Efficient genetic screening method
11913017 ยท 2024-02-27
Assignee
Inventors
- Kun Zhang (La Jolla, CA, US)
- Prashant Mali (La Jolla, CA, US)
- Yan Wu (La Jolla, CA, US)
- Dongxin Zhao (La Jolla, CA, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
G16B40/00
PHYSICS
C12N2320/12
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/87
CHEMISTRY; METALLURGY
G16B40/10
PHYSICS
C12N15/113
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
G16B25/10
PHYSICS
C12N15/111
CHEMISTRY; METALLURGY
G16B20/20
PHYSICS
International classification
C12N15/90
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
G16B20/20
PHYSICS
G16B25/10
PHYSICS
Abstract
A guide RNA comprising: a gRNA spacer sequence at the 5 end of the guide RNA, wherein the spacer sequence is complementary to a target gene, a scaffold sequence that binds to Cas9, and an RNA capture and sequencing domain comprising: a barcode sequence, and a primer binding sequence; nucleic acids and vectors encoding the guide RNA; cells expressing the guide RNA; and a library comprising a plurality of guide RNAs. Also disclosed are methods of introducing a genetic perturbation into a cell, methods of assessing an effect of at least one genetic perturbation on RNA expression in a cell, methods of identifying nucleic acid sequences associated with a disease state and a method of identifying candidate therapeutic agents.
Claims
1. A guide RNA comprising from 5 to 3: (a) a gRNA spacer sequence at the 5 end of the guide RNA, wherein the spacer sequence is complementary to a target gene, (b) a scaffold sequence that binds to Cas9, and (c) an RNA capture and sequencing domain comprising: (1) a barcode sequence of 7-20 nucleotides, and (2) a primer binding sequence comprising a polyA sequence of 20-25 adenosines.
2. The guide RNA of claim 1, wherein said barcode sequence is uniquely associated with said gRNA spacer sequence.
3. The guide RNA of claim 1, wherein a linker sequence is positioned between said barcode sequence and said primer binding sequence.
4. The guide RNA of claim 1, wherein the barcode sequence is a patterned sequence.
5. A nucleic acid encoding the guide RNA of claim 1.
6. A vector comprising the nucleic acid of claim 5.
7. A cell expressing the guide RNA of claim 1.
8. The cell of claim 7, wherein said cell further expresses a Cas9 polypeptide.
9. A library comprising a plurality of guide RNAs of claim 1.
10. The library of claim 9, wherein said library comprises at least 100 distinct guide RNAs of claim 1.
11. The library of claim 9, wherein said plurality of guide RNAs comprises at least 1000 guide RNAs.
12. The library of claim 9, wherein said plurality of guide RNAs comprises at least 10000 guide RNAs.
13. The library of claim 9 wherein said plurality of guide RNAs are cloned into a viral vector.
14. The library of claim 13, wherein said viral vector is a lentiviral vector.
15. A method of introducing a genetic perturbation into a cell comprising: contacting a target nucleic acid in said cell with a guide RNA of claim 1 and a Cas9 nuclease; and performing a guide RNA-mediated genetic modification process to introduce said genetic perturbation into said cell.
16. The method of claim 15, wherein said guide RNA-mediated genetic modification process comprises a CRISPR genetic modification process.
17. A method of assessing an effect of at least one genetic perturbation on RNA expression in a cell comprising: performing an RNA expression analysis on a cell in which at least one genetic perturbation has been introduced using a guide RNA of claim 1, measuring a change in RNA expression of at least one gene, and identifying the at least one genetic perturbation that is responsible for said change in RNA expression of at least one gene by determining the sequence of said barcode in said guide RNA.
18. The method of claim 17, wherein said RNA expression analysis comprises a single cell RNA expression analysis.
19. The method of claim 17, wherein said at least one genetic perturbation has been introduced by transducing said cell with a virus encoding said guide RNA.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
DETAILED DESCRIPTION
(23) Some embodiments relate to a method for highly efficient characterization of the functional consequences of genetic modifications in many single mammalian cells in parallel. Some embodiments utilize a CRISPR system designed such that the exact genetic modification in each cell as well as the functional consequences of the modification in the form of gene expression, can be determined in a massively parallel manner. In some embodiments, the methods and compositions described herein may be utilized to provide comprehensive characterization of disease-causing genetic mutations, massive screening of potent T-cells for immunotherapy, high-throughput bio-production optimization, and discovering therapeutically relevant neutralizing antibodies.
(24) Some embodiments relate to a CRISPR guide RNA design, which allows for the first time genetic perturbations to be connected with the profile of all genes in a cell. This allows examination of a variety of different outcomes in one shot, many of which are not possible to quantify with the existing approaches. Being able to assess the functional outcomes on a larger number of individual cells also greatly improves the efficiency of the screen by orders of magnitude. Thus, some embodiments greatly expand what is possible in terms of screening and also dramatically improves efficiency.
(25) Some embodiments provide a method for highly efficient characterization of the functional consequences of genetic modifications in many single mammalian cells in parallel. Some embodiments employ a CRISPR system designed such that the exact genetic modification in each cell as well as the functional consequences of the modification in the form of gene expression, can be determined in a massively parallel manner. Some embodiments may be utilized to allow comprehensive characterization of disease causing genetic mutations, massive screening of potent T-cells for immunotherapy, high-throughput bio-production optimization, and discovery of therapeutically relevant neutralizing antibodies.
(26) Some embodiments relate to a CRISPR guide RNA construct that includes a poly(A) sequence connected to a DNA barcode, constituting an RNA capture and sequencing domain. The barcode sequence may be completely arbitrary. In some instances, a pattern in the barcode sequence may be chosen so that there is an underlying pattern to the barcode so that mutations, such as during sequencing, can be computationally resolved to ensure accurate barcode calling. The barcode sequence is of a defined length, non-limiting examples including 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 18, 19, 20 or more nucleotides in length, or a range defined by any two of the preceding values. Each DNA barcode can be matched to a unique genetic modification, whereas the poly(A) sequence enables one to simultaneously read out the quantitative information of either the full transcriptome or a select subset of genes, as well as the identity of genetic perturbations in single cells of a heterogeneous population.
(27) Most high throughput genetic screening technology relies on phenotypes that can be coupled to some sort of easily detectable phenotypes, such as fluorescent cell sorting, cell imaging, or cell death. However, many genetic variants or perturbations may result in a phenotype that is much more subtle and cannot be easily detected by existing screening technologies. Some embodiments provided herein enable detection of these subtle phenotypes by assaying changes in gene expression that result when a genetic perturbation is made. This not only provides a much richer phenotype (the expression levels of more than 20 k genes), it allows interrogation of gene pathways and regulatory networks in a novel fashion. The effect of a genetic perturbation on all genes may be directly read out, combining this data with existing knowledge of gene regulatory pathways to further our understanding of how genes interact.
(28) Additionally, some embodiments retain the scalability of previous high throughput genetic perturbation screening technology since the screen is conducted in a pooled format.
