STRAIN HAVING ENHANCED L-GLUTAMIC ACID PRODUCTIVITY, CONSTRUCTION METHOD THEREFOR AND APPLICATION THEREOF
20240067998 ยท 2024-02-29
Assignee
Inventors
- Houbo SU (Ningxia, CN)
- Aiying WEI (Ningxia, CN)
- Gang Meng (Ningxia, CN)
- Lipeng YANG (Ningxia, CN)
- Fengyong Ma (Ningxia, CN)
- Huiping Jia (Ningxia, CN)
- Xiaoqun ZHOU (Ningxia, CN)
- Chunguang ZHAO (Ningxia, CN)
Cpc classification
International classification
Abstract
Disclosed are strain having enhanced L-glutamic acid production capacity, and method for constructing the same and use thereof. A nucleotide sequence is provided by introducing a point mutation to a wild-type BBD29-00405 gene in Corynebacterium glutamicum so that the base at position 597 of SEQ ID NO: 1 is mutated from guanine (G) into adenine (A). Also provided is a recombinant strain obtained by introducing the polynucleotide sequence into L-glutamic acid-producing Corynebacterium glutamicum, the recombinant strain comprising a BBD29-00405 gene containing a point mutation. Compared with an unmodified strain, the resulting strain facilitates production of L-glutamic acid at a higher concentration.
Claims
1. A bacterium for generating L-glutamic acid having an improved expression of a polynucleotide encoding an amino acid sequence of SEQ ID NO: 3; wherein the improved expression is an enhanced expression of the polynucleotide encoding an amino acid sequence of SEQ ID NO: 3, or having a point mutation in the polynucleotide encoding an amino acid sequence of SEQ ID NO: 3, or having a point mutation in, and an enhanced expression of the polynucleotide encoding an amino acid sequence of SEQ ID NO: 3.
2. The bacterium of claim 1, wherein the point mutation to the polynucleotide encoding an amino acid sequence of SEQ ID NO: 3 causes methionine at position 199 in the amino acid sequence of SEQ ID NO: 3 to be substituted with a different amino acid.
3. The bacterium of claim 1, wherein the polynucleotide encoding an amino acid sequence of SEQ ID NO: 3 comprises a nucleotide sequence of SEQ ID NO: 1.
4. The bacterium of claim 1, wherein the polynucleotide sequence having a point mutation is formed from a mutation to the base at position 597 of a polynucleotide sequence set forth in SEQ ID NO: 1.
5. The bacterium of claim 1, wherein the bacterium is a bacterium of the genus Corynebacterium, preferably, Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum, Corynebacterium callunae, Corynebacterium glutamicum, Brevibacterium flavum, Brevibacterium lactofermentum, Corynebacterium ammoniagenes, Corynebacterium pekinense, Brevibacterium saccharolyticum, Brevibacterium roseum, and Brevibacterium thiogenitalis.
6. A method for producing L-glutamic acid, the method comprising: culturing the bacterium of claim 1 and recovering L-glutamic acid from the culture.
7-10. (canceled)
11. A protein, wherein the protein is any one of: A1) a protein whose amino acid sequence is SEQ ID NO: 4; A2) a protein having 80% or more identity to and the same function as the protein indicated in A1), as obtained by subjecting the amino acid sequence set forth in SEQ ID NO: 4 to substitution and/or deletion and/or addition of amino acid residues; A3) a fusion protein having the same function, as obtained by linking a tag to the N-terminus and/or C-terminus of A1) or A2).
12. A nucleic molecule, wherein the nucleic acid molecule is any one of: B1) a nucleic acid molecule encoding the protein of claim 11; B2) a DNA molecule whose coding sequence is set forth in SEQ ID NO: 2; B3) a DNA molecule whose nucleotide sequence is set forth in SEQ ID NO: 2; B4) a polynucleotide sequence comprising a polynucleotide encoding an amino acid sequence set forth in SEQ ID NO: 3, wherein methionine at position 199 is substituted with a different amino acid.
13. A biomaterial, wherein the biomaterial is any one of: C1) an expression cassette comprising the nucleic acid molecule of claim 12; C2) a recombinant vector comprising the nucleic acid molecule of claim 12, or a recombinant vector comprising the expression cassette of C1); C3) a recombinant microorganism comprising the nucleic acid molecule of claim 12, or a recombinant microorganism comprising the expression cassette of C1), or a recombinant microorganism comprising the recombinant vector of C2).
14. (canceled)
15. A method for increasing the production of L-glutamic acid in a microorganism, wherein the method comprises any one of: E1) increasing the expression amount, or content of the nucleic acid molecule of claim 12 in a target microorganism to provide a microorganism having a greater production of L-glutamic acid than the target microorganism; E2) performing a mutation on the DNA molecule whose nucleotide sequence is SEQ ID NO: 1 in the target microorganism to provide a microorganism having a greater production of L-glutamic acid than the target microorganism.
