RECOMBINANT STRAIN WITH MODIFIED GENE BBD29_11265 FOR PRODUCING L-GLUTAMIC ACID, AND METHOD FOR CONSTRUCTING THE SAME AND USE THEREOF
20240067999 ยท 2024-02-29
Assignee
Inventors
- Aiying WEI (Ningxia, CN)
- Gang Meng (Ningxia, CN)
- Chunguang ZHAO (Ningxia, CN)
- Huiping Jia (Ningxia, CN)
- Houbo SU (Ningxia, CN)
- Lipeng YANG (Ningxia, CN)
- Xiaowei GUO (Ningxia, CN)
- Bin TIAN (Ningxia, CN)
- Fengyong Ma (Ningxia, CN)
- Xiaoqun ZHOU (Ningxia, CN)
Cpc classification
International classification
Abstract
A recombinant strain with modified gene BBD29_11265 and a method for constructing the same are provided. The recombinant strain is a bacterium that generates L-glutamic acid, and has an improved expression of a polynucleotide encoding an amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof; the improved expression can be having a point mutation in, and an enhanced expression of the polynucleotide encoding an amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof. A genetically engineered bacterium in which the base at position 70 in the BBD29_112665 gene sequence is mutated to adenine from guanine, causing alanine at position 24 in the coded corresponding amino acid sequence to be substituted with threonine, and an engineered bacterium overexpressing the BBD29_112665 gene or BBD29_11265.sup.G70A gene are constructed in the present invention, facilitating an increase in the production and conversion rate of L-glutamic acid.
Claims
1. A bacterium for generating L-glutamic acid, having an improved expression of a polynucleotide encoding an amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof; preferably, the improved expression is an enhanced expression of the polynucleotide encoding an amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof, or having a point mutation in the polynucleotide encoding an amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof, or having a point mutation in, and an enhanced expression of the polynucleotide encoding an amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof.
2. The bacterium of claim 1, wherein a point mutation to the polynucleotide encoding an amino acid sequence of SEQ ID NO: 3 such that alanine at position 24 in the amino acid sequence of SEQ ID NO: 3 is substituted with a different amino acid; preferably, alanine at position 24 is substituted with threonine.
3. The bacterium of claim 1, wherein the polynucleotide encoding an amino acid sequence of SEQ ID NO: 3 comprises a nucleotide sequence of SEQ ID NO: 1.
4. The bacterium of claim 1, wherein the polynucleotide sequence having a point mutation is formed from a mutation to the base at position 70 of a polynucleotide sequence set forth in SEQ ID NO: 1; preferably, the mutation comprises a mutation of the base at position 70 of a polynucleotide sequence set forth in SEQ ID NO: 1 from guanine (G) to adenine (A); preferably, the polynucleotide sequence having a point mutation comprises a polynucleotide sequence set forth in SEQ ID NO: 2.
5. The bacterium of claim 1, wherein the bacterium is a bacterium of the genus Corynebacterium, preferably, Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum, Corynebacterium callunae, Corynebacterium glutamicum, Brevibacterium flavum, Brevibacterium lactofermentum, Corynebacterium ammoniagenes, Corynebacterium pekinense, Brevibacterium saccharolyticum, Brevibacterium roseum, and Brevibacterium thiogenitalis; more preferably, Corynebacterium glutamicum CGMCC No. 21220 or ATCC 13869.
6-9. (canceled)
10. A method for producing L-glutamic acid, the method comprising: culturing the bacterium of claim 1 and recovering L-glutamic acid from the culture.
11. A protein, wherein the protein is any one of: A1) a protein whose amino acid sequence is SEQ ID NO: 4; A2) a protein having 80% or more identity to and the same function as the protein indicated in A1), as obtained by subjecting the amino acid sequence set forth in SEQ ID NO: 4 to substitution and/or deletion and/or addition of amino acid residues; A3) a fusion protein having the same function, as obtained by linking a tag to the N-terminus and/or C-terminus of A1) or A2).
12. A nucleic acid molecule, wherein the nucleic acid molecule is any one of: B1) a nucleic acid molecule encoding the protein of claim 11; B2) a DNA molecule whose coding sequence is set forth in SEQ ID NO: 2; B3) a DNA molecule whose nucleotide sequence is set forth in SEQ ID NO: 2; or B4) a polynucleotide sequence comprising a polynucleotide encoding an amino acid sequence set forth in SEQ ID NO: 3, wherein alanine at position 24 is substituted with a different amino acid; preferably, alanine at position 24 is substituted with threonine; preferably, the polynucleotide sequence comprises a polynucleotide encoding an amino acid sequence set forth in SEQ ID NO: 4; preferably, the polynucleotide sequence is formed from a mutation to the base at position 70 of a polynucleotide sequence set forth in SEQ ID NO: 1; preferably, the mutation is a mutation of the base at position 70 of the polynucleotide sequence set forth in SEQ ID NO: 1 from guanine (G) to adenine (A); preferably, the polynucleotide sequence comprises a polynucleotide sequence set forth in SEQ ID NO: 2.