(29) Shalem et al and Wang et al illustrate pooled CRISPR knockout screens for cell death (Shalem et al. 2014 Science, 343(6166): 84-87) (Wang et al. 2014 Science, 343(6166): 80-84). Additionally, there are examples of CRISPR-Cas9 knockout screens for imageable phenotypes such as protein expression via immunostaining (Parnas et al. 2015 Cell, 162(3): 675-686). Recently, there have been CRISPR-Cas9 screens that result in overexpression or repression of the target genes (instead of a gene knockout) (Konermann et al. 2015 Nature, 517(7536): 583-588). Some embodiments provided herein can be easily modified to use gene activation/repression instead of gene knockouts.
(30) An embodiment of an exemplary custom CRISPR guide RNA construct illustrated in
(31) An embodiment of an exemplary high throughput screening approach is illustrated in
(32) In some embodiments, the CRISPR-Cas9 construct shown in
(33) In some embodiments, in the optimized gRNA design provided herein, one can incorporate polyAs in the regions highlighted by underlined N's:
(34) TABLE-US-00001 (SEQIDNO:5) GNNNNNNNNNNNNNNNNNNNNGTTTgAGAGCTAggNNNNNNNNNN NNNNNNNNNNccTAGCAAGTTcAAATAAGGCTAGTCCGTTcTCAACT TggccaNNNNNNNNNNNNNNNNNNNNctgcagggccAAGTGGCACCGAGT CGGTGCNNNNNNNNNNNNNNNNNNNNTTTTTT
(35) In some embodiments, the compositions and methods provided herein may be used to characterize the functions of >1000 genes (or genetic loci) across a variety of cell types.
(36) In some embodiments, the methods and compositions provided herein may be used to identify potential disease causing genetic perturbations. While Genome Wide Association Studies and private companies such as 23AndMe have identified some genetic variants associated with diseases, the phenotypic effects of most genetic variants is still unknown. The methods and compositions provided herein may be used for identifying the effects of these variants.
(37) In some embodiments, the methods and compositions provided herein may be used to identify promising therapeutic targets. Target identification can be a difficult process since it can be difficult to discern the effects of inhibiting a specific protein in a high throughput manner. The screening methods provided herein may be used to detect any effect a gene knockout may have on a transcriptome, allowing for rapid target identification in any number of disease specific cell lines.
(38) In some embodiments, the methods and compostions provided herein may be used for optimizing biomolecule production in eukaryotic cells. Chinese Hamster Ovary (CHO) cells are widely used to produce recombinant mammalian proteins (Kim et al. 2012). The methods and compositions provided herein can be used to optimize protein production by determining which genetic perturbations maximize RNA expression of the recombinant protein. Additionally, the methods and compositions described herein can be easily ported to prokaryotic cell lines such as E. Coli.
(39) In some embodiments, the methods and compositions provided herein may be used for discovering therapeutically relevant neutralizing antibodies.
(40) With the rapid advances in DNA sequencing, we now have a near-complete human genome, a fairly comprehensive catalog of germline and somatic variants, as well as rich annotations of functional genomic elements. The next challenge in the field is to obtain a complete functional annotation of genetic variants and genomic elements at the cellular and organismal levels.
(41) Genome editing technology, in particularly the CRISPR/Cas9 system, has allowed rapid and precise modifications of the genome and connecting of these to functional outcomes. However, current high-throughput screening approaches rely on phenotypes that can be coupled to cell survival, cell imaging, fluorescent cell sorting, or affinity enrichments. Genetic variants that have more subtle phenotypic consequences, which might represent the majority, are not amenable to such screens. Furthermore, screening of natural genetic variation via assaying of individual cell lines under in vitro culture conditions also has limited throughput and might miss functional differences that depend on specific physiological contexts.
(42) Some embodiments described herein provide a next-generation functional genetic screening method that can overcome these fundamental limitations. Specifically, by treating the full transcriptome of a single cell as the phenotype, any genetic perturbation that leads to systematic transcriptional changes, including many un-screenable traits, become detectable. To scale this, in some embodiments, a CRISPR/Cas9 design is provided whereby genetic modifications in large numbers of individual cells can be linked via unique RNA barcodes to the transcriptome of the same cells. This allows aggressive multiplexing not only on the number of genetic changes but also different cell types in pooling experiments. The scalability is only limited by sequencing power. This method greatly accelerates the functional annotation of genetic variants, including many variants of unknown significance, across various normal and diseased cell types and tissues.
(43) Some embodiments provide en masse single-cell phenotyping and functional screening of coding changes. In some embodiments, a CRISPR/Cas9 system that is compatible with massively parallel single-cell transcriptome sequencing using droplets may be used. Some embodiments enable characterization of the transcriptional states of at least 50,000 single cells and connection of them with 5,000 genetic modifications per single experiment. In some embodiments, the methods and compositions provided herein may be used to evaluate the effects of genetic perturbations on induced pluripotent stem cell (iPSC) differentiation.
(44) Unlike in current genetic screens, some embodiments provided herein can elucidate subtle changes in cellular states and especially transcriptional dynamics. For example, the methods and compositions provided herein may be used for mapping the role of genetic factors on iPSC pluripotency and differentiation. In some embodiments, these screens may be established based on both targeted gene knockouts and gene regulation to obtain complementary genetic and epigenetic insights.
(45) Some embodiments provided herein can engineer and deconvolve multiple genetic perturbations per cell, opening an avenue to systematically elucidate the interactions between pathways and co-dependencies of genes. For example, some embodiments may be used for de novo mapping the functional gene networks during iPSC differentiation.
(46) In some embodiments, the methods and compositions provided herein may be used to develop a highly multiplexed genome engineering method to perform systematic disruption of SNPs or allelic deletions of whole enhancers adjacent to GWAS hits, and examine their potential functional effects in vivo using a mouse teratoma model. This unique strategy allows evaluation of the functions of these regions across multiple cell types. In some embodiments, the methods and compositions provided herein may be used for characterization of at least 1000 SNPs and enhancer segments in cells of all the three developmental germ layers per single experiment.
(47) Differences in our individual genomes give rise to most human diversity, including the susceptibility to diseases. Unraveling the precise code of the temporal-spatial execution of the human genome and consequences of sequence variations on phenotype will have tremendous impact on our understanding of normal and diseased human states. Such an understanding will also enable programming the genome for medicinal and technological purposes. Indeed a variety of powerful approaches have been employed towards deciphering the human genetic code. These include the Encyclopedia of DNA Elements (ENCODE) consortium projects that seek to identify functional genetic elements by correlating output with sequence data, and the Genome Wide Association Studies (GWAS) that have revealed large numbers of sequence variants associated with human diseases (Consortium EP. 2004, Klein et al. 2005a). Most recently with the advances in genome engineering tools, in particular the CRISPR-Cas9 (Mali et al. 2013a Nat Methods, 10(10): 957-963, Cong et al. 2013 Science. 2013; 339(6121):819-823, Jinek et al. 2013 eLife, 2: e00471) systems, we now have powerful approaches that also enable interpretation of how DNA elements act in new contexts or when mutated. Taken together, this advent of next generation genome engineering and sequencing technologies is enabling an unprecedented ability to both perturb DNA elements and assay the consequences of these perturbations.