16. The method of claim 15, wherein the mutation is a point mutation.
17. The method of claim 16, wherein the point mutation is a mutation of methionine residue at position 199 in an amino acid sequence coded by the DNA molecule set forth in SEQ ID NO: 1 to another amino acid residue.
18. The method of claim 16, wherein the point mutation is a mutation of alanine at position 199 in an amino acid sequence coded by the DNA molecule set forth in SEQ ID NO: 1 to isoleucine, providing a mutated protein whose amino acid sequence is SEQ ID NO: 4.
19. A method for constructing the recombinant microorganism of claim 13, wherein the method comprises at least one of: F1) introducing a nucleic acid molecule into a target microorganism to provide the recombinant microorganism; F2) introducing the DNA molecule set forth in SEQ ID NO: 1 into a target microorganism to provide the recombinant microorganism; F3) editing the DNA molecule set forth in SEQ ID NO: 1 with a gene editing measure to contain the DNA molecule set forth in SEQ ID NO: 2 in a target microorganism, wherein the nucleic acid molecule is any one of: B1) a nucleic acid molecule encoding a protein, wherein the protein is any one of: A1) a protein whose amino acid sequence is SEQ ID NO: 4: A2) a protein having 80% or more identity to and the same function as the protein indicated in A1), as obtained by subjecting the amino acid sequence set forth in SEQ ID NO: 4 to substitution and/or deletion and/or addition of amino acid residues; A3) a fusion protein having the same function, as obtained by linking a tag to the N-terminus and/or C-terminus of A1) or A2): B2) a DNA molecule whose coding sequence is set forth in SEQ ID NO: 2; B3) a DNA molecule whose nucleotide sequence is set forth in SEQ ID NO: 2: B4) a polynucleotide sequence comprising a polynucleotide encoding an amino acid sequence set forth in SEQ ID NO: 3, wherein methionine at position 199 is substituted with a different amino acid.
20. A method for preparing L-glutamic acid, wherein the method comprises producing L-glutamic acid with the recombinant microorganism of claim 13.
Description
DETAILED DESCRIPTION
[0167] In the following, the technical solutions of the present invention will be further described in detail in connection with specific examples. It should be understood that the following examples merely illustrate and explain the present invention, and should not be construed as limiting the scope of protection of the present invention. All the techniques implemented based on the above contents of the present invention are encompassed in the scope that the present invention intends to protect.
[0168] Unless otherwise specified, the raw materials and reagents used in the following examples are all commercially available or can be prepared by known methods. The experimental methods without specific conditions annotated in the following examples usually adhere to routine conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or to those recommended by manufacturers.
[0169] Unless otherwise defined or expressly indicated by the background, all the technical and scientific terms in the disclosure have the same meaning as commonly understood by one of ordinary skilled in the art to which the disclosure pertains.
[0170] In the following examples, the constitution of the basic medium used to culture the strain is the same, and sucrose, kanamycin or chloramphenicol, etc. are added based on the constitution of the basic medium for a corresponding demand. If a solid one is desired, just add 2% agar, with pH at 7.0 and temperature at 30 C. for culturing. The constitution of solutes in a basic medium is shown in Table 1 below. Dissolve the solutes shown in Table 1 in water to provide a basic medium:
TABLE-US-00006 TABLE 1 Constitution of Basic Medium Compounding Fermentation Name of Reagent Ratio Tank Glucose g/L 5.0 Phosphoric Acid g/L 0.38 Magnesium Sulfate g/L 1.85 Potassium Chloride g/L 1.6 Biotin g/L 550 Vitamin B1 g/L 300 Ferrous Sulfate mg/L 10 Manganese Sulfate g/dl 10 KH.sub.2PO.sub.4 g/L 2.8 Vitamin C mg/L 0.75 Vitamin B12 g/L 2.5 Para-Aminobenzoic acid mg/L 0.75 Defoamer ml/dl 0.0015 Betaine g/L 1.5 Cane-Sugar Molasses ml/L 7 Corn Steep Liquor ml/L 77 Aspartic acid g/L 1.7 Hair powder g/L 2
[0171] Corynebacterium glutamicum YPGLU001 CGMCC No. 21220 in the following examples has been deposited at China General Microbiological Culture Collection Center (abbreviated as CGMCC, Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences) on Nov. 23, 2020, with Accession No. CGMCC No. 21220. Corynebacterium glutamicum YPGLU001 is also known as Corynebacterium glutamicum CGMCC No. 21220.