13. A biomaterial, wherein the biomaterial is any one of: C1) an expression cassette comprising the nucleic acid molecule of claim 12; C2) a recombinant vector comprising the nucleic acid molecule of claim 12, or a recombinant vector comprising the expression cassette of C1); C3) a recombinant microorganism comprising the nucleic acid molecule of claim 12, or a recombinant microorganism comprising the expression cassette of C1), or a recombinant microorganism comprising the recombinant vector of C2).
14. (canceled)
15. A method for increasing the production of L-glutamic acid in a microorganism, wherein the method comprises any one of: E1) increasing the expression amount, or content of the nucleic acid molecule of claim 12 in a target microorganism to provide a microorganism having a greater production of L-glutamic acid than the target microorganism; E2) increasing the expression amount, or content of the DNA molecule in a target microorganism to provide a microorganism having a greater production of L-glutamic acid than the target microorganism, wherein the DNA molecule is a DNA molecule whose nucleotide sequence is SEQ ID NO: 1; or the DNA molecule is a DNA molecule having 90% or more identity to and the same function as the DNA molecule set forth in SEQ ID NO: 1, as obtained by subjecting the nucleotide sequence set forth in SEQ ID NO: 1 to modification, and/or substitution and/or deletion and/or addition of one or several nucleotides; E3) performing a mutation on the DNA molecule whose nucleotide sequence is SEQ ID NO: 1 in the target microorganism to provide a microorganism having a greater production of L-glutamic acid than the target microorganism.
16. The method of claim 15, wherein the mutation is a point mutation.
17. The method of claim 16, wherein the point mutation is a mutation of alanine residue at position 24 in an amino acid sequence coded by the DNA molecule set forth in SEQ ID NO: 1 to another amino acid residue.
18. The method of claim 16, wherein the point mutation is a mutation of alanine at position 24 in an amino acid sequence coded by the DNA molecule set forth in SEQ ID NO: 1 to threonine, providing a mutated protein whose amino acid sequence is SEQ ID NO: 4.
19. A method for constructing the recombinant microorganism of claim 13, wherein the method comprises at least one of: F1) introducing the nucleic acid molecule of claim 12 into a target microorganism to provide the recombinant microorganism; F2) introducing the DNA molecule set forth in SEQ ID NO: 1 into a target microorganism to provide the recombinant microorganism; F3) editing the DNA molecule set forth in SEQ ID NO: 1 with a gene editing measure to contain the DNA molecule set forth in SEQ ID NO: 2 in a target microorganism.
20. A method for preparing L-glutamic acid, wherein the method comprises producing L-glutamic acid with the recombinant microorganism of claim 13.
Description
DESCRIPTION OF THE EMBODIMENTS
[0176] The present invention will be further described in detail in connection to specific embodiments, and the examples are given only to illustrate the present invention, but not to limit the scope of the present invention. The examples provided below can be used as a guide for further improvement by those skilled in the art, and are not intended to limit the invention in any way.
[0177] Unless otherwise specified specially, the experimental methods in the following examples are all routine methods, which are carried out according to the techniques or conditions described in the literature in the art, or according to the instructions of products. Unless otherwise specified specially, the materials and reagents used in the following examples can be commercially available.
[0178] In the following examples, the constitution of the basic medium used to culture the strain is the same, and sucrose, kanamycin or chloramphenicol are added based on the constitution of the basic medium for a corresponding demand. The constitution of the basic medium is shown in Table 1:
TABLE-US-00010 TABLE 1 Constitution of Basic Culture Medium Ingredients Formulation Sucrose 10 g/L Polypeptone 10 g/L Beef Extract 10 g/L Powdered Yeast 5 g/L Urea 2 g/L Sodium Chloride 2.5 g/L Powdered Agar 20 g/L pH 7.0 Temperature for Culturing 32 Degrees
[0179] Corynebacterium glutamicum YPGLU001 CGMCC No. 21220 in the following examples has been deposited at China General Microbiological Culture Collection Center (abbreviated as CGMCC, Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences) on Nov. 23, 2020, with Accession No. CGMCC No. 21220. Corynebacterium glutamicum YPGLU001 is also known as Corynebacterium glutamicum CGMCC No. 21220.
