA molecule can optionally further comprise one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1-10 of the termini position(s).

    [0435] In some embodiments, the dsRNA molecule of the disclosure further comprises one to five phosphorothioate or methylphosphonate internucleotide linkage modification(s) within position 1-5 and one to five phosphorothioate or methylphosphonate internucleotide linkage modification(s) within position 18-23 of the sense strand (counting from the 5-end), and one to two phosphorothioate or methylphosphonate internucleotide linkage modification at positions 1 and 2 and one to five within positions 18-23 of the antisense strand (counting from the 5-end).

    [0436] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 and one phosphorothioate or methylphosphonate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5-end), and one phosphorothioate internucleotide linkage modification at positions 1 or 2 and two phosphorothioate or methylphosphonate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5-end).

    [0437] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5-end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5-end).

    [0438] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and two phosphorothioate internucleotide linkage modifications within position 18-23 of the sense strand (counting from the 5-end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5-end).

    [0439] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and two phosphorothioate internucleotide linkage modifications within position 18-23 of the sense strand (counting from the 5-end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5-end).

    [0440] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5-end).

    [0441] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 and one within position 18-23 of the sense strand (counting from the 5-end), and two phosphorothioate internucleotide linkage modification at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5-end).

    [0442] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 (counting from the 5-end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5-end).

    [0443] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 (counting from the 5-end) of the sense strand, and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5-end).

    [0444] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one within position 18-23 of the sense strand (counting from the 5-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5-end).

    [0445] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5-end).

    [0446] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5-end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5-end).

    [0447] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 20 and 21 of the sense strand (counting from the 5-end), and one phosphorothioate internucleotide linkage modification at positions 1 and one at position 21 of the antisense strand (counting from the 5-end).

    [0448] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification at position 1, and one phosphorothioate internucleotide linkage modification at position 21 of the sense strand (counting from the 5-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 20 and 21 the antisense strand (counting from the 5-end).

    [0449] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 21 and 22 of the sense strand (counting from the 5-end), and one phosphorothioate internucleotide linkage modification at positions 1 and one phosphorothioate internucleotide linkage modification at position 21 of the antisense strand (counting from the 5-end).

    [0450] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification at position 1, and one phosphorothioate internucleotide linkage modification at position 21 of the sense strand (counting from the 5-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 21 and 22 the antisense strand (counting from the 5-end).

    [0451] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 22 and 23 of the sense strand (counting from the 5-end), and one phosphorothioate internucleotide linkage modification at positions 1 and one phosphorothioate internucleotide linkage modification at position 21 of the antisense strand (counting from the 5-end).

    [0452] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification at position 1, and one phosphorothioate internucleotide linkage modification at position 21 of the sense strand (counting from the 5-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 23 and 23 the antisense strand (counting from the 5-end).

    [0453] In some embodiments, compound of the disclosure comprises a pattern of backbone chiral centers. In some embodiments, a common pattern of backbone chiral centers comprises at least 5 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 6 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 7 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 8 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 9 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 10 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 11 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 12 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 13 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 14 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 15 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 16 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 17 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 18 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 19 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 8 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 7 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 6 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 5 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 4 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 3 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 2 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 1 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 8 internucleotidic linkages which are not chiral (as a non-limiting example, a phosphodiester). In some embodiments, a common pattern of backbone chiral centers comprises no more than 7 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 6 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 5 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 4 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 3 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 2 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 1 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 10 internucleotidic linkages in the Sp configuration, and no more than 8 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 11 internucleotidic linkages in the Sp configuration, and no more than 7 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 12 internucleotidic linkages in the Sp configuration, and no more than 6 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 13 internucleotidic linkages in the Sp configuration, and no more than 6 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 14 internucleotidic linkages in the Sp configuration, and no more than 5 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 15 internucleotidic linkages in the Sp configuration, and no more than 4 internucleotidic linkages which are not chiral. In some embodiments, the internucleotidic linkages in the Sp configuration are optionally contiguous or not contiguous. In some embodiments, the internucleotidic linkages in the Rp configuration are optionally contiguous or not contiguous. In some embodiments, the internucleotidic linkages which are not chiral are optionally contiguous or not contiguous.

    [0454] In some embodiments, compound of the disclosure comprises a block is a stereochemistry block. In some embodiments, a block is an Rp block in that each internucleotidic linkage of the block is Rp. In some embodiments, a 5-block is an Rp block. In some embodiments, a 3-block is an Rp block. In some embodiments, a block is an Sp block in that each internucleotidic linkage of the block is Sp. In some embodiments, a 5-block is an Sp block. In some embodiments, a 3-block is an Sp block. In some embodiments, provided oligonucleotides comprise both Rp and Sp blocks. In some embodiments, provided oligonucleotides comprise one or more Rp but no Sp blocks. In some embodiments, provided oligonucleotides comprise one or more Sp but no Rp blocks. In some embodiments, provided oligonucleotides comprise one or more PO blocks wherein each internucleotidic linkage in a natural phosphate linkage.

    [0455] In some embodiments, compound of the disclosure comprises a 5-block is an Sp block wherein each sugar moiety comprises a 2-F modification. In some embodiments, a 5-block is an Sp block wherein each of internucleotidic linkage is a modified internucleotidic linkage and each sugar moiety comprises a 2-F modification. In some embodiments, a 5-block is an Sp block wherein each of internucleotidic linkage is a phosphorothioate linkage and each sugar moiety comprises a 2-F modification. In some embodiments, a 5-block comprises 4 or more nucleoside units. In some embodiments, a 5-block comprises 5 or more nucleoside units. In some embodiments, a 5-block comprises 6 or more nucleoside units. In some embodiments, a 5-block comprises 7 or more nucleoside units. In some embodiments, a 3-block is an Sp block wherein each sugar moiety comprises a 2-F modification. In some embodiments, a 3-block is an Sp block wherein each of internucleotidic linkage is a modified internucleotidic linkage and each sugar moiety comprises a 2-F modification. In some embodiments, a 3-block is an Sp block wherein each of internucleotidic linkage is a phosphorothioate linkage and each sugar moiety comprises a 2-F modification. In some embodiments, a 3-block comprises 4 or more nucleoside units. In some embodiments, a 3-block comprises 5 or more nucleoside units. In some embodiments, a 3-block comprises 6 or more nucleoside units. In some embodiments, a 3-block comprises 7 or more nucleoside units.

    [0456] In some embodiments, compound of the disclosure comprises a type of nucleoside in a region or an oligonucleotide is followed by a specific type of internucleotidic linkage, e.g., natural phosphate linkage, modified internucleotidic linkage, Rp chiral internucleotidic linkage, Sp chiral internucleotidic linkage, etc. In some embodiments, A is followed by Sp. In some embodiments, A is followed by Rp. In some embodiments, A is followed by natural phosphate linkage (PO). In some embodiments, U is followed by Sp. In some embodiments, U is followed by Rp. In some embodiments, U is followed by natural phosphate linkage (PO). In some embodiments, C is followed by Sp. In some embodiments, C is followed by Rp. In some embodiments, C is followed by natural phosphate linkage (PO). In some embodiments, G is followed by Sp. In some embodiments, G is followed by Rp. In some embodiments, G is followed by natural phosphate linkage (PO). In some embodiments, C and U are followed by Sp. In some embodiments, C and U are followed by Rp. In some embodiments, C and U are followed by natural phosphate linkage (PO). In some embodiments, A and G are followed by Sp. In some embodiments, A and G are followed by Rp.

    [0457] In some embodiments, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-8 of the 5-end of the antisense strand or at position 2-9 of the 5-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 6 2-fluoro modifications; (ii) the antisense comprises 3, 4, or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2-fluoro modifications; (vii) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5-end of the antisense strand.

    [0458] In some embodiments, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-8 of the 5-end of the antisense strand or at position 2-9 of the 5-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 6 2-fluoro modifications; (ii) the sense strand is conjugated with a ligand; (iii) the sense strand comprises 2, 3, 4 or 5 2-fluoro modifications; (iv) the sense strand comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; (v) the dsRNA comprises at least four 2-fluoro modifications; (vi) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; (vii) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5-end of the antisense strand.

    [0459] In some embodiments, the sense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-8 of the 5-end of the antisense strand or at position 2-9 of the 5-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 6 2-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2-fluoro modifications; (v) the sense strand comprises 3, 4 or 5 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2-fluoro modifications; (vii) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5-end of the antisense strand.

    [0460] In some embodiments, the sense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-8 of the 5-end of the antisense strand or at position 2-9 of the 5-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2-fluoro modifications; (ii) the sense strand is conjugated with a ligand; (iii) the sense strand comprises 2, 3, 4 or 5 2-fluoro modifications; (iv) the sense strand comprises 3, 4 or 5 phosphorothioate internucleotide linkages; (v) the dsRNA comprises at least four 2-fluoro modifications; (vi) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (vii) the dsRNA has a blunt end at 5-end of the antisense strand.

    [0461] In some embodiments, the dsRNA molecule of the disclosure comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mismatch can occur in the overhang region or the duplex region. The base pair can be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.

    [0462] In some embodiments, the dsRNA molecule of the disclosure comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5-end of the antisense strand can be chosen independently from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5-end of the duplex.

    [0463] In some embodiments, the nucleotide at the 1 position within the duplex region from the 5-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5-end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5-end of the antisense strand is an AU base pair.

    [0464] It was found that introducing 4-modified or 5-modified nucleotide to the 3-end of a phosphodiester (PO), phosphorothioate (PS), or phosphorodithioate (PS2) linkage of a dinucleotide at any position of single stranded or double stranded oligonucleotide can exert steric effect to the internucleotide linkage and, hence, protecting or stabilizing it against nucleases.

    [0465] In some embodiments, 5-modified nucleotide is introduced at the 3-end of a dinucleotide at any position of single stranded or double stranded siRNA. For instance, a 5-alkylated nucleotide may be introduced at the 3-end of a dinucleotide at any position of single stranded or double stranded siRNA. The alkyl group at the 5 position of the ribose sugar can be racemic or chirally pure R or S isomer. An exemplary 5-alkylated nucleotide is 5-methyl nucleoside. The 5-methyl can be either racemic or chirally pure R or S isomer.

    [0466] In some embodiments, 4-modified nucleotide is introduced at the 3-end of a dinucleotide at any position of single stranded or double stranded siRNA. For instance, a 4-alkylated nucleotide may be introduced at the 3-end of a dinucleotide at any position of single stranded or double stranded siRNA. The alkyl group at the 4 position of the ribose sugar can be racemic or chirally pure R or S isomer. An exemplary 4-alkylated nucleotide is 4-methyl nucleotide. The 4-methyl can be either racemic or chirally pure R or S isomer. Alternatively, a 4-O-alkylated nucleotide may be introduced at the 3-end of a dinucleotide at any position of single stranded or double stranded siRNA. The 4-O-alkyl of the ribose sugar can be racemic or chirally pure R or S isomer. An exemplary 4-O-alkylated nucleotide is 4-O-methyl nucleotide. The 4-O-methyl can be either racemic or chirally pure R or S isomer.

    [0467] In some embodiments, 5-alkylated nucleotide is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA. The 5-alkyl can be either racemic or chirally pure R or S isomer. An exemplary 5-alkylated nucleotide is 5-methyl nucleotide. The 5-methyl can be either racemic or chirally pure R or S isomer.

    [0468] In some embodiments, 4-alkylated nucleotide is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA. The 4-alkyl can be either racemic or chirally pure R or S isomer. An exemplary 4-alkylated nucleotide is 4-methyl nucleotide. The 4-methyl can be either racemic or chirally pure R or S isomer.

    [0469] In some embodiments, 4-O-alkylated nucleotide is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA. The 5-alkyl can be either racemic or chirally pure R or S isomer. An exemplary 4-O-alkylated nucleotide is 4-O-methyl nucleotide. The 4-O-methyl can be either racemic or chirally pure R or S isomer.

    [0470] In some embodiments, the dsRNA molecule of the disclosure can comprise 2-5 linkages (with 2-H, 2-OH and 2-OMe and with PO or PS). For example, the 2-5 linkages modifications can be used to promote nuclease resistance or to inhibit binding of the sense to the antisense strand, or can be used at the 5 end of the sense strand to avoid sense strand activation by RISC.

    [0471] In another embodiment, the dsRNA molecule of the disclosure can comprise L sugars (e.g., L ribose, L-arabinose with 2-H, 2-OH and 2-OMe). For example, these L sugars modifications can be used to promote nuclease resistance or to inhibit binding of the sense to the antisense strand, or can be used at the 5 end of the sense strand to avoid sense strand activation by RISC.

    [0472] Various publications describe multimeric siRNA which can all be used with the dsRNA of the disclosure. Such publications include WO2007/091269, U.S. Pat. No. 7,858,769, WO2010/141511, WO2007/117686, WO2009/014887, and WO2011/031520 which are hereby incorporated by their entirely.

    [0473] As described in more detail below, the RNAi agent that contains conjugations of one or more carbohydrate moieties to an RNAi agent can optimize one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, e.g., a non-carbohydrate (such as, cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS). A cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.

    [0474] The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one backbone attachment point, such as two backbone attachment points and (ii) at least one tethering attachment point. A backbone attachment point as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid. A tethering attachment point (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected moiety is connected by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring.

    [0475] The RNAi agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group. In one embodiment, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and decalin. In another embodiment, the acyclic group is selected from serinol backbone or diethanolamine backbone.

    [0476] In certain specific embodiments, the RNAi agent for use in the methods of the disclosure is an agent selected from the group of agents listed in any one of Tables 2-3 and 5-6. These agents may further comprise a ligand, such as one or more lipophilic moieties, one or more GalNAc derivatives, or both of one of more lipophilic moieties and one or more GalNAc derivatives.

    IV. iRNAs Conjugated to Ligands

    [0477] Another modification of the RNA of an iRNA of the invention involves chemically linking to the iRNA one or more ligands, moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the iRNA into a cell. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N. Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

    [0478] In certain embodiments, a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incorporated. In some embodiments, a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. Typical ligands will not take part in duplex pairing in a duplexed nucleic acid.

    [0479] Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a lipid. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an helical peptide.

    [0480] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, or an RGD peptide or RGD peptide mimetic. In certain embodiments, the ligand is a multivalent galactose, e.g., an N-acetyl-galactosamine.

    [0481] Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG].sub.2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

    [0482] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell. Ligands may also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-B.

    [0483] The ligand can be a substance, e.g., a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

    [0484] In some embodiments, a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.

    [0485] Ligand-conjugated iRNAs of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.

    [0486] The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.

    [0487] In the ligand-conjugated oligonucleotides and ligand-molecule bearing sequence-specific linked nucleosides of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.

    [0488] When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.

    [0489] A. Lipid Conjugates

    [0490] In certain embodiments, the ligand or conjugate is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule can typically bind a serum protein, such as human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, or (c) can be used to adjust binding to a serum protein, e.g., HSA.

    [0491] A lipid-based ligand can be used to modulate, e.g., control (e.g., inhibit) the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.

    [0492] In certain embodiments, the lipid-based ligand binds HSA. For example, the ligand can bind HSA with a sufficient affinity such that distribution of the conjugate to a non-kidney tissue is enhanced. However, the affinity is typically not so strong that the HSA-ligand binding cannot be reversed.

    [0493] In certain embodiments, the lipid-based ligand binds HSA weakly or not at all, such that distribution of the conjugate to the kidney is enhanced. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid-based ligand.

    [0494] In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells. Also included are HSA and low density lipoprotein (LDL).

    [0495] B. Cell Permeation Agents

    [0496] In another aspect, the ligand is a cell-permeation agent, such as a helical cell-permeation agent. In certain embodiments, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is typically an -helical agent and can have a lipophilic and a lipophobic phase.

    [0497] The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to iRNA agents can affect pharmacokinetic distribution of the iRNA, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

    [0498] A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO:31). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO:32)) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a delivery peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO:33)) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO:34)) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Typically, the peptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit is a cell targeting peptide such as an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.

    [0499] An RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand, such as PECAM-1 or VEGF.

    [0500] An RGD peptide moiety can be used to target a particular cell type, e.g., a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res., 62:5139-43, 2002). An RGD peptide can facilitate targeting of an dsRNA agent to tumors of a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001). Typically, the RGD peptide will facilitate targeting of an iRNA agent to the kidney. The RGD peptide can be linear or cyclic, and can be modified, e.g., glycosylated or methylated to facilitate targeting to specific tissues. For example, a glycosylated RGD peptide can deliver an iRNA agent to a tumor cell expressing .sub.V.sub.3 (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001).

    [0501] A cell permeation peptide is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an -helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g., -defensin, -defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

    [0502] C. Carbohydrate Conjugates

    [0503] In some embodiments of the compositions and methods of the invention, an iRNA further comprises a carbohydrate. The carbohydrate conjugated iRNA are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, carbohydrate refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and tri-saccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).

    [0504] In certain embodiments, a carbohydrate conjugate comprises a monosaccharide.

    [0505] In certain embodiments, the monosaccharide is an N-acetylgalactosamine (GalNAc). GalNAc conjugates, which comprise one or more N-acetylgalactosamine (GalNAc) derivatives, are described, for example, in U.S. Pat. No. 8,106,022, the entire content of which is hereby incorporated herein by reference. In some embodiments, the GalNAc conjugate serves as a ligand that targets the iRNA to particular cells. In some embodiments, the GalNAc conjugate targets the iRNA to liver cells, e.g., by serving as a ligand for the asialoglycoprotein receptor of liver cells (e.g., hepatocytes).

    [0506] In some embodiments, the carbohydrate conjugate comprises one or more GalNAc derivatives. The GalNAc derivatives may be attached via a linker, e.g., a bivalent or trivalent branched linker. In some embodiments the GalNAc conjugate is conjugated to the 3 end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 3 end of the sense strand) via a linker, e.g., a linker as described herein. In some embodiments the GalNAc conjugate is conjugated to the 5 end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 5 end of the sense strand) via a linker, e.g., a linker as described herein.

    [0507] In certain embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a bivalent linker. In yet other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a trivalent linker. In other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a tetravalent linker.

    [0508] In certain embodiments, the double stranded RNAi agents of the invention comprise one GalNAc or GalNAc derivative attached to the iRNA agent. In certain embodiments, the double stranded RNAi agents of the invention comprise a plurality (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.

    [0509] In some embodiments, for example, when the two strands of an iRNA agent of the invention are part of one larger molecule connected by an uninterrupted chain of nucleotides between the 3-end of one strand and the 5-end of the respective other strand forming a hairpin loop comprising, a plurality of unpaired nucleotides, each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker. The hairpin loop may also be formed by an extended overhang in one strand of the duplex.

    [0510] In some embodiments, for example, when the two strands of an iRNA agent of the invention are part of one larger molecule connected by an uninterrupted chain of nucleotides between the 3-end of one strand and the 5-end of the respective other strand forming a hairpin loop comprising, a plurality of unpaired nucleotides, each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker. The hairpin loop may also be formed by an extended overhang in one strand of the duplex.

    [0511] In some embodiments, the GalNAc conjugate is

    ##STR00015##

    [0512] In some embodiments, the RNAi agent is attached to the carbohydrate conjugate via a linker as shown in the following schematic, wherein X is O or S

    ##STR00016##

    [0513] In some embodiments, the RNAi agent is conjugated to L96 as defined in Table 1 and shown below:

    ##STR00017##

    [0514] In certain embodiments, a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:

    ##STR00018## ##STR00019## ##STR00020## ##STR00021## ##STR00022## ##STR00023## ##STR00024##

    [0515] In certain embodiments, a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide. In certain embodiments, the monosaccharide is an N-acetylgalactosamine, such as

    ##STR00025##

    [0516] Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to,

    ##STR00026## [0517] when one of X or Y is an oligonucleotide, the other is a hydrogen.

    [0518] In some embodiments, a suitable ligand is a ligand disclosed in WO 2019/055633, the entire contents of which are incorporated herein by reference. In one embodiment the ligand comprises the structure below:

    ##STR00027##

    [0519] In certain embodiments, the RNAi agents of the disclosure may include GalNAc ligands.

    [0520] In certain embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a bivalent linker. In yet other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a trivalent linker. In other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a tetravalent linker.

    [0521] In certain embodiments, the double stranded RNAi agents of the invention comprise one GalNAc or GalNAc derivative attached to the iRNA agent, e.g., the 5end of the sense strand of a dsRNA agent, or the 5 end of one or both sense strands of a dual targeting RNAi agent as described herein. In certain embodiments, the double stranded RNAi agents of the invention comprise a plurality (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.

    [0522] In some embodiments, for example, when the two strands of an iRNA agent of the invention are part of one larger molecule connected by an uninterrupted chain of nucleotides between the 3-end of one strand and the 5-end of the respective other strand forming a hairpin loop comprising, a plurality of unpaired nucleotides, each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker.

    [0523] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator or a cell permeation peptide.

    [0524] Additional carbohydrate conjugates and linkers suitable for use in the present invention include those described in WO 2014/179620 and WO 2014/179627, the entire contents of each of which are incorporated herein by reference.

    [0525] D. Linkers

    [0526] In some embodiments, the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable.

    [0527] The term linker or linking group means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO.sub.2, SO.sub.2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO.sub.2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In certain embodiments, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-16, or 8-16 atoms.

    [0528] A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In one embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).

    [0529] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.

    [0530] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a selected pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.

    [0531] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.

    [0532] Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

    [0533] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In certain embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

    [0534] i. Redox Cleavable Linking Groups

    [0535] In certain embodiments, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (SS). To determine if a candidate cleavable linking group is a suitable reductively cleavable linking group, or for example is suitable for use with a particular iRNA moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.

    [0536] ii. Phosphate-Based Cleavable Linking Groups

    [0537] In certain embodiments, a cleavable linker comprises a phosphate-based cleavable linking group. A phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are OP(O)(ORk)-O, OP(S)(ORk)-O, OP(S)(SRk)-O, SP(O)(ORk)-O, OP(O)(ORk)-S, SP(O)(ORk)-S, OP(S)(ORk)-S, SP(S)(ORk)-O, OP(O)(Rk)-O, OP(S)(Rk)-O, SP(O)(Rk)-O, SP(S)(Rk)-O, SP(O)(Rk)-S, OP(S)(Rk)-S, wherein Rk at each occurrence can be, independently, C1-C20 alkyl, C1-C20 haloalkyl, C6-C10 aryl, or C7-C12 aralkyl. Exemplary embodiments include OP(O)(OH)O, OP(S)(OH)O, OP(S)(SH)O, SP(O)(OH)O, OP(O)(OH)S, SP(O)(OH)S, OP(S)(OH)S, SP(S)(OH)O, OP(O)(H)O, OP(S)(H)O, SP(O)(H)O, SP(S)(H)O, SP(O)(H)S, and OP(S)(H)S. in certain embodiments, a phosphate-based linking group is OP(O)(OH)O. These candidates can be evaluated using methods analogous to those described above.

    [0538] iii. Acid Cleavable Linking Groups

    [0539] In certain embodiments, a cleavable linker comprises an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In other embodiments acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula CNN, C(O)O, or OC(O). An exemplary embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.

    [0540] iv. Ester-Based Cleavable Linking Groups

    [0541] In certain embodiments, a cleavable linker comprises an ester-based cleavable linking group. An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula C(O)O, or OC(O). These candidates can be evaluated using methods analogous to those described above.

    [0542] v. Peptide-Based Cleavable Linking Groups

    [0543] In yet another embodiment, a cleavable linker comprises a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (C(O)NH). The amide group can be formed between any alkylene, alkenylene or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula NHCHRAC(O)NHCHRBC(O), where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.

    [0544] In some embodiments, an iRNA of the invention is conjugated to a carbohydrate through a linker. Non-limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to,

    ##STR00028## ##STR00029## ##STR00030##

    when one of X or Y is an oligonucleotide, the other is a hydrogen.

    [0545] In certain embodiments of the compositions and methods of the invention, a ligand is one or more GalNAc (N-acetylgalactosamine) derivatives attached through a bivalent or trivalent branched linker.

    [0546] In certain embodiments, a dsRNA of the invention is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XLV)-(XLVI):

    ##STR00031## [0547] wherein: [0548] q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different; [0549] P.sup.2A, P.sup.2B, P.sup.3A, P.sup.3B, P.sup.4A, P.sup.4B, P.sup.5A, P.sup.5B, P.sup.5C, T.sup.2A, T.sup.2B, T.sup.3A, T.sup.3B, T.sup.4A, T.sup.4B, T.sup.4A, T.sup.5B, T.sup.5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH.sub.2, CH.sub.2NH or CH.sub.2O; [0550] Q.sup.2A, Q.sup.2B, Q.sup.3A, Q.sup.3B, Q.sup.4A, Q.sup.4B, Q.sup.5A, Q.sup.5B, Q.sup.5C are independently for each occurrence absent, alkylene, substituted alkylene wherein one or more methylenes can be interrupted or terminated by one or more of O, S, S(O), SO.sub.2, N(R.sup.N), C(R)C(R), CC or C(O); [0551] R.sup.2A, R.sup.2B, R.sup.3A, R.sup.3B, R.sup.4A, R.sup.4B, R.sup.5A, R.sup.5B, R.sup.5C are each independently for each occurrence absent, NH, O,-S, CH.sub.2, C(O)O, C(O)NH, NHCH(R.sup.a)C(O), C(O)CH(R.sup.a)NH, CO, CHN-O,

    ##STR00032##

    or heterocyclyl; [0552] L.sup.2A, L.sup.2B, L.sup.3A, L.sup.3B, L.sup.4A, L.sup.4B, L.sup.5A, L.sup.5B and L.sup.5C represent the ligand; i.e. each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and R.sup.a is H or amino acid side chain. Trivalent conjugating GalNAc derivatives are particularly useful for use with RNAi agents for inhibiting the expression of a target gene, such as those of formula (XLIX):

    ##STR00033## [0553] wherein L.sup.5A, L.sup.5B and L.sup.5C represent a monosaccharide, such as GalNAc derivative.

    [0554] Examples of suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures recited above as formulas II, VII, XI, X, and XIII.

    [0555] Representative U.S. patents that teach the preparation of RNA conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928; 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; and 8,106,022, the entire contents of each of which are hereby incorporated herein by reference.

    [0556] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated in a single compound or even at a single nucleoside within an iRNA. The present invention also includes iRNA compounds that are chimeric compounds.

    [0557] Chimeric iRNA compounds or chimeras, in the context of this invention, are iRNA compounds, such as dsRNA agents, that contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound. These iRNAs typically contain at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, or increased binding affinity for the target nucleic acid. An additional region of the iRNA can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter iRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

    [0558] In certain instances, the RNA of an iRNA can be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.

    V. Delivery of an RNAi Agent of the Disclosure

    [0559] The delivery of a RNAi agent of the disclosure to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having a DPP4-associated disorder, e.g., a metabolic disease, e.g., diabetes or a lipid metabolism disorder, e.g., a subject having or at risk of developing or at risk of having a metabolic disease, e.g., diabetes or a lipid metabolism disorder, can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an RNAi agent of the disclosure either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising an RNAi agent, e.g., a dsRNA, to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the RNAi agent. These alternatives are discussed further below.

    [0560] In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with a RNAi agent of the disclosure (see e.g., Akhtar S. and Julian RL., (1992) Trends Cell. Biol. 2(5):139-144 and WO94/02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver an RNAi agent include, for example, biological stability of the delivered agent, prevention of non-specific effects, and accumulation of the delivered agent in the target tissue. The non-specific effects of an RNAi agent can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the RNAi agent to be administered. Several studies have shown successful knockdown of gene products when an RNAi agent is administered locally. For example, pulmonary delivery, e.g., inhalation, of a dsRNA, e.g., SOD1, has been shown to effectively knockdown gene and protein expression in lung tissue and that there is excellent uptake of the dsRNA by the bronchioles and alveoli of the lung. Intraocular delivery of a VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino, M J. et al., (2004) Retina 24:132-138) and subretinal injections in mice (Reich, S J. et al. (2003) Mol. Vis. 9:210-216) were also both shown to prevent neovascularization in an experimental model of age-related macular degeneration. In addition, direct intratumoral injection of a dsRNA in mice reduces tumor volume (Pille, J. et al. (2005) Mol. Ther. 11:267-274) and can prolong survival of tumor-bearing mice (Kim, W J. et al., (2006) Mol. Ther. 14:343-350; Li, S. et al., (2007) Mol. Ther. 15:515-523). RNA interference has also shown success with local delivery to the CNS by direct injection (Dorn, G. et al., (2004) Nucleic Acids 32:e49; Tan, P H. et al. (2005) Gene Ther. 12:59-66; Makimura, H. et al. (2002) BMC Neurosci. 3:18; Shishkina, G T., et al. (2004) Neuroscience 129:521-528; Thakker, E R., et al. (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275; Akaneya, Y., et al. (2005) J. Neurophysiol. 93:594-602) and to the lungs by intranasal administration (Howard, K A. et al., (2006) Mol. Ther. 14:476-484; Zhang, X. et al., (2004) J. Biol. Chem. 279:10677-10684; Bitko, V. et al., (2005) Nat. Med. 11:50-55). For administering a RNAi agent systemically for the treatment of a disease, the RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the dsRNA by endo- and exo-nucleases in vivo. Modification of the RNA or the pharmaceutical carrier can also permit targeting of the RNAi agent to the target tissue and avoid undesirable off-target effects (e.g., without wishing to be bound by theory, use of GNAs as described herein has been identified to destabilize the seed region of a dsRNA, resulting in enhanced preference of such dsRNAs for on-target effectiveness, relative to off-target effects, as such off-target effects are significantly weakened by such seed region destabilization). RNAi agents can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, a RNAi agent directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J. et al., (2004) Nature 432:173-178). Conjugation of an RNAi agent to an aptamer has been shown to inhibit tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, J O. et al., (2006) Nat. Biotechnol. 24:1005-1015). In an alternative embodiment, the RNAi agent can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of molecule RNAi agent (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an RNAi agent by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an RNAi agent, or induced to form a vesicle or micelle (see e.g., Kim SH. et al., (2008) Journal of Controlled Release 129(2):107-116) that encases an RNAi agent. The formation of vesicles or micelles further prevents degradation of the RNAi agent when administered systemically. Methods for making and administering cationic-RNAi agent complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., et al. (2003) J. Mol. Biol 327:761-766; Verma, U N. et al., (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A S et al. (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of RNAi agents include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N. et al., (2003), supra), Oligofectamine, solid nucleic acid lipid particles (Zimmermann, T S. et al., (2006) Nature 441:111-114), cardiolipin (Chien, P Y. et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet ME. et al., (2008) Pharm. Res. August 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A. et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. et al., (1999) Pharm. Res. 16:1799-1804). In some embodiments, a RNAi agent forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of RNAi agents and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is herein incorporated by reference in its entirety.

    [0561] Certain aspects of the instant disclosure relate to a method of reducing the expression of a DPP4 gene in a cell, comprising contacting said cell with the double-stranded RNAi agent of the disclosure. In one embodiment, the cell is a hepatic cell, optionally a hepatocyte.

    [0562] In certain embodiments, the RNAi agent is taken up on one or more tissue or cell types present in organs, e.g., liver, kidney.

    [0563] Another aspect of the disclosure relates to a method of reducing the expression and/or activity of a DPP4 gene in a subject, comprising administering to the subject the double-stranded RNAi agent of the disclosure.

    [0564] Another aspect of the disclosure relates to a method of treating a subject having a DPP4-associated disorder orat risk of having or at risk of developing a DPP4-associated disorder, comprising administering to the subject a therapeutically effective amount of the double-stranded RNAi agent of the disclosure, thereby treating the subject. In some embodiments, the DPP4-associated disorder comprises a metabolic disease, e.g., diabetes or a lipid metabolism disorders.

    [0565] In one embodiment, the double-stranded RNAi agent is administered subcutaneously.

    [0566] In one embodiment, the double-stranded RNAi agent is administered orally.

    [0567] In one embodiment, the double-stranded RNAi agent is administered by intravenously.

    [0568] In one embodiment, the double-stranded RNAi agent is administered by pulmonary sytem administration, e.g., intranasal administration, or oral inhalative administration.

    [0569] For ease of exposition the formulations, compositions and methods in this section are discussed largely with regard to modified siRNA compounds. It may be understood, however, that these formulations, compositions and methods can be practiced with other siRNA compounds, e.g., unmodified siRNA compounds, and such practice is within the disclosure. A composition that includes a RNAi agent can be delivered to a subject by a variety of routes. Exemplary routes include pulmonary system, intravenous, subcutaneous, intraventricular, oral, topical, rectal, anal, vaginal, nasal, and ocular.

    [0570] The RNAi agents of the disclosure can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically include one or more species of RNAi agent and a pharmaceutically acceptable carrier. As used herein the language pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

    [0571] The pharmaceutical compositions of the present disclosure may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be intratracheal, intranasal, topical (including ophthalmic, vaginal, rectal, intranasal, transdermal), oral, parenteral, or pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal, or intramuscular injection, or intrathecal or intraventricular administration.

    [0572] The route and site of administration may be chosen to enhance targeting. For example, to target muscle cells, intramuscular injection into the muscles of interest would be a logical choice.

    [0573] Lung cells might be targeted by administering the RNAi agent in powder or aerosol form. The vascular endothelial cells could be targeted by coating a balloon catheter with the RNAi agent and mechanically introducing the RNA.

    [0574] Compositions for pulmonary system delivery may include aqueous solutions, e.g., for intranasal or oral inhalative administration, suitable carriers composed of, e.g., lipids (liposomes, niosomes, microemulsions, lipidic micelles, solid lipid nanoparticles) or polymers (polymer micelles, dendrimers, polymeric nanoparticles, nonogels, nanocapsules), adjuvant, e.g., for oral inhalative administration. Aqueous compositions may be sterile and may optionally contain buffers, diluents, absorbtion enhancers and other suitable additives. Such administration permits both systemic and local delivery of the double stranded RNAi agents of the invention.

    [0575] Intranasal administration may include instilling or insufflating a double stranded RNAi agent into the nasal cavity with syringes or droppers by applying a few drops at a time or via atomization. Suitable dosage forms for intranasal administration include drops, powders, nebulized mists, and sprays. Nasal delivery devices include, but not limited to, vapor inhaler, nasal dropper, spray bottle, metered dose spray pump, gas driven spray atomizer, nebulizer, mechanical powder sprayer, breath actuated inhaler, and insufflator. Devices for delivery deeper into the respiratory system, e.g., into the lung, include nebulizer, pressured metered-dose inhaler, dry powder inhaler, and thermal vaporization aerosol device. Devices for delivery by inhalation are available from commercial suppliers. Devices can be fixed or variable dose, single or multidose, disposable or reusable depending on, for example, the disease or disorder to be prevented or treated, the volume of the agent to be delivered, the frequency of delivery of the agent, and other considerations in the art.