Example 1. Construction of Transformation Vector pK18-BBD29_00405.SUP.G597A .Comprising BBD29_00405 Gene Coding Region with Point Mutation
[0172] According to the Corynebacterium glutamicum ATCC13869 genome (GenBank: CP016335.1) sequence published on NCBI, two pairs of primers are designed and synthesized for amplifying a sequence of a BBD29_00405 gene (GenBank: AKF27993.1) coding zone to introduce a point mutation to the strains ATCC13869 and Corynebacterium glutamicum YPGLU001 (Accession Number of the Biological Deposit: CGMCC No. 21220) producing L-glutamic acid in high yield by virtue of allelic replacement. The amino acid sequence corresponding to a coded protein is SEQ ID NO: 3, with a change of guanine (G) at position 597 in the nucleotide sequence of BBD29_00405 gene to adenine (A) (SEQ ID NO: 2: BBD29_00405.sup.G597A) and thus a change of methionine (M) at position 199 in the amino acid sequence corresponding to the coded protein to isoleucine (I) (SEQ ID NO: 4: BBD29_00405.sup.M199I).
[0173] The nucleotide sequence of a wild-type BBD29_00405 gene is SEQ ID NO: 1 and the amino acid sequence of the BBD29_00405 protein coded by it is SEQ ID NO: 3;
[0174] The nucleotide sequence of a mutated BBD29_00405.sup.G597A gene is SEQ ID NO: 2 and the amino acid sequence of the mutated BBD29_00405.sup.M199I protein coded by it is SEQ ID NO: 4.
[0175] The primers are designed as follows (synthesized by Invitrogen Corporation, Shanghai, with mutated base underlined):
TABLE-US-00007 P1: (SEQIDNO:5) 5CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGATGACTATTAAT GTCTCCGA3 P2: (SEQIDNO:6) 5AGACCGGCATCAAGTATGGTCTGGGCA3 P3: (SEQIDNO:7) 5TGCCCAGACCATACTTGATGCCGGTCT3 P4: (SEQIDNO:8) 5CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCTAGCCGGCG TAAGGATCCCGGAT3
[0176] Method for Construction: using Corynebacterium glutamicum ATCC13869 as a template, PCR amplification is performed with respective primers P1, P2 and P3, P4.
[0177] PCR System: 10Ex Taq Buffer 5 L, dNTP Mixture (2.5 mM each) 4 L, Mg 2+(25 mM) 4 L, primers (10 M) 2 L each, Ex Taq (5 U/L) 0.25 L, a template 1 L, with water as balance, in a total volume of 50 L.
[0178] The above PCR amplification is performed by pre-denaturation for 5 min at 94 C., denaturation for 30 s at 94 C., annealing for 30 s at 52 C., and extension for 40 s at 72 C. (30 circles), and overextension for 10 min at 72 C., to provide two DNA fragments containing a BBD29_00405 gene coding region each sized in about 647 bp and 927 bp, respectively, (BBD29_00405.sup.G597A-Up (SEQ ID NO: 29) and BBD29_00405.sup.G597A-Down (SEQ ID NO: 30).
[0179] After BBD29_00405.sup.G597A-Up and BBD29_00405.sup.G597A-Down are isolated via Agarose Gel Electrophoresis and purified, the above two DNA fragments are then used as a template with P1 and P4 as primers for overlap PCR amplification to provide a BBD29_00405.sup.G597A-Up-Down fragment in 1547 bp in length, having a nucleotide sequence of SEQ ID NO: 31.
[0180] PCR System: 10Ex Taq Buffer 5 L, dNTP Mixture (2.5 mM each) 4 L, Mg 2+(25 mM) 4 L, primers (10 M) 2 L each, Ex Taq (5 U/L) 0.25 L, a template 1 L, with water as balance, in a total volume of 50 L.
[0181] The above PCR amplification is performed by pre-denaturation for 5 min at 94 C., denaturation for 30 s at 94 C., annealing for 30 s at 52 C., and extension for 100 s at 72 C. (30 circles), and overextension for 10 min at 72 C.
[0182] The DNA fragment causes a change of guanine (G) at position 597 in the BBD29_00405 gene coding zone of the mutagenized strain of ATCC13869, Corynebacterium glutamicum YPGLU001 (Accession Number of the Biological Deposit: CGMCC No. 21220), finally resulting in a change of the amino acid at position 199 of a coded protein from methionine (M) to isoleucine (I).
[0183] After pK18mobsacB plasmid (purchased from Addgene Coporation) is cleaved with Xba I, the BBD29_00405.sup.G597A-Up-Down and the linearized pK18mobsacB plasmid are isolated via Agarose Gel Electrophoresis and purified, followed by assembly with NEBuider recombination system (NEB E5520S) to provide vector pK18-BBD29_00405.sup.G597A a plasmid containing a kanamycin-resistant marker. And, the vector pK18-BBD29_00405.sup.G597A is sent for sequencing and identification in a company for sequencing, while vector pK18-BBD29_00405.sup.G597A containing a correct point mutation (G-A) is preserved for reserve.