Example 1. Construction of Transformation Vector pK18-BBD29_11265.SUP.G70A .Comprising BBD29_11265 Gene Coding Region With Point Mutation
[0180] According to the genome sequence of Corynebacterium glutamicum ATCC13869 published on NCBI, two pairs of primers for amplifying the sequence of BBD29_11265 gene coding region are designed and synthesized, and a point mutation is introduced into a strain, Corynebacterium glutamicum CGMCC No. 21220, in allelic replacement (the BBD29_11265 gene coding region on the chromosome of the strain is confirmed consistent with that of ATCC13869 upon sequencing). The amino acid sequence corresponding to a coded protein is SEQ ID NO: 3, with a change of guanine (G) at position 70 in the nucleotide sequence of BBD29_11265 gene to adenine (A) (SEQ ID NO: 2: BBD29_11265.sup.G70A), and thus a change of alanine (A) at position 24 in the amino acid sequence corresponding to the coded protein to threonine (T) (SEQ ID NO: 4: BBD29_11265.sup.A24T).
[0181] The point mutation is a mutation of guanine (G) at position 70 in a nucleotide sequence of BBD29_11265 gene (SEQ ID NO: 1) to adenine (A), providing a DNA molecule set forth in SEQ ID NO: 2 (a mutated BBD29_11265 gene, designated as BBD29_11265.sup.G70A).
[0182] Wherein, the DNA molecule set forth in SEQ ID NO: 1 encodes a protein whose amino acid sequence is SEQ ID NO: 3 (the protein is designated as protein BBD29_11265).
[0183] The DNA molecule set forth in SEQ ID NO: 2 encodes a mutant protein whose amino acid sequence is SEQ ID NO: 4 (the mutant protein is designated as BBD29_11265.sup.A24T). Threonine (T) at position 24 in an amino acid sequence of the mutant protein BBD29_11265.sup.A24T (SEQ ID NO: 4) is derived from a mutation of alanine (A).
[0184] Overlap PCR technique is employed for site-directed mutation to genes, with the primers designed as follows (synthesized by Invitrogen Corporation, Shanghai). The bold base is where mutation occurs:
TABLE-US-00011 P1: (SEQIDNO:5) 5CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCGGTGCCAGA CACTGTCAAG3 P2: (SEQIDNO:6) 5ACGATGACAATCGTTGCGATCCCGCCCATG3 P3: (SEQIDNO:7) CATGGGCGGGATCGCAACGATTGTCATCGT3 P4: (SEQIDNO:8) 5CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC CGTCAGCCCCTGACCGTTCT3
[0185] Method for Construction: using Corynebacterium glutamicum ATCC13869 as a template, PCR amplification is performed with respective primers P1, P2 and P3, P4 to provide two DNA fragments of a BBD29_11265 gene coding region each having a mutated base and sized in 775 bp and 788 bp, respectively (BBD29_11265 Up and BBD29_11265 Down).
[0186] PCR System: 10Ex Taq Buffer 5 dNTP Mixture (2.5 mM each) 4 L, Mg.sup.2+ (25 mM) 4 L, primers (10 M) 2 L each, Ex Taq (5 U/L) 0.25 L in a total volume of 50 L.
[0187] The PCR amplification is performed by pre-denaturation for 5 min at 94 C., denaturation for 30 s at 94 C., annealing for 30 s at 52 C., extension for 45 s at 72 C. for 30 circles, and overextension for 10 min at 72 C., to provide two DNA fragments containing a BBD29_11265 gene coding region each sized in 775 bp and 788 bp (BBD29_11265 Up and BBD29_11265 Down).
[0188] Target bands are recovered after the above two DNA fragments (BBD29_11265 Up and BBD29_11265 Down) are isolated via Agarose Gel Electrophoresis and purified. The above two DNA fragments are then used as a template with P1 and P4 as primers for overlap PCR amplification to provide a fragment in 1533 bp in length, designated as BBD29_11265 Up-Down (as set forth in SEQ ID NO: 29 for the sequence). In the DNA molecule set forth in SEQ ID NO: 29, positions 693-965 are a BBD29_11265.sup.G70A gene fragment with a mutation site (i.e., positions 1-273 of SEQ ID NO: 2).
[0189] Overlap PCR System: 10Ex Taq Buffer 5 L, dNTP Mixture (2.5 mM each) 4 L, Mg.sup.2+ (25 mM) 4 L, primers (10 M) 2 L each, Ex Taq (5 U/L) 0.25 L in a total volume of 50 L.
[0190] The overlap PCR amplification is performed by pre-denaturation for 5 min at 94 C., denaturation for 30 s at 94 C., annealing for 30 s at 52 C., extension for 90 s at 72 C. for 30 circles, and overextension for 10 min at 72 C.