    [0576] Oral inhalative administration may include use of device, e.g., a passive breath driven or active power driven single/-multiple dose dry powder inhaler (DPI), to deliver a double stranded RNAi agent to the pulmonary system. Suitable dosage forms for oral inhalative administration include powders and solutions. Suitable devices for oral inhalative administration include nebulizers, metered-dose inhalers, and dry powder inhalers. Dry powder inhalers are of the most popular devices used to deliver drugs, especially proteins to the lungs. Exemplary commercially available dry powder inhalers include Spinhaler (Fisons Pharmaceuticals, Rochester, NY) and Rotahaler (GSK, RTP, NC). Several types of nebulizers are available, namely jet nebulizers, ultrasonic nebulizers, vibrating mesh nebulizers. Jet nebulizers are driven by compressed air. Ultrasonic nebulizers use a piezoelectric transducer in order to create droplets from an open liquid reservoir. Vibrating mesh nebulizers use perforated membranes actuated by an annular piezoelement to vibrate in resonant bending mode. The holes in the membrane have a large cross-section size on the liquid supply side and a narrow cross-section size on the side from where the droplets emerge. Depending on the therapeutic application, the hole sizes and number of holes can be adjusted. Selection of a suitable device depends on parameters, such as nature of the drug and its formulation, the site of action, and pathophysiology of the lung. Aqueous suspensions and solutions are nebulized effectively. Aerosols based on mechanically generated vibration mesh technologies also have been used successfully to deliver proteins to lungs.

    [0577] The amount of RNAi agent for pulmonary system administration may vary from one target gene to another target gene and the appropriate amount that has to be applied may have to be determined individually for each target gene. Typically, this amount ranges from 10 g to 2 mg, or 50 g to 1500 g, or 100 g to 1000 g.

    [0578] Formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves, and the like may also be useful.

    [0579] Compositions for oral administration include powders or granules, suspensions or solutions in water, syrups, elixirs or non-aqueous media, tablets, capsules, lozenges, or troches. In the case of tablets, carriers that can be used include lactose, sodium citrate and salts of phosphoric acid. Various disintegrants such as starch, and lubricating agents such as magnesium stearate, sodium lauryl sulfate and talc, are commonly used in tablets. For oral administration in capsule form, useful diluents are lactose and high molecular weight polyethylene glycols. When aqueous suspensions are required for oral use, the nucleic acid compositions can be combined with emulsifying and suspending agents. If desired, certain sweetening or flavoring agents can be added. Compositions suitable for oral administration of the agents of the invention are further described in PCT Application No. PCT/US20/33156, the entire contents of which are incorporated herein by reference.

    [0580] Compositions for intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents, and other suitable additives.

    [0581] Formulations for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents, and other suitable additives. Intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir. For intravenous use, the total concentration of solutes may be controlled to render the preparation isotonic.

    [0582] In one embodiment, the administration of the siRNA compound, e.g., a double-stranded siRNA compound, is parenteral, e.g., intravenous (e.g., as a bolus or as a diffusible infusion), intradermal, intraperitoneal, intramuscular, intrathecal, intraventricular, intracranial, subcutaneous, transmucosal, buccal, sublingual, endoscopic, rectal, oral, vaginal, topical, pulmonary system, intranasal, urethral, or ocular. Administration can be provided by the subject or by another person, e.g., a health care provider. The medication can be provided in measured doses or in a dispenser which delivers a metered dose. Selected modes of delivery are discussed in more detail below.

    [0583] Vector Encoded RNAi Agents of the Disclosure

    [0584] RNAi agents targeting the DPP4 gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; WO 00/22113, WO 00/22114, and U.S. Pat. No. 6,054,299). Expression can be sustained (months or longer), depending upon the specific construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., (1995) Proc. Natl. Acad. Sci. USA 92:1292).

    [0585] The individual strand or strands of a RNAi agent can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced (e.g., by transfection or infection) into a target cell. Alternatively, each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid. In one embodiment, a dsRNA is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.

    [0586] RNAi agent expression vectors are generally DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, such as those compatible with vertebrate cells, can be used to produce recombinant constructs for the expression of a RNAi agent as described herein. Delivery of RNAi agent expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.

    [0587] Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Replication-defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells' genome. The constructs can include viral sequences for transfection, if desired. Alternatively, the construct can be incorporated into vectors capable of episomal replication, e.g. EPV and EBV vectors. Constructs for the recombinant expression of a RNAi agent will generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure the expression of the RNAi agent in target cells. Other aspects to consider for vectors and constructs are known in the art.

    VI. Pharmaceutical Compositions of the Invention

    [0588] The present disclosure also includes pharmaceutical compositions and formulations which include the RNAi agents of the disclosure. In one embodiment, provided herein are pharmaceutical compositions containing an RNAi agent, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical compositions containing the RNAi agent are useful for treating a subject who would benefit from inhibiting or reducing the expression of a DPP4 gene, e.g., a subject having a DPP4-associated disorder, e.g., a subject having or at risk of having or at risk of developing a metabolic disease, e.g., diabetes or a lipid metabolism disorder. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by intravenous (IV), intramuscular (IM), or for subcutaneous (subQ) delivery.

    [0589] In some embodiments, the pharmaceutical compositions of the invention are pyrogen free or non-pyrogenic.

    [0590] The pharmaceutical compositions of the disclosure may be administered in dosages sufficient to inhibit expression of a DPP4 gene. In general, a suitable dose of an RNAi agent of the disclosure will be a flat dose in the range of about 0.001 to about 200.0 mg about once per month to about once per year, typically about once per quarter (i.e., about once every three months) to about once per year, generally a flat dose in the range of about 1 to 50 mg about once per month to about once per year, typically about once per quarter to about once per year. In certain embodiments, the dose will be a fixed dose, e.g., a fixed dose of about 25 g to about 5 mg.

    [0591] A repeat-dose regimen may include administration of a therapeutic amount of a RNAi agent on a regular basis, such as monthly to once every six months. In certain embodiments, the RNAi agent is administered about once per quarter (i.e., about once every three months) to about twice per year, particularly for treatment of a chronic disease.

    [0592] After an initial treatment regimen (e.g., loading dose), of once per day, twice per week, once per week, the treatments can be administered on a less frequent basis.

    [0593] In other embodiments, a single dose of the pharmaceutical compositions can be long lasting, such that subsequent doses are administered at not more than 1, 2, 3, or 4 or more month intervals. In some embodiments of the disclosure, a single dose of the pharmaceutical compositions of the disclosure is administered once per month. In other embodiments of the disclosure, a single dose of the pharmaceutical compositions of the disclosure is administered once per quarter to twice per year.

    [0594] The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments.

    [0595] Advances in mouse genetics have generated a number of mouse models for the study of various DPP4-associated diseases that would benefit from reduction in the expression of DPP4. Such models can be used for in vivo testing of RNAi agents, as well as for determining a therapeutically effective dose. Suitable mouse models are known in the art and include, for example, the mouse models described elsewhere herein.

    [0596] The pharmaceutical compositions of the present disclosure can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary system administration by intranasal administration or oral inhalative administration, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.

    [0597] The RNAi agents can be delivered in a manner to target a particular tissue, such as the liver.

    [0598] Pharmaceutical compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like can be necessary or desirable. Coated condoms, gloves and the like can also be useful. Suitable topical formulations include those in which the RNAi agents featured in the disclosure are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). RNAi agents featured in the disclosure can be encapsulated within liposomes or can form complexes thereto, in particular to cationic liposomes. Alternatively, RNAi agents can be complexed to lipids, in particular to cationic lipids. Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C.sub.1-20 alkyl ester (e.g., isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof. Topical formulations are described in detail in U.S. Pat. No. 6,747,014, which is incorporated herein by reference.

    [0599] A. RNAi Agent Formulations Comprising Membranous Molecular Assemblies

    [0600] A RNAi agent for use in the compositions and methods of the disclosure can be formulated for delivery in a membranous molecular assembly, e.g., a liposome or a micelle. As used herein, the term liposome refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the RNAi agent composition. The lipophilic material isolates the aqueous interior from an aqueous exterior, which typically does not include the RNAi agent composition, although in some examples, it may. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the RNAi agent are delivered into the cell where the RNAi agent can specifically bind to a target RNA and can mediate RNAi. In some cases the liposomes are also specifically targeted, e.g., to direct the RNAi agent to particular cell types.

    [0601] A liposome containing an RNAi agent can be prepared by a variety of methods. In one example, the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or lipid conjugate. The detergent can have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. The RNAi agent preparation is then added to the micelles that include the lipid component. The cationic groups on the lipid interact with the RNAi agent and condense around the RNAi agent to form a liposome. After condensation, the detergent is removed, e.g., by dialysis, to yield a liposomal preparation of RNAi agent.

    [0602] If necessary a carrier compound that assists in condensation can be added during the condensation reaction, e.g., by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or spermidine). pH can also adjusted to favor condensation.

    [0603] Methods for producing stable polynucleotide delivery vehicles, which incorporate a polynucleotide/cationic lipid complex as structural components of the delivery vehicle, are further described in, e.g., WO 96/37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of exemplary methods described in Felgner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417; U.S. Pat. Nos. 4,897,355; 5,171,678; Bangham et al., (1965) M. Mol. Biol. 23:238; Olson et al., (1979) Biochim. Biophys. Acta 557:9; Szoka et al., (1978) Proc. Natl. Acad. Sci. 75: 4194; Mayhew et al., (1984) Biochim. Biophys. Acta 775:169; Kim et al., (1983) Biochim. Biophys. Acta 728:339; and Fukunaga et al., (1984) Endocrinol. 115:757. Commonly used techniques for preparing lipid aggregates of appropriate size for use as delivery vehicles include sonication and freeze-thaw plus extrusion (see, e.g., Mayer et al., (1986) Biochim. Biophys. Acta 858:161. Microfluidization can be used when consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew et al., (1984) Biochim. Biophys. Acta 775:169. These methods are readily adapted to packaging RNAi agent preparations into liposomes.

    [0604] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic acid/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al. (1987) Biochem. Biophys. Res. Commun., 147:980-985).

    [0605] Liposomes, which are pH-sensitive or negatively charged, entrap nucleic acids rather than complex with them. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some nucleic acid is entrapped within the aqueous interior of these liposomes. pH sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al. (1992) Journal of Controlled Release, 19:269-274).

    [0606] One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid or phosphatidylcholine or cholesterol.

    [0607] Examples of other methods to introduce liposomes into cells in vitro and in vivo include U.S. Pat. Nos. 5,283,185; 5,171,678; WO 94/00569; WO 93/24640; WO 91/16024; Felgner, (1994) J. Biol. Chem. 269:2550; Nabel, (1993) Proc. Natl. Acad. Sci. 90:11307; Nabel, (1992) Human Gene Ther. 3:649; Gershon, (1993) Biochem. 32:7143; and Strauss, (1992) EMBO J. 11:417.

    [0608] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al., (1994) S.T.P.Pharma. Sci., 4(6):466).

    [0609] Liposomes also include sterically stabilized liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G.sub.M1, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., (1987) FEBS Letters, 223:42; Wu et al., (1993) Cancer Research, 53:3765).

    [0610] Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., (1987), 507:64) reported the ability of monosialoganglioside G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., (1988), 85:6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside G.sub.Mi or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al).

    [0611] In one embodiment, cationic liposomes are used. Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non-cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver RNAi agents to macrophages.

    [0612] Further advantages of liposomes include: liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated RNAi agents in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.

    [0613] A positively charged synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid-nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of RNAi agent (see, e.g., Felgner, P. L. et al., (1987) Proc. Natd. Acad. Sci. USA 8:7413-7417, and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).

    [0614] A DOTMA analogue, 1,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA-complexing vesicles. Lipofectin Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that comprise positively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive. Positively charged complexes prepared in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane (DOTAP) (Boehringer Mannheim, Indianapolis, Indiana) differs from DOTMA in that the oleoyl moieties are linked by ester, rather than ether linkages.

    [0615] Other reported cationic lipid compounds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5-carboxyspermylglycine dioctaoleoylamide (DOGS) (Transfectam, Promega, Madison, Wisconsin) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide (DPPES) (see, e.g., U.S. Pat. No. 5,171,678).

    [0616] Another cationic lipid conjugate includes derivatization of the lipid with cholesterol (DC-Chol) which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L., (1991) Biochim. Biophys. Res. Commun. 179:280). Lipopolylysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., (1991) Biochim. Biophys. Acta 1065:8). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, California) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Maryland). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.

    [0617] Liposomal formulations are particularly suited for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer RNAi agent into the skin. In some implementations, liposomes are used for delivering RNAi agent to epidermal cells and also to enhance the penetration of RNAi agent into dermal tissues, e.g., into skin. For example, the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e.g., Weiner et al., (1992) Journal of Drug Targeting, vol. 2,405-410 and du Plessis et al., (1992) Antiviral Research, 18:259-265; Mannino, R. J. and Fould-Fogerite, S., (1998) Biotechniques 6:682-690; Itani, T. et al., (1987) Gene 56:267-276; Nicolau, C. et al. (1987) Meth. Enzymol. 149:157-176; Straubinger, R. M. and Papahadjopoulos, D. (1983) Meth. Enzymol. 101:512-527; Wang, C. Y. and Huang, L., (1987) Proc. Natl. Acad. Sci. USA 84:7851-7855).

    [0618] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver a drug into the dermis of mouse skin. Such formulations with RNAi agent are useful for treating a dermatological disorder.

    [0619] Liposomes that include RNAi agents can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome. For example, transfersomes are a type of deformable liposomes. Transferosomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include RNAi agent can be delivered, for example, subcutaneously by infection in order to deliver RNAi agent to keratinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. In addition, due to the lipid properties, these transferosomes can be self-optimizing (adaptive to the shape of pores, e.g., in the skin), self-repairing, and can frequently reach their targets without fragmenting, and often self-loading.

    [0620] Other formulations amenable to the present disclosure are described in U.S. provisional application Ser. No. 61/018,616, filed Jan. 2, 2008; 61/018,611, filed Jan. 2, 2008; 61/039,748, filed Mar. 26, 2008; 61/047,087, filed Apr. 22, 2008 and 61/051,528, filed May 8, 2008. PCT application number PCT/US2007/080331, filed Oct. 3, 2007, also describes formulations that are amenable to the present disclosure.

    [0621] Transfersomes, yet another type of liposomes, are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g., they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

    [0622] Surfactants find wide application in formulations such as those described herein, particularly in emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the head) provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

    [0623] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general, their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

    [0624] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.

    [0625] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.

    [0626] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.

    [0627] The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

    [0628] The RNAi agent for use in the methods of the disclosure can also be provided as micellar formulations. Micelles are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.

    [0629] A mixed micellar formulation suitable for delivery through transdermal membranes may be prepared by mixing an aqueous solution of the siRNA composition, an alkali metal C.sub.8 to C.sub.22 alkyl sulphate, and a micelle forming compounds. Exemplary micelle forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil, evening of primrose oil, menthol, trihydroxy oxo cholanyl glycine and pharmaceutically acceptable salts thereof, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ethers and analogues thereof, polidocanol alkyl ethers and analogues thereof, chenodeoxycholate, deoxycholate, and mixtures thereof. The micelle forming compounds may be added at the same time or after addition of the alkali metal alkyl sulphate. Mixed micelles will form with substantially any kind of mixing of the ingredients but vigorous mixing in order to provide smaller size micelles.

    [0630] In one method a first micellar composition is prepared which contains the siRNA composition and at least the alkali metal alkyl sulphate. The first micellar composition is then mixed with at least three micelle forming compounds to form a mixed micellar composition. In another method, the micellar composition is prepared by mixing the siRNA composition, the alkali metal alkyl sulphate and at least one of the micelle forming compounds, followed by addition of the remaining micelle forming compounds, with vigorous mixing.

    [0631] Phenol or m-cresol may be added to the mixed micellar composition to stabilize the formulation and protect against bacterial growth. Alternatively, phenol or m-cresol may be added with the micelle forming ingredients. An isotonic agent such as glycerin may also be added after formation of the mixed micellar composition.

    [0632] For delivery of the micellar formulation as a spray, the formulation can be put into an aerosol dispenser and the dispenser is charged with a propellant. The propellant, which is under pressure, is in liquid form in the dispenser. The ratios of the ingredients are adjusted so that the aqueous and propellant phases become one, i.e., there is one phase. If there are two phases, it is necessary to shake the dispenser prior to dispensing a portion of the contents, e.g., through a metered valve. The dispensed dose of pharmaceutical agent is propelled from the metered valve in a fine spray.

    [0633] Propellants may include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2 tetrafluoroethane) may be used.

    [0634] The specific concentrations of the essential ingredients can be determined by relatively straightforward experimentation. For absorption through the oral cavities, it is often desirable to increase, e.g., at least double or triple, the dosage for through injection or administration through the gastrointestinal tract.

    [0635] Lipid Particles

    [0636] RNAi agents, e.g., dsRNAs of in the disclosure may be fully encapsulated in a lipid formulation, e.g., a LNP, or other nucleic acid-lipid particle.

    [0637] As used herein, the term LNP refers to a stable nucleic acid-lipid particle. LNPs typically contain a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate). LNPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). LNPs include pSPLP, which include an encapsulated condensing agent-nucleic acid complex as set forth in WO 00/03683. The particles of the present disclosure typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid-lipid particles of the present disclosure are resistant in aqueous solution to degradation with a nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; United States Patent publication No. 2010/0324120 and WO 96/40964.

    [0638] In one embodiment, the lipid to drug ratio (mass/mass ratio) (e.g., lipid to dsRNA ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above recited ranges are also contemplated to be part of the disclosure.

    [0639] Certain specific LNP formulations for delivery of RNAi agents have been described in the art, including, e.g., LNP01 formulations as described in, e.g., WO 2008/042973, which is hereby incorporated by reference.

    [0640] Additional exemplary lipid-dSRNA formulations are identified in the table below.

    TABLE-US-00001 cationic lipid/non-cationic lipid/cholesterol/PEG-lipid conjugate Ionizable/Cationic Lipid Lipid:siRNA ratio SNALP-1 1,2-Dilinolenyloxy-N,N- DLinDMA/DPPC/Cholesterol/PEG- dimethylaminopropane (DLinDMA) cDMA (57.1/7.1/34.4/1.4) lipid:siRNA ~7:1 2-XTC 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DPPC/Cholesterol/PEG-cDMA dioxolane (XTC) 57.1/7.1/34.4/1.4 lipid:siRNA ~7:1 LNP05 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:siRNA ~6:1 LNP06 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:siRNA ~11:1 LNP07 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 60/7.5/31/1.5, lipid:siRNA ~6:1 LNP08 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 60/7.5/31/1.5, lipid:siRNA ~11:1 LNP09 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]- XTC/DSPC/Cholesterol/PEG-DMG dioxolane (XTC) 50/10/38.5/1.5 Lipid:siRNA10:1 LNP10 (3aR,5s,6aS)-N,N-dimethyl-2,2- ALN100/DSPC/Cholesterol/PEG- di((9Z,12Z)-octadeca-9,12- DMG dienyl)tetrahydro-3aH- 50/10/38.5/1.5 cyclopenta[d][1,3]dioxol-5-amine Lipid:siRNA10:1 (ALN100) LNP11 (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31- MC-3/DSPC/Cholesterol/PEG-DMG tetraen-19-yl 4-(dimethylamino)butanoate 50/10/38.5/1.5 (MC3) Lipid:siRNA10:1 LNP12 1,1'-(2-(4-(2-((2-(bis(2- Tech G1/DSPC/Cholesterol/PEG- hydroxydodecyl)amino)ethyl)(2- DMG hydroxydodecyl)amino)ethyl)piperazin-1- 50/10/38.5/1.5 yl)ethylazanediyl)didodecan-2-ol (Tech Lipid:siRNA10:1 G1) LNP13 XTC XTC/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA:33:1 LNP14 MC3 MC3/DSPC/Chol/PEG-DMG 40/15/40/5 Lipid:siRNA:11:1 LNP15 MC3 MC3/DSPC/Chol/PEG-DSG/GalNAc- PEG-DSG 50/10/35/4.5/0.5 Lipid:siRNA:11:1 LNP16 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA:7:1 LNP17 MC3 MC3/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA:10:1 LNP18 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 12:1 LNP19 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/35/5 Lipid:siRNA:8:1 LNP20 MC3 MC3/DSPC/Chol/PEG-DPG 50/10/38.5/1.5 Lipid:siRNA:10:1 LNP21 C12-200 C12-200/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA:7:1 LNP22 XTC XTC/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA:10:1 [0641] DSPC: distearoylphosphatidylcholine [0642] DPPC: dipalmitoylphosphatidylcholine [0643] PEG-DMG: PEG-didimyristoyl glycerol (C14-PEG, or PEG-C14) (PEG with avg mol wt of 2000) [0644] PEG-DSG: PEG-distyryl glycerol (C18-PEG, or PEG-C18) (PEG with avg mol wt of 2000) [0645] PEG-cDMA: PEG-carbamoyl-1,2-dimyristyloxypropylamine (PEG with avg mol wt of 2000) [0646] SNALP (1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)) comprising formulations are described in WO 2009/127060, which is hereby incorporated by reference. [0647] XTC comprising formulations are described in WO 2010/088537, the entire contents of which are hereby incorporated herein by reference. [0648] MC3 comprising formulations are described, e.g., in United States Patent Publication No. 2010/0324120, the entire contents of which are hereby incorporated by reference. [0649] ALNY-100 comprising formulations are described in WO 2010/054406, the entire contents of which are hereby incorporated herein by reference. [0650] C12-200 comprising formulations are described in WO 2010/129709, the entire contents of which are hereby incorporated herein by reference.

    [0651] Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable. In some embodiments, oral formulations are those in which dsRNAs featured in the disclosure are administered in conjunction with one or more penetration enhancer surfactants and chelators. Suitable surfactants include fatty acids or esters or salts thereof, bile acids or salts thereof. Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g., sodium). In some embodiments, combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. DsRNAs featured in the disclosure can be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. DsRNA complexing agents include poly-amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses and starches. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for dsRNAs and their preparation are described in detail in U.S. Pat. No. 6,887,906, U.S. 2003/0027780, and U.S. Pat. No. 6,747,014, each of which is incorporated herein by reference.

    [0652] Compositions for pulmonary system delivery may include aqueous solutions, e.g., for intranasal or oral inhalative administration, suitable carriers composed of, e.g., lipids (liposomes, niosomes, microemulsions, lipidic micelles, solid lipid nanoparticles) or polymers (polymer micelles, dendrimers, polymeric nanoparticles, nonogels, nanocapsules), adjuvant, e.g., for oral inhalative administration. Aqueous compositions may be sterile and may optionally contain buffers, diluents, absorbtion enhancers and other suitable additives.

    [0653] Compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

    [0654] Pharmaceutical compositions of the present disclosure include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. Particularly useful formulations include those that target the brain when treating DPP4-associated diseases or disorders.

    [0655] The pharmaceutical formulations of the present disclosure, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

    [0656] The compositions of the present disclosure can be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present disclosure can also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol or dextran. The suspension can also contain stabilizers.

    [0657] Additional Formulations

    [0658] i. Emulsions

    [0659] The compositions of the present disclosure can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 m in diameter (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions can be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions can contain additional components in addition to the dispersed phases, and the active drug which can be present as a solution in either aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants can also be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise, a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.

    [0660] Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion can be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that can be incorporated into either phase of the emulsion. Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

    [0661] Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).

    [0662] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.

    [0663] A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

    [0664] Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.

    [0665] Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that can readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used can be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

    [0666] The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of ease of formulation, as well as efficacy from an absorption and bioavailability standpoint (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.

    [0667] ii. Microemulsions

    [0668] In one embodiment of the present disclosure, the compositions of RNAi agents and nucleic acids are formulated as microemulsions. A microemulsion can be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically, microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used, and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

    [0669] The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.

    [0670] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DA0750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions can, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase can typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase can include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.

    [0671] Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions can form spontaneously when their components are brought together at ambient temperature. This can be particularly advantageous when formulating thermolabile drugs, peptides or RNAi agents. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present disclosure will facilitate the increased systemic absorption of RNAi agents and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of RNAi agents and nucleic acids.

    [0672] Microemulsions of the present disclosure can also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the RNAi agents and nucleic acids of the present disclosure. Penetration enhancers used in the microemulsions of the present disclosure can be classified as belonging to one of five broad categoriessurfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.

    [0673] iii. Microparticles

    [0674] An RNAi agent of the disclosure may be incorporated into a particle, e.g., a microparticle. Microparticles can be produced by spray-drying, but may also be produced by other methods including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques.

    [0675] iv. Penetration Enhancers

    [0676] In one embodiment, the present disclosure employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly RNAi agents, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.

    [0677] Penetration enhancers can be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.

    [0678] Surfactants (or surface-active agents) are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of RNAi agents through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

    [0679] Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C.sub.1-20 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see e.g., Touitou, E., et al. Enhancement in Drug Delivery, CRC Press, Danvers, M A, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

    [0680] The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term bile salts includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).

    [0681] Chelating agents, as used in connection with the present disclosure, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of RNAi agents through the mucosa is enhanced. With regards to their use as penetration enhancers in the present disclosure, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(see e.g., Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, M A, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

    [0682] As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of RNAi agents through the alimentary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

    [0683] Agents that enhance uptake of RNAi agents at the cellular level can also be added to the pharmaceutical and other compositions of the present disclosure. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (WO 97/30731), are also known to enhance the cellular uptake of dsRNAs.

    [0684] Other agents can be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.

    [0685] vi. Excipients

    [0686] In contrast to a carrier compound, a pharmaceutical carrier or excipient is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc).

    [0687] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present disclosure. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

    [0688] Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions can also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.

    [0689] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

    [0690] vii. Other Components

    [0691] The compositions of the present disclosure can additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions can contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or can contain additional materials useful in physically formulating various dosage forms of the compositions of the present disclosure, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present disclosure. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.

    [0692] Aqueous suspensions can contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol or dextran. The suspension can also contain stabilizers.

    [0693] In some embodiments, pharmaceutical compositions featured in the disclosure include (a) one or more RNAi agents and (b) one or more agents which function by a non-RNAi mechanism and which are useful in treating a DPP4-associated disorder. Examples of such agents include, but are not limited to an antiviral agent, an immune stimulator, a therapeutic vaccine, a viral entry inhibitor, and a combination of any of the foregoing.

    [0694] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD.sub.50 (the dose lethal to 50% of the population) and the ED.sub.50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD.sub.50/ED.sub.50. Compounds that exhibit high therapeutic indices are preferred.

    [0695] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured herein in the disclosure lies generally within a range of circulating concentrations that include the ED.sub.50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the disclosure, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC.sub.50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.

    [0696] In addition to their administration, as discussed above, the RNAi agents featured in the disclosure can be administered in combination with other known agents effective in treatment of pathological processes mediated by nucleotide repeat expression. In any event, the administering physician can adjust the amount and timing of RNAi agent administration on the basis of results observed using standard measures of efficacy known in the art or described herein.

    VII. Kits

    [0697] In certain aspects, the instant disclosure provides kits that include a suitable container containing a pharmaceutical formulation of a siRNA compound, e.g., a double-stranded siRNA compound, or siRNA compound, (e.g., a precursor, e.g., a larger siRNA compound which can be processed into a siRNA compound, or a DNA which encodes an siRNA compound, e.g., a double-stranded siRNA compound, or siRNA compound, or precursor thereof). In certain embodiments the individual components of the pharmaceutical formulation may be provided in one container. Alternatively, it may be desirable to provide the components of the pharmaceutical formulation separately in two or more containers, e.g., one container for a siRNA compound preparation, and at least another for a carrier compound. The kit may be packaged in a number of different configurations such as one or more containers in a single box. The different components can be combined, e.g., according to instructions provided with the kit. The components can be combined according to a method described herein, e.g., to prepare and administer a pharmaceutical composition. The kit can also include a delivery device, such as a device suitable for pulmonary administration, e.g., a device suitable for oral inhalative administration including nebulizers, metered-dose inhalers, and dry powder inhalers.

    VIII. Methods for Inhibiting DPP4 Expression

    [0698] The present disclosure also provides methods of inhibiting expression of a DPP4 gene in a cell. The methods include contacting a cell with an RNAi agent, e.g., double stranded RNAi agent, in an amount effective to inhibit expression of a DPP4 gene in the cell, thereby inhibiting expression of DPP4 in the cell. In certain embodiments of the disclosure, expression of a DPP4 gene is inhibited in liver cells (e.g., hepatocytes).

    [0699] Contacting of a cell with a RNAi agent, e.g., a double stranded RNAi agent, may be done in vitro or in vivo. Contacting a cell in vivo with the RNAi agent includes contacting a cell or group of cells within a subject, e.g., a human subject, with the RNAi agent. Combinations of in vitro and in vivo methods of contacting a cell are also possible.

    [0700] Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is a lipophilic moiety, e.g., a C16, and/or a carbohydrate moiety, e.g., a GalNAc ligand, or any other ligand that directs the RNAi agent to a site of interest. In certain embodiments, the ligand is not a cholesterol moiety. In certain embodiments, the RNAi agent does not include a targeting ligand.

    [0701] The term inhibiting, as used herein, is used interchangeably with reducing, silencing, downregulating, suppressing and other similar terms, and includes any level of inhibition. In certain embodiments, a level of inhibition, e.g., for an RNAi agent of the instant disclosure, can be assessed in cell culture conditions, e.g., wherein cells in cell culture are transfected via Lipofectamine-mediated transfection at a concentration in the vicinity of a cell of 10 nM or less, 1 nM or less, etc. Knockdown of a given RNAi agent can be determined via comparison of pre-treated levels in cell culture versus post-treated levels in cell culture, optionally also comparing against cells treated in parallel with a scrambled or other form of control RNAi agent. Knockdown in cell culture of, e.g., 50% or more, can thereby be identified as indicative of inhibiting or reducing, downregulating or suppressing, etc. having occurred. It is expressly contemplated that assessment of targeted mRNA or encoded protein levels (and therefore an extent of inhibiting, etc. caused by a RNAi agent of the disclosure) can also be assessed in in vivo systems for the RNAi agents of the instant disclosure, under properly controlled conditions as described in the art.

    [0702] The phrase inhibiting expression of a DPP4 gene or inhibiting expression of DPP4, as used herein, includes inhibition of expression of any DPP4 gene (such as, e.g., a mouse DPP4 gene, a rat DPP4 gene, a monkey DPP4 gene, or a human DPP4 gene) as well as variants or mutants of a DPP4 gene that encode a DPP4 protein. Thus, the DPP4 gene may be a wild-type DPP4 gene, a mutant DPP4 gene, or a transgenic DPP4 gene in the context of a genetically manipulated cell, group of cells, or organism.

    [0703] Inhibiting expression of a DPP4 gene includes any level of inhibition of a DPP4 gene, e.g., at least partial suppression of the expression of a DPP4 gene, such as an inhibition by at least 20%. In certain embodiments, inhibition is by at least 30%, at least 40%, at least 50%, at least about 60%, at least 70%, at least about 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%; or to below the level of detection of the assay method. In certain method, inhibition is measured at a 10 nM concentration of the siRNA using the luciferase assay provided in Example 1.

    [0704] The expression of a DPP4 gene may be assessed based on the level of any variable associated with DPP4 gene expression, e.g., DPP4 mRNA level or DPP4 protein level.

    [0705] Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

    [0706] In some embodiments of the methods of the disclosure, expression of a DPP4 gene is inhibited by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, or 95%, or to below the level of detection of the assay. In certain embodiments, the methods include a clinically relevant inhibition of expression of DPP4, e.g. as demonstrated by a clinically relevant outcome after treatment of a subject with an agent to reduce the expression of a DPP4 gene.

    [0707] Inhibition of the expression of a DPP4 gene may be manifested by a reduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a DPP4 gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with a RNAi agent of the disclosure, or by administering a RNAi agent of the disclosure to a subject in which the cells are or were present) such that the expression of a DPP4 gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s) not treated with a RNAi agent or not treated with a RNAi agent targeted to the genome of interest). The degree of inhibition may be expressed in terms of:

    [00002] ( mRNA in control cells ) - ( mRNA in treated cells ) ( mRNA in control cells ) .Math. 100 %

    [0708] In other embodiments, inhibition of the expression of a DPP4 gene may be assessed in terms of a reduction of a parameter that is functionally linked to a DPP4 gene expression, e.g., DPP4 protein expression, S protein priming, efficiency of viral entry, viral load. DPP4 gene silencing may be determined in any cell expressing a DPP4 gene, either endogenous or heterologous from an expression construct, and by any assay known in the art.

    [0709] Inhibition of the expression of a DPP4 protein may be manifested by a reduction in the level of the DPP4 protein that is expressed by a cell or group of cells (e.g., the level of protein expressed in a sample derived from a subject). As explained above, for the assessment of genome suppression, the inhibition of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells.

    [0710] A control cell or group of cells that may be used to assess the inhibition of the expression of a DPP4 gene includes a cell or group of cells that has not yet been contacted with an RNAi agent of the disclosure. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an RNAi agent.

    [0711] The level of DPP4 mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing RNA expression. In one embodiment, the level of expression of DPP4 in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the DPP4 gene. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis. Circulating DPP4 mRNA may be detected using methods the described in WO2012/177906, the entire contents of which are hereby incorporated herein by reference.

    [0712] In some embodiments, the level of expression of DPP4 is determined using a nucleic acid probe. The term probe, as used herein, refers to any molecule that is capable of selectively binding to a specific DPP4 nucleic acid or protein, or fragment thereof. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

    [0713] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses and probe arrays. One method for the determination of RNA levels involves contacting the isolated RNA with a nucleic acid molecule (probe) that can hybridize to DPP4 RNA. In one embodiment, the RNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated RNA on an agarose gel and transferring the RNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the RNA is contacted with the probe(s), for example, in an Affymetrix gene chip array. A skilled artisan can readily adapt known RNA detection methods for use in determining the level of DPP4 mRNA.

    [0714] An alternative method for determining the level of expression of DPP4 in a sample involves the process of nucleic acid amplification or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natd. Acad. Sci. USA 88:189-193), self sustained sequence replication (Guatelli et al. (1990) Proc. Natd. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natd. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), rolling circle replication (Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects of the disclosure, the level of expression of DPP4 is determined by quantitative fluorogenic RT-PCR (i.e., the TaqMan System), by a Dual-Glo Luciferase assay, or by other art-recognized method for measurement of DPP4 expression or mRNA level.

    [0715] The expression level of DPP4 mRNA may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Pat. Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, which are incorporated herein by reference. The determination of DPP4 expression level may also comprise using nucleic acid probes in solution.