[0184] Recombinant vector pK18-BBD29_00405.sup.G597A is a recombinant vector obtained by inserting the DNA fragment BBD29_00405.sup.G597A-Up-Down fragment set forth in SEQ ID NO: 31 between XbaI recognition sites of pK18mobsacB vector, while keeping the other sequences of pK18mobsacB vector unchanged.
Example 2. Construction of Engineered Strain Comprising BBD29_00405.SUP.G597A .with Point Mutation
[0185] Method for Construction: plasmid pK18-BBD29_00405.sup.G597A following allelic replacement is electrotransformed into Corynebacterium glutamicum YPGLU001 producing L-glutamic acid in high yield (Accession Number of the Biological Deposit: CGMCC No. 21220; it is confirmed by sequencing that a wild-type BBD29_00405 gene coding zone is retained on the chromosome of the strain); the cultured mono-colonies are each identified with primer P1 and universal primer M13R for a positive strain with a band in about 1554 bp (SEQ ID NO: 32) following amplification. The positive strain is cultured on a culture medium containing 15% sucrose; and the cultured mono-colonies are cultured on culture media with and without kanamycin, respectively. Strains that grow on a culture medium without kanamycin and do not grow on a culture medium with kanamycin are subjected to further identification by PCR with the primers as follows (synthesized by Invitrogen Corporation, Shanghai).
TABLE-US-00008 P5: (SEQIDNO:9) 5AGAAGGCAACCTGCGCATGA3 P6: (SEQIDNO:10) 5ATCGGGTTGGAAATCGCAGA3;
[0186] The sequence of the universal primer M13R is follows: M13R: 5CAG GAA ACA GCT ATG ACC3.
[0187] The above amplified product in 261 bp (SEQ ID NO: 33) from PCR are subjected to denaturation at a high temperature and ice bath before sscp electrophoresis (with an amplified fragment of plasmid pK18-BBD29_00405.sup.G597A as a positive control, an amplified fragment of ATCC13869 as a negative control, and water as a blank control). Since fragments are different in their structures, their locations in electrophoresis are different. Thus, a strain having successful allelic replacement is such a strain that the location of its fragment in electrophoresis is inconsistent with that of a negative control fragment and consistent with that of a positive control fragment.
[0188] Again, primers P5 and P6 are used for PCR amplification of a target fragment in a strain having successful allelic replacement, which is linked to PMD19-T vector for sequencing. Base sequence alignment is employed to identify a successful or failed replacement; and the mutant strain derived from a successful replacement of Corynebacterium glutamicum YPGLU001 producing glutamic acid in high yield (Accession Number of the Biological Deposit: CGMCC No. 21220) is designated as YPG-025.
[0189] The recombinant bacterium YPG-025 is a genetically engineered bacterium YPG-025 containing a point mutation (G-A), as obtained by introducing a point mutation G597A to the BBD29_00405 gene coding zone (SEQ ID NO: 1) of Corynebacterium glutamicum CGMCC No. 21220 by virtue of allelic replacement, causing a mutation to the position 597 of the gene from G to A, while keeping the other sequences of the gene unchanged.
[0190] Compared with Corynebacterium glutamicum CGMCC21220, Corynebacterium glutamicum YPG-025 differs only in the substitution of the BBD29_00405 gene set forth in SEQ ID NO: 1 in the genome of Corynebacterium glutamicum CGMCC21220 with the BBD29_00405.sup.G597A gene set forth in SEQ ID NO: 2. SEQ ID NO: 1 and SEQ ID NO: 2 only differ in one nucleotide, at position 597.
[0191] Preparation of PAGE and conditions for SSCP electrophoresis are shown in Table 2 below:
TABLE-US-00009 TABLE 2 Preparation of PAGE for sscp Electrophoresis Ingredients Concentration at 8% 40% Acrylamide 8 mL ddH.sub.2O 26 mL Glycerol 4 mL 10 * TBE 2 mL TEMED 40 L 10% AP 600 L Conditions for Electrophoresis Tank Electrophoresis Placed into Ice, 1 TBE Buffer, Voltage 120 V for 10 h
Example 3. Construction of Engineered Strain with BBD29_00405 or BBD29_00405.SUP.G597A .Gene Overexpressing on Genome
[0192] According to the Corynebacterium glutamicum ATCC13869 genome (GenBank: CP016335.1) sequence published on NCBI, three pairs of primers are designed and synthesized for amplification of upstream and downstream homology arm fragments, and a sequence of a BBD29_00405 gene coding region and a promoter region, so as to introduce BBD29_00405 or BBD29_00405.sup.G597A gene into the strain Corynebacterium glutamicum YPGLU001 (Accession Number of the Biological Deposit: CGMCC No. 21220) through homologous recombination.