[0191] The DNA fragment BBD29_11265 Up-Down (SEQ ID NO: 29) contains a mutation site for introducing nucleic acid modification to position 70 in a BBD29_11265 gene coding region in Corynebacterium glutamicum CGMCC No. 21220, specifically, a change of guanine (G) at position 70 in the BBD29_11265 gene coding region in the strain Corynebacterium glutamicum CGMCC No. 21220 to adenine (A), and finally resulting in change of the amino acid at position 24 of a coded protein from alanine (A) to threonine (T). After pK18mobsacB plasmid (purchased from Addgene Corporation) is cleaved with Xba I/BamH I, BBD29_11265.sup.G70A and the linearized pK18mobsacB plasmid are isolated via Agarose Gel Electrophoresis and purified, followed by assembly using NEBuider recombination system to provide vector pK18-BBD29_11265.sup.G70A, a plasmid containing a kanamycin-resistant marker. And, the vector pK18-BBD29_11265.sup.G70A is sent for sequencing and identification in a company for sequencing, while vector pK18-BBD29_11265.sup.G70A containing a correct point mutation (G-A) is preserved for reserve.
[0192] Specifically, the DNA fragment (BBD29_11265 Up-Down) is purified after being isolated via Agarose Gel Electrophoresis, followed by ligation to a pK18mobsacB plasmid (purchased from Addgene Corporation, cleaved with Xbal I/BamH I) purified after being cleaved with enzymes (Xbal I/BamH I) for 30 min at 50 C. using NEBuilder enzyme (purchased from NEB Corporation). A grown single clone after the ligation product is transformed into DH5a (purchased form TAKARA Corporation) is subjected to PCR identification for a positive recombinant vector pK18-BBD29_11265.sup.G70A, a recombinant vector containing a kanamycin-resistant (Kan.sup.r) marker. A recombinant vector pK18-BBD29_11265.sup.G70A with correct cleavage is sent for sequencing and identification in a company for sequencing, while a recombinant vector pK18-BBD29_11265.sup.G70A containing a correct point mutation (G-A) is preserved for reserve.
[0193] The recombinant vector pK18-BBD29_11265.sup.G70A is a recombinant vector obtained by substituting a fragment (a small fragment) between Xbal I and/BamH I recognition sites in pK18mobsacB vector with the DNA fragment set forth as positions 37-1495 of SEQ ID NO: 29 in the Sequence Listing, while keeping the other sequences of the pK18mobsacB vector unchanged.
[0194] The recombinant vector pK18-BBD29_11265.sup.G70A contains a DNA molecule set forth as positions 1-273 in the mutated gene BBD29_11265.sup.G70A set forth in SEQ ID NO: 2.
Example 2. Construction of Engineered Strain Comprising BBD29_11265.SUP.G70A .With Point Mutation
[0195] Method for Construction: Plasmid pK18-BBD29_11265.sup.G70A following allelic replacement in Example 1 is electrotransformed into Corynebacterium glutamicum CGMCC No. 21220 for culturing in a culturing medium. See Table 1 for the ingredients in the medium and the conditions for culturing. The cultured mono-colonies are each identified with primer P1 and universal primer M13R for a positive strain with a band in about 1560 bp following amplification. The positive strain is cultured on a culture medium containing 15% sucrose, and the cultured mono-colonies are cultured on culture media with and without kanamycin, respectively. Strains that grow on a culture medium without kanamycin and do not grow on a culture medium with kanamycin are selected for further identification by PCR with the primers as follows (synthesized by Invitrogen Corporation, Shanghai):
TABLE-US-00012 P5: (SEQIDNO:9) 5TTTTCTGACTGCTCTGAACC3 P6: (SEQIDNO:10) 5GACCGTTAACCACGCTAGAC3
[0196] The above amplified products from PCR are subjected to denaturation at a high temperature and ice bath before SSCP electrophoresis (with an amplified fragment of plasmid pK18-BBD29_11265.sup.G70A as a positive control, an amplified fragment of ATCC13869 as a negative control, and water as a blank control). See Table 2 for the preparation of PAGE for SSCP electrophoresis and the conditions for electrophoresis. Since fragments are different in their structures, their locations in electrophoresis are different. Thus, a strain having successful allelic replacement is such a strain that the location of its fragment in electrophoresis is inconsistent with that of a negative control fragment and consistent with that of a positive control fragment. Primers P5 and P6 are used again for PCR amplification of a target fragment of the strain with successful allelic replacement, which is then ligated to PMD19-T vector for sequencing. By virtue of sequence alignment, the sequence with a mutated base sequence verified that the allelic replacement of the strain is successful, which is designated as YPG-013.
[0197] The recombinant bacterium YPG-013 contains a mutated gene BBD29_11265.sup.G70A set forth in SEQ ID NO: 2.