    [0716] In some embodiments, the level of RNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The use of this PCR method is described and exemplified in the Examples presented herein. Such methods can also be used for the detection of DPP4 nucleic acids.

    [0717] The level of DPP4 protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like. Such assays can also be used for the detection of proteins indicative of the presence or replication of DPP4 proteins.

    [0718] In some embodiments, the efficacy of the methods of the disclosure in the treatment of a DPP4-related disease is assessed by a decrease in DPP4 mRNA level (e.g, by assessment of a blood DPP4 level, or otherwise).

    [0719] In some embodiments, the efficacy of the methods of the disclosure in the treatment of a DPP4-related disease is assessed by a decrease in DPP4 mRNA level (e.g, by assessment of a liver sample for DPP4 level, by biopsy, or otherwise).

    [0720] In some embodiments of the methods of the disclosure, the RNAi agent is administered to a subject such that the RNAi agent is delivered to a specific site within the subject. The inhibition of expression of DPP4 may be assessed using measurements of the level or change in the level of DPP4 mRNA or DPP4 protein in a sample derived from a specific site within the subject, e.g., liver cells. In certain embodiments, the methods include a clinically relevant inhibition of expression of DPP4, e.g. as demonstrated by a clinically relevant outcome after treatment of a subject with an agent to reduce the expression of DPP4.

    [0721] As used herein, the terms detecting or determining a level of an analyte are understood to mean performing the steps to determine if a material, e.g., protein, RNA, is present. As used herein, methods of detecting or determining include detection or determination of an analyte level that is below the level of detection for the method used.

    IX. Methods of Treating or Preventing DPP4-Associated Diseases

    [0722] The present disclosure also provides methods of using a RNAi agent of the disclosure or a composition containing a RNAi agent of the disclosure to reduce or inhibit DPP4 expression in a cell. The methods include contacting the cell with a dsRNA of the disclosure and maintaining the cell for a time sufficient to obtain degradation of the mRNA transcripts of a DPP4 gene, thereby inhibiting expression of the DPP4 gene in the cell. Reduction in gene expression can be assessed by any methods known in the art. For example, a reduction in the expression of DPP4 may be determined by determining the mRNA expression level of a DPP4 gene using methods routine to one of ordinary skill in the art, e.g., northern blotting, qRT-PCR; by determining the protein level of a DPP4 protein using methods routine to one of ordinary skill in the art, such as western blotting, immunological techniques.

    [0723] In the methods of the disclosure the cell may be contacted in vitro or in vivo, i.e., the cell may be within a subject.

    [0724] A cell suitable for treatment using the methods of the disclosure may be any cell that expresses a DPP4 gene. A cell suitable for use in the methods of the disclosure may be a mammalian cell, e.g., a primate cell (such as a human cell or a non-human primate cell, e.g., a monkey cell or a chimpanzee cell), a non-primate cell (such as a rat cell, or a mouse cell. In one embodiment, the cell is a human cell, e.g., a human liver cell.

    [0725] DPP4 expression is inhibited in the cell by at least about 30, 40, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or about 100%, i.e., to below the level of detection. In certain embodiments, DPP4 expression is inhibited by at least 50%.

    [0726] The in vivo methods of the disclosure may include administering to a subject a composition containing a RNAi agent, where the RNAi agent includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the DPP4 gene of the subject to be treated. When the organism to be treated is a mammal such as a human, the composition can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection. In certain embodiments, the compositions are administered orally. In certain embodiments, the compositions are administered by pulmonary delivery, e.g., oral inhalation or intranasal delivery.

    [0727] In some embodiments, the administration is via a depot injection. A depot injection may release the RNAi agent in a consistent way over a prolonged time period. Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of DPP4, or a therapeutic or prophylactic effect. A depot injection may also provide more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In certain embodiments, the depot injection is a subcutaneous injection.

    [0728] In one embodiment, the double-stranded RNAi agent is administered by pulmonary system administration, e.g., intranasal administration or oral inhalative administration. Pulmonary system administration may be via a syringe, a dropper, atomization, or use of device, e.g., a passive breath driven or active power driven single/-multiple dose dry powder inhaler (DPI) device.

    [0729] The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting.

    [0730] In one aspect, the present disclosure also provides methods for inhibiting the expression of a DPP4 gene in a mammal. The methods include administering to the mammal a composition comprising a dsRNA that targets a DPP4 gene in a cell of the mammal and maintaining the mammal for a time sufficient to obtain degradation of the RNA transcript of the DPP4 gene, thereby inhibiting expression of the DPP4 gene in the cell. Reduction in genome expression can be assessed by any methods known it the art and by methods, e.g. qRT-PCR, described herein. Reduction in protein production can be assessed by any methods known it the art and by methods, e.g. ELISA, described herein.

    [0731] The present disclosure further provides methods of treatment of a subject in need thereof. The treatment methods of the disclosure include administering an RNAi agent of the disclosure to a subject, e.g., a subject that would benefit from inhibition of DPP4 expression, in a therapeutically effective amount of a RNAi agent targeting a DPP4 gene or a pharmaceutical composition comprising a RNAi agent targeting a DPP4 gene.

    [0732] In addition, the present disclosure provides methods of preventing, treating or inhibiting the progression of a DPP4-associated disease or disorder, e.g., a metabolic disease, e.g., diabetes or a lipid metabolism disorder.

    [0733] The methods include administering to the subject a therapeutically effective amount of any of the RNAi agent, e.g., dsRNA agents, or the pharmaceutical composition provided herein, thereby preventing, treating, or inhibiting the progression of the DPP4-associated disease or disorder in the subject.

    [0734] An RNAi agent of the disclosure may be administered as a free RNAi agent. A free RNAi agent is administered in the absence of a pharmaceutical composition. The naked RNAi agent may be in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the RNAi agent can be adjusted such that it is suitable for administering to a subject. In certain embodiments, the free RNAi agent may be formulated in water or normal saline.

    [0735] Alternatively, an RNAi agent of the disclosure may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation.

    [0736] Subjects that would benefit from a reduction or inhibition of DPP4 gene expression are those having a DPP4-associated disease, subjects at risk of developing a DPP4-associate disease.

    [0737] Non-limiting examples of metabolic diseases include disorders of carbohydrates, e.g., diabetes (type I and type II diabetes), galactosemia, hereditary fructose intolerance, fructose 1,6-diphosphatase deficiency, glycogen storage disorders, congenital disorders of glycosylation, insulin resistance, insulin insufficiency, hyperinsulinemia, impaired glucose tolerance (IGT), abnormal glycogen metabolism; disorders of amino acid metabolism, e.g., maple syrup urine disease (MSUD), or homocystinuria; disorder of organic acid metabolism, e.g., methylmalonic aciduria, 3-methylglutaconic aciduriaBarth syndrome, glutaric aciduria or 2-hydroxyglutaric aciduriaD and L forms; disorders of faccy acid beta-oxidation, e.g., medium-chain acyl-CoA dehydrogenase deficiency (MCAD), long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency (LCHAD), very-long-chain acyl-CoA dehydrogenase deficiency (VLCAD); disorders of lipid metabolism, e.g., GM1 Gangliosidosis, Tay-Sachs Disease, Sandhoff Disease, Fabry Disease, Gaucher Disease, Niemann-Pick Disease, Krabbe Disease, Mucolipidoses, or Mucopolysaccharidoses; mitochondrial disorders, e.g., mitochondrial cardiomyopathies; Leigh disease; mitochondrial encephalopathy, lactic acidosis, and stroke-like episodes (MELAS); myoclonic epilepsy with ragged-red fibers (MERRF); neuropathy, ataxia, and retinitis pigmentosa (NARP); Barth syndrome; or peroxisomal disorders, e.g., Zellweger Syndrome (cerebrohepatorenal syndrome), X-Linked Adrenoleukodystrophy or Refsum Disease.

    [0738] The disclosure further provides methods for the use of a RNAi agent or a pharmaceutical composition thereof, e.g., for treating a subject that would benefit from reduction or inhibition of DPP4 expression, e.g., a subject having a DPP4-associated disorder, in combination with other pharmaceuticals or other therapeutic methods, e.g., with known pharmaceuticals or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders. For example, in certain embodiments, an RNAi agent targeting DPP4 is administered in combination with, e.g., an agent useful in treating a DPP4-associated disorder as described elsewhere herein or as otherwise known in the art. For example, additional agents and treatments suitable for treating a subject that would benefit from reduction in DPP4 expression, e.g., a subject having a DPP4-associated disorder, may include agents currently used to treat symptoms of DPP4-associated disorder.

    [0739] Examples of the additional therapeutic agents which can be used with an RNAi agent of the invention include, but are not limited to, diabetes mellitus-treating agents, diabetic complication-treating agents, cardiovascular diseases-treating agents, anti-hyperlipemic agents, hypotensive or antihypertensive agents, anti-obesity agents, nonalcoholic steatohepatitis (NASH)-treating agents, chemotherapeutic agents, immunotherapeutic agents, immunosuppressive agents, and the like. Such combination therapies may advantageously utilize lower dosages of the administered therapeutic agents, thus avoiding possible toxicities or complications associated with the various monotherapies.

    [0740] Examples of agents for treating diabetes mellitus include insulin formulations (e.g., animal insulin formulations extracted from a pancreas of a cattle or a swine; a human insulin formulation synthesized by a gene engineering technology using microorganisms or methods), insulin sensitivity enhancing agents, pharmaceutically acceptable salts, hydrates, or solvates thereof (e.g., pioglitazone, troglitazone, rosiglitazone, netoglitazone, balaglitazone, rivoglitazone, tesaglitazar, farglitazar, CLX-0921, R-483, NIP-221, NIP-223, DRF-2189, GW-7282TAK-559, T-131, RG-12525, LY-510929, LY-519818, BMS-298585, DRF-2725, GW-1536, GI-262570, KRP-297, TZD18 (Merck), DRF-2655, and the like), alpha-glycosidase inhibitors (e.g., voglibose, acarbose, miglitol, emiglitate and the like), biguanides (e.g., phenformin, metformin, buformin and the like) or sulfonylureas (e.g., tolbutamide, glibenclamide, gliclazide, chlorpropamide, tolazamide, acetohexamide, glyclopyramide, glimepiride and the like) as well as other insulin secretion-promoting agents (e.g., repaglinide, senaglinide, nateglinide, mitiglinide, GLP-1 and the like), amyrin agonist (e.g., pramlintide and the like), phosphotyrosin phosphatase inhibitor (e.g., vanadic acid and the like) and the like.

    [0741] Examples of agents for treating diabetic complications include, but are not limited to, aldose reductase inhibitors (e.g., tolrestat, epalrestat, zenarestat, zopolrestat, minalrestat, fidareatat, SK-860, CT-112 and the like), neurotrophic factors (e.g., NGF, NT-3, BDNF and the like), PKC inhibitors (e.g., LY-333531 and the like), advanced glycation end-product (AGE) inhibitors (e.g., ALT946, pimagedine, pyradoxamine, phenacylthiazolium bromide (ALT766) and the like), active oxygen quenching agents (e.g., thioctic acid or derivative thereof, a bioflavonoid including flavones, isoflavones, flavonones, procyanidins, anthocyanidins, pycnogenol, lutein, lycopene, vitamins E, coenzymes Q, and the like), cerebrovascular dilating agents (e.g., tiapride, mexiletene and the like).

    [0742] Anti-hyperlipemic agents include, for example, statin-based compounds which are cholesterol synthesis inhibitors (e.g., pravastatin, simvastatin, lovastatin, atorvastatin, fluvastatin, rosuvastatin and the like), squalene synthetase inhibitors or fibrate compounds having a triglyceride-lowering effect (e.g., fenofibrate, gemfibrozil, bezafibrate, clofibrate, sinfibrate, clinofibrate and the like), niacin, PCSK9 inhibitors, triglyceride lowing agents or cholesterol sequesting agents.

    [0743] Hypotensive agents include, for example, angiotensin converting enzyme inhibitors (e.g., captopril, enalapril, delapril, benazepril, cilazapril, enalapril, enalaprilat, fosinopril, lisinopril, moexipril, perindopril, quinapril, ramipril, trandolapril and the like) or angiotensin II antagonists (e.g., losartan, candesartan cilexetil, olmesartan medoxomil, eprosartan, valsartan, telmisartan, irbesartan, tasosartan, pomisartan, ripisartan forasartan, and the like) or calcium channel blockers (e.g., amlodipine) or aspirin.

    [0744] Nonalcoholic steatohepatitis (NASH)-treating agents include, for example, ursodiol, pioglitazone, orlistat, betaine, rosiglitazone.

    [0745] Anti-obesity agents include, for example, central antiobesity agents (e.g., dexfenfluramine, fenfluramine, phentermine, sibutramine, amfepramone, dexamphetamine, mazindol, phenylpropanolamine, clobenzorex and the like), gastrointestinal lipase inhibitors (e.g., orlistat and the like), beta 3-adrenoceptor agonists (e.g., CL-316243, SR-58611-A, UL-TG-307, SB-226552, AJ-9677, BMS-196085 and the like), peptide-based appetite-suppressing agents (e.g., leptin, CNTF and the like), cholecystokinin agonists (e.g., lintitript, FPL-15849 and the like) and the like.

    [0746] Chemotherapeutic agents include, for example, alkylating agents (e.g., cyclophosphamide, iphosphamide and the like), metabolism antagonists (e.g., methotrexate, 5-fluorouracil and the like), anticancer antibiotics (e.g., mitomycin, adriamycin and the like), vegetable-derived anticancer agents (e.g., vincristine, vindesine, taxol and the like), cisplatin, carboplatin, etoposide and the like. Among these substances, 5-fluorouracil derivatives such as furtulon and neofurtulon are preferred.

    [0747] Immunotherapeutic agents include, for example, microorganisms or bacterial components (e.g., muramyl dipeptide derivative, picibanil and the like), polysaccharides having immune potentiating activity (e.g., lentinan, sizofilan, krestin and the like), cytokines obtained by a gene engineering technology (e.g., interferon, interleukin (IL) and the like), colony stimulating factors (e.g., granulocyte colony stimulating factor, erythropoetin and the like) and the like. In some embodiments, the agents are IL-1, IL-2, IL-12 and the like.

    [0748] Immunosuppressive agents include, for example, calcineurin inhibitor/immunophilin modulators such as cyclosporine (Sandimmune, Gengraf, Neoral), tacrolimus (Prograf, FK506), ASM 981, sirolimus (RAPA, rapamycin, Rapamune), or its derivative SDZ-RAD, glucocorticoids (prednisone, prednisolone, methylprednisolone, dexamethasone and the like), purine synthesis inhibitors (mycophenolate mofetil, MMF, CellCept, azathioprine, cyclophosphamide), interleukin antagonists (basiliximab, daclizumab, deoxyspergualin), lymphocyte-depleting agents such as antithymocyte globulin (Thymoglobulin, Lymphoglobuline), anti-CD3 antibody (OKT3), and the like.

    [0749] In addition, agents whose cachexia improving effect has been established in an animal model or at a clinical stage, such as cyclooxygenase inhibitors (e.g., indomethacin and the like), progesterone derivatives (e.g., megestrol acetate), glucosteroid (e.g., dexamethasone and the like), metoclopramide-based agents, tetrahydrocannabinol-based agents, lipid metabolism improving agents (e.g., eicosapentanoic acid and the like), growth hormones, IGF-1, antibodies against TNF-, LIF, IL-6 and oncostatin M may also be employed concomitantly with an RNAi agent according to the present invention. Additional therapeutic agents for use in the treatment of diseases or conditions related to metabolic disorders and/or impaired neurological signaling would be apparent to the skilled artisan and are within the scope of this disclosure.

    [0750] In some embodiments, second agents suitable for administration as a combination therapy in conjunction with the RNAi agents described herein are anti-fibrotic agents, such as TGF1 inhibitors; anti-inflammatory agents (e.g., a systemic corticosteroid (e.g., prednisone), anti-steatosis agents, anti-viral agents, immune modulators, tyrosine kinase inhibitors, and a combination of any of the foregoing.

    [0751] The RNAi agent and additional therapeutic agents may be administered at the same time or in the same combination, or the additional therapeutic agent can be administered as part of a separate composition or at separate times or by another method known in the art or described herein.

    [0752] In one embodiment, the method includes administering a composition featured herein such that expression of the target DPP4 gene is decreased, for at least one month. In some embodiments, expression is decreased for at least 2 months, 3 months, or 6 months.

    [0753] In certain embodiments, administration includes a loading dose administered at a higher frequency, e.g., once per day, twice per week, once per week, for an initial dosing period, e.g., 2-4 doses.

    [0754] In some embodiments, the RNAi agents useful for the methods and compositions featured herein specifically target RNAs (primary or processed) of the target DPP4 gene. Compositions and methods for inhibiting the expression of these genes using RNAi agents can be prepared and performed as described herein.

    [0755] Administration of the dsRNA according to the methods of the disclosure may result in a reduction of the severity, signs, symptoms, or markers of such diseases or disorders in a patient with a DPP4-associated disorder. In some embodiments, administration of the dsRNA results in a reduction in blood glucose level in a subject with a DPP4-associated disorder. In other embodiments, administration of the dsRNA results in a reduction in blood lipid level in a subject with a DPP4-associated disorder. By reduction in this context is meant a statistically significant or clinically significant decrease in such level. The reduction can be, for example, at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%.

    [0756] Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. In connection with the administration of a RNAi agent targeting DPP4 or pharmaceutical composition thereof, effective against a DPP4-associated disorder indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as an improvement of symptoms, a cure, a reduction in disease, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating DPP4-associated disorders and the related causes.

    [0757] A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, and at least 20%, 30%, 40%, 50%, or more can be indicative of effective treatment. Efficacy for a given RNAi agent drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant reduction in a marker or symptom is observed.

    [0758] Alternatively, the efficacy can be measured by a reduction in the severity of disease as determined by one skilled in the art of diagnosis based on a clinically accepted disease severity grading scale. Any positive change resulting in e.g., lessening of severity of disease measured using the appropriate scale, represents adequate treatment using a RNAi agent or RNAi agent formulation as described herein.

    [0759] Subjects can be administered a therapeutic amount of dsRNA, such as about 0.01 mg/kg to about 200 mg/kg.

    [0760] The RNAi agent can be administered over a period of time, on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. Administration of the RNAi agent can reduce DPP4 levels, e.g., in a cell, tissue, blood sample or other compartment of the patient by at least 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70,% 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or at least about 99% or more. In one embodiment, administration of the RNAi agent can reduce DPP4 levels, e.g., in a cell, tissue, blood sample, or other compartment of the patient by at least 50%.

    [0761] Before administration of a full dose of the RNAi agent, patients can be administered a smaller dose, such as a 5% infusion reaction, and monitored for adverse effects, such as an allergic reaction. In another example, the patient can be monitored for unwanted immunostimulatory effects, such as increased cytokine (e.g., TNF-alpha or INF-alpha) levels.

    [0762] Alternatively, the RNAi agent can be administered by oral administration, pulmonary admiration, intravenously, i.e., by intravenous injection, or subcutaneously, i.e., by subcutaneous injection. One or more injections may be used to deliver the desired, e.g., monthly dose of RNAi agent to a subject. The injections may be repeated over a period of time. The administration may be repeated on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. A repeat-dose regimen may include administration of a therapeutic amount of RNAi agent on a regular basis, such as monthly or extending to once a quarter, twice per year, once per year. In certain embodiments, the RNAi agent is administered about once per month to about once per quarter (i.e., about once every three months).

    [0763] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the RNAi agents and methods featured in the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

    [0764] This invention is further illustrated by the following examples which should not be construed as limiting. The entire contents of all references, patents and published patent applications cited throughout this application, as well as the Figures and the Sequence Listing, are hereby incorporated herein by reference.

    EXAMPLES

    Example 1. iRNA Synthesis

    [0765] Source of Reagents

    [0766] Where the source of a reagent is not specifically given herein, such reagent can be obtained from any supplier of reagents for molecular biology at a quality/purity standard for application in molecular biology.

    [0767] siRNA Design

    [0768] The selection of siRNA designs targeting human dipeptidyl-peptidase 4 (DPP4) gene (human NCBI refseqID: NM_001935.4; NCBI GeneID: 1803) were designed using custo R and Python scripts. The human NM_001935.4 REFSEQ mRNA has a length of 3575 bases.

    [0769] A detailed list of a set of the unmodified siRNA sense and antisense strand sequences targeting DPP4 is shown in Table 2.

    [0770] A detailed list of a set of the modified siRNA sense and antisense strand sequences targeting DPP4 is shown in Table 3.

    [0771] It is to be understood that, throughout the application, a duplex name without a decimal is equivalent to a duplex name with a decimal which merely references the batch number of the duplex. For example, AD-1230521 is equivalent to AD-1230521.

    [0772] siRNA Synthesis

    [0773] siRNAs were synthesized and annealed using routine methods known in the art. Briefly, siRNA sequences were synthesized on a 1 mol scale using a Mermade 192 synthesizer (BioAutomation) with phosphoramidite chemistry on solid supports. The solid support was controlled pore glass (500-1000 ) loaded with a custom GalNAc ligand (3-GalNAc conjugates), universal solid support (AM Chemicals), or the first nucleotide of interest. Ancillary synthesis reagents and standard 2-cyanoethyl phosphoramidite monomers (2-deoxy-2-fluoro, 2-O-methyl, RNA, DNA) were obtained from Thermo-Fisher (Milwaukee, WI), Hongene (China), or Chemgenes (Wilmington, MA, USA). Additional phosphoramidite monomers were procured from commercial suppliers, prepared in-house, or procured using custom synthesis from various CMOs. Phosphoramidites were prepared at a concentration of 100 mM in either acetonitrile or 9:1 acetonitrile:DMF and were coupled using 5-Ethylthio-1H-tetrazole (ETT, 0.25 M in acetonitrile) with a reaction time of 400 s.

    [0774] Phosphorothioate linkages were generated using a 100 mM solution of 3-((Dimethylamino-methylidene) amino)-3H-1,2,4-dithiazole-3-thione (DDTT, obtained from Chemgenes (Wilmington, MA, USA)) in anhydrous acetonitrile/pyridine (9:1 v/v). Oxidation time was 5 minutes. All sequences were synthesized with final removal of the DMT group (DMT-Off).

    [0775] Upon completion of the solid phase synthesis, solid-supported oligoribonucleotides were treated with 300 L of Methylamine (40% aqueous) at room temperature in 96 well plates for approximately 2 hours to afford cleavage from the solid support and subsequent removal of all additional base-labile protecting groups. For sequences containing any natural ribonucleotide linkages (2-OH) protected with a tert-butyl dimethyl silyl (TBDMS) group, a second deprotection step was performed using TEA.3HF (triethylamine trihydrofluoride). To each oligonucleotide solution in aqueous methylamine was added 200 L of dimethyl sulfoxide (DMSO) and 300 L TEA.3HF and the solution was incubated for approximately 30 mins at 60 C. After incubation, the plate was allowed to come to room temperature and crude oligonucleotides were precipitated by the addition of 1 mL of 9:1 acetontrile:ethanol or 1:1 ethanol:isopropanol. The plates were then centrifuged at 4 C. for 45 mins and the supernatant carefully decanted with the aid of a multichannel pipette. The oligonucleotide pellet was resuspended in 20 mM NaOAc and subsequently desalted using a HiTrap size exclusion column (5 mL, GE Healthcare) on an Agilent LC system equipped with an autosampler, UV detector, conductivity meter, and fraction collector. Desalted samples were collected in 96 well plates and then analyzed by LC-MS and UV spectrometry to confirm identity and quantify the amount of material, respectively.

    [0776] Duplexing of single strands was performed on a Tecan liquid handling robot. Sense and antisense single strands were combined in an equimolar ratio to a final concentration of 10 M in 1 PBS in 96 well plates, the plate sealed, incubated at 100 C. for 10 minutes, and subsequently allowed to return slowly to room temperature over a period of 2-3 hours. The concentration and identity of each duplex was confirmed and then subsequently utilized for in vitro screening assays.

    Example 2. In Vitro Screening of siRNA Duplexes

    [0777] Cell Culture and Transfections

    [0778] Hep3b cells (ATCC, Manassas, VA) were grown to near confluence at 37 C. in an atmosphere of 5% CO2 in Eagle's Minimum Essential Medium (Gibco) supplemented with 10% FBS (ATCC) before being released from the plate by trypsinization. Transfection was carried out by adding 7.5 L of Opti-MEM plus 0.1 L of RNAiMAX per well (Invitrogen, Carlsbad CA. cat #13778-150) to 2.5 L of each siRNA duplex to an individual well in a 384-well plate. The mixtures were then incubated at room temperature for 15 minutes. Forty L of complete growth media containing 1.510.sup.4 cells were then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification. Single dose experiments were performed at 10 nM. The assays were performed as quadruplicates.

    [0779] Total RNA Isolation Using DYNABEADS mRNA Isolation Kit

    [0780] Total RNA isolation was performed using DYNABEADS. Briefly, cells were lysed in 10 l of Lysis/Binding Buffer containing 3 L of beads per well and mixed for 10 minutes on an electrostatic shaker. The washing steps were automated on a Biotek EL406, using a magnetic plate support. Beads were washed (in 3 L) once in Buffer A, once in Buffer B, and twice in Buffer E, with aspiration steps in between. Following a final aspiration, complete 12 L RT mixture is added to each well, as described below.

    [0781] cDNA Synthesis

    [0782] For cDNA synthesis, a master mix of 1.5 l 10 Buffer, 0.6 l 10dNTPs, 1.5 l Random primers, 0.75 l Reverse Transcriptase, 0.75 l RNase inhibitor and 9.9 l of H.sub.2O per reaction were added per well. Plates were sealed, agitated for 10 minutes on an electrostatic shaker, and then incubated at 37 degrees C. for 2 hours. Following this, the plates were agitated at 80 degrees C. for 8 minutes.

    [0783] Real time PCR Two Microlitre (l) of cDNA were Added to a Master Mix Containing 0.5 l of Human GAPDH TaqMan Probe (4326317E), 0.5 l human DPP4, 2 l nuclease-free water and 5 l Lightcycler 480 probe master mix (Roche Cat #04887301001) per well in a 384 well plates (Roche cat #04887301001). Real time PCR was done in a LightCycler48 Real Time PCR system (Roche).

    [0784] To calculate relative fold change, data were analyzed using the Ct method and normalized to assays performed with cells transfected with 10 nM AD-1955, or mock transfected cells. IC.sub.5S were calculated using a 4 parameter fit model using XLFit and normalized to cells transfected with AD-1955 or mock-transfected. The sense and antisense sequences of AD-1955 are: sense: cuuAcGcuGAGuAcuucGAdTsdT (SEQ ID NO:35) and antisense UCGAAGuACUcAGCGuAAGdTsdT (SEQ ID NO:36).

    [0785] The results of the single dose screens of the dsRNA agents listed in Tables 2 and 3 in Hep3B cells are shown in Table 4. The results are presented as the mean percent of message remaining.

    TABLE-US-00002 TABLE 1 Abbreviations of nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5-3- phosphodiester bonds; and it is understood that when the nucleotide contains a 2-fluoro modification, then the fluoro replaces the hydroxy at that position in the parent nucleotide (i.e., it is a 2-deoxy-2-fluoronucleotide). Abbreviation Nucleotide(s) A Adenosine-3-phosphate Ab beta-L-adenosine-3-phosphate Abs beta-L-adenosine-3-phosphorothioate Af 2-fluoroadenosine-3-phosphate Afs 2-fluoroadenosine-3-phosphorothioate As adenosine-3-phosphorothioate C cytidine-3-phosphate Cb beta-L-cytidine-3-phosphate Cbs beta-L-cytidine-3-phosphorothioate Cf 2-fluorocytidine-3-phosphate Cfs 2-fluorocytidine-3-phosphorothioate Cs cytidine-3-phosphorothioate G guanosine-3-phosphate Gb beta-L-guanosine-3-phosphate Gbs beta-L-guanosine-3-phosphorothioate Gf 2-fluoroguanosine-3-phosphate Gfs 2-fluoroguanosine-3-phosphorothioate Gs guanosine-3-phosphorothioate T 5-methyluridine-3-phosphate Tf 2-fluoro-5-methyluridine-3-phosphate Tfs 2-fluoro-5-methyluridine-3-phosphorothioate Ts 5-methyluridine-3-phosphorothioate U Uridine-3-phosphate Uf 2-fluorouridine-3-phosphate Ufs 2-fluorouridine-3-phosphorothioate Us uridine-3-phosphorothioate N any nucleotide, modified or unmodified a 2-O-methyladenosine-3-phosphate as 2-O-methyladenosine-3-phosphorothioate C 2-O-methylcytidine-3-phosphate CS 2-O-methylcytidine-3-phosphorothioate g 2-O-methylguanosine-3-phosphate gs 2-O-methylguanosine-3-phosphorothioate t 2-O-methyl-5-methyluridine-3-phosphate ts 2-O-methyl-5-methyluridine-3-phosphorothioate u 2-O-methyluridine-3-phosphate us 2-O-methyluridine-3-phosphorothioate S phosphorothioate linkage L10 N-(cholesterylcarboxamidocaproyl)-4-hydroxyprolinol (Hyp-C6-Chol) L96 N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol (Hyp-(GalNAc-alkyl)3) [00034]embedded image Y34 2-hydroxymethyl-tetrahydrofurane-4-methoxy-3-phosphate (abasic 2-OMe furanose) Y44 inverted abasic DNA (2-hydroxymethyl-tetrahydrofurane-5-phosphate) (Agn) Adenosine-glycol nucleic acid (GNA) (Cgn) Cytidine-glycol nucleic acid (GNA) (Ggn) Guanosine-glycol nucleic acid (GNA) (Tgn) Thymidine-glycol nucleic acid (GNA) S-Isomer P Phosphate VP Vinyl-phosphonate dA 2-deoxyadenosine-3-phosphate dAs 2-deoxyadenosine-3-phosphorothioate dC 2-deoxycytidine-3-phosphate dCs 2-deoxycytidine-3-phosphorothioate dG 2-deoxyguanosine-3-phosphate dGs 2-deoxyguanosine-3-phosphorothioate dT 2-deoxythymidine-3-phosphate dTs 2-deoxythymidine-3-phosphorothioate dU 2-deoxyuridine dUs 2-deoxyuridine-3-phosphorothioate (C2p) cytidine-2-phosphate (G2p) guanosine-2-phosphate (U2p) uridine-2-phosphate (A2p) adenosine-2-phosphate (Chd) 2-O-hexadecyl-cytidine-3-phosphate (Ahd) 2-O-hexadecyl-adenosine-3-phosphate (Ghd) 2-O-hexadecyl-guanosine-3-phosphate (Uhd) 2-O-hexadecyl-uridine-3-phosphate