[0193] The primers are designed as follows (synthesized by Invitrogen Corporation, Shanghai):
TABLE-US-00010 P7: 5CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGACCCGCTTGCC ATACGAAG3 P8: 5CCTACCACGACGAGCACTACATCTACTCATCTGAAGAATC3 P9: 5GATTCTTCAGATGAGTAGATGTAGTGCTCGTCGTGGTAGG3 P10: 5CAAACCAGAGTGCCCACGAACTAGCCGGCGTAAGGATCCC3 P11: 5GGGATCCTTACGCCGGCTAGTTCGTGGGCACTCTGGTTTG3 P12: 5CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCATAAGAAAC AACCACTTCC3
[0194] Method for Construction: using Corynebacterium glutamicum ATCC13869 or YPI019 as a template, PCR amplification is performed with primers P7/P8, P9/P10, and P11/P22, respectively, to provide an upstream homologous arm fragment in about 806 bp, a fragment of BBD29_00405 (SEQ ID NO: 34) or BBD29_00405.sup.G597A (SEQ ID NO: 36) gene in about 1777 bp, and a downstream homologous arm fragment in about 788 bp (SEQ ID NO: 37). Further, using P7/P12 as primers, amplification is performed with a mixture of the three amplified fragments above as a template to provide an integrated homologous arm fragment upstream-BBD29_00405-downstream (SEQ ID NO: 38) or an integrated homologous arm fragment upstream-BBD29_00405.sup.G597A-downstream (SEQ ID NO: 39) in 3291 bp. After the PCR reaction is completed, electrophoresis is performed on the amplified products for recovering a desired DNA fragment in about 3291 bp using a Column DNA Gel Recovery Kit, which is ligated, using NEBuider recombination system, to shuttle plasmid PK18mobsacB having been cleaved with Xba I and recovered to provide an integrative plasmid (i.e., a recombinant vector) PK18mobsacB-BBD29_00405 or PK18mobsacB-BBD29_00405.sup.G597A The plasmid contains a kanamycin-resistant marker through which a recombinant having a plasmid integrated into genome can be obtained by screening with kanamycin.
[0195] pk18mobsacB-BBD29_00405 is a recombinant vector obtained by inserting the integrated homologous arm fragment upstream-BBD29_00405-downstream (SEQ ID NO: 38) between the cleavage sites of Xba I of shuttle plasmid pk18mobsacB.
[0196] pk18mobsacB-BBD29_00405 is a recombinant vector obtained by inserting the integrated homologous arm fragment upstream-BBD29_00405.sup.G597A-downstream (SEQ ID NO: 39) between the cleavage sites of Xba I of shuttle plasmid pk18mobsacB.
[0197] PCR System: 10Ex Taq Buffer 5 L, dNTP Mixture (2.5 mM each) 4 L, Mg.sup.2+ (25 mM) 4 L, primers (10 M) 2 L each, Ex Taq (5 U/L) 0.25 L, a template 1 L, with water as balance, in a total volume of 50 L.
[0198] The above PCR amplification is performed by pre-denaturation for 5 min at 94 C., denaturation for 30 s at 94 C., annealing for 30 s at 52 C., and extension for 180 s at 72 C. (30 circles), and overextension for 10 min at 72 C.
[0199] The two integrative plasmids are each electrotransformed into Corynebacterium glutamicum YPGLU001 (Accession Number of the Biological Deposit: CGMCC No. 21220), and PCR identification is performed on the cultured mono-colonies with primers P13/P14 for a positive strain containing a fragment in about 1970 bp (SEQ ID NO: 40) from PCR amplification, while a strain without any fragments amplified therefrom is an original one. Having being screened with 15% sucrose, the positive strain is cultured on culture media with and without kanamycin, respectively, and strains that grow on a culture medium without kanamycin and do not grow on a culture medium with kanamycin are further subjected to PCR for identification with primers P15/P16. The bacterium with a fragment amplified therefrom in about 1758 bp (SEQ ID NO: 41) is a strain having BBD29_00405 or BBD29_00405.sup.G597A gene integrated into the genome of the strain Corynebacterium glutamicum YPGLU001 (Accession Number of the Biological Deposit: CGMCC No. 21220), designated as YPG-026 (without a mutation point) and YPG-027 (with a mutation point).
TABLE-US-00011 P13: 5GTCCAAGGTGACGGCCGCAC3 P14: 5AGCTTCGCCGATGTTGCGCA3 P15: 5AGGTTGCACCCGCCATCGCTGCA3 P16: 5ATATTCGGCCCAGCAGCAGC3
[0200] The recombinant bacterium YPG-026 is a recombinant bacterium containing a double-copy BBD29_00405 gene set forth in SEQ ID NO: 1, as obtained by integrating the integrated homologous arm fragment upstream-BBD29_00405-downstream (SEQ ID NO: 38) to the genome of the strain Corynebacterium glutamicum YPGLU001. The recombinant bacterium containing a double-copy BBD29_00405 gene can significantly and stably increase the expression amount of the BBD29_00405 gene.