TABLE-US-00013 TABLE 2 Preparation of PAGE and Conditions for SSCP Electrophoresis Amount (Final Concentration of Ingredients 8% for Acrylamide Formulation) 40% Acrylamide 8 mL ddH.sub.2O 26 mL Glycerol 4 mL 10 TBE 2 mL TEMED 40 L 10% APS 600 L Conditions for Electrophoresis Tank Placed into Ice, Electrophoresis 1 TBE Buffer, Voltage 120 V for 10 h
Example 3. Construction of Engineered Strain With BBD29_11265 or BBD29_11265.SUP.G70A .Gene Overexpressing on Genome
[0198] In order to further investigate and verify that overexpressing a wild-type BBD29_11265 gene or a mutant gene thereof, BBD29_11265.sup.G70A, in a producer bacterium can increase the production of L-glutamic acid, an exogenous gene is integrated into a chromosome of a host to construct an engineered strain with BBD29_11265 gene or BBD29_11265.sup.G70A gene overexpressing on genome.
[0199] According to the genome sequence of Corynebacterium glutamicum ATCC13869 published on NCBI, three pairs of primers are designed and synthesized for amplification of upstream and downstream homology arm fragments, and a sequence of BBD29_11265 gene coding region and a promoter region for introduction of BBD29_11265 or BBD29_11265.sup.G70A gene into the strain Corynebacterium glutamicum CGMCC No. 21220 through homologous recombination.
[0200] The primers are designed as follows (synthesized by Invitrogen Corporation, Shanghai):
TABLE-US-00014 P7: (SEQIDNO:11) 5CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GACCCGCTTGCCATACGAAG3 P8: (SEQIDNO:12) 5CCCAGAACACGACAAAAGGTATCTACTCATCTGAAGAATC3 P9: (SEQIDNO:13) 5GATTCTTCAGATGAGTAGATACCTTTTGTCGTGTTCTGGG3 P10: (SEQIDNO:14) 5CAAACCAGAGTGCCCACGAATTATTGCGTAGGAGGCCAGT3 P11: (SEQIDNO:15) 5ACTGGCCTCCTACGCAATAATTCGTGGGCACTCTGGTTTG3
[0201] Method for Construction: Using Corynebacterium glutamicum ATCC13869 or YPG-013, respectively, as a template, PCR amplification is performed with primers P7/P8, P9/P10, and P11/P22, respectively, to provide an upstream homologous arm fragment in about 806 bp, a fragment of BBD29_11265 gene coding region and promoter region in 490 bp or a fragment of BBD29_11265.sup.G70A gene coding region and promoter region in about 490 bp, and a downstream homologous arm fragment in about 788 bp. Further, using P7/P12 as primers, amplification is performed with a mixture of the three amplified fragments above as a template to provide integrated homologous arm fragments 1 and 2 (integrated homologous arm fragment 1 in 2004 bp, as set forth in SEQ ID NO: 30 for its sequence; and integrated homologous arm fragment 2 in 2004 bp, as set forth in SEQ ID NO: 31 for its sequence). After the PCR reaction is completed, electrophoresis is performed on the amplified products for recovering a desired DNA fragment in about 2004bp using a Column DNA Gel Recovery Kit (TIANGEN), which is ligated, using NEBuider recombination system, to shuttle plasmid PK18mobsacB having been cleaved with Xba I and recovered to provide an integrative plasmid (i.e., a recombinant vector) PK18mobsacB-BBD29_11265 or PK18mobsacB-BBD29_11265.sup.G70A. The plasmid contains a kanamycin-resistant marker through which a recombinant having a plasmid integrated into genome can be obtained by screening with kanamycin.
[0202] The recombinant vector pK18mobsacB-BBD29_11265 is a recombinant vector obtained by substituting a fragment (a small fragment) between Xbal I and/BamH I recognition sites in pK18mobsacB vector with the DNA fragment set forth as positions 37-1966 of SEQ ID NO: 30 in the Sequence Listing, while keeping the other sequences of the pK18mobsacB vector unchanged.
[0203] The recombinant vector pK18mobsacB-BBD29_11265.sup.G70A is a recombinant vector obtained by substituting a fragment (a small fragment) between Xbal I and/BamH I recognition sites in pK18mobsacB vector with the DNA fragment set forth as positions 37-1966 of SEQ ID NO: 31 in the Sequence Listing, while keeping the other sequences of the pK18mobsacB vector unchanged.
[0204] PCR System: 10Ex Taq Buffer 5 L, dNTP Mixture (2.5 mM each) 4 L, Mg.sup.2+ (25 mM) 4 L, primers (10 M) 2 L each, Ex Taq (5 U/L) 0.25 L in a total volume of 50 L.
[0205] The PCR amplification is performed by pre-denaturation for 5 min at 94 C., denaturation for 30 s at 94 C., annealing for 30 s at 52 C., and extension for 120 s at 72 C. (30 cycles), and overextension for 10 min at 72 C.