    TABLE-US-00003 TABLE2 UnmodifiedSenseandAntisenseStrandDPP4dsRNASequences SEQ SEQ StartSite EndSite Duplex SenseSequence ID AntisenseSequence ID inNM_ inNM_ Name 5to3 NO: 5to3 NO: 001935.4 001935.4 AD-1420199 GCGCUCACUAAUGUUUAACUC 37 GAGUUAAACAUUAGUGAGCGCCG 397 80 102 AD-1420212 CUUGCCAGCGGCGAGUGACUC 38 GAGUCACUCGCCGCUGGCAAGUU 398 111 133 AD-1420250 UUCUGCCUGCGCUCCUUCUCU 39 AGAGAAGGAGCGCAGGCAGAAGU 399 183 205 AD-1420258 GCGCUCCUUCUCUGAACGCUC 40 GAGCGUUCAGAGAAGGAGCGCAG 400 191 213 AD-1420264 CUUCUCUGAACGCUCACUUCC 41 GGAAGUGAGCGUUCAGAGAAGGA 401 197 219 AD-1420273 ACGCUCACUUCCGAGGAGACG 42 CGUCUCCUCGGAAGUGAGCGUUC 402 206 228 AD-1420282 UCCGAGGAGACGCCGACGAUG 43 CAUCGUCGGCGUCUCCUCGGAAG 403 215 237 AD-1420293 GCCGACGAUGAAGACACCGUG 44 CACGGUGUCUUCAUCGUCGGCGU 404 226 248 AD-1420300 AUGAAGACACCGUGGAAGGUU 45 AACCUUCCACGGUGUCUUCAUCG 405 233 255 AD-1420306 ACACCGUGGAAGGUUCUUCUG 46 CAGAAGAACCUUCCACGGUGUCU 406 239 261 AD-1420312 UGGAAGGUUCUUCUGGGACUG 47 CAGUCCCAGAAGAACCUUCCACG 407 245 267 AD-1420338 UGCUGCUGCGCUUGUCACCAU 48 AUGGUGACAAGCGCAGCAGCACC 408 271 293 AD-1420344 UGCGCUUGUCACCAUCAUCAC 49 GUGAUGAUGGUGACAAGCGCAGC 409 277 299 AD-1420365 CGUGCCCGUGGUUCUGCUGAA 50 UUCAGCAGAACCACGGGCACGGU 410 298 320 AD-1420371 CGUGGUUCUGCUGAACAAAGG 51 CCUUUGUUCAGCAGAACCACGGG 411 304 326 AD-1420379 UGCUGAACAAAGGCACAGAUG 52 CAUCUGUGCCUUUGUUCAGCAGA 412 312 334 AD-1420385 ACAAAGGCACAGAUGAUGCUA 53 UAGCAUCAUCUGUGCCUUUGUUC 413 318 340 AD-1420391 GCACAGAUGAUGCUACAGCUG 54 CAGCUGUAGCAUCAUCUGUGCCU 414 324 346 AD-1420399 GAUGCUACAGCUGACAGUCGC 55 GCGACUGUCAGCUGUAGCAUCAU 415 332 354 AD-1420406 CAGCUGACAGUCGCAAAACUU 56 AAGUUUUGCGACUGUCAGCUGUA 416 339 361 AD-1420412 ACAGUCGCAAAACUUACACUC 57 GAGUGUAAGUUUUGCGACUGUCA 417 345 367 AD-1420422 AACUUACACUCUAACUGAUUA 58 UAAUCAGUUAGAGUGUAAGUUUU 418 355 377 AD-1420428 CACUCUAACUGAUUACUUAAA 59 UUUAAGUAAUCAGUUAGAGUGUA 419 361 383 AD-1420437 UUAUAGACUGAAGUUAUACUC 60 GAGUAUAACUUCAGUCUAUAAGU 420 388 410 AD-1420446 GAAGUUAUACUCCUUAAGAUG 61 CAUCUUAAGGAGUAUAACUUCAG 421 397 419 AD-1420455 CUCCUUAAGAUGGAUUUCAGA 62 UCUGAAAUCCAUCUUAAGGAGUA 422 406 428 AD-1420462 AGAUGGAUUUCAGAUCAUGAA 63 UUCAUGAUCUGAAAUCCAUCUUA 423 413 435 AD-1420468 AUUUCAGAUCAUGAAUAUCUC 64 GAGAUAUUCAUGAUCUGAAAUCC 424 419 441 AD-1420475 AUCAUGAAUAUCUCUACAAAC 65 GUUUGUAGAGAUAUUCAUGAUCU 425 426 448 AD-1420482 AUAUCUCUACAAACAAGAAAA 66 UUUUCUUGUUUGUAGAGAUAUUC 426 433 455 AD-1420499 AUCUUGGUAUUCAAUGCUGAA 67 UUCAGCAUUGAAUACCAAGAUAU 427 458 480 AD-1420505 GUAUUCAAUGCUGAAUAUGGA 68 UCCAUAUUCAGCAUUGAAUACCA 428 464 486 AD-1420511 AAUGCUGAAUAUGGAAACAGC 69 GCUGUUUCCAUAUUCAGCAUUGA 429 470 492 AD-1420518 AAUAUGGAAACAGCUCAGUUU 70 AAACUGAGCUGUUUCCAUAUUCA 430 477 499 AD-1420524 GAAACAGCUCAGUUUUCUUGG 71 CCAAGAAAACUGAGCUGUUUCCA 431 483 505 AD-1420534 AGUUUUCUUGGAGAACAGUAC 72 GUACUGUUCUCCAAGAAAACUGA 432 493 515 AD-1420543 GGAGAACAGUACAUUUGAUGA 73 UCAUCAAAUGUACUGUUCUCCAA 433 502 524 AD-1420549 CAGUACAUUUGAUGAGUUUGG 74 CCAAACUCAUCAAAUGUACUGUU 434 508 530 AD-1420557 UUGAUGAGUUUGGACAUUCUA 75 UAGAAUGUCCAAACUCAUCAAAU 435 516 538 AD-1420563 AGUUUGGACAUUCUAUCAAUG 76 CAUUGAUAGAAUGUCCAAACUCA 436 522 544 AD-1420569 GACAUUCUAUCAAUGAUUAUU 77 AAUAAUCAUUGAUAGAAUGUCCA 437 528 550 AD-1420576 AUGAUUAUUCAAUAUCUCCUG 78 CAGGAGAUAUUGAAUAAUCAUUG 438 540 562 AD-1420593 CCUGAUGGGCAGUUUAUUCUC 79 GAGAAUAAACUGCCCAUCAGGAG 439 557 579 AD-1420601 GCAGUUUAUUCUCUUAGAAUA 80 UAUUCUAAGAGAAUAAACUGCCC 440 565 587 AD-1420611 CUCUUAGAAUACAACUACGUG 81 CACGUAGUUGUAUUCUAAGAGAA 441 575 597 AD-1420619 AUACAACUACGUGAAGCAAUG 82 CAUUGCUUCACGUAGUUGUAUUC 442 583 605 AD-1420628 CGUGAAGCAAUGGAGGCAUUC 83 GAAUGCCUCCAUUGCUUCACGUA 443 592 614 AD-1420640 GAGGCAUUCCUACACAGCUUC 84 GAAGCUGUGUAGGAAUGCCUCCA 444 604 626 AD-1420646 UUCCUACACAGCUUCAUAUGA 85 UCAUAUGAAGCUGUGUAGGAAUG 445 610 632 AD-1420652 CACAGCUUCAUAUGACAUUUA 86 UAAAUGUCAUAUGAAGCUGUGUA 446 616 638 AD-1420658 UUCAUAUGACAUUUAUGAUUU 87 AAAUCAUAAAUGUCAUAUGAAGC 447 622 644 AD-1420662 UGAUUUAAAUAAAAGGCAGCU 88 AGCUGCCUUUUAUUUAAAUCAUA 448 637 659 AD-1420668 AAAUAAAAGGCAGCUGAUUAC 89 GUAAUCAGCUGCCUUUUAUUUAA 449 643 665 AD-1420675 AGGCAGCUGAUUACAGAAGAG 90 CUCUUCUGUAAUCAGCUGCCUUU 450 650 672 AD-1420682 UGAUUACAGAAGAGAGGAUUC 91 GAAUCCUCUCUUCUGUAAUCAGC 451 657 679 AD-1420691 AAGAGAGGAUUCCAAACAACA 92 UGUUGUUUGGAAUCCUCUCUUCU 452 666 688 AD-1420698 GAUUCCAAACAACACACAGUG 93 CACUGUGUGUUGUUUGGAAUCCU 453 673 695 AD-1420707 CAACACACAGUGGGUCACAUG 94 CAUGUGACCCACUGUGUGUUGUU 454 682 704 AD-1420717 UGGGUCACAUGGUCACCAGUG 95 CACUGGUGACCAUGUGACCCACU 455 692 714 AD-1420725 AUGGUCACCAGUGGGUCAUAA 96 UUAUGACCCACUGGUGACCAUGU 456 700 722 AD-1420734 AGUGGGUCAUAAAUUGGCAUA 97 UAUGCCAAUUUAUGACCCACUGG 457 709 731 AD-1420741 CAUAAAUUGGCAUAUGUUUGG 98 CCAAACAUAUGCCAAUUUAUGAC 458 716 738 AD-1420749 GGCAUAUGUUUGGAACAAUGA 99 UCAUUGUUCCAAACAUAUGCCAA 459 724 746 AD-1420759 UGGAACAAUGACAUUUAUGUU 100 AACAUAAAUGUCAUUGUUCCAAA 460 734 756 AD-1420773 UUGAACCAAAUUUACCAAGUU 101 AACUUGGUAAAUUUGGUUCAAUU 461 759 781 AD-1420779 CAAAUUUACCAAGUUACAGAA 102 UUCUGUAACUUGGUAAAUUUGGU 462 765 787 AD-1420786 ACCAAGUUACAGAAUCACAUG 103 CAUGUGAUUCUGUAACUUGGUAA 463 772 794 AD-1420792 UUACAGAAUCACAUGGACGGG 104 CCCGUCCAUGUGAUUCUGUAACU 464 778 800 AD-1420797 UAUAAUGGAAUAACUGACUGG 105 CCAGUCAGUUAUUCCAUUAUAUA 465 815 837 AD-1420804 GAAUAACUGACUGGGUUUAUG 106 CAUAAACCCAGUCAGUUAUUCCA 466 822 844 AD-1420812 GACUGGGUUUAUGAAGAGGAA 107 UUCCUCUUCAUAAACCCAGUCAG 467 830 852 AD-1420818 GUUUAUGAAGAGGAAGUCUUC 108 GAAGACUUCCUCUUCAUAAACCC 468 836 858 AD-1420824 GAAGAGGAAGUCUUCAGUGCC 109 GGCACUGAAGACUUCCUCUUCAU 469 842 864 AD-1420831 AAGUCUUCAGUGCCUACUCUG 110 CAGAGUAGGCACUGAAGACUUCC 470 849 871 AD-1420841 UGCCUACUCUGCUCUGUGGUG 111 CACCACAGAGCAGAGUAGGCACU 471 859 881 AD-1420853 UCUGUGGUGGUCUCCAAACGG 112 CCGUUUGGAGACCACCACAGAGC 472 871 893 AD-1420861 GGUCUCCAAACGGCACUUUUU 113 AAAAAGUGCCGUUUGGAGACCAC 473 879 901 AD-1420864 UAGCAUAUGCCCAAUUUAACG 114 CGUUAAAUUGGGCAUAUGCUAAA 474 900 922 AD-1420871 UGCCCAAUUUAACGACACAGA 115 UCUGUGUCGUUAAAUUGGGCAUA 475 907 929 AD-1420878 UUUAACGACACAGAAGUCCCA 116 UGGGACUUCUGUGUCGUUAAAUU 476 914 936 AD-1420887 ACAGAAGUCCCACUUAUUGAA 117 UUCAAUAAGUGGGACUUCUGUGU 477 923 945 AD-1420893 GUCCCACUUAUUGAAUACUCC 118 GGAGUAUUCAAUAAGUGGGACUU 478 929 951 AD-1420901 UAUUGAAUACUCCUUCUACUC 119 GAGUAGAAGGAGUAUUCAAUAAG 479 937 959 AD-1420910 CUCCUUCUACUCUGAUGAGUC 120 GACUCAUCAGAGUAGAAGGAGUA 480 946 968 AD-1420921 CUGAUGAGUCACUGCAGUACC 121 GGUACUGCAGUGACUCAUCAGAG 481 957 979 AD-1420929 UCACUGCAGUACCCAAAGACU 122 AGUCUUUGGGUACUGCAGUGACU 482 965 987 AD-1420936 AGUACCCAAAGACUGUACGGG 123 CCCGUACAGUCUUUGGGUACUGC 483 972 994 AD-1420945 AGACUGUACGGGUUCCAUAUC 124 GAUAUGGAACCCGUACAGUCUUU 484 981 1003 AD-1420954 GGGUUCCAUAUCCAAAGGCAG 125 CUGCCUUUGGAUAUGGAACCCGU 485 990 1012 AD-1420974 GGAGCUGUGAAUCCAACUGUA 126 UACAGUUGGAUUCACAGCUCCUG 486 1010 1032 AD-1420980 GUGAAUCCAACUGUAAAGUUC 127 GAACUUUACAGUUGGAUUCACAG 487 1016 1038 AD-1420987 CAACUGUAAAGUUCUUUGUUG 128 CAACAAAGAACUUUACAGUUGGA 488 1023 1045 AD-1420998 UUCUUUGUUGUAAAUACAGAC 129 GUCUGUAUUUACAACAAAGAACU 489 1034 1056 AD-1421004 GUUGUAAAUACAGACUCUCUC 130 GAGAGAGUCUGUAUUUACAACAA 490 1040 1062 AD-1421015 AGACUCUCUCAGCUCAGUCAC 131 GUGACUGAGCUGAGAGAGUCUGU 491 1051 1073 AD-1421021 UCUCAGCUCAGUCACCAAUGC 132 GCAUUGGUGACUGAGCUGAGAGA 492 1057 1079 AD-1421028 UCAGUCACCAAUGCAACUUCC 133 GGAAGUUGCAUUGGUGACUGAGC 493 1064 1086 AD-1421035 CCAAUGCAACUUCCAUACAAA 134 UUUGUAUGGAAGUUGCAUUGGUG 494 1071 1093 AD-1421041 CAACUUCCAUACAAAUCACUG 135 CAGUGAUUUGUAUGGAAGUUGCA 495 1077 1099 AD-1421047 CCAUACAAAUCACUGCUCCUG 136 CAGGAGCAGUGAUUUGUAUGGAA 496 1083 1105 AD-1421055 AUCACUGCUCCUGCUUCUAUG 137 CAUAGAAGCAGGAGCAGUGAUUU 497 1091 1113 AD-1421063 UCCUGCUUCUAUGUUGAUAGG 138 CCUAUCAACAUAGAAGCAGGAGC 498 1099 1121 AD-1421067 GAUCACUACUUGUGUGAUGUG 139 CACAUCACACAAGUAGUGAUCCC 499 1121 1143 AD-1421073 UACUUGUGUGAUGUGACAUGG 140 CCAUGUCACAUCACACAAGUAGU 500 1127 1149 AD-1421086 UGACAUGGGCAACACAAGAAA 141 UUUCUUGUGUUGCCCAUGUCACA 501 1140 1162 AD-1421092 GGGCAACACAAGAAAGAAUUU 142 AAAUUCUUUCUUGUGUUGCCCAU 502 1146 1168 AD-1421098 CACAAGAAAGAAUUUCUUUGC 143 GCAAAGAAAUUCUUUCUUGUGUU 503 1152 1174 AD-1421104 AAAGAAUUUCUUUGCAGUGGC 144 GCCACUGCAAAGAAAUUCUUUCU 504 1158 1180 AD-1421120 GUGGCUCAGGAGGAUUCAGAA 145 UUCUGAAUCCUCCUGAGCCACUG 505 1174 1196 AD-1421126 CAGGAGGAUUCAGAACUAUUC 146 GAAUAGUUCUGAAUCCUCCUGAG 506 1180 1202 AD-1421132 GAUUCAGAACUAUUCGGUCAU 147 AUGACCGAAUAGUUCUGAAUCCU 507 1186 1208 AD-1421141 CUAUUCGGUCAUGGAUAUUUG 148 CAAAUAUCCAUGACCGAAUAGUU 508 1195 1217 AD-1421147 GGUCAUGGAUAUUUGUGACUA 149 UAGUCACAAAUAUCCAUGACCGA 509 1201 1223 AD-1421153 GGAUAUUUGUGACUAUGAUGA 150 UCAUCAUAGUCACAAAUAUCCAU 510 1207 1229 AD-1421160 UGUGACUAUGAUGAAUCCAGU 151 ACUGGAUUCAUCAUAGUCACAAA 511 1214 1236 AD-1421169 GAUGAAUCCAGUGGAAGAUGG 152 CCAUCUUCCACUGGAUUCAUCAU 512 1223 1245 AD-1421177 CAGUGGAAGAUGGAACUGCUU 153 AAGCAGUUCCAUCUUCCACUGGA 513 1231 1253 AD-1421183 AAGAUGGAACUGCUUAGUGGC 154 GCCACUAAGCAGUUCCAUCUUCC 514 1237 1259 AD-1421191 ACUGCUUAGUGGCACGGCAAC 155 GUUGCCGUGCCACUAAGCAGUUC 515 1245 1267 AD-1421197 UAGUGGCACGGCAACACAUUG 156 CAAUGUGUUGCCGUGCCACUAAG 516 1251 1273 AD-1421206 GGCAACACAUUGAAAUGAGUA 157 UACUCAUUUCAAUGUGUUGCCGU 517 1260 1282 AD-1421212 ACAUUGAAAUGAGUACUACUG 158 CAGUAGUACUCAUUUCAAUGUGU 518 1266 1288 AD-1421222 GAGUACUACUGGCUGGGUUGG 159 CCAACCCAGCCAGUAGUACUCAU 519 1276 1298 AD-1421231 UGGCUGGGUUGGAAGAUUUAG 160 CUAAAUCUUCCAACCCAGCCAGU 520 1285 1307 AD-1421237 GGUUGGAAGAUUUAGGCCUUC 161 GAAGGCCUAAAUCUUCCAACCCA 521 1291 1313 AD-1421245 GAUUUAGGCCUUCAGAACCUC 162 GAGGUUCUGAAGGCCUAAAUCUU 522 1299 1321 AD-1421253 CCUUCAGAACCUCAUUUUACC 163 GGUAAAAUGAGGUUCUGAAGGCC 523 1307 1329 AD-1421259 GAACCUCAUUUUACCCUUGAU 164 AUCAAGGGUAAAAUGAGGUUCUG 524 1313 1335 AD-1421265 CAUUUUACCCUUGAUGGUAAU 165 AUUACCAUCAAGGGUAAAAUGAG 525 1319 1341 AD-1421271 ACCCUUGAUGGUAAUAGCUUC 166 GAAGCUAUUACCAUCAAGGGUAA 526 1325 1347 AD-1421278 AUGGUAAUAGCUUCUACAAGA 167 UCUUGUAGAAGCUAUUACCAUCA 527 1332 1354 AD-1421285 UAGCUUCUACAAGAUCAUCAG 168 CUGAUGAUCUUGUAGAAGCUAUU 528 1339 1361 AD-1421294 CAAGAUCAUCAGCAAUGAAGA 169 UCUUCAUUGCUGAUGAUCUUGUA 529 1348 1370 AD-1421304 AGCAAUGAAGAAGGUUACAGA 170 UCUGUAACCUUCUUCAUUGCUGA 530 1358 1380 AD-1421320 ACAGACACAUUUGCUAUUUCC 172 GGAAAUAGCAAAUGUGUCUGUAA 532 1374 1396 AD-1421327 CAUUUGCUAUUUCCAAAUAGA 173 UCUAUUUGGAAAUAGCAAAUGUG 533 1381 1403 AD-1421335 GACUGCACAUUUAUUACAAAA 174 UUUUGUAAUAAAUGUGCAGUCUU 534 1409 1431 AD-1421341 ACAUUUAUUACAAAAGGCACC 175 GGUGCCUUUUGUAAUAAAUGUGC 535 1415 1437 AD-1421348 UUACAAAAGGCACCUGGGAAG 176 CUUCCCAGGUGCCUUUUGUAAUA 536 1422 1444 AD-1421356 GGCACCUGGGAAGUCAUCGGG 177 CCCGAUGACUUCCCAGGUGCCUU 537 1430 1452 AD-1421362 UGGGAAGUCAUCGGGAUAGAA 178 UUCUAUCCCGAUGACUUCCCAGG 538 1436 1458 AD-1421368 GUCAUCGGGAUAGAAGCUCUA 179 UAGAGCUUCUAUCCCGAUGACUU 539 1442 1464 AD-1421375 GGAUAGAAGCUCUAACCAGUG 180 CACUGGUUAGAGCUUCUAUCCCG 540 1449 1471 AD-1421383 GCUCUAACCAGUGAUUAUCUA 181 UAGAUAAUCACUGGUUAGAGCUU 541 1457 1479 AD-1421389 ACCAGUGAUUAUCUAUACUAC 182 GUAGUAUAGAUAAUCACUGGUUA 542 1463 1485 AD-1421394 GAUUAUCUAUACUACAUUAGU 183 ACUAAUGUAGUAUAGAUAAUCAC 543 1469 1491 AD-1421408 UAAUGAAUAUAAAGGAAUGCC 184 GGCAUUCCUUUAUAUUCAUUACU 544 1489 1511 AD-1421414 AUAUAAAGGAAUGCCAGGAGG 185 CCUCCUGGCAUUCCUUUAUAUUC 545 1495 1517 AD-1421428 CAGGAGGAAGGAAUCUUUAUA 186 UAUAAAGAUUCCUUCCUCCUGGC 546 1509 1531 AD-1421433 GAAGGAAUCUUUAUAAAAUCC 187 GGAUUUUAUAAAGAUUCCUUCCU 547 1515 1537 AD-1421441 UUAUAAAAUCCAACUUAGUGA 188 UCACUAAGUUGGAUUUUAUAAAG 548 1525 1547 AD-1421451 CAACUUAGUGACUAUACAAAA 189 UUUUGUAUAGUCACUAAGUUGGA 549 1535 1557 AD-1421459 UGACUAUACAAAAGUGACAUG 190 CAUGUCACUUUUGUAUAGUCACU 550 1543 1565 AD-1421468 AAAAGUGACAUGCCUCAGUUG 191 CAACUGAGGCAUGUCACUUUUGU 551 1552 1574 AD-1421480 CCUCAGUUGUGAGCUGAAUCC 192 GGAUUCAGCUCACAACUGAGGCA 552 1564 1586 AD-1421490 GAGCUGAAUCCGGAAAGGUGU 193 ACACCUUUCCGGAUUCAGCUCAC 553 1574 1596 AD-1421499 CCGGAAAGGUGUCAGUACUAU 194 AUAGUACUGACACCUUUCCGGAU 554 1583 1605 AD-1421505 AGGUGUCAGUACUAUUCUGUG 195 CACAGAAUAGUACUGACACCUUU 555 1589 1611 AD-1421511 CAGUACUAUUCUGUGUCAUUC 196 GAAUGACACAGAAUAGUACUGAC 556 1595 1617 AD-1421521 CUGUGUCAUUCAGUAAAGAGG 197 CCUCUUUACUGAAUGACACAGAA 557 1605 1627 AD-1421530 UCAGUAAAGAGGCGAAGUAUU 198 AAUACUUCGCCUCUUUACUGAAU 558 1614 1636 AD-1421538 GAGGCGAAGUAUUAUCAGCUG 199 CAGCUGAUAAUACUUCGCCUCUU 559 1622 1644 AD-1421546 GUAUUAUCAGCUGAGAUGUUC 200 GAACAUCUCAGCUGAUAAUACUU 560 1630 1652 AD-1421563 CUCUAUACUCUACACAGCAGC 201 GCUGCUGUGUAGAGUAUAGAGGG 561 1667 1689 AD-1421570 CUCUACACAGCAGCGUGAAUG 202 CAUUCACGCUGCUGUGUAGAGUA 562 1674 1696 AD-1421578 AGCAGCGUGAAUGAUAAAGGG 203 CCCUUUAUCAUUCACGCUGCUGU 563 1682 1704 AD-1421587 AAUGAUAAAGGGCUGAGAGUC 204 GACUCUCAGCCCUUUAUCAUUCA 564 1691 1713 AD-1421596 GGGCUGAGAGUCCUGGAAGAC 205 GUCUUCCAGGACUCUCAGCCCUU 565 1700 1722 AD-1421604 AGUCCUGGAAGACAAUUCAGC 206 GCUGAAUUGUCUUCCAGGACUCU 566 1708 1730 AD-1421612 AAGACAAUUCAGCUUUGGAUA 207 UAUCCAAAGCUGAAUUGUCUUCC 567 1716 1738 AD-1421620 UCAGCUUUGGAUAAAAUGCUG 208 CAGCAUUUUAUCCAAAGCUGAAU 568 1724 1746 AD-1421629 GAUAAAAUGCUGCAGAAUGUC 209 GACAUUCUGCAGCAUUUUAUCCA 569 1733 1755 AD-1421635 AUGCUGCAGAAUGUCCAGAUG 210 CAUCUGGACAUUCUGCAGCAUUU 570 1739 1761 AD-1421650 CUGGACUUCAUUAUUUUGAAU 211 AUUCAAAAUAAUGAAGUCCAGUU 571 1772 1794 AD-1421662 AAACAAAAUUUUGGUAUCAGA 212 UCUGAUACCAAAAUUUUGUUUCA 572 1794 1816 AD-1421672 UUGGUAUCAGAUGAUCUUGCC 213 GGCAAGAUCAUCUGAUACCAAAA 573 1804 1826 AD-1421679 CAGAUGAUCUUGCCUCCUCAU 214 AUGAGGAGGCAAGAUCAUCUGAU 574 1811 1833 AD-1421685 AUCUUGCCUCCUCAUUUUGAU 215 AUCAAAAUGAGGAGGCAAGAUCA 575 1817 1839 AD-1421691 CCUCCUCAUUUUGAUAAAUCC 216 GGAUUUAUCAAAAUGAGGAGGCA 576 1823 1845 AD-1421697 CAUUUUGAUAAAUCCAAGAAA 217 UUUCUUGGAUUUAUCAAAAUGAG 577 1829 1851 AD-1421706 AAAUCCAAGAAAUAUCCUCUA 218 UAGAGGAUAUUUCUUGGAUUUAU 578 1838 1860 AD-1421712 AAGAAAUAUCCUCUACUAUUA 219 UAAUAGUAGAGGAUAUUUCUUGG 579 1844 1866 AD-1421722 CUCUACUAUUAGAUGUGUAUG 220 CAUACACAUCUAAUAGUAGAGGA 580 1854 1876 AD-1421765 AGACACUGUCUUCAGACUGAA 221 UUCAGUCUGAAGACAGUGUCUGC 581 1897 1919 AD-1421771 UGUCUUCAGACUGAACUGGGC 222 GCCCAGUUCAGUCUGAAGACAGU 582 1903 1925 AD-1421778 AGACUGAACUGGGCCACUUAC 223 GUAAGUGGCCCAGUUCAGUCUGA 583 1910 1932 AD-1421791 CCACUUACCUUGCAAGCACAG 224 CUGUGCUUGCAAGGUAAGUGGCC 584 1923 1945 AD-1421800 UUGCAAGCACAGAAAACAUUA 225 UAAUGUUUUCUGUGCUUGCAAGG 585 1932 1954 AD-1421807 CACAGAAAACAUUAUAGUAGC 226 GCUACUAUAAUGUUUUCUGUGCU 586 1939 1961 AD-1421815 ACAUUAUAGUAGCUAGCUUUG 227 CAAAGCUAGCUACUAUAAUGUUU 587 1947 1969 AD-1421823 GUAGCUAGCUUUGAUGGCAGA 228 UCUGCCAUCAAAGCUAGCUACUA 588 1955 1977 AD-1421830 GCUUUGAUGGCAGAGGAAGUG 229 CACUUCCUCUGCCAUCAAAGCUA 589 1962 1984 AD-1421839 GCAGAGGAAGUGGUUACCAAG 230 CUUGGUAACCACUUCCUCUGCCA 590 1971 1993 AD-1421850 GGUUACCAAGGAGAUAAGAUC 231 GAUCUUAUCUCCUUGGUAACCAC 591 1982 2004 AD-1421857 AAGGAGAUAAGAUCAUGCAUG 232 CAUGCAUGAUCUUAUCUCCUUGG 592 1989 2011 AD-1421865 AAGAUCAUGCAUGCAAUCAAC 233 GUUGAUUGCAUGCAUGAUCUUAU 593 1997 2019 AD-1421874 CAUGCAAUCAACAGAAGACUG 234 CAGUCUUCUGUUGAUUGCAUGCA 594 2006 2028 AD-1421884 ACAGAAGACUGGGAACAUUUG 235 CAAAUGUUCCCAGUCUUCUGUUG 595 2016 2038 AD-1421891 ACUGGGAACAUUUGAAGUUGA 236 UCAACUUCAAAUGUUCCCAGUCU 596 2023 2045 AD-1421897 AACAUUUGAAGUUGAAGAUCA 237 UGAUCUUCAACUUCAAAUGUUCC 597 2029 2051 AD-1421903 UGAAGUUGAAGAUCAAAUUGA 238 UCAAUUUGAUCUUCAACUUCAAA 598 2035 2057 AD-1421909 UGAAGAUCAAAUUGAAGCAGC 239 GCUGCUUCAAUUUGAUCUUCAAC 599 2041 2063 AD-1421917 AAAUUGAAGCAGCCAGACAAU 240 AUUGUCUGGCUGCUUCAAUUUGA 600 2049 2071 AD-1421925 GCAGCCAGACAAUUUUCAAAA 241 UUUUGAAAAUUGUCUGGCUGCUU 601 2057 2079 AD-1421948 GGGAUUUGUGGACAACAAACG 242 CGUUUGUUGUCCACAAAUCCCAU 602 2080 2102 AD-1421954 UGUGGACAACAAACGAAUUGC 243 GCAAUUCGUUUGUUGUCCACAAA 603 2086 2108 AD-1421961 AACAAACGAAUUGCAAUUUGG 244 CCAAAUUGCAAUUCGUUUGUUGU 604 2093 2115 AD-1421968 GGUCAUAUGGAGGGUACGUAA 245 UUACGUACCCUCCAUAUGACCAG 605 2118 2140 AD-1421979 GGGUACGUAACCUCAAUGGUC 246 GACCAUUGAGGUUACGUACCCUC 606 2129 2151 AD-1422005 AUCGGGAAGUGGCGUGUUCAA 247 UUGAACACGCCACUUCCCGAUCC 607 2155 2177 AD-1422014 UGGCGUGUUCAAGUGUGGAAU 248 AUUCCACACUUGAACACGCCACU 608 2164 2186 AD-1422021 UUCAAGUGUGGAAUAGCCGUG 249 CACGGCUAUUCCACACUUGAACA 609 2171 2193 AD-1422057 UGGGAGUACUAUGACUCAGUG 250 CACUGAGUCAUAGUACUCCCACC 610 2207 2229 AD-1422067 AUGACUCAGUGUACACAGAAC 251 GUUCUGUGUACACUGAGUCAUAG 611 2217 2239 AD-1422075 GUGUACACAGAACGUUACAUG 252 CAUGUAACGUUCUGUGUACACUG 612 2225 2247 AD-1422081 ACAGAACGUUACAUGGGUCUC 253 GAGACCCAUGUAACGUUCUGUGU 613 2231 2253 AD-1422088 GUUACAUGGGUCUCCCAACUC 254 GAGUUGGGAGACCCAUGUAACGU 614 2238 2260 AD-1422096 GGUCUCCCAACUCCAGAAGAC 255 GUCUUCUGGAGUUGGGAGACCCA 615 2246 2268 AD-1422103 CAACUCCAGAAGACAACCUUG 256 CAAGGUUGUCUUCUGGAGUUGGG 616 2253 2275 AD-1422114 GACAACCUUGACCAUUACAGA 257 UCUGUAAUGGUCAAGGUUGUCUU 617 2264 2286 AD-1422120 CUUGACCAUUACAGAAAUUCA 258 UGAAUUUCUGUAAUGGUCAAGGU 618 2270 2292 AD-1422127 AUUACAGAAAUUCAACAGUCA 259 UGACUGUUGAAUUUCUGUAAUGG 619 2277 2299 AD-1422133 GAAAUUCAACAGUCAUGAGCA 260 UGCUCAUGACUGUUGAAUUUCUG 620 2283 2305 AD-1422145 UCAUGAGCAGAGCUGAAAAUU 261 AAUUUUCAGCUCUGCUCAUGACU 621 2295 2317 AD-1422151 GCAGAGCUGAAAAUUUUAAAC 262 GUUUAAAAUUUUCAGCUCUGCUC 622 2301 2323 AD-1422161 UUUAAACAAGUUGAGUACCUC 263 GAGGUACUCAACUUGUUUAAAAU 623 2315 2337 AD-1422169 AGUUGAGUACCUCCUUAUUCA 264 UGAAUAAGGAGGUACUCAACUUG 624 2323 2345 AD-1422176 UACCUCCUUAUUCAUGGAACA 265 UGUUCCAUGAAUAAGGAGGUACU 625 2330 2352 AD-1422183 UUAUUCAUGGAACAGCAGAUG 266 CAUCUGCUGUUCCAUGAAUAAGG 626 2337 2359 AD-1422192 GAACAGCAGAUGAUAACGUUC 267 GAACGUUAUCAUCUGCUGUUCCA 627 2346 2368 AD-1422198 CAGAUGAUAACGUUCACUUUC 268 GAAAGUGAACGUUAUCAUCUGCU 628 2352 2374 AD-1422205 UAACGUUCACUUUCAGCAGUC 269 GACUGCUGAAAGUGAACGUUAUC 629 2359 2381 AD-1422211 UCACUUUCAGCAGUCAGCUCA 270 UGAGCUGACUGCUGAAAGUGAAC 630 2365 2387 AD-1422220 GCAGUCAGCUCAGAUCUCCAA 271 UUGGAGAUCUGAGCUGACUGCUG 631 2374 2396 AD-1422227 GCUCAGAUCUCCAAAGCCCUG 272 CAGGGCUUUGGAGAUCUGAGCUG 632 2381 2403 AD-1422234 UCUCCAAAGCCCUGGUCGAUG 273 CAUCGACCAGGGCUUUGGAGAUC 633 2388 2410 AD-1422242 GCCCUGGUCGAUGUUGGAGUG 274 CACUCCAACAUCGACCAGGGCUU 634 2396 2418 AD-1422248 GUCGAUGUUGGAGUGGAUUUC 275 GAAAUCCACUCCAACAUCGACCA 635 2402 2424 AD-1422259 AGUGGAUUUCCAGGCAAUGUG 276 CACAUUGCCUGGAAAUCCACUCC 636 2413 2435 AD-1422267 UCCAGGCAAUGUGGUAUACUG 277 CAGUAUACCACAUUGCCUGGAAA 637 2421 2443 AD-1422274 AAUGUGGUAUACUGAUGAAGA 278 UCUUCAUCAGUAUACCACAUUGC 638 2428 2450 AD-1422280 GUAUACUGAUGAAGACCAUGG 279 CCAUGGUCUUCAUCAGUAUACCA 639 2434 2456 AD-1422288 AUGAAGACCAUGGAAUAGCUA 280 UAGCUAUUCCAUGGUCUUCAUCA 640 2442 2464 AD-1422295 CCAUGGAAUAGCUAGCAGCAC 281 GUGCUGCUAGCUAUUCCAUGGUC 641 2449 2471 AD-1422302 AUAGCUAGCAGCACAGCACAC 282 GUGUGCUGUGCUGCUAGCUAUUC 642 2456 2478 AD-1422310 CAGCACAGCACACCAACAUAU 283 AUAUGUUGGUGUGCUGUGCUGCU 643 2464 2486 AD-1422316 AGCACACCAACAUAUAUAUAC 284 GUAUAUAUAUGUUGGUGUGCUGU 644 2470 2492 AD-1422322 CCAACAUAUAUAUACCCACAU 285 AUGUGGGUAUAUAUAUGUUGGUG 645 2476 2498 AD-1422334 UACCCACAUGAGCCACUUCAU 286 AUGAAGUGGCUCAUGUGGGUAUA 646 2488 2510 AD-1422340 CAUGAGCCACUUCAUAAAACA 287 UGUUUUAUGAAGUGGCUCAUGUG 647 2494 2516 AD-1422346 CCACUUCAUAAAACAAUGUUU 288 AAACAUUGUUUUAUGAAGUGGCU 648 2500 2522 AD-1422357 AACAAUGUUUCUCUUUACCUU 289 AAGGUAAAGAGAAACAUUGUUUU 649 2511 2533 AD-1422363 GUUUCUCUUUACCUUAGCACC 290 GGUGCUAAGGUAAAGAGAAACAU 650 2517 2539 AD-1422370 UUUACCUUAGCACCUCAAAAU 291 AUUUUGAGGUGCUAAGGUAAAGA 651 2524 2546 AD-1422376 UUAGCACCUCAAAAUACCAUG 292 CAUGGUAUUUUGAGGUGCUAAGG 652 2530 2552 AD-1422383 CUCAAAAUACCAUGCCAUUUA 293 UAAAUGGCAUGGUAUUUUGAGGU 653 2537 2559 AD-1422390 UACCAUGCCAUUUAAAGCUUA 294 UAAGCUUUAAAUGGCAUGGUAUU 654 2544 2566 AD-1422412 UUUUCAUUAUCUCAAAACUGC 295 GCAGUUUUGAGAUAAUGAAAACA 655 2581 2603 AD-1422421 UCUCAAAACUGCACUGUCAAG 296 CUUGACAGUGCAGUUUUGAGAUA 656 2590 2612 AD-1422429 CUGCACUGUCAAGAUGAUGAU 297 AUCAUCAUCUUGACAGUGCAGUU 657 2598 2620 AD-1422438 CAAGAUGAUGAUGAUCUUUAA 298 UUAAAGAUCAUCAUCAUCUUGAC 658 2607 2629 AD-1422449 GAUCUUUAAAAUACACACUCA 299 UGAGUGUGUAUUUUAAAGAUCAU 659 2619 2641 AD-1422457 AAAUACACACUCAAAUCAAGA 300 UCUUGAUUUGAGUGUGUAUUUUA 660 2627 2649 AD-1422465 ACUCAAAUCAAGAAACUUAAG 301 CUUAAGUUUCUUGAUUUGAGUGU 661 2635 2657 AD-1422471 AUCAAGAAACUUAAGGUUACC 302 GGUAACCUUAAGUUUCUUGAUUU 662 2641 2663 AD-1422479 ACUUAAGGUUACCUUUGUUCC 303 GGAACAAAGGUAACCUUAAGUUU 663 2649 2671 AD-1422489 ACCUUUGUUCCCAAAUUUCAU 304 AUGAAAUUUGGGAACAAAGGUAA 664 2659 2681 AD-1422495 GUUCCCAAAUUUCAUACCUAU 305 AUAGGUAUGAAAUUUGGGAACAA 665 2665 2687 AD-1422501 AAAUUUCAUACCUAUCAUCUU 306 AAGAUGAUAGGUAUGAAAUUUGG 666 2671 2693 AD-1422508 AUACCUAUCAUCUUAAGUAGG 307 CCUACUUAAGAUGAUAGGUAUGA 667 2678 2700 AD-1422516 CAUCUUAAGUAGGGACUUCUG 308 CAGAAGUCCCUACUUAAGAUGAU 668 2686 2708 AD-1422526 AGGGACUUCUGUCUUCACAAC 309 GUUGUGAAGACAGAAGUCCCUAC 669 2696 2718 AD-1422535 UGUCUUCACAACAGAUUAUUA 310 UAAUAAUCUGUUGUGAAGACAGA 670 2705 2727 AD-1422542 ACAACAGAUUAUUACCUUACA 311 UGUAAGGUAAUAAUCUGUUGUGA 671 2712 2734 AD-1422549 AUUAUUACCUUACAGAAGUUU 312 AAACUUCUGUAAGGUAAUAAUCU 672 2719 2741 AD-1422555 ACCUUACAGAAGUUUGAAUUA 313 UAAUUCAAACUUCUGUAAGGUAA 673 2725 2747 AD-1422562 AGAAGUUUGAAUUAUCCGGUC 314 GACCGGAUAAUUCAAACUUCUGU 674 2732 2754 AD-1422568 UUGAAUUAUCCGGUCGGGUUU 315 AAACCCGACCGGAUAAUUCAAAC 675 2738 2760 AD-1422575 AUCCGGUCGGGUUUUAUUGUU 316 AACAAUAAAACCCGACCGGAUAA 676 2745 2767 AD-1422581 UCGGGUUUUAUUGUUUAAAAU 317 AUUUUAAACAAUAAAACCCGACC 677 2751 2773 AD-1422586 UUUAAAAUCAUUUCUGCAUCA 318 UGAUGCAGAAAUGAUUUUAAACA 678 2764 2786 AD-1422593 UCAUUUCUGCAUCAGCUGCUG 319 CAGCAGCUGAUGCAGAAAUGAUU 679 2771 2793 AD-1422599 CUGCAUCAGCUGCUGAAACAA 320 UUGUUUCAGCAGCUGAUGCAGAA 680 2777 2799 AD-1422605 CAGCUGCUGAAACAACAAAUA 321 UAUUUGUUGUUUCAGCAGCUGAU 681 2783 2805 AD-1422614 AAACAACAAAUAGGAAUUGUU 322 AACAAUUCCUAUUUGUUGUUUCA 682 2792 2814 AD-1422623 AGGAAUUGUUUUUAUGGAGGC 323 GCCUCCAUAAAAACAAUUCCUAU 683 2803 2825 AD-1422630 GUUUUUAUGGAGGCUUUGCAU 324 AUGCAAAGCCUCCAUAAAAACAA 684 2810 2832 AD-1422640 AGGCUUUGCAUAGAUUCCCUG 325 CAGGGAAUCUAUGCAAAGCCUCC 685 2820 2842 AD-1422646 UGCAUAGAUUCCCUGAGCAGG 326 CCUGCUCAGGGAAUCUAUGCAAA 686 2826 2848 AD-1422653 AUUCCCUGAGCAGGAUUUUAA 327 UUAAAAUCCUGCUCAGGGAAUCU 687 2833 2855 AD-1422659 UGAGCAGGAUUUUAAUCUUUU 328 AAAAGAUUAAAAUCCUGCUCAGG 688 2839 2861 AD-1422667 UAAUCUUUUUCUAACUGGACU 329 AGUCCAGUUAGAAAAAGAUUAAA 689 2851 2873 AD-1422676 UCUAACUGGACUGGUUCAAAU 330 AUUUGAACCAGUCCAGUUAGAAA 690 2860 2882 AD-1422683 GGACUGGUUCAAAUGUUGUUC 331 GAACAACAUUUGAACCAGUCCAG 691 2867 2889 AD-1422693 AAAUGUUGUUCUCUUCUUUAA 332 UUAAAGAAGAGAACAACAUUUGA 692 2877 2899 AD-1422701 UUCUCUUCUUUAAAGGGAUGG 333 CCAUCCCUUUAAAGAAGAGAACA 693 2885 2907 AD-1422708 CUUUAAAGGGAUGGCAAGAUG 334 CAUCUUGCCAUCCCUUUAAAGAA 694 2892 2914 AD-1422720 GGCAAGAUGUGGGCAGUGAUG 335 CAUCACUGCCCACAUCUUGCCAU 695 2904 2926 AD-1422729 UGGGCAGUGAUGUCACUAGGG 336 CCCUAGUGACAUCACUGCCCACA 696 2913 2935 AD-1422752 GGGACAGGAUAAGAGGGAUUA 337 UAAUCCCUCUUAUCCUGUCCCUG 697 2936 2958 AD-1422758 GGAUAAGAGGGAUUAGGGAGA 338 UCUCCCUAAUCCCUCUUAUCCUG 698 2942 2964 AD-1422765 AGGGAUUAGGGAGAGAAGAUA 339 UAUCUUCUCUCCCUAAUCCCUCU 699 2949 2971 AD-1422771 UAGGGAGAGAAGAUAGCAGGG 340 CCCUGCUAUCUUCUCUCCCUAAU 700 2955 2977 AD-1422797 CUGGGAACCCAAGUCCAAGCA 341 UGCUUGGACUUGGGUUCCCAGCC 701 2981 3003 AD-1422803 ACCCAAGUCCAAGCAUACCAA 342 UUGGUAUGCUUGGACUUGGGUUC 702 2987 3009 AD-1422809 GUCCAAGCAUACCAACACGAG 343 CUCGUGUUGGUAUGCUUGGACUU 703 2993 3015 AD-1422821 CAACACGAGCAGGCUACUGUC 344 GACAGUAGCCUGCUCGUGUUGGU 704 3005 3027 AD-1422827 GAGCAGGCUACUGUCAGCUCC 345 GGAGCUGACAGUAGCCUGCUCGU 705 3011 3033 AD-1422831 CGGAGAAGAGCUGUUCACAGC 346 GCUGUGAACAGCUCUUCUCCGAG 706 3035 3057 AD-1422838 GAGCUGUUCACAGCCAGACUG 347 CAGUCUGGCUGUGAACAGCUCUU 707 3042 3064 AD-1422847 ACAGCCAGACUGGCACAGUUU 348 AAACUGUGCCAGUCUGGCUGUGA 708 3051 3073 AD-1422857 UGGCACAGUUUUCUGAGAAAG 349 CUUUCUCAGAAAACUGUGCCAGU 709 3061 3083 AD-1422863 AGUUUUCUGAGAAAGACUAUU 350 AAUAGUCUUUCUCAGAAAACUGU 710 3067 3089 AD-1422869 CUGAGAAAGACUAUUCAAACA 351 UGUUUGAAUAGUCUUUCUCAGAA 711 3073 3095 AD-1422875 AAGACUAUUCAAACAGUCUCA 352 UGAGACUGUUUGAAUAGUCUUUC 712 3079 3101 AD-1422882 UUCAAACAGUCUCAGGAAAUC 353 GAUUUCCUGAGACUGUUUGAAUA 713 3086 3108 AD-1422890 GUCUCAGGAAAUCAAAUAUGC 354 GCAUAUUUGAUUUCCUGAGACUG 714 3094 3116 AD-1422896 GGAAAUCAAAUAUGCAAAGCA 355 UGCUUUGCAUAUUUGAUUUCCUG 715 3100 3122 AD-1422902 CAAAUAUGCAAAGCACUGACU 356 AGUCAGUGCUUUGCAUAUUUGAU 716 3106 3128 AD-1422908 UGCAAAGCACUGACUUCUAAG 357 CUUAGAAGUCAGUGCUUUGCAUA 717 3112 3134 AD-1422914 GCACUGACUUCUAAGUAAAAC 358 GUUUUACUUAGAAGUCAGUGCUU 718 3118 3140 AD-1422920 ACUUCUAAGUAAAACCACAGC 359 GCUGUGGUUUUACUUAGAAGUCA 719 3124 3146 AD-1422928 GUAAAACCACAGCAGUUGAAA 360 UUUCAACUGCUGUGGUUUUACUU 720 3132 3154 AD-1422934 CCACAGCAGUUGAAAAGACUC 361 GAGUCUUUUCAACUGCUGUGGUU 721 3138 3160 AD-1422943 UUGAAAAGACUCCAAAGAAAU 362 AUUUCUUUGGAGUCUUUUCAACU 722 3147 3169 AD-1422949 AGACUCCAAAGAAAUGUAAGG 363 CCUUACAUUUCUUUGGAGUCUUU 723 3153 3175 AD-1422955 AAAGAAAUGUAAGGGAAACUG 364 CAGUUUCCCUUACAUUUCUUUGG 724 3160 3182 AD-1422965 AAGGGAAACUGCCAGCAACGC 365 GCGUUGCUGGCAGUUUCCCUUAC 725 3170 3192 AD-1422975 GUGCCAGUUAUGGCUAUAGGU 366 ACCUAUAGCCAUAACUGGCACCU 726 3201 3223 AD-1422984 AUGGCUAUAGGUGCUACAAAA 367 UUUUGUAGCACCUAUAGCCAUAA 727 3210 3232 AD-1423007 ACAGCAAGGGUGAUGGGAAAG 368 CUUUCCCAUCACCCUUGCUGUGU 728 3233 3255 AD-1423014 GGGUGAUGGGAAAGCAUUGUA 369 UACAAUGCUUUCCCAUCACCCUU 729 3240 3262 AD-1423020 UGGGAAAGCAUUGUAAAUGUG 370 CACAUUUACAAUGCUUUCCCAUC 730 3246 3268 AD-1423026 AGCAUUGUAAAUGUGCUUUUA 371 UAAAAGCACAUUUACAAUGCUUU 731 3252 3274 AD-1423035 ACUGAUGUUCCUAGUGAAAGA 372 UCUUUCACUAGGAACAUCAGUAU 732 3282 3304 AD-1423041 GUUCCUAGUGAAAGAGGCAGC 373 GCUGCCUCUUUCACUAGGAACAU 733 3288 3310 AD-1423048 GUGAAAGAGGCAGCUUGAAAC 374 GUUUCAAGCUGCCUCUUUCACUA 734 3295 3317 AD-1423055 AGGCAGCUUGAAACUGAGAUG 375 CAUCUCAGUUUCAAGCUGCCUCU 735 3302 3324 AD-1423065 AAACUGAGAUGUGAACACAUC 376 GAUGUGUUCACAUCUCAGUUUCA 736 3312 3334 AD-1423071 AGAUGUGAACACAUCAGCUUG 377 CAAGCUGAUGUGUUCACAUCUCA 737 3318 3340 AD-1423082 CAUCAGCUUGCCCUGUUAAAA 378 UUUUAACAGGGCAAGCUGAUGUG 738 3329 3351 AD-1423088 CUUGCCCUGUUAAAAGAUGAA 379 UUCAUCUUUUAACAGGGCAAGCU 739 3335 3357 AD-1423104 GUAUCACAAAUCUUAACUUGA 380 UCAAGUUAAGAUUUGUGAUACAA 740 3363 3385 AD-1423111 AAAUCUUAACUUGAAGGAGUC 381 GACUCCUUCAAGUUAAGAUUUGU 741 3370 3392 AD-1423118 AACUUGAAGGAGUCCUUGCAU 382 AUGCAAGGACUCCUUCAAGUUAA 742 3377 3399 AD-1423124 AAGGAGUCCUUGCAUCAAUUU 383 AAAUUGAUGCAAGGACUCCUUCA 743 3383 3405 AD-1423130 UCCUUGCAUCAAUUUUUCUUA 384 UAAGAAAAAUUGAUGCAAGGACU 744 3389 3411 AD-1423138 UUAUUUCAUUUCUUUGAGUGU 385 ACACUCAAAGAAAUGAAAUAAGA 745 3407 3429 AD-1423145 AUUUCUUUGAGUGUCUUAAUU 386 AAUUAAGACACUCAAAGAAAUGA 746 3414 3436 AD-1423151 UUGAGUGUCUUAAUUAAAAGA 387 UCUUUUAAUUAAGACACUCAAAG 747 3420 3442 AD-1423158 GAAUAUUUUAACUUCCUUGGA 388 UCCAAGGAAGUUAAAAUAUUCUU 748 3439 3461 AD-1423164 UUUAACUUCCUUGGACUCAUU 389 AAUGAGUCCAAGGAAGUUAAAAU 749 3445 3467 AD-1423170 UUCCUUGGACUCAUUUUAAAA 390 UUUUAAAAUGAGUCCAAGGAAGU 750 3451 3473 AD-1423184 UAUUAUUAUUCCCAUUCUACA 391 UGUAGAAUGGGAAUAAUAAUACA 751 3498 3520 AD-1423191 AUUCCCAUUCUACAUACUAUG 392 CAUAGUAUGUAGAAUGGGAAUAA 752 3505 3527 AD-1423200 CUACAUACUAUGGAAUUUCUC 393 GAGAAAUUCCAUAGUAUGUAGAA 753 3514 3536 AD-1423210 UGGAAUUUCUCCCAGUCAUUU 394 AAAUGACUGGGAGAAAUUCCAUA 754 3524 3546 AD-1423220 CCCAGUCAUUUAAUAAAUGUG 395 CACAUUUAUUAAAUGACUGGGAG 755 3534 3556 AD-1423226 CAUUUAAUAAAUGUGCCUUCA 396 UGAAGGCACAUUUAUUAAAUGAC 756 3540 3562