(48) However unraveling the genetic code entails exploring a genomic sequence space and combinations thereof that is vast, and fine-mapping of the consequences of targeted genetic perturbations. In this regard we remain fundamentally bottlenecked by lack of facile approaches that couple genetic perturbations with comprehensive phenotyping at a massive scale. Genetic variants that have more subtle phenotypic consequences, which might represent the majority, are not amenable to current screening strategies. In fact most genetic screens typically assay only a few phenotypes such as cell survival or growth rate (Boutros et al. 2008 Nat Rev Genet, 9(7): 554-566, Liberali et al. 2015 Nat Rev Genet, 16(1): 18-32, Shalem et al. 2015 Nat Rev Genet, 16(5): 299-311) as cells from screens are usually bulk harvested for analysis at the end of the selection process, and consequently the transcriptomic or proteomic changes associated with the specific perturbations are rendered inaccessible (
(49) As shown in in
(50) As shown in
(51) Some embodiments provided herein integrate cutting-edge technologies in three areas: genome engineering, single-cell genomics analyses and stem cell assays. In some embodiments, a barcoding strategy to directly couple the presence of gRNAs in a cell (the genotype) to the corresponding transcriptomic state (the phenotype) is provided. By scaling this to gRNA libraries and to droplet-based analyses on tens of thousands of cells, a genotype-phenotype mapping platform of unprecedented scale and resolution may be provided. Notably this barcoding and assaying strategy is also versatile and can be extended to RNAi, ORFeome and other screening systems. Unlike contemporary genetic screens, some embodiments also enable two major methodological advances towards interpreting the human genome: (i) massive scale assaying of genetic elements and variants that have un-screenable phenotypes (subtle effects, loss of cell identity or gain of diversity, pleiotropic effects) is now made feasible, thus opening an avenue to exhaustively explore coding and non-coding regions for their functions; (ii) engineering and de-convolving of multiple genetic perturbations per cell is also now made feasible, thus opening an avenue to systematically elucidate the interactions between pathways and co-dependencies of genes. Some embodiments provide a strategy to access phenotypic information that utilizes iPSC differentiation to a teratoma thus allowing us to effectively evaluate functions of genomic elements across multiple cell types for all the three germ layers. This is particularly relevant to genetic variants underlying susceptibility to complex diseases, because the cell types of interest might not be immediately obvious.
(52) The compositions and methods described herein provide a powerful next-generation functional population genetics technology that complements sequencing-based hypothesis generation capacity. Some embodiments provided herein integrate CRISPR-Cas9 based genome engineering with droplet based single-cell genomics methodologies and associated computational analyses.
(53) The prokaryotic CRISPR-Cas systems can be engineered to function robustly as a RNA-guided genome-editing tool in many eukaryotic cells (Mali et al. 2013c, Cong et al. 2013, Jinek et al. 2013). In this system a guide-RNA (gRNA), in complex with a protein Cas9, targets genomic sequences homologous to the gRNA. Targeting new genomic sequences simply entails modifying the gRNA sequence, thus enabling a range of targeted and multiplexed genome editing and regulation capabilities (Mali et al. 2013a Nat Methods, 10(10): 957-963, Price et al. 2015 Proc Natl Acad Sci USA, 112(19): 6164-6169). Some embodiments provided herein relate to a next-generation functional genetic screening method that integrates the CRISPR-Cas9 systems with single-cell genome-scale transcriptomic assaying technologies (
(54)
(55) Current high-throughput pooled screening approaches rely on phenotypes that can be coupled to cell survival, fluorescent cell sorting, or affinity enrichments. Genetic variants that have more subtle phenotypic consequences are not amenable to such screens. By treating the full transcriptome of a single cell as the phenotype, any genetic perturbation that leads to systematic transcriptional changes becomes detectable. By coupling CRISPR/Cas9 library screening with massively parallel single-cell transcriptome sequencing using droplets, a platform for rapid and large-scale cataloging of gene functions is provided. Such an approach will pave the way for unprecedented systematic, in-depth, and highly quantitative studies of genotype-phenotype relationships.
(56) One embodiment relates to quantitative characterization of the transcriptional response of individual cells each carrying different CRISPR-Cas engineered genetic modifications at a massive scale.
(57) In some embodiments, CRISPR-Cas9 design compatible with single-cell RNA sequencing may be utilized, such that the sequencing data from each cell contain information of both the genetic modification and its functional outcomes in the form of transcriptome profile. Towards this end a gRNA design that is detectable with standard RNA capture and sequencing approaches used in single-cell assays, and also compatible with lentiviral production may be utilized. An exemplary gRNA design is outlined in
(58)
(59) In some embodiments, production-scale single-cell RNA sequencing may be performed using the Fluidigm C1 platform, and more recently has implemented two droplet-based methods, Drop-Seq (Macosko et al. 2015 Cell, 161(5): 1202-1214) and In-Drop (Klein et al. 2015 Cell, 161(5): 1187-1201). In some embodiments, PDMS microfluidic chips for droplet formation may be manufactured, and can consistently produce droplets with barcoded beads and cells at a success rate comparable to Drop-Seq (
(60)
(61) Towards downstream analysis, computation on single-cell RNA sequencing data may be performed at three levels. First, from the raw sequencing data we will perform read decoding, mapping, gene expression quantification and assignment of different Cas9 modifications to single-cell transcriptome data sets. Such low-level data processing produces a big matrix per experiment, which contains 5,000-10,000 rows (genes) and 50,000+ columns (cells). In additional, each column (cell) may have a label, which corresponds to a particular genetic modification made to the cell. The computational tools required for this part of processing are all in place. In some embodiments, single-cell transcriptome analysis of human brains may be performed using the methods and compositions provided herein. A computational pipeline for automatic processing of tens of thousands of single-cell transcriptome data sets, reporting various QC metrics and quality filtering are already in place on the TSCC cluster housed by the San Diego Supercomputer Center. The second level of analysis may start with large and relatively sparse data matrices, and computationally partition all cells into clusters in distinct transcriptional states. There are multiple computational methods for this purpose, including PAGODA, or other published methods (Monocle (Trapnell et al. 2014 Nat Biotechnol, 32(4): 381-386), Seurat (Satija et al. 2015 Nat Biotechnol, 33(5): 495-502), RacelD (Grun et al. 2015 Nature, 525(7568): 251-255). The most appropriate method will depend on the nature of transcriptional responses. For example, if the cells fall into several clearly separated and discrete cell states, the iterative clustering & classification strategy developed for the SCAP-T project (Lake et al, submitted) or Seurat would be applicable. If the responded cells represent a rare sub-population, outlier analysis such as the one implemented in RaceID could be more sensitive. On the other hand, if cells respond to the genetic modifications by migrating on certain trajectories along the transcriptional landscape without grouping into clearly separated clusters, Monocle could be particularly powerful. Eventually, each transcriptome data set in the matrix will be assigned to a cluster, or in the case of Monocle, a pseudo-time value assigned along the population trajectory.