[0206] The two integrative plasmids (PK18mobsacB-BBD29_11265 and PK18mobsacB-BBD29_11265.sup.G70A) are each introduced into the strain Corynebacterium glutamicum CGMCC No. 21220 by virtue of electrotransformation, and PCR identification is performed on the cultured mono-colonies with primers P13/P14 for a positive strain containing a fragment in about 1190 bp from PCR amplification, while a strain without any fragments amplified therefrom is an original one. Having being screened with 15% sucrose, the positive strain is cultured on culture media with and without kanamycin, respectively, and strains that grow on a culture medium without kanamycin and do not grow on a culture medium with kanamycin are further subjected to PCR for identification with primers P15/P16. The strain with a fragment amplified therefrom in about 1200 bp is a strain having BBD29_11265 or BBD29_11265.sup.G70A gene integrated into the genome of Corynebacterium glutamicum CGMCC No. 21220, designated as YPG-014 (without a mutation point) and YPG-015 (with a mutation point).
[0207] The recombinant bacterium YPG-014 contains a double-copy BBD29_11265 gene as set forth in SEQ ID NO: 1; the recombinant bacterium containing the double-copy BBD29_11265 gene can significantly and steadily increase the expression amount of BBD29_11265 gene. The recombinant bacterium YPG-014 is an engineered bacterium overexpressing a wild-type BBD29_11265 gene on genome.
[0208] The recombinant bacterium YPG-015 contains a mutated BBD29_11265.sup.G70A gene as set forth in SEQ ID NO: 2; the recombinant bacterium YPG-015 is an engineered bacterium overexpressing a mutant BBD29_11265.sup.G70A A gene on genome.
[0209] The primers for PCR identification are shown as follows:
TABLE-US-00015 P13: (SEQIDNO:17) 5GTCCAAGGTGACGGCCGCAC3 P14: (SEQIDNO:18) 5TGCGATCTCTGTCAATGCAG3 P15: (SEQIDNO:19) 5CTGGGATAGTTTCAAGCCTT3 P16: (SEQIDNO:20) 5ATATTCGGCCCAGCAGCAGC3
Example 4. Construction of Engineered Strain Overexpressing BBD29_11265 or BBD29_11265.SUP.G70A .Gene on Plasmid
[0210] According to the genome sequence of Corynebacterium glutamicum ATCC13869 published on NCBI, a pair of primers for amplifying a sequence of BBD29_11265 gene coding region and promoter region are designed and synthesized. The primers are designed as follows (synthesized by Invitrogen Corporation, Shanghai):
TABLE-US-00016 P17: (SEQIDNO:21) 5GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCACCTTTTGTC GTGTTCTGGG3 P18: (SEQIDNO:22) 5ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACTTATTGCGTA GGAGGCCAGT3
[0211] Method for Construction: Using YPG-0014 or YPG-0013, respectively, as a template, PCR amplification is performed with primers P17/P18 to provide a fragment of BBD29_11265 gene and the promoter thereof in 520 bp (SEQ ID NO: 32) or a fragment of BBD29_11265.sup.G70A gene and the promoter thereof in 520 bp (SEQ ID NO: 33). Electrophoresis is performed on the amplified products for recovering a desired DNA fragment in 520 bp using a Column DNA Gel Recovery Kit, which is ligated, using NEBuider recombination system, to shuttle plasmid pXMJ19 having been cleaved with EcoR I and recovered to provide an overexpression plasmid (i.e., a recombinant vector) pXMJ19-BBD29_11265 or pXMJ19-BBD29_11265.sup.G70A. The plasmid contains a chloramphenicol-resistant marker, and the transformation of the plasmid into the strain can be achieved by screening with chloramphenicol.
[0212] The recombinant vector pXMJ19-BBD29_11265 is a recombinant vector obtained by substituting a fragment (a small fragment) between EcoR I and Kpn I recognition sites in pXMJ19 vector with the DNA fragment set forth as positions 37-486 of SEQ ID NO: 32 in the Sequence Listing, while keeping the other sequences of the pXMJ19 vector unchanged.
[0213] The recombinant vector pXMJ19-BBD29_11265.sup.G70A is a recombinant vector obtained by substituting a fragment (a small fragment) between EcoR I and Kpn I recognition sites in pXMJ19 vector with the DNA fragment set forth as positions 37-486 of SEQ ID NO: 33 in the Sequence Listing, while keeping the other sequences of the pXMJ19 vector unchanged.
[0214] PCR System: 10Ex Taq Buffer 5 L, dNTP Mixture (2.5 mM each) 4 L, Mg.sup.2+ (25 mM) 4 L, primers (10 M) 2 L each, Ex Taq (5 U/L) 0.25 L in a total volume of 50 L.
[0215] The PCR amplification is performed by pre-denaturation for 5 min at 94 C., denaturation for 30 s at 94 C., annealing for 30 s at 52 C., and extension for 45 s at 72 C. (30 circles), and overextension for 10 min at 72 C.