    TABLE-US-00004 TABLE3 ModifiedSenseandAntisenseStrandDPP4dsRNASequences mRNATarget Duplex SenseSequence SEQID Antisense SEQID Sequence SEQID Name 5to3 NO: Sequence NO: 5to3 NO: AD- gscsgcucAf 757 asAfsguuAf 1117 CGGCGCTCAC 1477 1420199 cUfAfAfugu aAfCfauuaG TAATGTTTAA uuaacuuL96 fuGfagcgcs CTC csg AD- csusugccAf 758 asAfsgucAf 1118 AACTTGCCAG 1478 1420212 gCfGfGfcga cUfCfgccgC CGGCGAGTGA gugacuuL96 fuGfgcaags CTC usu AD- ususcugcCf 759 asGfsagaAf 1119 ACTTCTGCCT 1479 1420250 uGfCfGfcuc gGfAfgcgcA GCGCTCCTTC cuucucuL96 fgGfcagaas TCT gsu AD- gscsgcucCf 760 asAfsgcgUf 1120 CTGCGCTCCT 1480 1420258 uUfCfUfcug uCfAfgagaA TCTCTGAACG aacgcuuL96 fgGfagcgcs CTC asg AD- csusucucUf 761 asGfsaagUf 1121 TCCTTCTCTG 1481 1420264 gAfAfCfgcu gAfGfcguuC AACGCTCACT cacuucuL96 faGfagaags TCC gsa AD- ascsgcucAf 762 asGfsucuCf 1122 GAACGCTCAC 1482 1420273 cUfUfCfcga cUfCfggaaG TTCCGAGGAG ggagacuL96 fuGfagcgus ACG usc AD- uscscgagGf 763 asAfsucgUf 1123 CTTCCGAGGA 1483 1420282 aGfAfCfgcc cGfGfcgucU GACGCCGACG gacgauuL96 fcCfucggas ATG asg AD- gscscgacGf 764 asAfscggUf 1124 ACGCCGACGA 1484 1420293 aUfGfAfaga gUfCfuucaU TGAAGACACC caccguuL96 fcGfucggcs GTG gsu AD- asusgaagAf 765 asAfsccuUf 1125 CGATGAAGAC 1485 1420300 cAfCfCfgug cCfAfcgguG ACCGTGGAAG gaagguuL96 fuCfuucaus GTT csg AD- ascsaccgUf 766 asAfsgaaGf 1126 AGACACCGTG 1486 1420306 gGfAfAfggu aAfCfcuucC GAAGGTTCTT ucuucuuL96 faCfggugus CTG csu AD- usgsgaagGf 767 asAfsgucCf 1127 CGTGGAAGGT 1487 1420312 uUfCfUfucu cAfGfaagaA TCTTCTGGGA gggacuuL96 fcCfuuccas CTG csg AD- usgscugcUf 768 asUfsgguGf 1128 GGTGCTGCTG 1488 1420338 gCfGfCfuug aCfAfagcgC CGCTTGTCAC ucaccauL96 faGfcagcas CAT cSC AD- usgscgcuUf 769 asUfsgauGf 1129 GCTGCGCTTG 1489 1420344 gUfCfAfcca aUfGfgugaC TCACCATCAT ucaucauL96 faAfgcgcas CAC gsc AD- csgsugccCf 770 asUfscagCf 1130 ACCGTGCCCG 1490 1420365 gUfGfGfuuc aGfAfaccaC TGGTTCTGCT ugcugauL96 fgGfgcacgs GAA gsu AD- csgsugguUf 771 asCfsuuuGf 1131 CCCGTGGTTC 1491 1420371 cUfGfCfuga uUfCfagcaG TGCTGAACAA acaaaguL96 faAfccacgs AGG gsg AD- usgscugaAf 772 asAfsucuGf 1132 TCTGCTGAAC 1492 1420379 cAfAfAfggc uGfCfcuuuG AAAGGCACAG acagauuL96 fuUfcagcas ATG gsa AD- ascsaaagGf 773 asAfsgcaUf 1133 GAACAAAGGC 1493 1420385 cAfCfAfgau cAfUfcuguG ACAGATGATG gaugcuuL96 fcCfuuugus CTA usc AD- gscsacagAf 774 asAfsgcuGf 1134 AGGCACAGAT 1494 1420391 uGfAfUfgcu uAfGfcaucA GATGCTACAG acagcuuL96 fuCfugugcs CTG csu AD- gsasugcuAf 775 asCfsgacUf 1135 ATGATGCTAC 1495 1420399 cAfGfCfuga gUfCfagcuG AGCTGACAGT cagucguL96 fuAfgcaucs CGC asu AD- csasgcugAf 776 asAfsguuUf 1136 TACAGCTGAC 1496 1420406 cAfGfUfcgc uGfCfgacuG AGTCGCAAAA aaaacuuL96 fuCfagcugs CTT usa AD- ascsagucGf 777 asAfsgugUf 1137 TGACAGTCGC 1497 1420412 cAfAfAfacu aAfGfuuuuG AAAACTTACA uacacuuL96 fcGfacugus CTC csa AD- asascuuaCf 778 asAfsaucAf 1138 AAAACTTACA 1498 1420422 aCfUfCfuaa gUfUfagagU CTCTAACTGA cugauuuL96 fgUfaaguus TTA usu AD- csascucuAf 779 asUfsuaaGf 1139 TACACTCTAA 1499 1420428 aCfUfGfauu uAfAfucagU CTGATTACTT acuuaauL96 fuAfgagugs AAA usa AD- ususauagAf 780 asAfsguaUf 1140 ACTTATAGAC 1500 1420437 cUfGfAfagu aAfCfuucaG TGAAGTTATA uauacuuL96 fuCfuauaas CTC gsu AD- gsasaguuAf 781 asAfsucuUf 1141 CTGAAGTTAT 1501 1420446 uAfCfUfccu aAfGfgaguA ACTCCTTAAG uaagauuL96 fuAfacuucs ATG asg AD- csusccuuAf 782 asCfsugaAf 1142 TACTCCTTAA 1502 1420455 aGfAfUfgga aUfCfcaucU GATGGATTTC uuucaguL96 fuAfaggags AGA usa AD- asgsauggAf 783 asUfscauGf 1143 TAAGATGGAT 1503 1420462 uUfUfCfaga aUfCfugaaA TTCAGATCAT ucaugauL96 fuCfcaucus GAA usa AD- asusuucaGf 784 asAfsgauAf 1144 GGATTTCAGA 1504 1420468 aUfCfAfuga uUfCfaugaU TCATGAATAT auaucuuL96 fcUfgaaaus CTC CSC AD- asuscaugAf 785 asUfsuugUf 1145 AGATCATGAA 1505 1420475 aUfAfUfcuc aGfAfgauaU TATCTCTACA uacaaauL96 fuCfaugaus AAC csu AD- asusaucuCf 786 asUfsuucUf 1146 GAATATCTCT 1506 1420482 uAfCfAfaac uGfUfuuguA ACAAACAAGA aagaaauL96 fgAfgauaus AAA usc AD- asuscuugGf 787 asUfscagCf 1147 ATATCTTGGT 1507 1420499 uAfUfUfcaa aUfUfgaauA ATTCAATGCT ugcugauL96 fcCfaagaus GAA asu AD- gsusauucAf 788 asCfscauAf 1148 TGGTATTCAA 1508 1420505 aUfGfCfuga uUfCfagcaU TGCTGAATAT auaugguL96 fuGfaauacs GGA csa AD- asasugcuGf 789 asCfsuguUf 1149 TCAATGCTGA 1509 1420511 aAfUfAfugg uCfCfauauU ATATGGAAAC aaacaguL96 fcAfgcauus AGC gsa AD- asasuaugGf 790 asAfsacuGf 1150 TGAATATGGA 1510 1420518 aAfAfCfagc aGfCfuguuU AACAGCTCAG ucaguuuL96 fcCfauauus TTT csa AD- gsasaacaGf 791 asCfsaagAf 1151 TGGAAACAGC 1511 1420524 cUfCfAfguu aAfAfcugaG TCAGTTTTCT uucuuguL96 fcUfguuucs TGG csa AD- asgsuuuuCf 792 asUfsacuGf 1152 TCAGTTTTCT 1512 1420534 uUfGfGfaga uUfCfuccaA TGGAGAACAG acaguauL96 fgAfaaacus TAC gsa AD- gsgsagaaCf 793 asCfsaucAf 1153 TTGGAGAACA 1513 1420543 aGfUfAfcau aAfUfguacU GTACATTTGA uugauguL96 fgUfucuccs TGA asa AD- csasguacAf 794 asCfsaaaCf 1154 AACAGTACAT 1514 1420549 uUfUfGfaug uCfAfucaaA TTGATGAGTT aguuuguL96 fuGfuacugs TGG usu AD- ususgaugAf 795 asAfsgaaUf 1155 ATTTGATGAG 1515 1420557 gUfUfUfgga gUfCfcaaaC TTTGGACATT cauucuuL96 fuCfaucaas CTA asu AD- asgsuuugGf 796 asAfsuugAf 1156 TGAGTTTGGA 1516 1420563 aCfAfUfucu uAfGfaaugU CATTCTATCA aucaauuL96 fcCfaaacus ATG csa AD- gsascauuCf 797 asAfsuaaUf 1157 TGGACATTCT 1517 1420569 uAfUfCfaau cAfUfugauA ATCAATGATT gauuauuL96 fgAfaugucs ATT csa AD- asusgauuAf 798 asAfsggaGf 1158 CAATGATTAT 1518 1420576 uUfCfAfaua aUfAfuugaA TCAATATCTC ucuccuuL96 fuAfaucaus CTG usg AD- cscsugauGf 799 asAfsgaaUf 1159 CTCCTGATGG 1519 1420593 gGfCfAfguu aAfAfcugcC GCAGTTTATT uauucuuL96 fcAfucaggs CTC asg AD- gscsaguuUf 800 asAfsuucUf 1160 GGGCAGTTTA 1520 1420601 aUfUfCfucu aAfGfagaaU TTCTCTTAGA uagaauuL96 faAfacugcs ATA cSC AD- csuscuuaGf 801 asAfscguAf 1161 TTCTCTTAGA 1521 1420611 aAfUfAfcaa gUfUfguauU ATACAACTAC cuacguuL96 fcUfaagags GTG asa AD- asusacaaCf 802 asAfsuugCf 1162 GAATACAACT 1522 1420619 uAfCfGfuga uUfCfacguA ACGTGAAGCA agcaauuL96 fgUfuguaus ATG usc AD- csgsugaaGf 803 asAfsaugCf 1163 TACGTGAAGC 1523 1420628 cAfAfUfgga cUfCfcauuG AATGGAGGCA ggcauuuL96 fcUfucacgs TTC usa AD- gsasggcaUf 804 asAfsagcUf 1164 TGGAGGCATT 1524 1420640 uCfCfUfaca gUfGfuaggA CCTACACAGC cagcuuuL96 faUfgccucs TTC csa AD- ususccuaCf 805 asCfsauaUf 1165 CATTCCTACA 1525 1420646 aCfAfGfcuu gAfAfgcugU CAGCTTCATA cauauguL96 fgUfaggaas TGA usg AD- csascagcUf 806 asAfsaauGf 1166 TACACAGCTT 1526 1420652 uCfAfUfaug uCfAfuaugA CATATGACAT acauuuuL96 faGfcugugs TTA usa AD- ususcauaUf 807 asAfsaucAf 1167 GCTTCATATG 1527 1420658 gAfCfAfuuu uAfAfauguC ACATTTATGA augauuuL96 faUfaugaas TTT gsc AD- usgsauuuAf 808 asGfscugCf 1168 TATGATTTAA 1528 1420662 aAfUfAfaaa cUfUfuuauU ATAAAAGGCA ggcagcuL96 fuAfaaucas GCT usa AD- asasauaaAf 809 asUfsaauCf 1169 TTAAATAAAA 1529 1420668 aGfGfCfagc aGfCfugccU GGCAGCTGAT ugauuauL96 fuUfuauuus TAC asa AD- asgsgcagCf 810 asUfscuuCf 1170 AAAGGCAGCT 1530 1420675 uGfAfUfuac uGfUfaaucA GATTACAGAA agaagauL96 fgCfugccus GAG usu AD- usgsauuaCf 811 asAfsaucCf 1171 GCTGATTACA 1531 1420682 aGfAfAfgag uCfUfcuucU GAAGAGAGGA aggauuuL96 fgUfaaucas TTC gSc AD- asasgagaGf 812 asGfsuugUf 1172 AGAAGAGAGG 1532 1420691 gAfUfUfcca uUfGfgaauC ATTCCAAACA aacaacuL96 fcUfcucuus ACA csu AD- gsasuuccAf 813 asAfscugUf 1173 AGGATTCCAA 1533 1420698 aAfCfAfaca gUfGfuuguU ACAACACACA cacaguuL96 fuGfgaaucs GTG csu AD- csasacacAf 814 asAfsuguGf 1174 AACAACACAC 1534 1420707 cAfGfUfggg aCfCfcacuG AGTGGGTCAC ucacauuL96 fuGfuguugs ATG usu AD- usgsggucAf 815 asAfscugGf 1175 AGTGGGTCAC 1535 1420717 cAfUfGfguc uGfAfccauG ATGGTCACCA accaguuL96 fuGfacccas GTG csu AD- asusggucAf 816 asUfsaugAf 1176 ACATGGTCAC 1536 1420725 cCfAfGfugg cCfCfacugG CAGTGGGTCA gucauauL96 fuGfaccaus TAA gsu AD- asgsugggUf 817 asAfsugcCf 1177 CCAGTGGGTC 1537 1420734 cAfUfAfaau aAfUfuuauG ATAAATTGGC uggcauuL96 faCfccacus ATA gsg AD- csasuaaaUf 818 asCfsaaaCf 1178 GTCATAAATT 1538 1420741 uGfGfCfaua aUfAfugccA GGCATATGTT uguuuguL96 faUfuuaugs TGG aSC AD- gsgscauaUf 819 asCfsauuGf 1179 TTGGCATATG 1539 1420749 gUfUfUfgga uUfCfcaaaC TTTGGAACAA acaauguL96 faUfaugccs TGA asa AD- usgsgaacAf 820 asAfscauAf 1180 TTTGGAACAA 1540 1420759 aUfGfAfcau aAfUfgucaU TGACATTTAT uuauguuL96 fuGfuuccas GTT asa AD- ususgaacCf 821 asAfscuuGf 1181 AATTGAACCA 1541 1420773 aAfAfUfuua gUfAfaauuU AATTTACCAA ccaaguuL96 fgGfuucaas GTT usu AD- csasaauuUf 822 asUfscugUf 1182 ACCAAATTTA 1542 1420779 aCfCfAfagu aAfCfuuggU CCAAGTTACA uacagauL96 faAfauuugs GAA gsu AD- ascscaagUf 823 asAfsuguGf 1183 TTACCAAGTT 1543 1420786 uAfCfAfgaa aUfUfcuguA ACAGAATCAC ucacauuL96 faCfuuggus ATG asa AD- ususacagAf 824 asCfscguCf 1184 AGTTACAGAA 1544 1420792 aUfCfAfcau cAfUfgugaU TCACATGGAC ggacgguL96 fuCfuguaas GGG csu AD- usasuaauGf 825 asCfsaguCf 1185 TATATAATGG 1545 1420797 gAfAfUfaac aGfUfuauuC AATAACTGAC ugacuguL96 fcAfuuauas TGG usa AD- gsasauaaCf 826 asAfsuaaAf 1186 TGGAATAACT 1546 1420804 uGfAfCfugg cCfCfagucA GACTGGGTTT guuuauuL96 fgUfuauucs ATG csa AD- gsascuggGf 827 asUfsccuCf 1187 CTGACTGGGT 1547 1420812 uUfUfAfuga uUfCfauaaA TTATGAAGAG agaggauL96 fcCfcagucs GAA asg AD- gsusuuauGf 828 asAfsagaCf 1188 GGGTTTATGA 1548 1420818 aAfGfAfgga uUfCfcucuU AGAGGAAGTC agucuuuL96 fcAfuaaacs TTC cSC AD- gsasagagGf 829 asGfscacUf 1189 ATGAAGAGGA 1549 1420824 aAfGfUfcuu gAfAfgacuU AGTCTTCAGT cagugcuL96 fcCfucuucs GCC asu AD- asasgucuUf 830 asAfsgagUf 1190 GGAAGTCTTC 1550 1420831 cAfGfUfgcc aGfGfcacuG AGTGCCTACT uacucuuL96 faAfgacuus CTG CSC AD- usgsccuaCf 831 asAfsccaCf 1191 AGTGCCTACT 1551 1420841 uCfUfGfcuc aGfAfgcagA CTGCTCTGTG ugugguuL96 fgUfaggcas GTG csu AD- uscsugugGf 832 asCfsguuUf 1192 GCTCTGTGGT 1552 1420853 uGfGfUfcuc gGfAfgaccA GGTCTCCAAA caaacguL96 fcCfacagas CGG gSC AD- gsgsucucCf 833 asAfsaaaGf 1193 GTGGTCTCCA 1553 1420861 aAfAfCfggc uGfCfcguuU AACGGCACTT acuuuuuL96 fgGfagaccs TTT aSC AD- usasgcauAf 834 asGfsuuaAf 1194 TTTAGCATAT 1554 1420864 uGfCfCfcaa aUfUfgggcA GCCCAATTTA uuuaacuL96 fuAfugcuas ACG asa AD- usgscccaAf 835 asCfsuguGf 1195 TATGCCCAAT 1555 1420871 uUfUfAfacg uCfGfuuaaA TTAACGACAC acacaguL96 fuUfgggcas AGA usa AD- ususuaacGf 836 asGfsggaCf 1196 AATTTAACGA 1556 1420878 aCfAfCfaga uUfCfugugU CACAGAAGTC agucccuL96 fcGfuuaaas CCA usu AD- ascsagaaGf 837 asUfscaaUf 1197 ACACAGAAGT 1557 1420887 uCfCfCfacu aAfGfugggA CCCACTTATT uauugauL96 fcUfucugus GAA gsu AD- gsuscccaCf 838 asGfsaguAf 1198 AAGTCCCACT 1558 1420893 uUfAfUfuga uUfCfaauaA TATTGAATAC auacucuL96 fgUfgggacs TCC usu AD- usasuugaAf 839 asAfsguaGf 1199 CTTATTGAAT 1559 1420901 uAfCfUfccu aAfGfgaguA ACTCCTTCTA ucuacuuL96 fuUfcaauas CTC asg AD- csusccuuCf 840 asAfscucAf 1200 TACTCCTTCT 1560 1420910 uAfCfUfcug uCfAfgaguA ACTCTGATGA augaguuL96 fgAfaggags GTC usa AD- csusgaugAf 841 asGfsuacUf 1201 CTCTGATGAG 1561 1420921 gUfCfAfcug gCfAfgugaC TCACTGCAGT caguacuL96 fuCfaucags ACC asg AD- uscsacugCf 842 asGfsucuUf 1202 AGTCACTGCA 1562 1420929 aGfUfAfccc uGfGfguacU GTACCCAAAG aaagacuL96 fgCfagugas ACT csu AD- asgsuaccCf 843 asCfscguAf 1203 GCAGTACCCA 1563 1420936 aAfAfGfacu cAfGfucuuU AAGACTGTAC guacgguL96 fgGfguacus GGG gsc AD- asgsacugUf 844 asAfsuauGf 1204 AAAGACTGTA 1564 1420945 aCfGfGfguu gAfAfcccgU CGGGTTCCAT ccauauuL96 faCfagucus ATC usu AD- gsgsguucCf 845 asUfsgccUf 1205 ACGGGTTCCA 1565 1420954 aUfAfUfcca uUfGfgauaU TATCCAAAGG aaggcauL96 fgGfaacccs CAG gsu AD- gsgsagcuGf 846 asAfscagUf 1206 CAGGAGCTGT 1566 1420974 uGfAfAfucc uGfGfauucA GAATCCAACT aacuguuL96 fcAfgcuccs GTA usg AD- gsusgaauCf 847 asAfsacuUf 1207 CTGTGAATCC 1567 1420980 cAfAfCfugu uAfCfaguuG AACTGTAAAG aaaguuuL96 fgAfuucacs TTC asg AD- csasacugUf 848 asAfsacaAf 1208 TCCAACTGTA 1568 1420987 aAfAfGfuuc aGfAfacuuU AAGTTCTTTG uuuguuuL96 faCfaguugs TTG gsa AD- ususcuuuGf 849 asUfscugUf 1209 AGTTCTTTGT 1569 1420998 uUfGfUfaaa aUfUfuacaA TGTAAATACA uacagauL96 fcAfaagaas GAC csu AD- gsusuguaAf 850 asAfsgagAf 1210 TTGTTGTAAA 1570 1421004 aUfAfCfaga gUfCfuguaU TACAGACTCT cucucuuL96 fuUfacaacs CTC asa AD- asgsacucUf 851 asUfsgacUf 1211 ACAGACTCTC 1571 1421015 cUfCfAfgcu gAfGfcugaG TCAGCTCAGT cagucauL96 faGfagucus CAC gsu AD- uscsucagCf 852 asCfsauuGf 1212 TCTCTCAGCT 1572 1421021 uCfAfGfuca gUfGfacugA CAGTCACCAA ccaauguL96 fgCfugagas TGC gsa AD- uscsagucAf 853 asGfsaagUf 1213 GCTCAGTCAC 1573 1421028 cCfAfAfugc uGfCfauugG CAATGCAACT aacuucuL96 fuGfacugas TCC gsc AD- cscsaaugCf 854 asUfsuguAf 1214 CACCAATGCA 1574 1421035 aAfCfUfucc uGfGfaaguU ACTTCCATAC auacaauL96 fgCfauuggs AAA usg AD- csasacuuCf 855 asAfsgugAf 1215 TGCAACTTCC 1575 1421041 cAfUfAfcaa uUfUfguauG ATACAAATCA aucacuuL96 fgAfaguugs CTG csa AD- cscsauacAf 856 asAfsggaGf 1216 TTCCATACAA 1576 1421047 aAfUfCfacu cAfGfugauU ATCACTGCTC gcuccuuL96 fuGfuauggs CTG asa AD- asuscacuGf 857 asAfsuagAf 1217 AAATCACTGC 1577 1421055 cUfCfCfugc aGfCfaggaG TCCTGCTTCT uucuauuL96 fcAfgugaus ATG usu AD- uscscugcUf 858 asCfsuauCf 1218 GCTCCTGCTT 1578 1421063 uCfUfAfugu aAfCfauagA CTATGTTGAT ugauaguL96 faGfcaggas AGG gSC AD- gsasucacUf 859 asAfscauCf 1219 GGGATCACTA 1579 1421067 aCfUfUfgug aCfAfcaagU CTTGTGTGAT ugauguuL96 faGfugaucs GTG cSC AD- usascuugUf 860 asCfsaugUf 1220 ACTACTTGTG 1580 1421073 gUfGfAfugu cAfCfaucaC TGATGTGACA gacauguL96 faCfaaguas TGG gsu AD- usgsacauGf 861 asUfsucuUf 1221 TGTGACATGG 1581 1421086 gGfCfAfaca gUfGfuugcC GCAACACAAG caagaauL96 fcAfugucas AAA csa AD- gsgsgcaaCf 862 asAfsauuCf 1222 ATGGGCAACA 1582 1421092 aCfAfAfgaa uUfUfcuugU CAAGAAAGAA agaauuuL96 fgUfugcccs TTT asu AD- csascaagAf 863 asCfsaaaGf 1223 AACACAAGAA 1583 1421098 aAfGfAfauu aAfAfuucuU AGAATTTCTT ucuuuguL96 fuCfuugugs TGC usu AD- asasagaaUf 864 asCfscacUf 1224 AGAAAGAATT 1584 1421104 uUfCfUfuug gCfAfaagaA TCTTTGCAGT cagugguL96 faUfucuuus GGC csu AD- gsusggcuCf 865 asUfscugAf 1225 CAGTGGCTCA 1585 1421120 aGfGfAfgga aUfCfcuccU GGAGGATTCA uucagauL96 fgAfgccacs GAA usg AD- csasggagGf 866 asAfsauaGf 1226 CTCAGGAGGA 1586 1421126 aUfUfCfaga uUfCfugaaU TTCAGAACTA acuauuuL96 fcCfuccugs TTC asg AD- gsasuucaGf 867 asUfsgacCf 1227 AGGATTCAGA 1587 1421132 aAfCfUfauu gAfAfuaguU ACTATTCGGT cggucauL96 fcUfgaaucs CAT csu AD- csusauucGf 868 asAfsaauAf 1228 AACTATTCGG 1588 1421141 gUfCfAfugg uCfCfaugaC TCATGGATAT auauuuuL96 fcGfaauags TTG usu AD- gsgsucauGf 869 asAfsgucAf 1229 TCGGTCATGG 1589 1421147 gAfUfAfuuu cAfAfauauC ATATTTGTGA gugacuuL96 fcAfugaccs CTA gsa AD- gsgsauauUf 870 asCfsaucAf 1230 ATGGATATTT 1590 1421153 uGfUfGfacu uAfGfucacA GTGACTATGA augauguL96 faAfuauccs TGA asu AD- usgsugacUf 871 asCfsuggAf 1231 TTTGTGACTA 1591 1421160 aUfGfAfuga uUfCfaucaU TGATGAATCC auccaguL96 faGfucacas AGT asa AD- gsasugaaUf 872 asCfsaucUf 1232 ATGATGAATC 1592 1421169 cCfAfGfugg uCfCfacugG CAGTGGAAGA aagauguL96 faUfucaucs TGG asu AD- csasguggAf 873 asAfsgcaGf 1233 TCCAGTGGAA 1593 1421177 aGfAfUfgga uUfCfcaucU GATGGAACTG acugcuuL96 fuCfcacugs CTT gsa AD- asasgaugGf 874 asCfscacUf 1234 GGAAGATGGA 1594 1421183 aAfCfUfgcu aAfGfcaguU ACTGCTTAGT uagugguL96 fcCfaucuus GGC cSC AD- ascsugcuUf 875 asUfsugcCf 1235 GAACTGCTTA 1595 1421191 aGfUfGfgca gUfGfccacU GTGGCACGGC cggcaauL96 faAfgcagus AAC usc AD- usasguggCf 876 asAfsaugUf 1236 CTTAGTGGCA 1596 1421197 aCfGfGfcaa gUfUfgccgU CGGCAACACA cacauuuL96 fgCfcacuas TTG asg AD- gsgscaacAf 877 asAfscucAf 1237 ACGGCAACAC 1597 1421206 cAfUfUfgaa uUfUfcaauG ATTGAAATGA augaguuL96 fuGfuugccs GTA gsu AD- ascsauugAf 878 asAfsguaGf 1238 ACACATTGAA 1598 1421212 aAfUfGfagu uAfCfucauU ATGAGTACTA acuacuuL96 fuCfaaugus CTG gsu AD- gsasguacUf 879 asCfsaacCf 1239 ATGAGTACTA 1599 1421222 aCfUfGfgcu cAfGfccagU CTGGCTGGGT ggguuguL96 faGfuacucs TGG asu AD- usgsgcugGf 880 asUfsaaaUf 1240 ACTGGCTGGG 1600 1421231 gUfUfGfgaa cUfUfccaaC TTGGAAGATT gauuuauL96 fcCfagccas TAG gsu AD- gsgsuuggAf 881 asAfsaggCf 1241 TGGGTTGGAA 1601 1421237 aGfAfUfuua cUfAfaaucU GATTTAGGCC ggccuuuL96 fuCfcaaces TTC csa AD- gsasuuuaGf 882 asAfsgguUf 1242 AAGATTTAGG 1602 1421245 gCfCfUfuca cUfGfaaggC CCTTCAGAAC gaaccuuL96 fcUfaaaucs CTC usu AD- cscsuucaGf 883 asGfsuaaAf 1243 GGCCTTCAGA 1603 1421253 aAfCfCfuca aUfGfagguU ACCTCATTTT uuuuacuL96 fcUfgaaggs ACC CSC AD- gsasaccuCf 884 asUfscaaGf 1244 CAGAACCTCA 1604 1421259 aUfUfUfuac gGfUfaaaaU TTTTACCCTT ccuugauL96 fgAfgguucs GAT usg AD- csasuuuuAf 885 asUfsuacCf 1245 CTCATTTTAC 1605 1421265 cCfCfUfuga aUfCfaaggG CCTTGATGGT ugguaauL96 fuAfaaaugs AAT asg AD- ascsccuuGf 886 asAfsagcUf 1246 TTACCCTTGA 1606 1421271 aUfGfGfuaa aUfUfaccaU TGGTAATAGC uagcuuuL96 fcAfagggus TTC asa AD- asusgguaAf 887 asCfsuugUf 1247 TGATGGTAAT 1607 1421278 uAfGfCfuuc aGfAfagcuA AGCTTCTACA uacaaguL96 fuUfaccaus AGA csa AD- usasgcuuCf 888 asUfsgauGf 1248 AATAGCTTCT 1608 1421285 uAfCfAfaga aUfCfuuguA ACAAGATCAT ucaucauL96 fgAfagcuas CAG usu AD- csasagauCf 889 asCfsuucAf 1249 TACAAGATCA 1609 1421294 aUfCfAfgca uUfGfcugaU TCAGCAATGA augaaguL96 fgAfucuugs AGA usa AD- asgscaauGf 890 asCfsuguAf 1250 TCAGCAATGA 1610 1421304 aAfGfAfagg aCfCfuucuU AGAAGGTTAC uuacaguL96 fcAfuugcus AGA gsa AD- gsasagguUf 891 asCfsaaaUf 1251 AAGAAGGTTA 1611 1421313 aCfAfGfaca gUfGfucugU CAGACACATT cauuuguL96 faAfccuucs TGC usu AD- ascsagacAf 892 asGfsaaaUf 1252 TTACAGACAC 1612 1421320 cAfUfUfugc aGfCfaaauG ATTTGCTATT uauuucuL96 fuGfucugus TCC asa AD- csasuuugCf 893 asCfsuauUf 1253 CACATTTGCT 1613 1421327 uAfUfUfucc uGfGfaaauA ATTTCCAAAT aaauaguL96 fgCfaaaugs AGA usg AD- gsascugcAf 894 asUfsuugUf 1254 AAGACTGCAC 1614 1421335 cAfUfUfuau aAfUfaaauG ATTTATTACA uacaaauL96 fuGfcagucs AAA usu AD- ascsauuuAf 895 asGfsugcCf 1255 GCACATTTAT 1615 1421341 uUfAfCfaaa uUfUfuguaA TACAAAAGGC aggcacuL96 fuAfaaugus ACC gsc AD- ususacaaAf 896 asUfsuccCf 1256 TATTACAAAA 1616 1421348 aGfGfCfacc aGfGfugccU GGCACCTGGG ugggaauL96 fuUfuguaas AAG usa AD- gsgscaccUf 897 asCfscgaUf 1257 AAGGCACCTG 1617 1421356 gGfGfAfagu gAfCfuuccC GGAAGTCATC caucgguL96 faGfgugccs GGG usu AD- usgsggaaGf 898 asUfscuaUf 1258 CCTGGGAAGT 1618 1421362 uCfAfUfcgg cCfCfgaugA CATCGGGATA gauagauL96 fcUfucccas GAA gsg AD- gsuscaucGf 899 asAfsgagCf 1259 AAGTCATCGG 1619 1421368 gGfAfUfaga uUfCfuaucC GATAGAAGCT agcucuuL96 fcGfaugacs CTA usu AD- gsgsauagAf 900 asAfscugGf 1260 CGGGATAGAA 1620 1421375 aGfCfUfcua uUfAfgagcU GCTCTAACCA accaguuL96 fuCfuauccs GTG csg AD- gscsucuaAf 901 asAfsgauAf 1261 AAGCTCTAAC 1621 1421383 cCfAfGfuga aUfCfacugG CAGTGATTAT uuaucuuL96 fuUfagagcs CTA usu AD- ascscaguGf 902 asUfsaguAf 1262 TAACCAGTGA 1622 1421389 aUfUfAfucu uAfGfauaaU TTATCTATAC auacuauL96 fcAfcuggus TAC usa AD- gsasuuauCf 903 asCfsuaaUf 1263 GTGATTATCT 1623 1421394 uAfUfAfcua gUfAfguauA ATACTACATT cauuaguL96 fgAfuaaucs AGT asc AD- usasaugaAf 904 asGfscauUf 1264 AGTAATGAAT 1624 1421408 uAfUfAfaag cCfUfuuauA ATAAAGGAAT gaaugcuL96 fuUfcauuas GCC csu AD- asusauaaAf 905 asCfsuccUf 1265 GAATATAAAG 1625 1421414 gGfAfAfugc gGfCfauucC GAATGCCAGG caggaguL96 fuUfuauaus AGG usc AD- csasggagGf 906 asAfsuaaAf 1266 GCCAGGAGGA 1626 1421428 aAfGfGfaau gAfUfuccuU AGGAATCTTT cuuuauuL96 fcCfuccugs ATA gsc AD- gsasaggaAf 907 asGfsauuUf 1267 AGGAAGGAAT 1627 1421433 uCfUfUfuau uAfUfaaagA CTTTATAAAA aaaaucuL96 fuUfccuucs TCC csu AD- ususauaaAf 908 asCfsacuAf 1268 CTTTATAAAA 1628 1421441 aUfCfCfaac aGfUfuggaU TCCAACTTAG uuaguguL96 fuUfuauaas TGA asg AD- csasacuuAf 909 asUfsuugUf 1269 TCCAACTTAG 1629 1421451 gUfGfAfcua aUfAfgucaC TGACTATACA uacaaauL96 fuAfaguugs AAA gsa AD- usgsacuaUf 910 asAfsuguCf 1270 AGTGACTATA 1630 1421459 aCfAfAfaag aCfUfuuugU CAAAAGTGAC ugacauuL96 faUfagucas ATG csu AD- asasaaguGf 911 asAfsacuGf 1271 ACAAAAGTGA 1631 1421468 aCfAfUfgcc aGfGfcaugU CATGCCTCAG ucaguuuL96 fcAfcuuuus TTG gsu AD- cscsucagUf 912 asGfsauuCf 1272 TGCCTCAGTT 1632 1421480 uGfUfGfagc aGfCfucacA GTGAGCTGAA ugaaucuL96 faCfugaggs TCC csa AD- gsasgcugAf 913 asCfsaccUf 1273 GTGAGCTGAA 1633 1421490 aUfCfCfgga uUfCfcggaU TCCGGAAAGG aagguguL96 fuCfagcucs TGT aSC AD- cscsggaaAf 914 asUfsaguAf 1274 ATCCGGAAAG 1634 1421499 gGfUfGfuca cUfGfacacC GTGTCAGTAC guacuauL96 fuUfuccggs TAT asu AD- asgsguguCf 915 asAfscagAf 1275 AAAGGTGTCA 1635 1421505 aGfUfAfcua aUfAfguacU GTACTATTCT uucuguuL96 fgAfcaccus GTG usu AD- csasguacUf 916 asAfsaugAf 1276 GTCAGTACTA 1636 1421511 aUfUfCfugu cAfCfagaaU TTCTGTGTCA gucauuuL96 faGfuacugs TTC aSC AD- csusguguCf 917 asCfsucuUf 1277 TTCTGTGTCA 1637 1421521 aUfUfCfagu uAfCfugaaU TTCAGTAAAG aaagaguL96 fgAfcacags AGG asa AD- uscsaguaAf 918 asAfsuacUf 1278 ATTCAGTAAA 1638 1421530 aGfAfGfgcg uCfGfccucU GAGGCGAAGT aaguauuL96 fuUfacugas ATT asu AD- gsasggcgAf 919 asAfsgcuGf 1279 AAGAGGCGAA 1639 1421538 aGfUfAfuua aUfAfauacU GTATTATCAG ucagcuuL96 fuCfgccucs CTG usu AD- gsusauuaUf 920 asAfsacaUf 1280 AAGTATTATC 1640 1421546 cAfGfCfuga cUfCfagcuG AGCTGAGATG gauguuuL96 faUfaauacs TTC usu AD- csuscuauAf 921 asCfsugcUf 1281 CCCTCTATAC 1641 1421563 cUfCfUfaca gUfGfuagaG TCTACACAGC cagcaguL96 fuAfuagags AGC gsg AD- csuscuacAf 922 asAfsuucAf 1282 TACTCTACAC 1642 1421570 cAfGfCfagc cGfCfugcuG AGCAGCGTGA gugaauuL96 fuGfuagags ATG usa AD- asgscagcGf 923 asCfscuuUf 1283 ACAGCAGCGT 1643 1421578 uGfAfAfuga aUfCfauucA GAATGATAAA uaaagguL96 fcGfcugcus GGG gsu AD- asasugauAf 924 asAfscucUf 1284 TGAATGATAA 1644 1421587 aAfGfGfgcu cAfGfcccuU AGGGCTGAGA gagaguuL96 fuAfucauus GTC csa AD- gsgsgcugAf 925 asUfscuuCf 1285 AAGGGCTGAG 1645 1421596 gAfGfUfccu cAfGfgacuC AGTCCTGGAA ggaagauL96 fuCfagcccs GAC usu AD- asgsuccuGf 926 asCfsugaAf 1286 AGAGTCCTGG 1646 1421604 gAfAfGfaca uUfGfucuuC AAGACAATTC auucaguL96 fcAfggacus AGC csu AD- asasgacaAf 927 asAfsuccAf 1287 GGAAGACAAT 1647 1421612 uUfCfAfgcu aAfGfcugaA TCAGCTTTGG uuggauuL96 fuUfgucuus ATA CSC AD- uscsagcuUf 928 asAfsgcaUf 1288 ATTCAGCTTT 1648 1421620 uGfGfAfuaa uUfUfauccA GGATAAAATG aaugcuuL96 faAfgcugas CTG asu AD- gsasuaaaAf 929 asAfscauUf 1289 TGGATAAAAT 1649 1421629 uGfCfUfgca cUfGfcagcA GCTGCAGAAT gaauguuL96 fuUfuuaucs GTC csa AD- asusgcugCf 930 asAfsucuGf 1290 AAATGCTGCA 1650 1421635 aGfAfAfugu gAfCfauucU GAATGTCCAG ccagauuL96 fgCfagcaus ATG usu AD- csusggacUf 931 asUfsucaAf 1291 AACTGGACTT 1651 1421650 uCfAfUfuau aAfUfaaugA CATTATTTTG uuugaauL96 faGfuccags AAT usu AD- asasacaaAf 932 asCfsugaUf 1292 TGAAACAAAA 1652 1421662 aUfUfUfugg aCfCfaaaaU TTTTGGTATC uaucaguL96 fuUfuguuus AGA csa AD- ususgguaUf 933 asGfscaaGf 1293 TTTTGGTATC 1653 1421672 cAfGfAfuga aUfCfaucuG AGATGATCTT ucuugcuL96 faUfaccaas GCC asa AD- csasgaugAf 934 asUfsgagGf 1294 ATCAGATGAT 1654 1421679 uCfUfUfgcc aGfGfcaagA CTTGCCTCCT uccucauL96 fuCfaucugs CAT asu AD- asuscuugCf 935 asUfscaaAf 1295 TGATCTTGCC 1655 1421685 cUfCfCfuca aUfGfaggaG TCCTCATTTT uuuugauL96 fgCfaagaus GAT csa AD- cscsuccuCf 936 asGfsauuUf 1296 TGCCTCCTCA 1656 1421691 aUfUfUfuga aUfCfaaaaU TTTTGATAAA