(62) In some embodiments, the effects of individual genetic modifications on transcriptional phenotypes are characterized. In some embodiments, on average >40 single cells may be sequenced per each genetic modification and each condition. In the most optimistic situation, the majority of cells with one particular modification will fall into one cluster (or one narrow pseudo-time interval) identified above, in which case standard differential gene expression analysis could be sufficient. Based on the combinatorial expression patterns of several well-understood genes, a biologically meaningful description (functional annotation) of the cell cluster and the effect of the genetic modification may be provided. Note that PAGODA (Fan et al. Nature Methods in press), which extended the principle of gene-set enrichment analysis to variably expressed network among single cells, is particularly powerful for identifying genetic modifications that affect multiple pathways (including controlling cell-cycle effects). In the situation where the transcriptional response to a genetic modification is less homogeneous among different cells, or more subtle to push the cells to a less clearly identifiable cellular state, iterate over all the genetic modifications may be utilized to determine whether each modification is enriched in one or a few cell clusters, or certain domain along the pseudo-time axis, over a null distribution generated by the permutation. In another situation along this direction, a genetic modification (i.e. epigenetic regulators) can potentially cause the loss of a cell's identity, similar to what has been observed in cancer (Hansen et al. 2011 Nat Genet, 43(8): 768-775). In this case, the compactness of all cells carrying a specific modification is a quantitative phenotype, which is not amenable to existing screening strategies, but can be analyzed within a formal statistical framework with our method. For modifications of genes that are in proximity of known gene-gene or protein-protein interaction networks, we will also pool such genes as a group for the enrichment analysis. Some embodiments take advantage of the fact that every single-cell data set is already connected to a specific modification, and perform supervised classification of all cells based on the genetic modifications. Under this approach, in some embodiments, a small set of the most differentially expressed genes for each modification may be identified and bi-clustering may be performed on the entire collection of such genes and all cells. This enables discovery of novel interactions between modified genes (columns) and responding genes (rows) not reported in the literature.
(63) In some embodiments, the synthesis process may be scaled up to create gRNA-poly(A) libraries by utilizing array-based oligonucleotide synthesis approaches. Some embodiments provide an integrated framework to couple CRISPR-Cas9 genome engineering and droplet based single-cell assay methodologies, and engineer corresponding gRNA libraries.
(64) An embodiment of an exemplary procedure is provided in the schematic outlined in
(65) In some embodiments, the genetic screens re implemented based on both gene knockouts and gene regulation to obtain complementary genetic and epigenetic insights, as endogenous gene expression modulation can yield nuanced and rich information on the underlying gene function. In this regard, in some embodiments, the CRISPR-Cas toolset may be expanded by engineering additional orthogonal Cas9-gRNA systems and the methodology may be extended to enable targeted genome-regulation via use of a nuclease-null Cas9 (dCas9) fused to transcriptional repression or activation domains (Esvelt et al. 2013 Nat Methods, 10(11): 1116-1121, Mali et al. 2013b Nat Biotechnol, 31(9): 833-838, Gilbert et al. 2014 Cell, 159(3): 647-661). For repression, in some embodiments, the well-established KRAB effector (Gilbert et al. 2014 Cell, 159(3): 647-661) may be used, and for transcriptional activation the highly active chimeric VP64-p65-RtA effector fusion (Chavez et al. 2015 Nat Methods, 12(4): 326-328) may be used. Since the core gRNA library construction methodology will be identical, simply utilization of these dCas9-transcriptional effector fusions coupled with the existing computational pipeline will readily expand the scope of the screens.
(66) Cas9 mediated genome regulation may not be robust and induced transcriptional changes may be moderate in amplitude. In some embodiments, this can be addressed by using synergy either via multiple gRNAs or via recruitment of multiple effector domains to alleviate robustness issues (Mali et al. 2013b Nat Biotechnol, 31(9): 833-838, Chavez et al. 2015 Nat Methods, 12(4): 326-328, Konermann et al. 2015 Nature, 517(7536): 583-588, Hilton et al. 2015 Nat Biotechnol, 33(5): 510-517). 2) In some embodiments, to ensure maximum library efficacy the choice of gRNAs may be optimized not just in their specificity profile, but also in their putative activity. In some embodiments, the recently described (Chari et al. 2015 Nat Methods, 12(9): 823-826) support vector machine (SVM) classifier developed to identify the most active gRNAs may be used and coupled with screened enhancers of genome engineering processes such as Trex2 (
(67) Considerable effort has been invested in unraveling the complex genetic mechanisms underlying cellular processes in normal and diseased states, and recent advances in loss-of-function screening techniques have become increasingly powerful at identifying individual members of pathways. Unfortunately, these single-gene screens are often unable to provide information on the interactions between pathways and the co-dependencies of genes that ultimately drive cellular transformations. In some embodiments, to gain insights into the gene networks underlying these complex processes, the methods and compositions provided herein may be used to enable a new class of high throughput reverse genetic screening approaches that enable combinatorial deciphering of the role of both single and interacting genes via a single high throughput experiment. Some embodiments provide a method for creating dual-gRNA libraries in which each synthesized oligonucleotide encodes either one or two gRNA spacer sequences. In a complimentary approach, since some of the methods herein directly assay each cell, it also enables engineering and deconvolving of multiple genetic perturbations per cell. Thus unlike in existing pooled genetic screens where to enable the downstream analysis the library MOI must be tightly regulated to ensure 1 perturbation per cell is effected, some embodiments provide the opportunity to explore higher order combinatorials via simply increasing the MOI of lentiviral library infection. As the number of interactions between genes scales exponentially with the number of combinations one wishes to explore, this precludes exhaustive evaluation of arbitrarily large gene sets, and thus some embodiments provide a hierarchical screening approach: starting first from the single-gRNA CRISPR screens to map key regulators of a biological system of interest, and then focusing on the top hits to evaluate those via the combinatorial screening format to map driver genetic interactions.
(68) In some embodiments, to build a systematic approach to map genetic interactions a combinatorial screening approach in hPSCs using pooled CRISPR-Cas9 dual-gRNA libraries is provided (
(69) In some embodiments, to enable accurate quantification of genetic interactions the following approach may be utilized: for each gene pair, a distribution of predicted double knockout phenotype effects is computed assuming multiplicative interactions between all pairwise combinations of gRNAs for a gene pair. The statistical significance of a genetic interaction is determined by comparing actual dual gRNA effects to the null distribution of expected effects. Interaction scores Or scores) are computed as the average distance of dual gRNA constructs for each double knockout from the expected distribution. P-values are also computed and FDR-corrected (Mani et al. 2008). Utilizing this approach, novel positive and negative interaction gene-pairs were unraveled and predicted interactions were validated (
(70) A schematic of an embodiment of an exemplary strategy is provided in
(71) While the use of the dual-gRNA library approach ensures that all possible single and double gene-pairs are perturbed exhaustively in the cell population, as, in some embodiments, the assay analyzes single cells, the MOI of infection can be increased to engineer multiplex perturbations per cell and still readily de-convolve these. In some embodiments, this approach may be utilized to evaluate higher order combinatorials where >2 perturbations per cell need to be engineered. Utilization of this approach may be particularly beneficial in scenarios when one wishes to fine-map complex pathways comprised of several gene family members with similar functions, such as isozymes in metabolic pathways.