[0201] The recombinant bacterium YPG027 is a recombinant bacterium containing a mutated BBD29_00405.sup.G597A gene set forth in SEQ ID NO: 2, as obtained by integrating the integrated homologous arm fragment upstream-BBD29_00405.sup.G597A-dowmstream (SEQ ID NO: 39) to the genome of the strain Corynebacterium glutamicum YPGLU001.
Example 4. Construction of Engineered Strain Overexpressing BBD29_00405 or BBD29_00405.SUP.G597A .Gene on Plasmid
[0202] According to the Corynebacterium glutamicum ATCC13869 genome (GenBank: CP016335.1) sequence published on NCBI, a pair of primers for amplifying a sequence of a BBD29_00405 gene coding region and a promoter region are designed and synthesized. The primers are designed as follows (synthesized by Invitrogen Corporation, Shanghai).
TABLE-US-00012 P17: 5GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGTAGTGCTCGT CGTGGTAGG3 P18: 5ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACCTAGCCGGCGTAA GGATCCCGGAT3
[0203] Method for Construction: using ATCC13869 or YPG-025 as a template, PCR amplification is performed with primers P17/P18 to provide a DNA molecule containing BBD29_00405 (SEQ ID NO: 42) or a DNA molecule containing BBD29_00405.sup.G597A (SEQ ID NO: 43) in about 1807 bp. Electrophoresis is performed on the amplified products for recovering a desired DNA fragment in 1807 bp using a Column DNA Gel Recovery Kit, which is ligated, using NEBuider recombination system, to shuttle plasmid pXMJ19 (BioVector NTCC BiovectorpXMJ19) having been cleaved with EcoR I and recovered to provide an overexpression plasmid pXMJ19-BBD29_00405 or pXMJ19-BBD29_00405.sup.G597A The plasmid contains a chloramphenicol-resistant marker, and the transformation of the plasmid into the strain can be achieved by screening with chloramphenicol.
[0204] PCR System: 10Ex Taq Buffer 5 L, dNTP Mixture (2.5 mM each) 4 L, Mg.sup.2+ (25 mM) 4 L, primers (10 M) 2 L each, Ex Taq (5 U/L) 0.25 L, a template 1 L, with water as balance, in a total volume of 50 L.
[0205] The above PCR amplification is performed by pre-denaturation for 5 min at 94 C., denaturation for 30 s at 94 C., annealing for 30 s at 52 C., and extension for 100 s at 72 C. (30 circles), and overextension for 10 min at 72 C.
[0206] The recombinant vector pXMJ19-BBD29_00405 is a recombinant strain obtained by inserting the DNA molecule containing BBD29_00405 (SEQ ID NO: 42) between the cleavage sites of EcoR I of shuttle plasmid pXMJ19.
[0207] The recombinant vector pXMJ19-BBD29_00405.sup.G597A is a recombinant strain obtained by inserting the DNA molecule containing BBD29_00405.sup.G597A (SEQ ID NO: 43) between the cleavage sites of EcoR I of shuttle plasmid pXMJ19.
[0208] Plasmids are each electrotransformed into Corynebacterium glutamicum YPGLU001 (Accession Number of the Biological Deposit: CGMCC No. 21220), and PCR identification is performed on the cultured mono-colonies with primers M13R (-48) and P18 for a transformed strain containing a fragment in about 1846 bp (SEQ ID NO: 44) from PCR amplification, designated as YPG-028 (without a mutation point) and YPG-029 (with a mutation point).
[0209] The sequence of M13R (-48) is as follows:
TABLE-US-00013 5AGCGGATAACAATTTCACACAGGA3
[0210] The recombinant bacterium YPG-028 contains a double-copy BBD29_00405 gene set forth in SEQ ID NO: 1; the recombinant bacterium YPG-028 is an engineered bacterium overexpressing a wild-type BBD29_00405 gene on a plasmid, i.e., overexpression outside a chromosome via plasmid pXMJ19-BBD29_00405.
[0211] The recombinant bacterium YPG-029 contains a mutated BBD29_00405.sup.G597A gene set forth in SEQ ID NO: 2; the recombinant bacterium YPG-029 is an engineered bacterium overexpressing a mutant-type BBD29_00405.sup.G597A gene on a plasmid, i.e., overexpression outside a chromosome via plasmid pXMJ19-BBD29_00405.sup.G597A.