uaaaucuL96 fgAfggaggs TCC csa AD- csasuuuuGf 937 asUfsucuUf 1297 CTCATTTTGA 1657 1421697 aUfAfAfauc gGfAfuuuaU TAAATCCAAG caagaauL96 fcAfaaaugs AAA asg AD- asasauccAf 938 asAfsgagGf 1298 ATAAATCCAA 1658 1421706 aGfAfAfaua aUfAfuuucU GAAATATCCT uccucuuL96 fuGfgauuus CTA asu AD- asasgaaaUf 939 asAfsauaGf 1299 CCAAGAAATA 1659 1421712 aUfCfCfucu uAfGfaggaU TCCTCTACTA acuauuuL96 faUfuucuus TTA gsg AD- csuscuacUf 940 asAfsuacAf 1300 TCCTCTACTA 1660 1421722 aUfUfAfgau cAfUfcuaaU TTAGATGTGT guguauuL96 faGfuagags ATG gsa AD- asgsacacUf 941 asUfscagUf 1301 GCAGACACTG 1661 1421765 gUfCfUfuca cUfGfaagaC TCTTCAGACT gacugauL96 faGfugucus GAA gsc AD- usgsucuuCf 942 asCfsccaGf 1302 ACTGTCTTCA 1662 1421771 aGfAfCfuga uUfCfagucU GACTGAACTG acuggguL96 fgAfagacas GGC gsu AD- asgsacugAf 943 asUfsaagUf 1303 TCAGACTGAA 1663 1421778 aCfUfGfggc gGfCfccagU CTGGGCCACT cacuuauL96 fuCfagucus TAC gsa AD- cscsacuuAf 944 asUfsgugCf 1304 GGCCACTTAC 1664 1421791 cCfUfUfgca uUfGfcaagG CTTGCAAGCA agcacauL96 fuAfaguggs CAG CSC AD- ususgcaaGf 945 asAfsaugUf 1305 CCTTGCAAGC 1665 1421800 cAfCfAfgaa uUfUfcuguG ACAGAAAACA aacauuuL96 fcUfugcaas TTA gsg AD- csascagaAf 946 asCfsuacUf 1306 AGCACAGAAA 1666 1421807 aAfCfAfuua aUfAfauguU ACATTATAGT uaguaguL96 fuUfcugugs AGC csu AD- ascsauuaUf 947 asAfsaagCf 1307 AAACATTATA 1667 1421815 aGfUfAfgcu uAfGfcuacU GTAGCTAGCT agcuuuuL96 faUfaaugus TTG usu AD- gsusagcuAf 948 asCfsugcCf 1308 TAGTAGCTAG 1668 1421823 gCfUfUfuga aUfCfaaagC CTTTGATGGC uggcaguL96 fuAfgcuacs AGA usa AD- gscsuuugAf 949 asAfscuuCf 1309 TAGCTTTGAT 1669 1421830 uGfGfCfaga cUfCfugccA GGCAGAGGAA ggaaguuL96 fuCfaaagcs GTG usa AD- gscsagagGf 950 asUfsuggUf 1310 TGGCAGAGGA 1670 1421839 aAfGfUfggu aAfCfcacuU AGTGGTTACC uaccaauL96 fcCfucugcs AAG csa AD- gsgsuuacCf 951 asAfsucuUf 1311 GTGGTTACCA 1671 1421850 aAfGfGfaga aUfCfuccuU AGGAGATAAG uaagauuL96 fgGfuaaccs ATC aSC AD- asasggagAf 952 asAfsugcAf 1312 CCAAGGAGAT 1672 1421857 uAfAfGfauc uGfAfucuuA AAGATCATGC augcauuL96 fuCfuccuus ATG gsg AD- asasgaucAf 953 asUfsugaUf 1313 ATAAGATCAT 1673 1421865 uGfCfAfugc uGfCfaugcA GCATGCAATC aaucaauL96 fuGfaucuus AAC asu AD- csasugcaAf 954 asAfsgucUf 1314 TGCATGCAAT 1674 1421874 uCfAfAfcag uCfUfguugA CAACAGAAGA aagacuuL96 fuUfgcaugs CTG csa AD- ascsagaaGf 955 asAfsaauGf 1315 CAACAGAAGA 1675 1421884 aCfUfGfgga uUfCfccagU CTGGGAACAT acauuuuL96 fcUfucugus TTG usg AD- ascsugggAf 956 asCfsaacUf 1316 AGACTGGGAA 1676 1421891 aCfAfUfuug uCfAfaaugU CATTTGAAGT aaguuguL96 fuCfccagus TGA csu AD- asascauuUf 957 asGfsaucUf 1317 GGAACATTTG 1677 1421897 gAfAfGfuug uCfAfacuuC AAGTTGAAGA aagaucuL96 faAfauguus TCA CSC AD- usgsaaguUf 958 asCfsaauUf 1318 TTTGAAGTTG 1678 1421903 gAfAfGfauc uGfAfucuuC AAGATCAAAT aaauuguL96 faAfcuucas TGA asa AD- usgsaagaUf 959 asCfsugcUf 1319 GTTGAAGATC 1679 1421909 cAfAfAfuug uCfAfauuuG AAATTGAAGC aagcaguL96 faUfcuucas AGC asc AD- asasauugAf 960 asUfsuguCf 1320 TCAAATTGAA 1680 1421917 aGfCfAfgcc uGfGfcugcU GCAGCCAGAC agacaauL96 fuCfaauuus AAT gsa AD- gscsagccAf 961 asUfsuugAf 1321 AAGCAGCCAG 1681 1421925 gAfCfAfauu aAfAfuuguC ACAATTTTCA uucaaauL96 fuGfgcugcs AAA usu AD- gsgsgauuUf 962 asGfsuuuGf 1322 ATGGGATTTG 1682 1421948 gUfGfGfaca uUfGfuccaC TGGACAACAA acaaacuL96 faAfaucccs ACG asu AD- usgsuggaCf 963 asCfsaauUf 1323 TTTGTGGACA 1683 1421954 aAfCfAfaac cGfUfuuguU ACAAACGAAT gaauuguL96 fgUfccacas TGC asa AD- asascaaaCf 964 asCfsaaaUf 1324 ACAACAAACG 1684 1421961 gAfAfUfugc uGfCfaauuC AATTGCAATT aauuuguL96 fgUfuuguus TGG gsu AD- gsgsucauAf 965 asUfsacgUf 1325 CTGGTCATAT 1685 1421968 uGfGfAfggg aCfCfcuccA GGAGGGTACG uacguauL96 fuAfugaccs TAA asg AD- gsgsguacGf 966 asAfsccaUf 1326 GAGGGTACGT 1686 1421979 uAfAfCfcuc uGfAfgguuA AACCTCAATG aaugguuL96 fcGfuacccs GTC usc AD- asuscgggAf 967 asUfsgaaCf 1327 GGATCGGGAA 1687 1422005 aGfUfGfgcg aCfGfccacU GTGGCGTGTT uguucauL96 fuCfccgaus CAA cSC AD- usgsgcguGf 968 asUfsuccAf 1328 AGTGGCGTGT 1688 1422014 uUfCfAfagu cAfCfuugaA TCAAGTGTGG guggaauL96 fcAfcgccas AAT csu AD- ususcaagUf 969 asAfscggCf 1329 TGTTCAAGTG 1689 1422021 gUfGfGfaau uAfUfuccaC TGGAATAGCC agccguuL96 faCfuugaas GTG csa AD- usgsggagUf 970 asAfscugAf 1330 GGTGGGAGTA 1690 1422057 aCfUfAfuga gUfCfauagU CTATGACTCA cucaguuL96 faCfucccas GTG cSC AD- asusgacuCf 971 asUfsucuGf 1331 CTATGACTCA 1691 1422067 aGfUfGfuac uGfUfacacU GTGTACACAG acagaauL96 fgAfgucaus AAC asg AD- gsusguacAf 972 asAfsuguAf 1332 CAGTGTACAC 1692 1422075 cAfGfAfacg aCfGfuucuG AGAACGTTAC uuacauuL96 fuGfuacacs ATG usg AD- ascsagaaCf 973 asAfsgacCf 1333 ACACAGAACG 1693 1422081 gUfUfAfcau cAfUfguaaC TTACATGGGT gggucuuL96 fgUfucugus CTC gsu AD- gsusuacaUf 974 asAfsguuGf 1334 ACGTTACATG 1694 1422088 gGfGfUfcuc gGfAfgaccC GGTCTCCCAA ccaacuuL96 faUfguaacs CTC gsu AD- gsgsucucCf 975 asUfscuuCf 1335 TGGGTCTCCC 1695 1422096 cAfAfCfucc uGfGfaguuG AACTCCAGAA agaagauL96 fgGfagaccs GAC csa AD- csasacucCf 976 asAfsaggUf 1336 CCCAACTCCA 1696 1422103 aGfAfAfgac uGfUfcuucU GAAGACAACC aaccuuuL96 fgGfaguugs TTG gsg AD- gsascaacCf 977 asCfsuguAf 1337 AAGACAACCT 1697 1422114 uUfGfAfcca aUfGfgucaA TGACCATTAC uuacaguL96 fgGfuugucs AGA usu AD- csusugacCf 978 asGfsaauUf 1338 ACCTTGACCA 1698 1422120 aUfUfAfcag uCfUfguaaU TTACAGAAAT aaauucuL96 fgGfucaags TCA gsu AD- asusuacaGf 979 asGfsacuGf 1339 CCATTACAGA 1699 1422127 aAfAfUfuca uUfGfaauuU AATTCAACAG acagucuL96 fcUfguaaus TCA gsg AD- gsasaauuCf 980 asGfscucAf 1340 CAGAAATTCA 1700 1422133 aAfCfAfguc uGfAfcuguU ACAGTCATGA augagcuL96 fgAfauuucs GCA usg AD- uscsaugaGf 981 asAfsuuuUf 1341 AGTCATGAGC 1701 1422145 cAfGfAfgcu cAfGfcucuG AGAGCTGAAA gaaaauuL96 fcUfcaugas ATT csu AD- gscsagagCf 982 asUfsuuaAf 1342 GAGCAGAGCT 1702 1422151 uGfAfAfaau aAfUfuuucA GAAAATTTTA uuuaaauL96 fgCfucugcs AAC usc AD- ususuaaaCf 983 asAfsgguAf 1343 ATTTTAAACA 1703 1422161 aAfGfUfuga cUfCfaacuU AGTTGAGTAC guaccuuL96 fgUfuuaaas CTC asu AD- asgsuugaGf 984 asGfsaauAf 1344 CAAGTTGAGT 1704 1422169 uAfCfCfucc aGfGfagguA ACCTCCTTAT uuauucuL96 fcUfcaacus TCA usg AD- usasccucCf 985 asGfsuucCf 1345 AGTACCTCCT 1705 1422176 uUfAfUfuca aUfGfaauaA TATTCATGGA uggaacuL96 fgGfagguas ACA csu AD- ususauucAf 986 asAfsucuGf 1346 CCTTATTCAT 1706 1422183 uGfGfAfaca cUfGfuuccA GGAACAGCAG gcagauuL96 fuGfaauaas ATG gsg AD- gsasacagCf 987 asAfsacgUf 1347 TGGAACAGCA 1707 1422192 aGfAfUfgau uAfUfcaucU GATGATAACG aacguuuL96 fgCfuguucs TTC csa AD- csasgaugAf 988 asAfsaagUf 1348 AGCAGATGAT 1708 1422198 uAfAfCfguu gAfAfcguuA AACGTTCACT cacuuuuL96 fuCfaucugs TTC csu AD- usasacguUf 989 asAfscugCf 1349 GATAACGTTC 1709 1422205 cAfCfUfuuc uGfAfaaguG ACTTTCAGCA agcaguuL96 faAfcguuas GTC usc AD- uscsacuuUf 990 asGfsagcUf 1350 GTTCACTTTC 1710 1422211 cAfGfCfagu gAfCfugcuG AGCAGTCAGC cagcucuL96 faAfagugas TCA asc AD- gscsagucAf 991 asUfsggaGf 1351 CAGCAGTCAG 1711 1422220 gCfUfCfaga aUfCfugagC CTCAGATCTC ucuccauL96 fuGfacugcs CAA usg AD- gscsucagAf 992 asAfsgggCf 1352 CAGCTCAGAT 1712 1422227 uCfUfCfcaa uUfUfggagA CTCCAAAGCC agcccuuL96 fuCfugagcs CTG usg AD- uscsuccaAf 993 asAfsucgAf 1353 GATCTCCAAA 1713 1422234 aGfCfCfcug cCfAfgggcU GCCCTGGTCG gucgauuL96 fuUfggagas ATG usc AD- gscsccugGf 994 asAfscucCf 1354 AAGCCCTGGT 1714 1422242 uCfGfAfugu aAfCfaucgA CGATGTTGGA uggaguuL96 fcCfagggcs GTG usu AD- gsuscgauGf 995 asAfsaauCf 1355 TGGTCGATGT 1715 1422248 uUfGfGfagu cAfCfuccaA TGGAGTGGAT ggauuuuL96 fcAfucgacs TTC csa AD- asgsuggaUf 996 asAfscauUf 1356 GGAGTGGATT 1716 1422259 uUfCfCfagg gCfCfuggaA TCCAGGCAAT caauguuL96 faUfccacus GTG cSC AD- uscscaggCf 997 asAfsguaUf 1357 TTTCCAGGCA 1717 1422267 aAfUfGfugg aCfCfacauU ATGTGGTATA uauacuuL96 fgCfcuggas CTG asa AD- asasugugGf 998 asCfsuucAf 1358 GCAATGTGGT 1718 1422274 uAfUfAfcug uCfAfguauA ATACTGATGA augaaguL96 fcCfacauus AGA gsc AD- gsusauacUf 999 asCfsaugGf 1359 TGGTATACTG 1719 1422280 gAfUfGfaag uCfUfucauC ATGAAGACCA accauguL96 faGfuauacs TGG csa AD- asusgaagAf 1000 asAfsgcuAf 1360 TGATGAAGAC 1720 1422288 cCfAfUfgga uUfCfcaugG CATGGAATAG auagcuuL96 fuCfuucaus CTA csa AD- cscsauggAf 1001 asUfsgcuGf 1361 GACCATGGAA 1721 1422295 aUfAfGfcua cUfAfgcuaU TAGCTAGCAG gcagcauL96 fuCfcauggs CAC usc AD- asusagcuAf 1002 asUfsgugCf 1362 GAATAGCTAG 1722 1422302 gCfAfGfcac uGfUfgcugC CAGCACAGCA agcacauL96 fuAfgcuaus CAC usc AD- csasgcacAf 1003 asUfsaugUf 1363 AGCAGCACAG 1723 1422310 gCfAfCfacc uGfGfugugC CACACCAACA aacauauL96 fuGfugcugs TAT csu AD- asgscacaCf 1004 asUfsauaUf 1364 ACAGCACACC 1724 1422316 cAfAfCfaua aUfAfuguuG AACATATATA uauauauL96 fgUfgugcus TAC gsu AD- cscsaacaUf 1005 asUfsgugGf 1365 CACCAACATA 1725 1422322 aUfAfUfaua gUfAfuauaU TATATACCCA cccacauL96 faUfguuggs CAT usg AD- usascccaCf 1006 asUfsgaaGf 1366 TATACCCACA 1726 1422334 aUfGfAfgcc uGfGfcucaU TGAGCCACTT acuucauL96 fgUfggguas CAT usa AD- csasugagCf 1007 asGfsuuuUf 1367 CACATGAGCC 1727 1422340 cAfCfUfuca aUfGfaaguG ACTTCATAAA uaaaacuL96 fgCfucaugs ACA usg AD- cscsacuuCf 1008 asAfsacaUf 1368 AGCCACTTCA 1728 1422346 aUfAfAfaac uGfUfuuuaU TAAAACAATG aauguuuL96 fgAfaguggs TTT csu AD- asascaauGf 1009 asAfsgguAf 1369 AAAACAATGT 1729 1422357 uUfUfCfucu aAfGfagaaA TTCTCTTTAC uuaccuuL96 fcAfuuguus CTT usu AD- gsusuucuCf 1010 asGfsugcUf 1370 ATGTTTCTCT 1730 1422363 uUfUfAfccu aAfGfguaaA TTACCTTAGC uagcacuL96 fgAfgaaacs ACC asu AD- ususuaccUf 1011 asUfsuuuGf 1371 TCTTTACCTT 1731 1422370 uAfGfCfacc aGfGfugcuA AGCACCTCAA ucaaaauL96 faGfguaaas AAT gsa AD- ususagcaCf 1012 asAfsuggUf 1372 CCTTAGCACC 1732 1422376 cUfCfAfaaa aUfUfuugaG TCAAAATACC uaccauuL96 fgUfgcuaas ATG gsg AD- csuscaaaAf 1013 asAfsaauGf 1373 ACCTCAAAAT 1733 1422383 uAfCfCfaug gCfAfugguA ACCATGCCAT ccauuuuL96 fuUfuugags TTA gsu AD- usasccauGf 1014 asAfsagcUf 1374 AATACCATGC 1734 1422390 cCfAfUfuua uUfAfaaugG CATTTAAAGC aagcuuuL96 fcAfugguas TTA usu AD- ususuucaUf 1015 asCfsaguUf 1375 TGTTTTCATT 1735 1422412 uAfUfCfuca uUfGfagauA ATCTCAAAAC aaacuguL96 faUfgaaaas TGC csa AD- uscsucaaAf 1016 asUfsugaCf 1376 TATCTCAAAA 1736 1422421 aCfUfGfcac aGfUfgcagU CTGCACTGTC ugucaauL96 fuUfugagas AAG usa AD- csusgcacUf 1017 asUfscauCf 1377 AACTGCACTG 1737 1422429 gUfCfAfaga aUfCfuugaC TCAAGATGAT ugaugauL96 faGfugcags GAT usu AD- csasagauGf 1018 asUfsaaaGf 1378 GTCAAGATGA 1738 1422438 aUfGfAfuga aUfCfaucaU TGATGATCTT ucuuuauL96 fcAfucuugs TAA aSC AD- gsasucuuUf 1019 asGfsaguGf 1379 ATGATCTTTA 1739 1422449 aAfAfAfuac uGfUfauuuU AAATACACAC acacucuL96 faAfagaucs TCA asu AD- asasauacAf 1020 asCfsuugAf 1380 TAAAATACAC 1740 1422457 cAfCfUfcaa uUfUfgaguG ACTCAAATCA aucaaguL96 fuGfuauuus AGA usa AD- ascsucaaAf 1021 asUfsuaaGf 1381 ACACTCAAAT 1741 1422465 uCfAfAfgaa uUfUfcuugA CAAGAAACTT acuuaauL96 fuUfugagus AAG gsu AD- asuscaagAf 1022 asGfsuaaCf 1382 AAATCAAGAA 1742 1422471 aAfCfUfuaa cUfUfaaguU ACTTAAGGTT gguuacuL96 fuCfuugaus ACC usu AD- ascsuuaaGf 1023 asGfsaacAf 1383 AAACTTAAGG 1743 1422479 gUfUfAfccu aAfGfguaaC TTACCTTTGT uuguucuL96 fcUfuaagus TCC usu AD- ascscuuuGf 1024 asUfsgaaAf 1384 TTACCTTTGT 1744 1422489 uUfCfCfcaa uUfUfgggaA TCCCAAATTT auuucauL96 fcAfaaggus CAT asa AD- gsusucccAf 1025 asUfsaggUf 1385 TTGTTCCCAA 1745 1422495 aAfUfUfuca aUfGfaaauU ATTTCATACC uaccuauL96 fuGfggaacs TAT asa AD- asasauuuCf 1026 asAfsgauGf 1386 CCAAATTTCA 1746 1422501 aUfAfCfcua aUfAfgguaU TACCTATCAT ucaucuuL96 fgAfaauuus CTT gsg AD- asusaccuAf 1027 asCfsuacUf 1387 TCATACCTAT 1747 1422508 uCfAfUfcuu uAfAfgaugA CATCTTAAGT aaguaguL96 fuAfgguaus AGG gsa AD- csasucuuAf 1028 asAfsgaaGf 1388 ATCATCTTAA 1748 1422516 aGfUfAfggg uCfCfcuacU GTAGGGACTT acuucuuL96 fuAfagaugs CTG asu AD- asgsggacUf 1029 asUfsuguGf 1389 GTAGGGACTT 1749 1422526 uCfUfGfucu aAfGfacagA CTGTCTTCAC ucacaauL96 faGfucccus AAC asc AD- usgsucuuCf 1030 asAfsauaAf 1390 TCTGTCTTCA 1750 1422535 aCfAfAfcag uCfUfguugU CAACAGATTA auuauuuL96 fgAfagacas TTA gsa AD- ascsaacaGf 1031 asGfsuaaGf 1391 TCACAACAGA 1751 1422542 aUfUfAfuua gUfAfauaaU TTATTACCTT ccuuacuL96 fcUfguugus ACA gsa AD- asusuauuAf 1032 asAfsacuUf 1392 AGATTATTAC 1752 1422549 cCfUfUfaca cUfGfuaagG CTTACAGAAG gaaguuuL96 fuAfauaaus TTT csu AD- ascscuuaCf 1033 asAfsauuCf 1393 TTACCTTACA 1753 1422555 aGfAfAfguu aAfAfcuucU GAAGTTTGAA ugaauuuL96 fgUfaaggus TTA asa AD- asgsaaguUf 1034 asAfsccgGf 1394 ACAGAAGTTT 1754 1422562 uGfAfAfuua aUfAfauucA GAATTATCCG uccgguuL96 faAfcuucus GTC gsu AD- ususgaauUf 1035 asAfsaccCf 1395 GTTTGAATTA 1755 1422568 aUfCfCfggu gAfCfcggaU TCCGGTCGGG cggguuuL96 faAfuucaas TTT aSC AD- asusccggUf 1036 asAfscaaUf 1396 TTATCCGGTC 1756 1422575 cGfGfGfuuu aAfAfacccG GGGTTTTATT uauuguuL96 faCfcggaus GTT asa AD- uscsggguUf 1037 asUfsuuuAf 1397 GGTCGGGTTT 1757 1422581 uUfAfUfugu aAfCfaauaA TATTGTTTAA uuaaaauL96 faAfcccgas AAT cSC AD- ususuaaaAf 1038 asGfsaugCf 1398 TGTTTAAAAT 1758 1422586 uCfAfUfuuc aGfAfaaugA CATTTCTGCA ugcaucuL96 fuUfuuaaas TCA csa AD- uscsauuuCf 1039 asAfsgcaGf 1399 AATCATTTCT 1759 1422593 uGfCfAfuca cUfGfaugcA GCATCAGCTG gcugcuuL96 fgAfaaugas CTG usu AD- csusgcauCf 1040 asUfsguuUf 1400 TTCTGCATCA 1760 1422599 aGfCfUfgcu cAfGfcagcU GCTGCTGAAA gaaacauL96 fgAfugcags CAA asa AD- csasgcugCf 1041 asAfsuuuGf 1401 ATCAGCTGCT 1761 1422605 uGfAfAfaca uUfGfuuucA GAAACAACAA acaaauuL96 fgCfagcugs ATA asu AD- asasacaaCf 1042 asAfscaaUf 1402 TGAAACAACA 1762 1422614 aAfAfUfagg uCfCfuauuU AATAGGAATT aauuguuL96 fgUfuguuus GTT csa AD- asgsgaauUf 1043 asCfscucCf 1403 ATAGGAATTG 1763 1422623 gUfUfUfuua aUfAfaaaaC TTTTTATGGA uggagguL96 faAfuuccus GGC asu AD- gsusuuuuAf 1044 asUfsgcaAf 1404 TTGTTTTTAT 1764 1422630 uGfGfAfggc aGfCfcuccA GGAGGCTTTG uuugcauL96 fuAfaaaacs CAT asa AD- asgsgcuuUf 1045 asAfsgggAf 1405 GGAGGCTTTG 1765 1422640 gCfAfUfaga aUfCfuaugC CATAGATTCC uucccuuL96 faAfagccus CTG CSC AD- usgscauaGf 1046 asCfsugcUf 1406 TTTGCATAGA 1766 1422646 aUfUfCfccu cAfGfggaaU TTCCCTGAGC gagcaguL96 fcUfaugcas AGG asa AD- asusucccUf 1047 asUfsaaaAf 1407 AGATTCCCTG 1767 1422653 gAfGfCfagg uCfCfugcuC AGCAGGATTT auuuuauL96 faGfggaaus TAA csu AD- usgsagcaGf 1048 asAfsaagAf 1408 CCTGAGCAGG 1768 1422659 gAfUfUfuua uUfAfaaauC ATTTTAATCT aucuuuuL96 fcUfgcucas TTT gsg AD- usasaucuUf 1049 asGfsuccAf 1409 TTTAATCTTT 1769 1422667 uUfUfCfuaa gUfUfagaaA TTCTAACTGG cuggacuL96 faAfgauuas ACT asa AD- uscsuaacUf 1050 asUfsuugAf 1410 TTTCTAACTG 1770 1422676 gGfAfCfugg aCfCfagucC GACTGGTTCA uucaaauL96 faGfuuagas AAT asa AD- gsgsacugGf 1051 asAfsacaAf 1411 CTGGACTGGT 1771 1422683 uUfCfAfaau cAfUfuugaA TCAAATGTTG guuguuuL96 fcCfaguccs TTC asg AD- asasauguUf 1052 asUfsaaaGf 1412 TCAAATGTTG 1772 1422693 gUfUfCfucu aAfGfagaaC TTCTCTTCTT ucuuuauL96 faAfcauuus TAA gsa AD- ususcucuUf 1053 asCfsaucCf 1413 TGTTCTCTTC 1773 1422701 cUfUfUfaaa cUfUfuaaaG TTTAAAGGGA gggauguL96 faAfgagaas TGG csa AD- csusuuaaAf 1054 asAfsucuUf 1414 TTCTTTAAAG 1774 1422708 gGfGfAfugg gCfCfauccC GGATGGCAAG caagauuL96 fuUfuaaags ATG asa AD- gsgscaagAf 1055 asAfsucaCf 1415 ATGGCAAGAT 1775 1422720 uGfUfGfggc uGfCfccacA GTGGGCAGTG agugauuL96 fuCfuugccs ATG asu AD- usgsggcaGf 1056 asCfscuaGf 1416 TGTGGGCAGT 1776 1422729 uGfAfUfguc uGfAfcaucA GATGTCACTA acuagguL96 fcUfgcccas GGG csa AD- gsgsgacaGf 1057 asAfsaucCf 1417 CAGGGACAGG 1777 1422752 gAfUfAfaga cUfCfuuauC ATAAGAGGGA gggauuuL96 fcUfgucccs TTA usg AD- gsgsauaaGf 1058 asCfsuccCf 1418 CAGGATAAGA 1778 1422758 aGfGfGfauu uAfAfucccU GGGATTAGGG agggaguL96 fcUfuauces AGA usg AD- asgsggauUf 1059 asAfsucuUf 1419 AGAGGGATTA 1779 1422765 aGfGfGfaga cUfCfucccU GGGAGAGAAG gaagauuL96 faAfucccus ATA csu AD- usasgggaGf 1060 asCfscugCf 1420 ATTAGGGAGA 1780 1422771 aGfAfAfgau uAfUfcuucU GAAGATAGCA agcagguL96 fcUfcccuas GGG asu AD- csusgggaAf 1061 asGfscuuGf 1421 GGCTGGGAAC 1781 1422797 cCfCfAfagu gAfCfuuggG CCAAGTCCAA ccaagcuL96 fuUfcccags GCA CSC AD- ascsccaaGf 1062 asUfsgguAf 1422 GAACCCAAGT 1782 1422803 uCfCfAfagc uGfCfuuggA CCAAGCATAC auaccauL96 fcUfugggus CAA usc AD- gsusccaaGf 1063 asUfscguGf 1423 AAGTCCAAGC 1783 1422809 cAfUfAfcca uUfGfguauG ATACCAACAC acacgauL96 fcUfuggacs GAG usu AD- csasacacGf 1064 asAfscagUf 1424 ACCAACACGA 1784 1422821 aGfCfAfggc aGfCfcugcU GCAGGCTACT uacuguuL96 fcGfuguugs GTC gsu AD- gsasgcagGf 1065 asGfsagcUf 1425 ACGAGCAGGC 1785 1422827 cUfAfCfugu gAfCfaguaG TACTGTCAGC cagcucuL96 fcCfugcucs TCC gsu AD- csgsgagaAf 1066 asCfsuguGf 1426 CTCGGAGAAG 1786 1422831 gAfGfCfugu aAfCfagcuC AGCTGTTCAC ucacaguL96 fuUfcuccgs AGC asg AD- gsasgcugUf 1067 asAfsgucUf 1427 AAGAGCTGTT 1787 1422838 uCfAfCfagc gGfCfugugA CACAGCCAGA cagacuuL96 faCfagcucs CTG usu AD- ascsagccAf 1068 asAfsacuGf 1428 TCACAGCCAG 1788 1422847 gAfCfUfggc uGfCfcaguC ACTGGCACAG acaguuuL96 fuGfgcugus TTT gsa AD- usgsgcacAf 1069 asUfsuucUf 1429 ACTGGCACAG 1789 1422857 gUfUfUfucu cAfGfaaaaC TTTTCTGAGA gagaaauL96 fuGfugccas AAG gsu AD- asgsuuuuCf 1070 asAfsuagUf 1430 ACAGTTTTCT 1790 1422863 uGfAfGfaaa cUfUfucucA GAGAAAGACT gacuauuL96 fgAfaaacus ATT gsu AD- csusgagaAf 1071 asGfsuuuGf 1431 TTCTGAGAAA 1791 1422869 aGfAfCfuau aAfUfagucU GACTATTCAA ucaaacuL96 fuUfcucags ACA asa AD- asasgacuAf 1072 asGfsagaCf 1432 GAAAGACTAT 1792 1422875 uUfCfAfaac uGfUfuugaA TCAAACAGTC agucucuL96 fuAfgucuus TCA usc AD- ususcaaaCf 1073 asAfsuuuCf 1433 TATTCAAACA 1793 1422882 aGfUfCfuca cUfGfagacU GTCTCAGGAA ggaaauuL96 fgUfuugaas ATC usa AD- gsuscucaGf 1074 asCfsauaUf 1434 CAGTCTCAGG 1794 1422890 gAfAfAfuca uUfGfauuuC AAATCAAATA aauauguL96 fcUfgagacs TGC usg AD- gsgsaaauCf 1075 asGfscuuUf 1435 CAGGAAATCA 1795 1422896 aAfAfUfaug gCfAfuauuU AATATGCAAA caaagcuL96 fgAfuuuccs GCA usg AD- csasaauaUf 1076 asGfsucaGf 1436 ATCAAATATG 1796 1422902 gCfAfAfagc uGfCfuuugC CAAAGCACTG acugacuL96 faUfauuugs ACT asu AD- usgscaaaGf 1077 asUfsuagAf 1437 TATGCAAAGC 1797 1422908 cAfCfUfgac aGfUfcaguG ACTGACTTCT uucuaauL96 fcUfuugcas AAG usa AD- gscsacugAf 1078 asUfsuuuAf 1438 AAGCACTGAC 1798 1422914 cUfUfCfuaa cUfUfagaaG TTCTAAGTAA guaaaauL96 fuCfagugcs AAC usu AD- ascsuucuAf 1079 asCfsuguGf 1439 TGACTTCTAA 1799 1422920 aGfUfAfaaa gUfUfuuacU GTAAAACCAC ccacaguL96 fuAfgaagus AGC csa AD- gsusaaaaCf 1080 asUfsucaAf 1440 AAGTAAAACC 1800 1422928 cAfCfAfgca cUfGfcuguG ACAGCAGTTG guugaauL96 fgUfuuuacs AAA usu AD- cscsacagCf 1081 asAfsgucUf 1441 AACCACAGCA 1801 1422934 aGfUfUfgaa uUfUfcaacU GTTGAAAAGA aagacuuL96 fgCfuguggs CTC usu AD- ususgaaaAf 1082 asUfsuucUf 1442 AGTTGAAAAG 1802 1422943 gAfCfUfcca uUfGfgaguC ACTCCAAAGA aagaaauL96 fuUfuucaas AAT csu AD- asgsacucCf 1083 asCfsuuaCf 1443 AAAGACTCCA 1803 1422949 aAfAfGfaaa aUfUfucuuU AAGAAATGTA uguaaguL96 fgGfagucus AGG usu AD- asasagaaAf 1084 asAfsguuUf 1444 CCAAAGAAAT 1804 1422955 uGfUfAfagg cCfCfuuacA GTAAGGGAAA gaaacuuL96 fuUfucuuus CTG gsg AD- asasgggaAf 1085 asCfsguuGf 1445 GTAAGGGAAA 1805 1422965 aCfUfGfcca cUfGfgcagU CTGCCAGCAA gcaacguL96 fuUfcccuus CGC asc AD- gsusgccaGf 1086 asCfscuaUf 1446 AGGTGCCAGT 1806 1422975 uUfAfUfggc aGfCfcauaA TATGGCTATA uauagguL96 fcUfggcacs GGT csu AD- asusggcuAf 1087 asUfsuugUf 1447 TTATGGCTAT 1807 1422984 uAfGfGfugc aGfCfaccuA AGGTGCTACA uacaaauL96 fuAfgccaus AAA asa AD- ascsagcaAf 1088 asUfsuucCf 1448 ACACAGCAAG 1808 1423007 gGfGfUfgau cAfUfcaccC GGTGATGGGA gggaaauL96 fuUfgcugus AAG gsu AD- gsgsgugaUf 1089 asAfscaaUf 1449 AAGGGTGATG 1809 1423014 gGfGfAfaag gCfUfuuccC GGAAAGCATT cauuguuL96 faUfcacccs GTA usu AD- usgsggaaAf 1090 asAfscauUf 1450 GATGGGAAAG 1810 1423020 gCfAfUfugu uAfCfaaugC CATTGTAAAT aaauguuL96 fuUfucccas GTG uSC AD- asgscauuGf 1091 asAfsaaaGf 1451 AAAGCATTGT 1811 1423026 uAfAfAfugu cAfCfauuuA AAATGTGCTT gcuuuuuL96 fcAfaugcus TTA usu AD- ascsugauGf 1092 asCfsuuuCf 1452 ATACTGATGT 1812 1423035 uUfCfCfuag aCfUfaggaA TCCTAGTGAA ugaaaguL96 fcAfucagus AGA asu AD- gsusuccuAf 1093 asCfsugcCf 1453 ATGTTCCTAG 1813 1423041 gUfGfAfaag uCfUfuucaC TGAAAGAGGC aggcaguL96 fuAfggaacs AGC asu AD- gsusgaaaGf 1094 asUfsuucAf 1454 TAGTGAAAGA 1814 1423048 aGfGfCfagc aGfCfugccU GGCAGCTTGA uugaaauL96 fcUfuucacs AAC usa AD- asgsgcagCf 1095 asAfsucuCf 1455 AGAGGCAGCT 1815 1423055 uUfGfAfaac aGfUfuucaA TGAAACTGAG ugagauuL96 fgCfugccus ATG csu AD- asasacugAf 1096 asAfsuguGf 1456 TGAAACTGAG 1816 1423065 gAfUfGfuga uUfCfacauC ATGTGAACAC acacauuL96 fuCfaguuus ATC csa AD- asgsauguGf 1097 asAfsagcUf 1457 TGAGATGTGA 1817 1423071 aAfCfAfcau gAfUfguguU ACACATCAGC cagcuuuL96 fcAfcaucus TTG csa AD- csasucagCf 1098 asUfsuuaAf 1458 CACATCAGCT 1818 1423082 uUfGfCfccu cAfGfggcaA TGCCCTGTTA guuaaauL96 fgCfugaugs AAA usg AD- csusugccCf 1099 asUfscauCf 1459 AGCTTGCCCT 1819 1423088 uGfUfUfaaa uUfUfuaacA GTTAAAAGAT agaugauL96 fgGfgcaags GAA csu AD- gsusaucaCf 1100 asCfsaagUf 1460 TTGTATCACA 1820 1423104 aAfAfUfcuu uAfAfgauuU AATCTTAACT aacuuguL96 fgUfgauacs TGA asa AD- asasaucuUf 1101 asAfscucCf 1461 ACAAATCTTA 1821 1423111 aAfCfUfuga uUfCfaaguU ACTTGAAGGA aggaguuL96 faAfgauuus GTC gsu AD- asascuugAf 1102 asUfsgcaAf 1462 TTAACTTGAA 1822 1423118 aGfGfAfguc gGfAfcuccU GGAGTCCTTG cuugcauL96 fuCfaaguus CAT asa AD- asasggagUf 1103 asAfsauuGf 1463 TGAAGGAGTC 1823 1423124 cCfUfUfgca aUfGfcaagG CTTGCATCAA ucaauuuL96 faCfuccuus TTT csa AD- uscscuugCf 1104 asAfsagaAf 1464 AGTCCTTGCA 1824 1423130 aUfCfAfauu aAfAfuugaU TCAATTTTTC uuucuuuL96 fgCfaaggas TTA csu AD- ususauuuCf 1105 asCfsacuCf 1465 TCTTATTTCA 1825 1423138 aUfUfUfcuu aAfAfgaaaU TTTCTTTGAG ugaguguL96 fgAfaauaas TGT gsa AD- asusuucuUf 1106 asAfsuuaAf 1466 TCATTTCTTT 1826 1423145 uGfAfGfugu gAfCfacucA GAGTGTCTTA cuuaauuL96 faAfgaaaus ATT gsa AD- ususgaguGf 1107 asCfsuuuUf 1467 CTTTGAGTGT 1827 1423151 uCfUfUfaau aAfUfuaagA CTTAATTAAA uaaaaguL96 fcAfcucaas AGA asg AD- gsasauauUf 1108 asCfscaaGf 1468 AAGAATATTT 1828 1423158 uUfAfAfcuu gAfAfguuaA TAACTTCCTT ccuugguL96 faAfuauucs GGA usu AD- ususuaacUf 1109 asAfsugaGf 1469 ATTTTAACTT 1829 1423164 uCfCfUfugg uCfCfaaggA CCTTGGACTC acucauuL96 faGfuuaaas ATT asu AD- ususccuuGf 1110 asUfsuuaAf 1470 ACTTCCTTGG 1830 1423170 gAfCfUfcau aAfUfgaguC ACTCATTTTA uuuaaauL96 fcAfaggaas AAA gsu AD- usasuuauUf 1111 asGfsuagAf 1471 TGTATTATTA 1831 1423184 aUfUfCfcca aUfGfggaaU TTCCCATTCT uucuacuL96 faAfuaauas ACA csa AD- asusucccAf 1112 asAfsuagUf 1472 TTATTCCCAT 1832 1423191 uUfCfUfaca aUfGfuagaA TCTACATACT uacuauuL96 fuGfggaaus ATG asa AD- csusacauAf 1113 asAfsgaaAf 1473 TTCTACATAC 1833 1423200 cUfAfUfgga uUfCfcauaG TATGGAATTT auuucuuL96 fuAfuguags CTC asa AD- usgsgaauUf 1114 asAfsaugAf 1474 TATGGAATTT 1834 1423210 uCfUfCfcca cUfGfggagA CTCCCAGTCA gucauuuL96 faAfuuccas TTT usa AD- cscscaguCf 1115 asAfscauUf 1475 CTCCCAGTCA 1835 1423220 aUfUfUfaau uAfUfuaaaU TTTAATAAAT aaauguuL96 fgAfcugggs GTG asg AD- csasuuuaAf 1116 asGfsaagGf 1476 GTCATTTAAT 1836 1423226 uAfAfAfugu cAfCfauuuA AAATGTGCCT gccuucuL96 fuUfaaaugs TCA asc