(72) In some embodiments, the result of these combinatorial screens provides a list of gene pairs that interact genetically. Viewing the genes as nodes, and interacting pairs as edges, a genetic interaction network limited to the candidate set may be obtained. In some embodiments, he enrichment of this sub-network may be analyzed by comparing this query network against known genetic interactions in humans and other model organisms (reference network). For humans, there is a one to one isomorphism among the nodes. The strength of the match can be tested by a composite function that rewards matching edges, and penalizes edges missing in the reference or the query network. The statistical significance of the match will be inferred by computing a P-value based on scoring edge-permuted random graphs. If the match is significant, then the edges of reference network will augment our experimentally tested edges giving a complete picture of the pathways involved in mediating the biological process.
(73) In some embodiments, the methods and compositions provided herein may be used to characterize 1,000 to 5,000 genetic interactions per assay. In some embodiments, the top functional candidates may be validated via targeted experiments. In some embodiments, the methods and compositions provided herein may be used to identify genetic interactions that can be exploited for engineering improved iPSC differentiation towards both enhanced efficiency and maturity of derived cell types.
(74) Since the number of interactions between n genes scales as n.sup.2, in some embodiments, to ensure experimental tractability the gene list under study may be curated. Towards this end existing computational and algorithmic approaches that leverage tissue specific pathway information and gene expression data may be used to systematically evaluate and assimilate high-value gene sets (Cahan et al. 2014 Cell. 2014; 158(4): 903-915). 2) In some embodiments, multiple iPSC lines may be used as there can be inherent differences in their abilities to differentiate to certain lineages. In this scenario iPSCs derived from hepatocytes may be the best candidates for the studies. Notably ATCC does provide such a primary hepatocyte derived iPSC cell line (ATCC-HYS0103).
(75) Despite enormous efforts by ENCODE, Roadmap Epigenomics and other consortiums, annotations of non-coding functional elements and regulatory genetic variants are mostly based on correlated analyses of enrichments. Systematic characterization of direct and causal regulatory relationships is the next frontier towards understanding the roles of numerous Variants of Unknown Significance (VUS) in normal physiology and various human genetic diseases. In some embodiments, the methods and compositions provided herein may be used to evaluate non-coding regions, by directly modifying a curated list of candidate causal SNPs and enhancers in linkage disequilibrium with GWAS hits. In some embodiments, because many regulatory regions, especially enhancers, are highly tissue specific, and cell types in which some causal regulatory variants are functioning are not immediately obvious (Gjoneska et al. 2015 Nature, 518(7539): 365-369, Zhang et al. 2013 Cell, 153(3): 707-720), a new axis may be added in the screening: injecting a library of genetically modified human iPS cells into SCID mice for teratoma formation, and sequencing single differentiated human cells from all three germ layers, to characterize the cell-type specific effects in a highly parallel manner.
(76) The methods and compositions provided herein are generally applicable to GWAS variants of a wide variety of human diseases. In some embodiments, one may focus on a set of GWAS hits identified in the following diseases. (i) Congenital abnormalities and neonatal diseases. Genetic variants underlying this group of diseases likely have strong phenotypes during embryonic or prenatal developments, which might represent the lowest-hanging fruits for the mouse teratoma model. (ii) Heart diseases. Heart contains only a limited number of cell types, and hence serves as stepping-stones along the axis of cellular diversity before we are ready to tackle a higher level of heterogeneity. (iii) Obesity, which is likely contributed by multiple cell types in different tissues. These methods may allow discovering unexpected cell types of relevance.
(77)
(78) A unique feature of the CRISPR-Cas9 system is that the gRNA design permits one to target multiple sites simultaneously by delivering more than one gRNA per cell. In some embodiments, gRNA scaffold sequences are linked to an RNA capture and sequencing domain that comprises: a barcode sequence, a primer binding sequence, and optionally a linker-spacer sequence between the barcode sequence and the primer binding sequence, as disclosed herein. In some embodiments, a linker having a certain length may be advantageous, for example in providing a length suitable for sequencing. In some embodiments the linker length is 5, 10, 15, 10, 25, 30, 35, 40, 45, 50, 75, 100, 250, 500 or 1000 nucleotides in length or a range defined by any two of the preceding values. The primer binding sequence may be any sequence to which a complementary primer can bind. In some embodiments, the primer binding sequence is conveniently a polyA sequence, which allows a gRNA to be captured alongside a cell's mRNA by reverse transcriptase when primed by an oligo-dT primer, for example during a single cell RNA-seq protocol. If the multiple sites targeted are located adjacent to each other on the same chromosome this approach can be used to effect targeted genomic deletions. This process can be very efficient in a range of cancer cell lines. More recently, this methodology has been optimized to work efficiently also in human iPSCs (Mali et al. 2013c Science, 339(6121): 823-826, Byrne et al. 2015 Nucleic Acids Res, 43(3): e21). Specifically using a dual-gRNA strategy both genomic deletions (up to a 100 kb) and genomic swaps (up to 5 kb) were efficiently engineered (
(79) To scale the above process, in some embodiments, array-based oligonucleotide synthesis approaches that simultaneously produce up to 105 defined sequences may be used (Shalem et al. 2014 Science, 343(6166): 84-87, Gilbert et al. 2014 Cell, 159(3): 647-661, Konermann et al. 2015 Nature, 517(7536): 583-588, Chen et al. 2015 Cell, 160(6): 1246-1260, Sanjana et al. 2014 Nat Methods, 11(8): 783-784, Parnas et al. 2015 Cell, 162(3): 675-686), to develop a method for creating libraries in which each synthesized oligonucleotide encodes two gRNA spacer sequences. Preparation of the dual-gRNA library may be done through a two-step cloning process whereby each synthesized oligonucleotide is assembled progressively with promoters and 3 gRNA scaffolds (
(80)
(81) A schematic of an embodiment of an exemplary approach for disrupting SNPs and deletions of enhancers adjacent to GWAS hits and examining their potential functional effects in vivo using a teratoma model is provided in
(82) In some embodiments, ENCODE annotated enhancers that are adjacent to GWAS hits may be identified, based on the EBI GWAS catalog. Subsequently paired gRNA targets in the PGP1-iPSC genome that either target these SNPs directly or which flank enhancers adjacent to these may be determined. An initial analysis has revealed there are about 7 k, 19 k and 108 k enhancers within 2 k, 10 k and 100 k base-pair windows respectively near GWAS sites. These represent testable high value genomic elements with putative function. Utilizing the phased genome sequencing information, gRNA pairs that specifically target one allele only may be computed. This approach may utilize the fact that the S. pyogenes CRISPR-Cas9 system obligate requires the presence of an NGG motif, the protospacer adjacent motif (PAM), after the 20 base pair guide sequence to successfully make a double stranded cut. Thus only phased SNPs that are part of a GG motif, or a CC motif may be included since the guide RNA can target either complementary strand. Uniqueness throughout the genome may be evaluated and the SNPs may be filtered also for haplotype phasing accuracy.