[0216] The two plasmids (pXMJ19-BBD29_11265 and pXMJ19-BBD29_11265.sup.G70A) are each introduced into the strain Corynebacterium glutamicum CGMCC No. 21220 by virtue of electrotransformation, and PCR identification is performed on the cultured mono-colonies with primers M13R (-48) and P18 for a transformed strain containing a fragment in about 569 bp from PCR amplification, designated as YPG-016 (without a mutation point) and YPG-017 (with a mutation point).
[0217] The recombinant bacterium YPG-016 contains a double-copy BBD29_11265 gene as set forth in SEQ ID NO: 1; the recombinant bacterium YPG-016 is an engineered bacterium overexpressing a wild-type BBD29_11265 gene on a plasmid, i.e., overexpression outside a chromosome from plasmid pXMJ19-BBD29_11265.
[0218] The recombinant bacterium YPG-017 contains a mutated BBD29_11265.sup.G70A gene as set forth in SEQ ID NO: 2; the recombinant bacterium YPG-017 is an engineered bacterium overexpressing a mutant BBD29_11265.sup.G70A gene on a plasmid, i.e., overexpression outside a chromosome from plasmid pXMJ19-BBD29_11265.sup.G70A.
Example 5. Construction of Engineered Strain with BBD29_11265 Gene Deleted on Genome
[0219] According to the genome sequence of Corynebacterium glutamicum ATCC13869 published on NCBI, two pairs of primers for amplifying fragments at both ends of a BBD29_11265 gene coding region are synthesized, as upstream and downstream homologous arm fragments. The primers are designed as follows (synthesized by Invitrogen Corporation, Shanghai):
TABLE-US-00017 P19: (SEQIDNO:23) 5CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGATTTCGCCA CGCCATCTAC3 P20: (SEQIDNO:24) 5AGCCCCTTTTAGATGGGGTGGTTTTCTCCTTAAATAACGG3 P21: (SEQIDNO:25) 5CCGTTATTTAAGGAGAAAACCACCCCATCTAAAAGGGGCT3 P22: (SEQIDNO:26) 5CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCGAGGGTGA GCCGGGTGCAT3
[0220] Method for Construction: Using Corynebacterium glutamicum ATCC13869 as a template, PCR amplification is performed with primers P19/P20 and P21/P22, respectively, to provide an upstream homologous arm fragment in 773 bp and a downstream homologous arm fragment in 778 bp. Further, P19/P22 are used as primers for an overlap PCR to provide an integral homologous arm fragment in 1511 bp. After the PCR reaction is completed, electrophoresis is performed on the amplified products for recovering a desired DNA fragment in 1511 bp using a Column DNA Gel Recovery Kit, which is ligated, by virtue of NEBuider recombination system, to a shuttle plasmid, plasmid pk18mobsacB, having been cleaved with Xba I and BamH I and recovered to provide a knockout plasmid. The plasmid contains a kanamycin-resistant marker.
[0221] The knockout plasmid is electrotransformed into the strain Corynebacterium glutamicum CGMCC No. 21220, and PCR identification is performed on the cultured mono-colonies each with the following primers (synthesized by Invitrogen Corporation, Shanghai):
TABLE-US-00018 P23: (SEQIDNO:27) 5GATTTCGCCACGCCATCTAC3 P24: (SEQIDNO:28) 5CGAGGGTGAGCCGGGTGCAT3
[0222] A strain with bands in 1437 bp and 1710 bp amplified from the above PCR amplification is a positive one, while a strain with just a band in 1710 bp amplified therefrom is an original one. Having being screened on a culture medium with 15% sucrose, the positive strain is cultured on culture media with and without kanamycin, respectively, and strains that grow on a culture medium without kanamycin and do not grow on a culture medium with kanamycin are selected for further PCR identification with primers P23/P24. The strain with a band in 1437 bp amplified therefrom is a genetically engineered strain with the BBD29_11265 gene coding region knocked out, designated as YPG-018 (BBD29_11265 gene on the genome of Corynebacterium glutamicum CGMCC No. 21220 is knocked out).
Example 6. Experiments on Fermentation of L-glutamic Acid
[0223] Experiments on fermentation are performed on the strains (YPG-013, YPG-014, YPG-015, YPG-016, YPG-017 and YPG-018) constructed in the above Examples 2-5 and an original strain Corynebacterium glutamicum CGMCC No. 21220 in a fermentation tank, BLBIO-5GC-4-H type (purchased from Shanghai Bailun Biological Technology Co., Ltd.) with the culturing medium shown in Table 3 and the control process shown in Table 4. Triplicates are made for each strain. Results are shown in Table 5.