    TABLE-US-00005 TABLE 4 Single Dose In Vitro Screen in Hep3B cells DPP4/gapdh 10 nM % of message Duplex Name remaining SD AD-1423226.1 31.72 7.63 AD-1423220.1 29.27 4.82 AD-1423210.1 31.72 3.31 AD-1423200.1 36.83 5.62 AD-1423191.1 25.95 7.80 AD-1423184.1 18.55 6.00 AD-1423170.1 23.35 0.62 AD-1423164.1 26.75 7.55 AD-1423158.1 21.07 5.48 AD-1423151.1 26.35 6.85 AD-1423145.1 32.64 6.46 AD-1423138.1 31.33 3.41 AD-1423130.1 31.59 5.16 AD-1423124.1 36.64 6.13 AD-1423118.1 30.98 6.99 AD-1423111.1 31.28 5.92 AD-1423104.1 27.49 7.33 AD-1423088.1 34.77 5.77 AD-1423082.1 32.63 6.22 AD-1423071.1 26.06 9.05 AD-1423065.1 25.09 1.64 AD-1423055.1 39.90 7.74 AD-1423048.1 31.61 2.11 AD-1423041.1 40.48 1.95 AD-1423035.1 24.08 5.79 AD-1423026.1 21.50 3.22 AD-1423020.1 28.53 1.34 AD-1423014.1 30.44 6.76 AD-1423007.1 55.94 5.09 AD-1422984.1 26.58 1.29 AD-1422975.1 46.06 1.40 AD-1422965.1 41.09 1.20 AD-1422955.1 32.16 7.59 AD-1422949.1 32.08 7.10 AD-1422943.1 30.69 1.72 AD-1422934.1 31.42 9.17 AD-1422928.1 36.27 4.68 AD-1422920.1 36.17 1.67 AD-1422914.1 29.67 2.26 AD-1422908.1 30.35 3.56 AD-1422902.1 28.52 13.07 AD-1422896.1 39.46 7.19 AD-1422890.1 44.33 7.61 AD-1422882.1 41.19 8.35 AD-1422875.1 36.63 6.25 AD-1422869.1 28.47 13.18 AD-1422863.1 21.57 4.62 AD-1422857.1 28.02 5.10 AD-1422847.1 29.60 5.85 AD-1422838.1 29.57 4.99 AD-1422831.1 56.78 3.04 AD-1422827.1 63.30 7.05 AD-1422821.1 39.76 6.18 AD-1422809.1 39.55 3.10 AD-1422803.1 38.64 3.84 AD-1422797.1 78.82 10.77 AD-1422771.1 31.84 1.35 AD-1422765.1 43.35 6.12 AD-1422758.1 50.27 6.83 AD-1422752.1 26.61 1.45 AD-1422729.1 41.20 1.95 AD-1422720.1 36.03 7.18 AD-1422708.1 29.12 3.91 AD-1422701.1 82.63 6.02 AD-1422693.1 25.28 6.77 AD-1422683.1 27.98 6.78 AD-1422676.1 23.80 3.46 AD-1422667.1 45.32 7.75 AD-1422659.1 28.75 2.80 AD-1422653.1 37.23 6.23 AD-1422646.1 52.85 6.50 AD-1422640.1 43.45 1.83 AD-1422630.1 35.48 2.20 AD-1422623.1 40.08 3.43 AD-1422614.1 34.75 1.17 AD-1422605.1 39.91 4.30 AD-1422599.1 33.81 1.32 AD-1422593.1 43.14 8.35 AD-1422586.1 31.37 1.09 AD-1422581.1 27.20 0.94 AD-1422575.1 33.87 2.87 AD-1422568.1 29.13 4.95 AD-1422562.1 36.35 10.06 AD-1422555.1 23.75 5.19 AD-1422549.1 44.06 6.46 AD-1422542.1 28.37 5.26 AD-1422535.1 19.38 2.20 AD-1422526.1 22.01 2.32 AD-1422516.1 24.66 7.45 AD-1422508.1 29.11 6.12 AD-1422501.1 34.77 4.49 AD-1422495.1 33.35 2.70 AD-1422489.1 31.67 1.41 AD-1422479.1 25.42 6.08 AD-1422471.1 28.09 5.38 AD-1422465.1 39.17 9.32 AD-1422457.1 23.84 4.08 AD-1422449.1 51.53 4.60 AD-1422438.1 19.92 2.02 AD-1422429.1 24.57 8.22 AD-1422421.1 32.40 2.36 AD-1422412.1 30.15 3.24 AD-1422390.1 14.76 5.87 AD-1422383.1 15.65 2.67 AD-1422376.1 20.33 4.52 AD-1422370.1 19.73 9.11 AD-1422363.1 28.27 8.02 AD-1422357.1 12.88 3.99 AD-1422346.1 11.55 3.01 AD-1422340.1 13.94 3.97 AD-1422334.1 11.30 1.22 AD-1422322.1 14.64 2.01 AD-1422316.1 20.29 2.49 AD-1422310.1 11.77 2.05 AD-1422302.1 31.03 5.57 AD-1422295.1 17.32 4.62 AD-1422288.1 18.00 2.68 AD-1422280.1 25.96 6.06 AD-1422274.1 13.28 2.40 AD-1422267.1 13.71 3.21 AD-1422259.1 20.54 2.15 AD-1422248.1 15.71 4.65 AD-1422242.1 28.38 4.27 AD-1422234.1 15.61 3.63 AD-1422227.1 19.98 3.74 AD-1422220.1 20.33 6.27 AD-1422211.1 24.56 5.62 AD-1422205.1 15.77 3.10 AD-1422198.1 19.38 2.76 AD-1422192.1 12.65 1.56 AD-1422183.1 12.71 4.48 AD-1422176.1 13.21 1.00 AD-1422169.1 13.44 3.39 AD-1422161.1 13.30 2.25 AD-1422151.1 12.21 2.46 AD-1422145.1 26.52 4.50 AD-1422133.1 16.04 8.66 AD-1422127.1 14.04 3.83 AD-1422120.1 13.57 3.58 AD-1422114.1 13.73 2.07 AD-1422103.1 11.00 1.91 AD-1422096.1 72.66 17.01 AD-1422088.1 73.54 24.59 AD-1422081.1 69.56 11.57 AD-1422075.1 17.42 2.41 AD-1422067.1 11.99 2.64 AD-1422057.1 14.87 3.76 AD-1422021.1 25.21 3.49 AD-1422014.1 18.29 8.47 AD-1422005.1 23.11 3.78 AD-1421979.1 20.07 2.75 AD-1421968.1 14.50 1.28 AD-1421961.1 12.64 0.39 AD-1421954.1 19.38 3.50 AD-1421948.1 70.81 4.46 AD-1421925.1 13.75 2.26 AD-1421917.1 11.82 1.12 AD-1421909.1 16.21 3.14 AD-1421903.1 18.51 5.75 AD-1421897.1 12.06 0.76 AD-1421891.1 10.55 2.78 AD-1421884.1 13.87 3.75 AD-1421874.1 10.07 0.55 AD-1421865.1 9.70 2.80 AD-1421857.1 10.87 0.51 AD-1421850.1 14.24 4.79 AD-1421839.1 12.29 1.44 AD-1421830.1 33.38 3.95 AD-1421823.1 20.44 3.49 AD-1421815.1 10.07 1.88 AD-1421807.1 10.50 1.92 AD-1421800.1 9.07 1.24 AD-1421791.1 33.44 2.58 AD-1421778.1 101.20 6.26 AD-1421771.1 28.03 8.15 AD-1421765.1 15.33 2.31 AD-1421722.1 11.63 2.67 AD-1421712.1 11.35 0.62 AD-1421706.1 8.02 1.39 AD-1421697.1 9.85 5.35 AD-1421691.1 15.44 2.96 AD-1421685.1 14.77 0.73 AD-1421679.1 23.75 2.14 AD-1421672.1 21.93 2.43 AD-1421662.1 19.00 2.90 AD-1421650.1 13.58 2.04 AD-1421635.1 23.02 3.45 AD-1421629.1 39.45 11.25 AD-1421620.1 12.10 3.05 AD-1421612.1 14.64 0.82 AD-1421604.1 28.39 3.23 AD-1421596.1 93.27 8.93 AD-1421587.1 120.46 7.86 AD-1421578.1 26.40 3.70 AD-1421570.1 19.72 3.30 AD-1421563.1 37.63 11.47 AD-1421546.1 18.17 4.96 AD-1421538.1 18.32 4.89 AD-1421530.1 22.91 5.92 AD-1421521.1 22.67 4.72 AD-1421511.1 11.49 0.62 AD-1421505.1 11.36 0.79 AD-1421499.1 17.02 4.93 AD-1421490.1 51.26 13.23 AD-1421480.1 20.05 4.84 AD-1421468.1 24.89 8.78 AD-1421459.1 12.33 0.74 AD-1421451.1 8.13 2.54 AD-1421441.1 15.12 3.67 AD-1421433.1 13.02 1.12 AD-1421428.1 14.47 4.68 AD-1421414.1 60.23 2.33 AD-1421408.1 77.26 16.60 AD-1421394.1 14.24 2.01 AD-1421389.1 10.31 1.92 AD-1421383.1 11.46 3.18 AD-1421375.1 12.72 2.99 AD-1421368.1 11.71 1.20 AD-1421362.1 13.16 2.02 AD-1421356.1 76.99 16.28 AD-1421348.1 17.94 1.14 AD-1421341.1 20.71 2.33 AD-1421335.1 11.72 3.82 AD-1421327.1 18.69 5.29 AD-1421320.1 9.85 2.27 AD-1421313.1 10.12 2.58 AD-1421304.1 13.02 2.21 AD-1421294.1 76.74 14.59 AD-1421285.1 13.65 1.27 AD-1421278.1 11.40 1.86 AD-1421271.1 10.15 1.70 AD-1421265.1 23.39 1.18 AD-1421259.1 16.94 2.15 AD-1421253.1 12.84 2.57 AD-1421245.1 13.52 2.70 AD-1421237.1 13.85 2.00 AD-1421231.1 36.29 9.24 AD-1421222.1 40.69 9.45 AD-1421212.1 15.10 1.56 AD-1421206.1 40.49 16.01 AD-1421197.1 20.54 4.32 AD-1421191.1 78.18 14.40 AD-1421183.1 33.99 3.26 AD-1421177.1 20.84 5.12 AD-1421169.1 16.90 4.17 AD-1421160.1 15.92 3.67 AD-1421153.1 19.27 3.28 AD-1421147.1 19.75 9.46 AD-1421141.1 11.66 2.25 AD-1421132.1 14.46 2.93 AD-1421126.1 11.23 2.29 AD-1421120.1 15.36 4.05 AD-1421104.1 21.65 4.16 AD-1421098.1 49.65 9.10 AD-1421092.1 14.87 2.35 AD-1421086.1 89.72 8.51 AD-1421073.1 15.86 6.70 AD-1421067.1 32.97 6.33 AD-1421063.1 15.66 1.05 AD-1421055.1 14.75 5.93 AD-1421047.1 16.41 1.30 AD-1421041.1 18.91 1.87 AD-1421035.1 14.75 2.01 AD-1421028.1 12.11 0.61 AD-1421021.1 20.91 3.10 AD-1421015.1 30.93 1.66 AD-1421004.1 10.45 2.37 AD-1420998.1 21.45 2.19 AD-1420987.1 12.39 1.32 AD-1420980.1 13.05 2.23 AD-1420974.1 13.84 2.67 AD-1420954.1 24.16 3.61 AD-1420945.1 63.15 4.25 AD-1420936.1 76.25 10.41 AD-1420929.1 19.07 2.46 AD-1420921.1 15.86 2.28 AD-1420910.1 18.99 3.71 AD-1420901.1 19.16 2.86 AD-1420893.1 12.13 1.48 AD-1420887.1 12.94 1.51 AD-1420878.1 14.43 1.33 AD-1420871.1 54.59 7.92 AD-1420864.1 13.07 3.59 AD-1420861.1 38.73 6.37 AD-1420853.1 31.11 6.33 AD-1420841.1 22.36 4.10 AD-1420831.1 40.40 7.82 AD-1420824.1 26.73 6.20 AD-1420818.1 17.89 1.97 AD-1420812.1 16.19 1.52 AD-1420804.1 12.41 3.57 AD-1420797.1 18.05 3.41 AD-1420792.1 30.19 6.85 AD-1420786.1 18.71 3.01 AD-1420779.1 13.61 2.87 AD-1420773.1 18.23 5.26 AD-1420759.1 15.01 4.78 AD-1420749.1 34.39 9.85 AD-1420741.1 20.90 4.50 AD-1420734.1 123.47 7.30 AD-1420725.1 16.87 2.44 AD-1420717.1 91.62 9.65 AD-1420707.1 40.75 9.66 AD-1420698.1 25.40 7.98 AD-1420691.1 11.48 3.32 AD-1420682.1 16.21 3.85 AD-1420675.1 20.50 4.55 AD-1420668.1 13.48 1.78 AD-1420662.1 50.45 5.34 AD-1420658.1 9.89 0.91 AD-1420652.1 9.32 0.86 AD-1420646.1 15.80 1.14 AD-1420640.1 21.40 2.55 AD-1420628.1 28.23 5.24 AD-1420619.1 12.60 1.42 AD-1420611.1 18.01 3.79 AD-1420601.1 12.59 2.96 AD-1420593.1 16.84 3.47 AD-1420576.1 12.69 1.16 AD-1420569.1 17.64 1.38 AD-1420563.1 12.33 1.05 AD-1420557.1 14.90 0.86 AD-1420549.1 16.83 0.52 AD-1420543.1 16.96 0.98 AD-1420534.1 30.57 1.91 AD-1420524.1 12.37 3.58 AD-1420518.1 20.23 0.87 AD-1420511.1 13.58 0.80 AD-1420505.1 11.70 2.09 AD-1420499.1 11.39 1.13 AD-1420482.1 13.48 0.80 AD-1420475.1 10.84 0.76 AD-1420468.1 10.98 1.55 AD-1420462.1 15.97 1.70 AD-1420455.1 15.87 1.44 AD-1420446.1 17.53 1.32 AD-1420437.1 14.51 1.55 AD-1420428.1 16.87 0.83 AD-1420422.1 7.33 0.38 AD-1420412.1 13.72 1.09 AD-1420406.1 17.74 1.82 AD-1420399.1 17.05 2.77 AD-1420391.1 39.47 6.95 AD-1420385.1 38.65 4.89 AD-1420379.1 64.26 7.42 AD-1420371.1 18.14 8.24 AD-1420365.1 31.18 6.14 AD-1420344.1 18.74 2.84 AD-1420338.1 20.64 5.13 AD-1420312.1 21.11 5.23 AD-1420306.1 26.09 4.12 AD-1420300.1 65.83 12.87 AD-1420293.1 19.10 3.35 AD-1420282.1 26.70 7.82 AD-1420273.1 47.33 15.01 AD-1420264.1 29.98 6.11 AD-1420258.1 27.37 8.81 AD-1420250.1 33.47 7.33 AD-1420212.1 88.80 13.95 AD-1420199.1 83.67 10.15