(83) In some embodiments, PGP1-iPSC lines bearing genomically integrated Cas9 and Trex2 genes that are stably expressed from the AAVS1 locus may be generated. This choice of locus is beneficial as it is expressed in nearly all tissues in the human body, and this ensures Cas9 expression in most differentiated cells. Poly(A) barcoded dual-gRNA libraries can be constructed as described herein, and these may be used to engineer corresponding regions (bi-allelic or allele specific) in the iPSCs. In some embodiments, the cells may be differentiated in vivo to a teratoma. Single-cells from the teratoma may be enzymatically dissociated, and analyzed via the droplet-based approach described earlier. To ensure adequate library coverage, at least 1000 single-cells may be analyzed, where x is the size of the dual-gRNA library. In some embodiments, more cells per modification may be sequenced, in order to cover multiple cells types in teratoma. As a control, >10,000 single cells from teratoma generated from unmodified hiPS cells may be sequenced, and unsupervised clustering approaches may be applied to identify the number of cell types and their relative abundance. The information allows adjustment of the number of single cells to sequence in order to achieve a sufficient coverage. In some embodiments, at least 1000 SNPs and enhancer segments may be characterized per assay. Top functional candidate SNPs may be validated via targeted genomic replacement experiments in an isogenic setting.
(84) Disruption of SNPs by NHEJ using a dual-gRNA approach is highly efficient and can be driven to near 100% completion in a cell population, however deletion of large genomic fragments (>10 kb) may be less efficient. While the use of Trex2 can greatly stimulate this process, is some embodiments, additional single-cells (up to 10 more) may be sampled to ensure adequate number of engineered deletions have been analyzed. In some embodiments, as the cell types in which certain causal regulatory variants are functioning may not be immediately obvious, at least 1000 cells from the teratoma per engineered perturbation may be assayed. In some embodiments, FACS sorting of teratoma cells may be used to enrich candidate cell types of highest interest for these assays.
(85) Genetic interaction mapping may have wide applications such as in synthetic lethal screening in cancers and a generalizable experimental cum computational pipeline may be built.
(86) In any of the embodiments disclosed herein, the gRNA scaffold sequences can be linked to an RNA capture and sequencing domain that comprises: a barcode sequence, a primer binding sequence, and optionally a linker-spacer sequence between the barcode sequence and the primer binding sequence, as disclosed herein. The primer binding sequence may be any sequence to which a complementary primer can bind, which together with the barcode sequence allows for amplification of the barcode. In some embodiments, the primer binding sequence is conveniently a polyA sequence, which allows a gRNA to be captured alongside a cell's mRNA by reverse transcriptase when primed by an oligo-dT primer, for example during a single cell RNA-seq protocol. However, one of skill in the art will recognize that in any of the embodiments disclosed herein, a primer sequence other than the disclosed polyA sequence can be used.
Example 1
(87) The experimental qPCR protocol used to generate the data in
(88) Individual CRISPR gRNAs (T2-polyA, T2) were synthesized using the barcoding library prep protocol, packaged into virus, and used to infect 293T-Cas9 cells. After 7 days, the 293T cells were harvested and RNA was extracted using the Zymo ZR RNA Microprep kit. For both T2-polyA and T2, 3 first strand RT reactions were performed with NEB ProtoScript II Enzyme (following the standard protocol) and 150 ng input RNA. i. polyT primer (supplied with the Protoscript II kit) ii. Degenerate random hexamer (from IDT) iii. polyT primer with no enzyme (the no RT control)
(89) The RT product was diluted with 30 uL H.sub.2O and 2 uL of the diluted product was used for qPCR, with 1 uL F primer, 1 uL R primer, 6 uL H20, and 10 uL 2 Kapa SYBR Fast Master mix. Both gRNA specific primers and GAPDH primers were used for the control. The gRNA specific primers were:
(90) TABLE-US-00002 gRNA_qPCR_F_V2 GCTAGAAATAGCAAGTTAAAATAAGGC (SEQIDNO:6) gRNA_qPCR_R_V2 CGACTCGGTGCCACTTTTTC (SEQIDNO:7)
(91) Relative expression was calculated from Cq scores for gRNA to GAPDH quantification. The raw data is in the table below. The formula used was
Relative Exparession=2.sup.gRNA.sup.
(92) TABLE-US-00003 TABLE 1 Sample Name RT Primer gRNA Target Cq GAPDH Target Cq T2-polyA polyT 21.97 23.15 T2-polyA No RT 27.74 26.36 T2-polyA Randomer 22.86 20.02 T2-noPolyA polyT 27.06 22.23 T2-noPolyA No RT 28.86 31.09 T2-noPolyA Randomer 22.5 18.93 NTC N/A 29.02 N/A
(93) The DropSeq library prep protocol was adapted with changes in the library prep section after the SMART PCR amplification. The PCR product was essentially split into cDNA and gRNA aliquots, standard tagmentation was performed on the cDNA aliquots and gRNA specific primers were used to amplify and attach Nextera adapters to the gRNA aliquot.
(94) The computational pipeline for genotyping the cells is provided in
(95) Doublet validation was done using the standard DropSeq protocol with a 50:50 mix of human and mouse iPSCs. The doublet plot is provided in
Example 2
Scalable Functional Screening by Sequencing and CRISPR-Cas9 Screening
(96) We report the development and integration of two complementary methodologies, namely, high-throughput CRISPR-Cas9 screening, and single cell RNA-seq. We performed perturbations via CRISPR-interference and analyzed the resulting effect on gene expression using massive single-cell transcriptomic profiling (SEUSS). We validated our ability to link genotype to transcriptomic phenotype by demonstrating that the correct target gene was downregulated in the cells that received the corresponding gene knockdown.
(97) Recently, the advent of droplet-based single-cell RNA sequencing has enabled us to assay the transcriptome of hundreds of thousands of individual cells. (Macosko E Z, et al. Cell. 2015 May 21; 161(5):1202-14; and Zheng G X, et al. Nat Commun. 2017 Jan. 16; 8:14049). To integrate high-throughput CRISPR-Cas9 screens and massively parallel single cell RNA-Seq, we developed a technique: ScalablE fUnctional Screening by Sequencing (SEUSS) to assay the transcriptomic effects of functional CRISPR-Cas9 perturbations (
(98) Results
(99) To link genetic modifications to transcriptome information in individual cells, we designed a novel CRISPR-Cas9 gRNA lentiviral library format, in which each gRNA bears a distinct RNA barcode and a 3 poly(A) sequence. Specifically, we fused a 12 bp random genotype barcode, a 25 bp PCR handle, and a 25 bp poly(A) tail at the 3 end of the gRNA scaffold (
(100) In addition, we developed an alternative gRNA design in which the poly(A) were inserted in the hairpin structure of gRNA instead of appending to the tail (
(101) We cloned 17 gRNAs which showed the highest fitness effects in previous CRISPRi fitness screens, and three non-targeting gRNA controls. Each gRNA was designed with a unique 12 bp barcode present between scaffold and polyA sequence for downstream genotyping. We transduced KRAB-dCas9 HeLa cells with the twenty gRNA-polyA constructs in an array format to verify effects of the single gene perturbation (
(102) To enable multi-parameter phenotyping, single cells were collected at four days after transduction and were pooled together and run through the 10 genomics Chromium single cell RNA-seq system. Because our custom gRNA design contains a polyA tail, the gRNA was captured alongside the cell's mRNA during the single cell RNA-seq protocol. Note that our guide RNA will be picked up by any single-cell RNA-seq protocol that uses polyT primers, and is thus highly compatible with a wide array of single-cell RNA-seq technologies, including recent technologies such as Split-Seq (Rosenberg A B 2017 Scaling single cell transcriptomics through split pool barcoding BioRxiv. doi: on the internet at: doi.org/10.1101/105163).