TABLE-US-00019 TABLE 3 Formulation of Culture Medium for Fermentation (with water as the rest) Name of Reagent Compounding Ratio Glucose 5.0 g/L Phosphoric Acid 0.38 g/L Magnesium Sulfate 1.85 g/L Potassium Chloride 1.6 g/L Biotin 550 g/L Vitamin B1 300 g/L Ferrous Sulfate 10 mg/L Manganese Sulfate 10 g/dL KH.sub.2PO.sub.4 2.8 g/L Vitamin C 0.75 mg/L Vitamin B12 2.5 g/L Para-Aminobenzoic acid 0.75 mg/L Defoamer 0.0015 mL/dL Betaine 1.5 g/L Cane-Sugar Molasses 7 mL/L Corn Steep Liquor 77 mL/L Aspartic acid 1.7 g/L Hair powder 2 g/L
TABLE-US-00020 TABLE 4 Control Process for Fermentation Cycle Revolutions Air Temperature Condition Per Minute Volume Pressure for Culturing 0 h 400 rpm 3 L/min 0.05 MPA 32.5 C. OD 1.0 600 rpm 5 L/min 0.08 MPA 37 C. OD 1.4 700 rpm 7 L/min 0.11 MPA 38 C. 32 h-34 h End of Fermentation, 50-20% Dissolved Oxygen as Standard for Increasing and Decreasing Air Volume during Control Process pH Controlled at 7.0 at 0 h; Controlled at 6.8 at 14 h Control of Fed-Batch Sugar at Concentration of 50-55% in Fermentation Fed-Batch Tank Sugar Residual Sugar Controlled at 0.5-1.0% in Fermentation Tank
TABLE-US-00021 TABLE 5 Results of Experiments on Fermentation of L-glutamic Acid Production of L- Strain Glutamic Acid (g/L) OD (562 nm) Corynebacterium glutamicum 99.6 43.1 CGMCC No. 21220 YPG-013 98.5 42.3 YPG-014 100.1 44.6 YPG-015 102.7 43.4 YPG-016 101.6 42.7 YPG-017 103.8 42.5 YPG-018 91.5 43.8
[0224] Results from Table 5 show that overexpression of the BBD29_11265 gene, or point mutation to the BBD29_11265 gene coding region, BBD29_11265.sup.G70A, and/or overexpression of the BBD29_11265 gene or a mutant gene BBD29_11265.sup.G70A thereof in Corynebacterium glutamicum facilitate an increase in the production of L-glutamic acid, while weakening or knocking out the BBD29_11265 gene is adverse to the accumulation of L-glutamic acid.
[0225] The present invention has been described in detail above. For those skilled in the art, the present invention can be implemented in a wide range with equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without unnecessary experiments. Although specific examples have been provided in the present invention, it should be understood that further improvements can be made to the present invention. In summary, according to the principles of the present invention, the present application is intended to include any variations, uses, or improvements to the present invention, including changes made with routine techniques as known in the art, which depart from the scope disclosed in the present application. Some essential features can be applied in accordance with the scope of the following appended claims.
INDUSTRIAL APPLICATION
[0226] The present invention has found out that, by weakening or knocking out the BBD29_11265 gene, the product coded by the gene has an effect on L-glutamic acid production capacity, and that a recombinant strain obtained by introducing a point mutation to the coding sequence, or by increasing the copy number of, or overexpressing the gene facilitates production of glutamic acid at a higher concentration as compared with an unmodified strain.
[0227] Specifically, the present invention first constructs a genetically engineered bacterium YPG-013 with a point mutation (G-A) by introducing a point mutation to a BBD29_11265 gene coding region (SEQ ID NO: 1) of Corynebacterium glutamicum CGMCC No. 21220 via allelic replacement. In order to further investigate and verify that overexpressing a wild-type BBD29_11265 gene or a mutant gene BBD29_11265.sup.G70A thereof in a producer bacterium can increase the production of L-glutamic acid, an exogenous gene is integrated into the chromosome of a host, or expressed outside the chromosome by a plasmid, respectively, thereby constructing engineered bacteria YPG-014, YPG-015, YPG-016 and YPG-017 overexpressing BBD29_11265 gene or BBD29_11265.sup.G70A gene on genome and plasmid. Experiments suggest that BBD29_11265 gene and variants thereof are involved in the biosynthesis of L-glutamic acid. By overexpressing or knocking out BBD29_11265 gene, or having site-directed mutation (such as point mutation) thereto, the amount of accumulation of L-glutamic acid in a microorganism can be regulated. Point mutation to the BBD29_11265 gene coding region or overexpression of BBD29_11265 gene or a mutant gene BBD29_11265.sup.G70A thereof in a producer bacterium facilitates an increase in the production and conversion rate of L-glutamic acid, while knocking out or weakening the BBD29_11265 gene is adverse to the accumulation of L-glutamic acid. BBD29_11265 gene and a variant thereof (such as BBD29_11265.sup.G70A gene) can be used to construct a genetically engineered strain for producing L-glutamic acid to promote an increase in the production of L-glutamic acid, and to breed a high-production and high-quality strain for industrialized production, which finds values in a wide range of applications to, and is of important economic significance for industrialized production of L-glutamic acid.