Example 5. Construction of Engineered Strain with BBD29_00405 Gene Deleted on Genome
[0212] According to the Corynebacterium glutamicum ATCC13869 genome (GenBank: CP016335.1) sequence published on NCBI, two pairs of primers for amplifying fragments at both ends of a BBD29_00405 gene coding region are synthesized, as upstream and downstream homologous arm fragments. The primers are designed as follows (synthesized by Invitrogen Corporation, Shanghai):
TABLE-US-00014 P19: 5CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGTCTGGGGGTGA GCGCGGAT3 P20: AGGAAAATAACGCATCCATCTGCCCCTTTACAAATCCACCGCAAACACTG GGAT3 P21: TGGATTTGTAAAGGGGCAGATGGATGCGTTATTTTCCTTCACTTTTCGTA TCCA3 P22: 5CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCTCTGGCGCA TCGAACAGGTCGAAGGA3
[0213] Using Corynebacterium glutamicum ATCC13869 as a template, PCR amplification is performed with primers P19/P20 and P21/P22, respectively, to provide an upstream homologous arm fragment in 709 bp (SEQ ID NO: 45) and a downstream homologous arm fragment in 734 bp (SEQ ID NO: 46). Further, primers P19/P22 are used for an OVER PCR to provide an integral homologous arm fragment in 1405 bp (SEQ ID NO: 47). After the PCR reaction is completed, electrophoresis is performed on the amplified products for recovering a desired DNA fragment in 1405 bp using a Column DNA Gel Recovery Kit, which is ligated, by virtue of NEBuider recombination system, to a shuttle plasmid, plasmid pk18mobsacB, having been cleaved with Xba I and recovered to provide a knockout plasmid. The plasmid contains a kanamycin-resistant marker.
[0214] The knockout plasmid is electrotransformed into Corynebacterium glutamicum YPGLU001 (Accession Number of the Biological Deposit: CGMCC No. 21220), and PCR identification is performed on the cultured mono-colonies each with the following primers (synthesized by Invitrogen Corporation, Shanghai):
TABLE-US-00015 P23: 5GTCTGGGGGTGAGCGCGGAT3 P24: 5CTCTGGCGCATCGAACAGGTCGAAGGA3
[0215] A strain with bands in about 1331 bp (SEQ ID NO: 49) and about 2804 bp (SEQ ID NO: 48) amplified from the above PCR amplification is a positive one, while a strain with just a band in 2804 bp amplified therefrom is a starting one. Having being screened on a culture medium with 15% sucrose, the positive strain is cultured on culture media with and without kanamycin, respectively, and strains that grow on a culture medium without kanamycin and do not grow on a culture medium with kanamycin are subjected further to PCR identification with primers P23/P24. The strain with a band in 1331 bp amplified therefrom is a genetically engineered strain with the BBD29_00405 gene coding region knocked out, designated as YPG-030.
[0216] The recombinant bacterium YPG-030 is one having the BBD29_00405 gene on the genome of Corynebacterium glutamicum CGMCC No. 21220 knocked out.
Example 6. Experiments on Fermentation of L-Glutamic Acid
[0217] Experiments on fermentation are performed on the strains YPG-025, YPG-026, YPG-027, YPG-028, YPG-029 and YPG-030 as constructed in Examples 2-5, and an original Corynebacterium glutamicum YPGLU001 (Accession Number of the Biological Deposit: CGMCC No. 21220) in a fermentation tank, BLBIO-5GC-4-H type (purchased from Shanghai Bailun Biological Technology Co., Ltd.) with the culturing medium shown in Table 3 and the control process for fermentation shown in Table 4, and products from fermentation are collected.
[0218] At the initial moment when seeding is completed, the bacterium is at a concentration of 15 g/L in the system. During the fermentation: sugar content in the system (residual sugar) is controlled by supplementing an aqueous solution containing 50-55% glucose.
[0219] Triplicates are made for each strain. Results are shown in Table 5.
TABLE-US-00016 TABLE 3 Formulation of Solutes in Culture Medium for Fermentation Name of Reagent Compounding Ratio Glucose 5.0 g/L Phosphoric Acid 0.38 g/L Magnesium Sulfate 1.85 g/L Potassium Chloride 1.6 g/L Biotin 550 g/L Vitamin B1 300 g/L Ferrous Sulfate 10 mg/L Manganese Sulfate 10 g/dL KH.sub.2PO.sub.4 2.8 g/L Vitamin C 0.75 mg/L Vitamin B12 2.5 g/L Para-Aminobenzoic acid 0.75 mg/L Defoamer 0.0015 mL/dL Betaine 1.5 g/L Cane-Sugar Molasses 7 mL/L Corn Steep Liquor 77 mL/L Aspartic acid 1.7 g/L Hair powder 2 g/L
[0220] The above culturing medium for fermentation is one obtained by dissolving the solutes shown in Table 3 in water.