(103) After reverse transcription of the mRNA/gRNAs, we performed a PCR-based amplification of the gRNAs from the cDNA pool using the PCR handle incorporated 3 to the RNA barcode (
(104) To assign CRISPR-Cas9 perturbations to individual cells, we developed a computational genotyping approach that confidently assigns a guide RNA (or multiple guide RNAs in the case where a cell receives more than one lentiviral vector) to each cell, thus linking the guide RNA to the cell's transcriptome. (
(105) To further validate our ability to link guide RNAs (genotype) to transcriptomic effects (phenotype), we looked at the expression of the genes targeted by the CRISPRi guide RNAs in both the single well validation experiment (
(106) As additional validation for the target gene knockdowns, we performed qPCR of the target genes on individual well CRISPRi knockdowns (
(107) Methods
(108) A. Design and Clone of gRNA Constructs
(109) A panel of 17 cancer relevant genes were selected for study. The gRNAs were previously verified in a pooled CRISPR-based functional screens. Three gRNAs were designed to be non-targeters that should not target any specific site in the genome. The oligonucleotide were ordered from Integrated DNA Technologies, annealed to generate double strands DNA. To attach the 12 bp random barcode to each gRNA, the second step PCR were performed for 6 cycles using the following primers:
(110) TABLE-US-00004 OLS_gRNA-SP_F: (SEQIDNO:8) TATATATCTTGTGGAAAGGACGAAACACCG OLS_gRNA-SP_12mer_R: (SEQIDNO:9) TATAAGCGGGAGATTCGTCCTCATANNNNNNNNNNNNGCACCGACTCGGT GCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTT CTAGCTCTAAAAC
(111) Amplicons were then purified and further treated with Exonuclease I to remove excess primers. The 169 bp amplicons were separated in 2% agarose gel electrophoresis and purified by QIAquick gel extraction kit. Subsequently, 4 g of LV-gRNA-polyA vector was digested by 3 l AgeI (NEB) in a 50 l reaction at 37 C. for 3 hours. After digestion, the vector was treated with 2 l of Calf Intestinal Alkaline Phosphatase (NEB) at 37 C. for 30 minutes, then purified by QIAquick PCR Purification Kit (QIAGEN). We assembled 200 ng linearized LV-gRNA-polyA vector with 36 ng (molar ratio 1:10) barcoded gRNA inserts in a 20 l Gibson assembly reaction at 50 C. for 1 hour and performed ten reactions to obtain a high yield. The product was pooled and purified by QIAquick PCR Purification Kit (QIAGEN) and then transformed into One Shot Stb13 Chemically Competent E. coli (Invitrogen). Single clones were picked and sequenced.
(112) The gRNA sequences and corresponding barcodes for the clones we used in this study were as follows:
(113) TABLE-US-00005 SEQ SEQ ID ID Gene Spacers NO Barcodes NO FGFR3 GCCCGTGCGGGCAGAGGCGT 10 ATCAGACCCATC 11 WEE1 GCTCATCGCGGCCCTGGGGA 12 GCGCAGGTAGAG 13 MTOR GTCCTCTAAGCCGGGAGCGA 14 TCGACTCACTCA 15 RRM2 GTGATGGGCGCGAGCGGGACA 16 ACGACTACTCGC 17 PRKDC GTGTGCGTTGCTCCCTGCTG 18 TAGATCAAACCC 19 IGF1R GCCGGCGAGGGGCAGAAACG 20 ACGCACTCCGTG 21 HDAC6 GAAACGCTAGGGGCGGGATC 22 TGAACATCGATC 23 FLT3 GCGAGGCGCGCCGCTCCAGG 24 CTGAGTTTATTC 25 CDK9 GCAGCAGCGACTGGGGGCGG 26 TAAAATATACTA 27 CHEK1 GAGGATATAGGGAGCGGTAT 28 TCGACGATATGC 29 ALK GACCCTCCGAACAGAGGCGG 30 TTGAGGCACCAA 31 HSP90AA1 GGCGCGCGCAGGCCCTGCTCG 32 ATTACTGATACA 33 PARP1 GCGTGCGCTCACCCAGCCGC 34 CTAGAATCTCGT 35 HDAC2 GATAGTCCCGCGGGGAAGGGC 36 CGTCAGATATAA 37 MAP2K1 GGAAAGCGCCGCATCCCGGG 38 GAGAGAGAAAAA 39 EGFR GCTGCCCCGGCCGTCCCGGA 40 AGCCTACCGTGT 41 PIK3CA GGGAGTCTCCGGCACCCACC 42 TTACGCAATCAC 43 NTC0001 ACGGAGGCTAAGCGTCGCAA 44 AAGTCTTGCTAG 45 NTC0006 TACTAACGCCGCTCCTACAG 46 CCCCATAAATAG 47 NTC0009 TAGACAACCGCGGAGAATGC 48 AGCTATTGGTGC 49
B. Cell Culture and Pooled Screen
(114) HEK293T cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. To produce lentivirus, HEK293T cells were seeded in 15 cm tissue culture dishes one day before transfection so that they were 70-80% confluent at the time of transfection. Prior to transfection, culture media was changed to pre-warmed DMEM medium supplemented with 10% fetal bovine serum. For each 15 cm dish, 36 l of Lipofectamine 3000 (Life Technologies) was diluted in 1.2 ml OptiMEM (Life Technologies). Separately, 3 g of pMD2.G (Addgene #12259), 12 g of pCMV delta R8.2 (Addgene #12263), 9 g of lentiviral vector and 48 l of P3000 Reagent were diluted in 1.2 ml OptiMEM. After incubation for 5 min, the Lipofectamine 3000 mixture and DNA mixture were combined and incubated at room temperature for 30 min. The mixture was then added to HEK293T cells dropwise. Viral particles were harvested 48 hours and 72 hours after transfection, further concentrated using Centricon Plus-20 centrifugal ultrafilters with a cutoff 100,000 NMWL (Millipore) to a final volume of 450 l, and then aliquoted and frozen at 80 C.
(115) The stable human cell lines HeLa in which the KRAB-dCas9 is stably integrated into the human AAVS1 site, were used for screening assays. Cells were expanded and frozen in multiple aliquots so that subsequent experiments could be performed with low (<5) passage number. These were grown in DMEM supplemented with 10% fetal bovine serum and blasticidin S (10 g/ml). After transduction with library, the cells were selected with 5 g/ml puromycin selection. Nearly 100% killing was observed in plain cells with these doses after 120 hours of exposure.