    Example 3. Design, Synthesis and In Vitro Screening of Additional siRNA Duplexes

    [0786] Additional siRNAs were designed, synthesized, and prepared using methods known in the art and described above in Example 1.

    [0787] The selection of siRNA designs targeting mouse dipeptidyl-peptidase 4 (DPP4) gene (NM_010074.3) were designed using custo R and Python scripts. The mouse NM_010074.3 REFSEQ mRNA has a length of 5268 bases.

    [0788] A detailed list of the additional unmodified DPP4 sense and antisense strand nucleotide sequences is shown in Table 5. A detailed list of the modified DPP4 sense and antisense strand nucleotide sequences is shown in Table 6.

    [0789] For transfections, cells (ATCC, Manassas, VA) were grown to near confluence at 37 C. in an atmosphere of 5% CO.sub.2 in Eagle's Minimum Essential Medium (Gibco) supplemented with 10% FBS (ATCC) before being released from the plate by trypsinization. Transfection was carried out by adding 7.5 l of Opti-MEM plus 0.1 l of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad CA. cat #13778-150) to 2.5 l of each siRNA duplex to an individual well in a 384-well plate. The mixture was then incubated at room temperature for 15 minutes. Forty l of complete growth media without antibiotic containing 1.510.sup.4 cells were then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification. Single dose experiments were performed at 50, nM, 10 nM, 1 nM, and 0.1 nM final duplex concentration. Single dose experiments were also performed at 10 nM, 1.666667 nM, 0.277778 nM, 0.046296 nM, 0.007716 nM, 0.001286 nM, 0.000214 nM, 3.57E-05 nM, 5.95E-06 nM, or 9.92E-07 nM.

    [0790] Total RNA isolation was performed using DYNABEADS. Briefly, cells were lysed in 10 l of Lysis/Binding Buffer containing 3 L of beads per well and mixed for 10 minutes on an electrostatic shaker. The washing steps were automated on a Biotek EL406, using a magnetic plate support. Beads were washed (in 3 L) once in Buffer A, once in Buffer B, and twice in Buffer E, with aspiration steps in between. Following a final aspiration, complete 12 L RT mixture was added to each well, as described below.

    [0791] For cDNA synthesis, a master mix of 1.5 l 10 Buffer, 0.6 l 10dNTPs, 1.5 l Random primers, 0.75 l Reverse Transcriptase, 0.75 l RNase inhibitor and 9.9 l of H.sub.2O per reaction were added per well. Plates were sealed, agitated for 10 minutes on an electrostatic shaker, and then incubated at 37 degrees C. for 2 hours. Following this, the plates were agitated at 80 degrees C. for 8 minutes.

    [0792] RT-qPCR was performed as described above and relative fold change was calculated as described above.

    [0793] The results of the transfection assays of the dsRNA agents listed in Tables 5 and 6 in primary mouse hepatocytes at 50 nM, 10 nM, 1 nM, or 0.1 nM are shown in Table 7. The results of the transfection assays of selected dsRNA agents listed in Tables 5 and 6 in primary cynomolgus hepatocytes at at 10 nM, 1.666667 nM, 0.277778 nM nM, 0.046296 nM, 0.007716 nM, 0.001286 nM, 0.000214 nM, 3.57E-05 nM, 5.95E-06 nM, or 9.92E-07 nM are shown in Table 8A and the ICsos are shown in Table 8B.

    TABLE-US-00006 TABLE5 UnmodifiedSenseandAntisenseStrandDPP4dsRNASequences SEQ Rangein AntisenseSequence SEQ Rangein SenseSequence ID NM_ ID NM_ DuplexName 5to3 NO: 010074.3 5to3 NO: 010074.3 AD-1285425.1 AAUGUGCAAUGUCUCUUUUAA 1837 140-160 UUAAAAGAGACAUUGCACAUUGA 1882 138-160 AD-1285427.1 UGUGCAAUGUCUCUUUUAGCA 1838 142-162 UGCUAAAAGAGACAUUGCACAUU 1883 140-162 AD-1285429.1 UGCAAUGUCUCUUUUAGCAAA 1839 144-164 UUUGCUAAAAGAGACAUUGCACA 1884 142-164 AD-1286251.1 CUCCAAACAACACGUUUCUAA 1840 1072-1092 UUAGAAACGUGUUGUUUGGAGAC 1885 1070-1092 AD-1286252.1 UCCAAACAACACGUUUCUAGA 1841 1073-1093 UCUAGAAACGUGUUGUUUGGAGA 1886 1071-1093 AD-1286365.1 GUGAAUCCAACUGUAAAGUUA 1842 1206-1226 UAACUUUACAGUUGGAUUCACAG 1887 1204-1226 AD-1286369.1 AUCCAACUGUAAAGUUCUUUA 1843 1210-1230 UAAAGAACUUUACAGUUGGAUUC 1888 1208-1230 AD-1286370.1 UCCAACUGUAAAGUUCUUUAA 1844 1211-1231 UUAAAGAACUUUACAGUUGGAUU 1889 1209-1231 AD-1286371.1 CCAACUGUAAAGUUCUUUAUA 1845 1212-1232 UAUAAAGAACUUUACAGUUGGAU 1890 1210-1232 AD-1286372.1 CAACUGUAAAGUUCUUUAUUA 1846 1213-1233 UAAUAAAGAACUUUACAGUUGGA 1891 1211-1233 AD-1286373.1 AACUGUAAAGUUCUUUAUUGA 1847 1214-1234 UCAAUAAAGAACUUUACAGUUGG 1892 1212-1234 AD-1286829.1 GAGGAAGAAAUCUCUAUAAAA 1848 1702-1722 UUUUAUAGAGAUUUCUUCCUCCU 1893 1700-1722 AD-1287272.1 GGAAGUUGAAGAUCAAAUUGA 1849 2225-2245 UCAAUUUGAUCUUCAACUUCCAG 1894 2223-2245 AD-1287273.1 GAAGUUGAAGAUCAAAUUGAA 1850 2226-2246 UUCAAUUUGAUCUUCAACUUCCA 1895 2224-2246 AD-1287274.1 AAGUUGAAGAUCAAAUUGAAA 1851 2227-2247 UUUCAAUUUGAUCUUCAACUUCC 1896 2225-2247 AD-1287780.1 AAGACCACAUUUGUUCUCAUA 1852 2751-2771 UAUGAGAACAAAUGUGGUCUUAA 1897 2749-2771 AD-1287791.1 UGUUCUCAUUAUCUCAAAAGA 1853 2762-2782 UCUUUUGAGAUAAUGAGAACAAA 1898 2760-2782 AD-1287792.1 GUUCUCAUUAUCUCAAAAGUA 1854 2763-2783 UACUUUUGAGAUAAUGAGAACAA 1899 2761-2783 AD-1287793.1 UUCUCAUUAUCUCAAAAGUGA 1855 2764-2784 UCACUUUUGAGAUAAUGAGAACA 1900 2762-2784 AD-1287861.1 CUGCUUUCUCCAGUUUUACAA 1856 2832-2852 UUGUAAAACUGGAGAAAGCAGCC 1901 2830-2852 AD-1287908.1 UUAGAGCAAUUUGGAUUUUCA 1857 2899-2919 UGAAAAUCCAAAUUGCUCUAAGG 1902 2897-2919 AD-1288171.1 UUCUGAGAAAGACUAUUCAAA 1858 3234-3254 UUUGAAUAGUCUUUCUCAGAAAA 1903 3232-3254 AD-1288585.1 UUAUGUCUUGAAUCAAACUUA 1859 3719-3739 UAAGUUUGAUUCAAGACAUAACC 1904 3717-3739 AD-1288623.1 GACACAUUUGUUCAAAGGUUA 1860 3757-3777 UAACCUUUGAACAAAUGUGUCCA 1905 3755-3777 AD-1288630.1 UUGUUCAAAGGUUCUUGUUUA 1861 3764-3784 UAAACAAGAACCUUUGAACAAAU 1906 3762-3784 AD-1288631.1 UGUUCAAAGGUUCUUGUUUAA 1862 3765-3785 UUAAACAAGAACCUUUGAACAAA 1907 3763-3785 AD-1288632.1 GUUCAAAGGUUCUUGUUUAAA 1863 3766-3786 UUUAAACAAGAACCUUUGAACAA 1908 3764-3786 AD-1288634.1 UCAAAGGUUCUUGUUUAACUA 1864 3768-3788 UAGUUAAACAAGAACCUUUGAAC 1909 3766-3788 AD-1288639.1 GGUUCUUGUUUAACUUGUUAA 1865 3773-3793 UUAACAAGUUAAACAAGAACCUU 1910 3771-3793 AD-1288640.1 GUUCUUGUUUAACUUGUUAGA 1866 3774-3794 UCUAACAAGUUAAACAAGAACCU 1911 3772-3794 AD-1288641.1 UUCUUGUUUAACUUGUUAGAA 1867 3775-3795 UUCUAACAAGUUAAACAAGAACC 1912 3773-3795 AD-1288726.1 GCUUUGGAGAAAUCAAUUAAA 1868 3937-3957 UUUAAUUGAUUUCUCCAAAGCUA 1913 3935-3957 AD-1288727.1 CUUUGGAGAAAUCAAUUAACA 1869 3938-3958 UGUUAAUUGAUUUCUCCAAAGCU 1914 3936-3958 AD-1288728.1 UUUGGAGAAAUCAAUUAACAA 1870 3939-3959 UUGUUAAUUGAUUUCUCCAAAGC 1915 3937-3959 AD-1288729.1 UUGGAGAAAUCAAUUAACAAA 1871 3940-3960 UUUGUUAAUUGAUUUCUCCAAAG 1916 3938-3960 AD-1288823.1 CCAGGGUUUUCUGUAUUGUUA 1872 4078-4098 UAACAAUACAGAAAACCCUGGAA 1917 4076-4098 AD-1288824.1 CAGGGUUUUCUGUAUUGUUUA 1873 4079-4099 UAAACAAUACAGAAAACCCUGGA 1918 4077-4099 AD-1288880.1 UAGCAAUGUUUGGAUAACUUA 1874 4167-4187 UAAGUUAUCCAAACAUUGCUAAG 1919 4165-4187 AD-1288938.1 AAUGGACUUCACACAUUUAAA 1875 4238-4258 UUUAAAUGUGUGAAGUCCAUUUU 1920 4236-4258 AD-1288939.1 AUGGACUUCACACAUUUAAAA 1876 4239-4259 UUUUAAAUGUGUGAAGUCCAUUU 1921 4237-4259 AD-1289328.1 UGUGUUCCUUUUGUUUCUAAA 1877 4723-4743 UUUAGAAACAAAAGGAACACAAA 1922 4721-4743 AD-1289466.1 CGUAAGAGUUGUGAAUUAGAA 1878 4875-4895 UUCUAAUUCACAACUCUUACGGA 1923 4873-4895 AD-1289513.1 UGAACUCAAGAGUAAGUUUGA 1879 4922-4942 UCAAACUUACUCUUGAGUUCACU 1924 4920-4942 AD-1289514.1 GAACUCAAGAGUAAGUUUGAA 1880 4923-4943 UUCAAACUUACUCUUGAGUUCAC 1925 4921-4943 AD-1289516.1 ACUCAAGAGUAAGUUUGAAAA 1881 4925-4945 UUUUCAAACUUACUCUUGAGUUC 1926 4923-4945

    TABLE-US-00007 TABLE6 ModifiedSenseandAntisenseStrandDPP4dsRNASequences SEQ Antisense SEQ mRNAtarget SEQ Duplex SenseSequence ID Sequence ID sequence ID Name 5to3 NO: 5to3 NO: 5to3 NO: AD- asasugugCfaAfUf 1927 VPusUfsaaaAfgAf 1972 UCAAUGUGCAAUGUC 2017 1285425.1 GfucucuuuuaaL96 GfacauUfgCfacau UCUUUUAG usgsa AD- usgsugcaAfuGfUf 1928 VPusGfscuaAfaAf 1973 AAUGUGCAAUGUCUC 2018 1285427.1 CfucuuuuagcaL96 GfagacAfuUfgcac UUUUAGCA asusu AD- usgscaauGfuCfUf 1929 VPusUfsugcUfaAf 1974 UGUGCAAUGUCUCUU 2019 1285429.1 CfuuuuagcaaaL96 AfagagAfcAfuugc UUAGCAAA ascsa AD- csusccaaAfcAfAf 1930 VPusUfsagaAfaCf 1975 GUCUCCAAACAACAC 2020 1286251.1 CfacguuucuaaL96 GfuguuGfuUfugga GUUUCUAG gsasc AD- uscscaaaCfaAfCf 1931 VPusCfsuagAfaAf 1976 UCUCCAAACAACACG 2021 1286252.1 AfcguuucuagaL96 CfguguUfgUfuugg UUUCUAGC asgsa AD- gsusgaauCfcAfAf 1932 VPusAfsacuUfuAf 1977 CUGUGAAUCCAACUG 2022 1286365.1 CfuguaaaguuaL96 CfaguuGfgAfuuca UAAAGUUC csasg AD- asusccaaCfuGfUf 1933 VPusAfsaagAfaCf 1978 GAAUCCAACUGUAAA 2023 1286369.1 AfaaguucuuuaL96 UfuuacAfgUfugga GUUCUUUA ususc AD- uscscaacUfgUfAf 1934 VPusUfsaaaGfaAf 1979 AAUCCAACUGUAAAG 2024 1286370.1 AfaguucuuuaaL96 CfuuuaCfaGfuugg UUCUUUAU asusu AD- cscsaacuGfuAfAf 1935 VPusAfsuaaAfgAf 1980 AUCCAACUGUAAAGU 2025 1286371.1 AfguucuuuauaL96 AfcuuuAfcAfguug UCUUUAUU gsasu AD- csasacugUfaAfAf 1936 VPusAfsauaAfaGf 1981 UCCAACUGUAAAGUU 2026 1286372.1 GfuucuuuauuaL96 AfacuuUfaCfaguu CUUUAUUG gsgsa AD- asascuguAfaAfGf 1937 VPusCfsaauAfaAf 1982 CCAACUGUAAAGUUC 2027 1286373.1 UfucuuuauugaL96 GfaacuUfuAfcagu UUUAUUGU usgsg AD- gsasggaaGfaAfAf 1938 VPusUfsuuaUfaGf 1983 AGGAGGAAGAAAUCU 2028 1286829.1 UfcucuauaaaaL96 AfgauuUfcUfuccu CUAUAAAA cscsu AD- gsgsaaguUfgAfAf 1939 VPusCfsaauUfuGf 1984 CUGGAAGUUGAAGAU 2029 1287272.1 GfaucaaauugaL96 AfucuuCfaAfcuuc CAAAUUGA csasg AD- gsasaguuGfaAfGf 1940 VPusUfscaaUfuUf 1985 UGGAAGUUGAAGAUC 2030 1287273.1 AfucaaauugaaL96 GfaucuUfcAfacuu AAAUUGAA cscsa AD- asasguugAfaGfAf 1941 VPusUfsucaAfuUf 1986 GGAAGUUGAAGAUCA 2031 1287274.1 UfcaaauugaaaL96 UfgaucUfuCfaacu AAUUGAAG uscsc AD- asasgaccAfcAfUf 1942 VPusAfsugaGfaAf 1987 UUAAGACCACAUUUG 2032 1287780.1 UfuguucucauaL96 CfaaauGfuGfgucu UUCUCAUU usasa AD- usgsuucuCfaUfUf 1943 VPusCfsuuuUfgAf 1988 UUUGUUCUCAUUAUC 2033 1287791.1 AfucucaaaagaL96 GfauaaUfgAfgaac UCAAAAGU asasa AD- gsusucucAfuUfAf 1944 VPusAfscuuUfuGf 1989 UUGUUCUCAUUAUCU 2034 1287792.1 UfcucaaaaguaL96 AfgauaAfuGfagaa CAAAAGUG csasa AD- ususcucaUfuAfUf 1945 VPusCfsacuUfuUf 1990 UGUUCUCAUUAUCUC 2035 1287793.1 CfucaaaagugaL96 GfagauAfaUfgaga AAAAGUGC ascsa AD- csusgcuuUfcUfCf 1946 VPusUfsguaAfaAf 1991 GGCUGCUUUCUCCAG 2036 1287861.1 CfaguuuuacaaL96 CfuggaGfaAfagca UUUUACAC gscsc AD- ususagagCfaAfUf 1947 VPusGfsaaaAfuCf 1992 CCUUAGAGCAAUUUG 2037 1287908.1 UfuggauuuucaL96 CfaaauUfgCfucua GAUUUUCC asgsg AD- ususcugaGfaAfAf 1948 VPusUfsugaAfuAf 1993 UUUUCUGAGAAAGAC 2038 1288171.1 GfacuauucaaaL96 GfucuuUfcUfcaga UAUUCAAA asasa AD- ususauguCfuUfGf 1949 VPusAfsaguUfuGf 1994 GGUUAUGUCUUGAAU 2039 1288585.1 AfaucaaacuuaL96 AfuucaAfgAfcaua CAAACUUA ascsc AD- gsascacaUfuUfGf 1950 VPusAfsaccUfuUf 1995 UGGACACAUUUGUUC 2040 1288623.1 UfucaaagguuaL96 GfaacaAfaUfgugu AAAGGUUC cscsa AD- ususguucAfaAfGf 1951 VPusAfsaacAfaGf 1996 AUUUGUUCAAAGGUU 2041 1288630.1 GfuucuuguuuaL96 AfaccuUfuGfaaca CUUGUUUA asasu AD- usgsuucaAfaGfGf 1952 VPusUfsaaaCfaAf 1997 UUUGUUCAAAGGUUC 2042 1288631.1 UfucuuguuuaaL96 GfaaccUfuUfgaac UUGUUUAA asasa AD- gsusucaaAfgGfUf 1953 VPusUfsuaaAfcAf 1998 UUGUUCAAAGGUUCU 2043 1288632.1 UfcuuguuuaaaL96 AfgaacCfuUfugaa UGUUUAAC csasa AD- uscsaaagGfuUfCf 1954 VPusAfsguuAfaAf 1999 GUUCAAAGGUUCUUG 2044 1288634.1 UfuguuuaacuaL96 CfaagaAfcCfuuug UUUAACUU asasc AD- gsgsuucuUfgUfUf 1955 VPusUfsaacAfaGf 2000 AAGGUUCUUGUUUAA 2045 1288639.1 UfaacuuguuaaL96 UfuaaaCfaAfgaac CUUGUUAG csusu AD- gsusucuuGfuUfUf 1956 VPusCfsuaaCfaAf 2001 AGGUUCUUGUUUAAC 2046 1288640.1 AfacuuguuagaL96 GfuuaaAfcAfagaa UUGUUAGA cscsu AD- ususcuugUfuUfAf 1957 VPusUfscuaAfcAf 2002 GGUUCUUGUUUAACU 2047 1288641.1 AfcuuguuagaaL96 AfguuaAfaCfaaga UGUUAGAC ascsc AD- gscsuuugGfaGfAf 1958 VPusUfsuaaUfuGf 2003 UAGCUUUGGAGAAAU 2048 1288726.1 AfaucaauuaaaL96 AfuuucUfcCfaaag CAAUUAAC csusa AD- csusuuggAfgAfAf 1959 VPusGfsuuaAfuUf 2004 AGCUUUGGAGAAAUC 2049 1288727.1 AfucaauuaacaL96 GfauuuCfuCfcaaa AAUUAACA gscsu AD- ususuggaGfaAfAf 1960 VPusUfsguuAfaUf 2005 GCUUUGGAGAAAUCA 2050 1288728.1 UfcaauuaacaaL96 UfgauuUfcUfccaa AUUAACAA asgsc AD- ususggagAfaAfUf 1961 VPusUfsuguUfaAf 2006 CUUUGGAGAAAUCAA 2051 1288729.1 CfaauuaacaaaL96 UfugauUfuCfucca UUAACAAU asasg AD- cscsagggUfuUfUf 1962 VPusAfsacaAfuAf 2007 UUCCAGGGUUUUCUG 2052 1288823.1 CfuguauuguuaL96 CfagaaAfaCfccug UAUUGUUU gsasa AD- csasggguUfuUfCf 1963 VPusAfsaacAfaUf 2008 UCCAGGGUUUUCUGU 2053 1288824.1 UfguauuguuuaL96 AfcagaAfaAfcccu AUUGUUUU gsgsa AD- usasgcaaUfgUfUf 1964 VPusAfsaguUfaUf 2009 CUUAGCAAUGUUUGG 2054 1288880.1 UfggauaacuuaL96 CfcaaaCfaUfugcu AUAACUUA asasg AD- asasuggaCfuUfCf 1965 VPusUfsuaaAfuGf 2010 AAAAUGGACUUCACA 2055 1288938.1 AfcacauuuaaaL96 UfgugaAfgUfccau CAUUUAAA ususu AD- asusggacUfuCfAf 1966 VPusUfsuuaAfaUf 2011 AAAUGGACUUCACAC 2056 1288939.1 CfacauuuaaaaL96 GfugugAfaGfucca AUUUAAAU ususu AD- usgsuguuCfcUfUf 1967 VPusUfsuagAfaAf 2012 UUUGUGUUCCUUUUG 2057 1289328.1 UfuguuucuaaaL96 CfaaaaGfgAfacac UUUCUAAA asasa AD- csgsuaagAfgUfUf 1968 VPusUfscuaAfuUf 2013 UCCGUAAGAGUUGUG 2058 1289466.1 GfugaauuagaaL96 CfacaaCfuCfuuac AAUUAGAU gsgsa AD- usgsaacuCfaAfGf 1969 VPusCfsaaaCfuUf 2014 AGUGAACUCAAGAGU 2059 1289513.1 AfguaaguuugaL96 AfcucuUfgAfguuc AAGUUUGA ascsu AD- gsasacucAfaGfAf 1970 VPusUfscaaAfcUf 2015 GUGAACUCAAGAGUA 2060 1289514.1 GfuaaguuugaaL96 UfacucUfuGfaguu AGUUUGAA csasc AD- ascsucaaGfaGfUf 1971 VPusUfsuucAfaAf 2016 GAACUCAAGAGUAAG 2061 1289516.1 AfaguuugaaaaL96 CfuuacUfcUfugag UUUGAAAA ususc

    TABLE-US-00008 TABLE 7 DPP4 Single Dose Screen in Primary Mouse Hepatocytes % Remaining Mouse mRNA Compared to Control Duplex Name 50 nM SD 10 nM SD 1 nM SD 0.1 nM SD AD-1285425.1 57 5 112 23 114 14 108 29 AD-1285427.1 59 18 76 27 150 45 100 28 AD-1285429.1 36 4 71 8 122 24 158 38 AD-1286251.1 5 6 2 1 17 16 12 3 AD-1286252.1 2 1 2 0 7 6 11 3 AD-1286365.1 2 2 3 1 43 19 24 10 AD-1286369.1 0 0 1 0 4 3 6 2 AD-1286370.1 1 0 2 1 12 5 6 2 AD-1286371.1 6 8 2 0 26 10 14 8 AD-1286372.1 2 1 1 0 15 5 4 2 AD-1286373.1 2 1 2 0 6 4 5 2 AD-1286829.1 4 6 2 0 17 13 20 6 AD-1287272.1 4 5 3 1 12 4 12 5 AD-1287273.1 1 0 1 0 4 1 4 2 AD-1287274.1 2 1 2 2 10 4 8 5 AD-1287780.1 1 1 2 1 5 4 4 1 AD-1287791.1 1 1 1 0 9 5 7 7 AD-1287792.1 2 0 2 0 2 1 6 1 AD-1287793.1 2 1 2 0 18 9 8 5 AD-1287861.1 2 2 2 1 9 9 5 1 AD-1287908.1 1 0 1 0 14 5 40 14 AD-1288171.1 2 0 2 1 3 1 7 3 AD-1288585.1 24 9 54 30 86 30 152 23 AD-1288623.1 47 13 93 38 74 12 175 18 AD-1288630.1 52 7 68 11 63 23 117 24 AD-1288631.1 51 24 36 7 87 27 87 10 AD-1288632.1 50 16 43 11 114 17 81 3 AD-1288634.1 39 7 54 16 123 56 109 41 AD-1288639.1 54 7 45 10 100 26 102 34 AD-1288640.1 45 12 33 7 130 12 114 56 AD-1288641.1 54 24 62 7 115 58 103 27 AD-1288726.1 43 16 57 7 100 19 136 29 AD-1288727.1 37 50 15 NA 169 27 AD-1288728.1 37 10 73 14 112 16 114 17 AD-1288729.1 49 8 83 17 92 40 81 8 AD-1288823.1 55 22 59 13 118 38 176 21 AD-1288824.1 66 13 59 20 140 10 146 73 AD-1288880.1 71 41 62 34 96 13 183 42 AD-1288938.1 51 10 81 39 133 23 153 39 AD-1288939.1 96 24 64 21 87 37 144 57 AD-1289328.1 42 13 53 12 93 36 120 32 AD-1289466.1 92 30 79 12 63 22 107 26 AD-1289513.1 88 5 115 45 111 36 124 57 AD-1289514.1 40 10 54 13 102 48 132 37 AD-1289516.1 47 12 59 10 80 31 125 29

    TABLE-US-00009 TABLE 8A DPP4 Single Dose Screen in Primary Cynomolgus Hepatocytes Duplex Concentration (nM) 10 1.666667 0.277778 0.046296 0.007716 0.001286 0.000214 3.57E05 5.95E06 9.92E07 % Avg of Message Remaining AD-1286365 15.73 32.24 42.20 51.38 55.75 60.90 96.16 74.89 101.45 70.26 AD-1286369 15.56 25.63 39.76 53.85 55.06 81.69 104.30 84.26 98.91 97.47 AD-1287272 25.50 41.74 48.47 62.14 66.06 62.67 115.98 105.80 121.67 109.57 AD-1287273 12.39 20.85 32.02 50.28 60.68 65.91 108.53 99.58 120.09 123.97 AD-1287274 14.67 17.05 39.46 63.19 61.59 57.47 107.93 89.75 117.02 101.72 AD-1288171 19.72 26.81 55.29 75.81 62.09 72.33 121.55 109.99 111.68 109.80 STDEV AD-1286365 4.17 2.42 6.71 5.13 15.65 12.10 9.75 3.90 10.23 14.88 AD-1286369 4.11 3.70 9.15 6.85 3.74 10.92 16.40 12.47 13.96 15.68 AD-1287272 12.06 9.68 6.24 5.91 6.59 9.12 15.77 19.96 13.08 40.32 AD-1287273 3.27 7.22 13.07 4.40 8.45 7.34 11.68 13.55 8.34 28.02 AD-1287274 5.70 2.27 5.19 11.04 5.53 7.39 24.09 18.91 15.50 30.64 AD-1288171 9.37 9.25 8.38 17.12 12.72 3.53 6.99 8.94 8.08 26.65

    TABLE-US-00010 TABLE 8B DPP4 Single Dose Screen in Primary Cynomolgus Hepatocytes IC50 Duplex ID (nM) AD-1286365 0.031 AD-1286369 0.042 AD-1287272 0.105 AD-1287273 0.022 AD-1287274 0.034 AD-1288171 0.15

    Example 4. In Vivo Screening of dsRNA Duplexes in Mice

    [0794] Selected duplexes of interest, identified from the above in vitro studies, were evaluated in vivo.

    [0795] In particular, at day 1, groups of three mice were subcutaneously administered a single 10 mg/kg dose of the agents of interest or PBS control. Table 9 provides the duplexes of interest. At day 16 post-dose animals were sacrificed, liver and serum samples were collected, mRNA was extracted and analyzed by the RT-QPCR method.

    [0796] Mouse DPP4 mRNA levels were measured. The values were normalized to the average of PBS vehicle control group. The data were expressed as percent of baseline value, and presented as mean plus standard deviation. As shown in FIG. 1, these duplexes effectively reduced the level of the mouse DPP4 messenger RNA in vivo.

    TABLE-US-00011 TABLE 9 Duplexes of Interest DuplexID Range in NM_010074.3 AD-1286365.1 1204-1226 AD-1286369.1 1208-1230 AD-1286370.1 1209-1231 AD-1286371.1 1210-1232 AD-1286372.1 1211-1233 AD-1286373.1 1212-1234 AD-1286829.1 1700-1722 AD-1287272.1 2223-2245 AD-1287273.1 2224-2246 AD-1287274.1 2225-2247 AD-1288171.1 3232-3254

    [0797] Duplexes AD-1287273 and AD-1286372 were selected for further evaluated in vivo and the effect of DPP4 knockdown on insulin sensitivity and insulin tolerance were investigated.

    [0798] In one set of analyses, the effect of AD-1287273 on insulin sensitivity was determined by administering a single 10 mg/kg dose of AD-1287273 once every two weeks for six weeks or PBS to high fat diet-fed mice (n=6 per group). At the end of the study, 3 mice in each group were injected with vehicle and 3 mice were injected with insulin. Mice were euthanized 5 mins after treatment with insulin or vehicle. As shown in FIG. 2, insulin stimulated a greater extent of phosphorylated AKT in the liver of mice with DPP4 knockdown, indicating that knockdown of DPP4 in the liver improves insulin sensitivity.

    [0799] In another set of analyses, the effect of AD-1286372 on insulin tolerance was determined by administering a single 10 mg/kg dose of AD-1286372 once every two weeks for eight weeks or PBS to high fat diet-fed mice (n=6 per group). In addition, mice (n=6) fed a regular chow diet (not high fat) were administered PBS once every two weeks for eight weeks. At the end of the study, an insulin tolerance test was performed by injection 0.75 U/kg of insulin and the blood glucose levels were determined at 10, 30, 60, 90, and 120 minutes after insulin injection. As depicted in FIG. 3, the mice fed a high fat diets and administered AD-1287272 had glycemia similar to lean mice (mice fed a regular chow diet). These results demonstrate that chronic knockdown of DPP4 in the liver improved insulin sensitivity and improved glycemia in insulin tolerance testing.

    [0800] The effect of AD-1286372 knockdown on circulating DPP4 protein level was also determined. Mice were administered a single 10 mg/kg dose of AD-1286372 once every two weeks for eight weeks or PBS to high fat diet-fed mice (n=6 per group). In addition, mice (n=6) fed a regular chow diet (not high fat) were administered PBS once every two weeks for eight weeks. At the end of the study, mice were sacrificed and circulating DPP4 protein levels were determined by a DPP4 enzymatic assay. As shown in FIG. 4, the increased circulating DPP4 level in obese mice can be attenuated by liver-specific knockdown of DPP4. These results demonstrated that knockdown of DPP4 in the liver was sufficient to reduce circulating DPP4.

    EQUIVALENTS

    [0801] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the following claims.