TABLE-US-00017 TABLE 4 Control Process for Fermentation Condition Revolutions Per Air Temperature for Cycle Minute Volume Pressure Culturing 0 h 400 rpm 3 L/min 0.05 MPA 32.5 C. OD 1.0 600 rpm 5 L/min 0.08 MPA 37 C. OD 1.4 700 rpm 7 L/min 0.11 MPA 38 C. 34 h- End of Fermentation, 50-20% Dissolved Oxygen as Standard 36 h for Increasing and Decreasing Air Volume during Control pH Process Controlled at 7.0 at 0 h; Controlled at 6.8 at 14 h Control Fed-Batch Sugar at Concentration of 50-55% of in Fermentation Tank Residual Sugar Controlled at Fed- 0.5-1.0% in Fermentation Tank Batch Sugar
TABLE-US-00018 TABLE 5 Results of Experiments on Fermentation of L-glutamic Acid Production of L- OD Strain Glutamic Acid (g/L) (562 nm) Corynebacterium 97.6 41.5 glutamicum YPGLU001 YPG-025 96.1 40.3 YPG-026 98.3 42.9 YPG-027 101.5 41.6 YPG-028 99.7 41.1 YPG-029 102.9 40.8 YPG-030 89.4 41.4
[0221] Results from Table 5 show that, in an engineered bacterium producing L-glutamic acid, Corynebacterium glutamicum YPGLU001 (Accession Number of the Biological Deposit: CGMCC No. 21220), point mutation to the BBD29_00405 gene coding region, BBD29_00405.sup.G597A facilitates an increase in the production of L-glutamic acid; overexpression of BBD29_00405 or BBD29_00405.sup.G597A facilitates to increase the production of L-glutamic acid, while knocking out the BBD29_00405 gene is adverse to the accumulation of L-glutamic acid.
[0222] The embodiments of the present invention have been illustrated above. However, the present invention is not limited to the above embodiments. Any modification, equivalent substitution, improvement, etc. made within the spirit and principle of the invention should be included in the scope of protection of the present invention.
INDUSTRIAL APPLICATION
[0223] The present invention has found out that, by knocking out the BBD29_00405 gene, the product coded by the gene has an effect on L-glutamic acid production capacity, and that a recombinant strain obtained by introducing a point mutation to the coding sequence, or by increasing the copy number of, or overexpressing the gene facilitates production of L-glutamic acid at a higher concentration as compared with an unmodified strain. When the inhibitor of CTD-2256P15.2 or the micropeptide PACMP coded by it provided by the present invention acts on tumor cells or tumor tissues, the growth of tumor cells can be remarkably inhibited, the apoptosis of tumor cells can be increased, the tumor volume can be reduced, and an excellent anti-tumor effect can be achieved. The novel anti-tumor drugs combination scheme provided by the present invention, use of the inhibitor of CTD-2256P15.2 or the micropeptide PACMP coded by it in combination with other anti-tumor drugs, can significantly enhance the killing effect of the anti-tumor drugs on tumor cells and reduce the resistance of tumor cells to chemotherapy, thereby improving the clinical treatment effect on tumors. CTD-2256P15.2 is highly expressed in chemotherapy-resistant tumor tissues and cell lines, and its high expression is significantly negatively correlated with progression-free survival and overall survival of patients with tumors. The CTD2256P15.2 gene expression level provided by the present invention can be used as a molecular index for predicting the sensitivity to chemotherapy and prognosis of patients with tumors, creating a new standard for an effective guide to clinical chemotherapeutic medication for patients with tumors and evaluating the prognosis of treatment.
[0224] Specifically, the present invention first constructs a genetically engineered bacterium YPG-025 with a point mutation (G-A) by introducing a point mutation to a BBD29_00405 gene coding region (SEQ ID NO: 1) of Corynebacterium glutamicum CGMCC No. 21220 via allelic replacement. In order to further investigate and verify that overexpressing a wild-type BBD29_00405 gene or a mutant gene BBD29_00405.sup.G597A thereof in a producer bacterium can increase the production of L-glutamic acid, an exogenous gene is integrated into the chromosome of a host, or expressed outside the chromosome by a plasmid, respectively, thereby constructing engineered bacteria YPG-026, YPG-027, YPG-028 and YPG-029 overexpressing BBD29_00405 gene or BBD29_00405.sup.G597A gene on genome and plasmid. Experiments suggest that BBD29_00405 gene and variants thereof are involved in the biosynthesis of L-glutamic acid. By overexpressing or knocking out BBD29_00405 gene, or having site-directed mutation (such as point mutation) thereto, the amount of accumulation of L-glutamic acid in a microorganism can be regulated. Point mutation to the BBD29_00405 gene coding region or overexpression of BBD29_00405 gene or a mutant gene BBD29_00405.sup.G597A thereof in a producer bacterium facilitates an increase in the production and conversion rate of L-glutamic acid, while knocking out or weakening the BBD29_00405 gene is adverse to the accumulation of L-glutamic acid. BBD29_00405 gene and a variant thereof (such as BBD29_00405.sup.G597A gene) can be used to construct a genetically engineered strain for producing L-glutamic acid to promote an increase in the production of L-glutamic acid, and to breed a high-production and high-quality strain for industrialized production, which finds values in a wide range of applications to, and is of important economic significance for industrialized production of L-glutamic acid.