(116) The pooled library of gRNA-barcode-polyA constructs was packaged into lentiviruses with Hela cell line infected at MOI=2 to ensure that most cell had two gRNA-barcode-polyA constructs. Puromycin selection was started 2 days after transduction and the cells were dissociated into single cells for droplet based single cells RNA sequencing at day 4.
(117) Single Cells RNA-Seq Library Preparation
(118) Two methods, drop-seq (Macosko E Z, et al. Cell. 2015 May 21; 161(5):1202-14) and 10 genomics (Zheng G X, et al. Nat Commun. 2017 Jan. 16; 8:14049) were used to capture single cells for RNA-seq according to their respective protocols. Around 2000 cells were captured in each Drop-seq run and 10,000 cells were captured in each 10 genomics run. The cDNA library were prepared as the standard protocol, and barcoded gRNAs were enriched from the cDNA pool by PCR first and then were attached with Illumina adaptors and indexes. The long fragments of cDNA products were size selected using SPRI beads at 0.55 ratio and the supernatant were saved for a further selection at 1:1.6 ratio to preserve the small fragments. The small fragments of cDNA library were used as template for gRNA enrichment PCR. The thermocycling parameters were: 95 C. for 30 s, 18 cycles of (98 C. for 15 s, 65 C. for 15 s, 72 C. for 30 s), and 72 C. for 5 min. For coupling with Drop-seq method, the primers were as follows:
(119) TABLE-US-00006 P5-TSO-hybrid(thesameoneasdrop-seqprotocol): (SEQIDNO:50) AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGG TATCAACGCAGAGT*A*C Asteriskreferstophosphorothioatebond. gRNA_Enrichment_F: (SEQIDNO:51) GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGCAAGTTAAAATAAG GCTAGTCCG.
For 10 genomics runs, the primers were as follows:
(120) TABLE-US-00007 P5: (SEQIDNO:52) AATGATACGGCGACCACCGA gRNA_Enrichment_F: (SEQIDNO:53) GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGCAAGTTAAAATAAG GCTAGTCCG.
(121) The amplicons were purified using AMPure XP beads at 1:1.2 ratio. Then 10 ng of enriched gRNA-barcode were further amplified in step 2 PCR for 6 cycles to attach with Illumina adaptors and indexes, using P5-TSO-hybrid or P5 primers (for Drop-seq and 10 genomics methods, respectively) and Nextera N70 primers.
(122) The cDNA libraries and gRNA libraries was quantified by real-time PCR using Illumina Library Quantification (Kapa Biosystems) and used for downstream sequencing on the Illumina HiSeq Rapid run platform.
(123) Computational Analysis
(124) This pipeline uses the software from DropSeq or 10 genomics to generate the UMI matrix.
(125) Starting with cDNA Fastq Files:
(126) 1. Cell and Molecule tags are extracted 2. cDNA reads are aligned to the human hg19 genome via STAR 3. UMI count matrix generated from cDNA reads
Starting with gRNA Fastq Files: 1. Cell and Molecule tags are extracted 2. gRNA reads are aligned to the gRNA scaffold via BWA 3. gRNA barcodes are extracted by looking for the flanking sequences before and after the 12 bp barcode. The flanking sequences are allowed to have a 1 bp mismatch. Barcodes are considered valid if they are at least 11 bp long, and they can have at most 1 base with a sequencing quality of less than 20.
Matching gRNA Reads to Cells in the UMI Count Matrix and Genotyping the Cells 1. The cell barcodes in the gRNA reads are matched to the cell barcodes in the UMI count matrix, allowing for a 1 edit distance difference a. If a gRNA cell tag matches multiple cell tags in the UMI count matrix (this happens because we allow for 1 edit distance mismatches), the read is discarded 2. For each cell in the UMI matrix, the number of reads for each gRNA barcode is counted, and gRNA barcodes are collapsed with edit distance 1 and the respective read counts summed. We also sum the respective UMI counts for each gRNA barcode. 3. gRNA barcodes that have less than 10% of total reads in the cell, or 10% of total UMIs in the given cell are discarded. This step removes most of the noise present in the gRNA reads. 4. After a gRNA barcode (or barcodes) is assigned, we look in the barcode to spacer plasmid library for that barcode, again allowing for a 1 edit distance mismatch to assign a gRNA identity (or identities) to each cell.
Target Gene Knockdown Validation
(127) The UMI counts matrix is assembled and unwanted sources of variation (library size, mitochondrial fraction, and single cell processing batch) are regressed away using negative binomial regression via the Seurat package. The target genes are tested for downregulation by first ranking each cell according to its normalized expression of a given target gene, and then testing each genotype to see if it contained cells with an abnormally large amount of low rankings.
(128) The person skilled in the art realizes that the present disclosure by no means is limited to the embodiments described above. On the contrary, many modifications and variations are possible within the scope of the appended claims.
(129) Additionally, variations to the disclosed embodiments can be understood and effected by the skilled person in practicing the claimed disclosure, from a study of the drawings, the disclosure, and the appended claims. In the claims, the word comprising does not exclude other elements or steps, and the indefinite article a or an does not exclude a plurality. The mere fact that certain features are recited in mutually different dependent claims does not indicate that a combination of these features cannot be used to advantage. Also two or more steps or processes may be performed concurrently or with partial concurrence. Further, in some embodiments, the steps or processes of the methods may be performed in an order different from what has been disclosed. All such variations are within the scope of the disclosure. Additionally, even though the disclosure has been described with reference to specific exemplifying embodiments thereof, many different alterations, modifications and the like will become apparent for those skilled in the art. Any suitable combination of the elements and acts of the various embodiments described above can be combined to provide further embodiments. The accompanying claims and their equivalents are intended to cover such forms or modifications as would fall within the scope and spirit of the disclosure.
(130) While the present description has been provided in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. All figures, tables, and appendices, as well as patents, applications, and publications, referred to above, are hereby incorporated by reference for the disclosures referenced herein and in their entirety.
(131) While the present description sets forth specific details of various embodiments, it will be appreciated that the description is illustrative only and should not be construed in any way as limiting. Furthermore, various applications of such embodiments and modifications thereto, which may occur to those who are skilled in the art, are also encompassed by the general concepts described herein. Each and every feature described herein, and each and every combination of two or more of such features, is included within the scope of the present invention provided that the features included in such a combination are not mutually inconsistent.
(132) Some embodiments have been described in connection with the accompanying drawing. However, it should be understood that the figures are not drawn to scale. Distances, angles, etc. are merely illustrative and do not necessarily bear an exact relationship to actual dimensions and layout of the devices illustrated. In some embodiments, components can be added, removed, and/or rearranged. Further, the disclosure herein of any particular feature, aspect, method, property, characteristic, quality, attribute, element, or the like in connection with various embodiments can be used in all other embodiments set forth herein. Additionally, it will be recognized that any methods described herein may be practiced using any device suitable for performing the recited steps.
(133) For purposes of this disclosure, certain aspects, advantages, and novel features are described herein. It is to be understood that not necessarily all such advantages may be achieved in accordance with any particular embodiment. Thus, for example, those skilled in the art will recognize that the disclosure may be embodied or carried out in a manner that achieves one advantage or a group of advantages as taught herein without necessarily achieving other advantages as may be taught or suggested herein.