Modified seed oil content by gene editing

11913035 ยท 2024-02-27

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are compositions comprising polynucleotides encoding modified diacylglycerol acyltransferase-1 (DGAT1) polypeptides having improved properties, such as increased enzymatic activity and/or increased stability. Plants, plant cells, seed, grain and comprising the polynucleotides are provided which have one or more of increased fatty acid or protein content. Methods of generating the polynucleotides in plant cells include transformation and genetic modification. Methods of employing the polynucleotides in plants, methods for increasing DGAT1 activity in a plant, and methods for increasing fatty acid content or protein content in a plant are provided.

Claims

1. A modified polynucleotide encoding a diacylglycerol acyltransferase-1 (DGAT1) polypeptide having at least 95% identity to SEQ ID NO:2, the polynucleotide encoding a modification comprising a non-asparagine at the position corresponding to position 473 of SEQ ID NO:2, wherein when expressed in a plant cell, the polynucleotide increases the fatty acid content of the plant cell compared to a plant cell comprising a comparable polynucleotide without the modification.

2. The modified polynucleotide of claim 1, wherein the polypeptide encoded by the modified polynucleotide has at least 98% identity to SEQ ID NO:2.

3. The modified polynucleotide of claim 1, wherein the polynucleotide encodes a serine at the position corresponding to position 473 of SEQ ID NO: 2.

4. The modified polynucleotide of claim 1, wherein the polynucleotide comprises a further modification encoding a non-cysteine at the position corresponding to position 355 of SEQ ID NO: 2.

5. The modified polynucleotide of claim 4, wherein the further modification encodes a serine at the position corresponding to position 355 of SEQ ID NO:2.

6. The modified polynucleotide of claim 1, wherein the polynucleotide further comprises a modification encoding a non-isoleucine at the position corresponding to position 479 of SEQ ID NO: 2.

7. The modified polynucleotide of claim 6, wherein the further modification encodes a serine at the position corresponding to position 479 of SEQ ID NO: 2.

8. The modified polynucleotide of claim 1, wherein the polypeptide further comprises a deletion of at least 1 and less than 107 amino acids corresponding to the region at positions 1 to 107 of SEQ ID NO: 2, wherein the DGAT1 polypeptide has increased stability when expressed in a plant cell.

9. The modified polynucleotide of claim 1, wherein the DGAT1 further comprises (i) at least one amino acid motif selected from the group consisting of APTLCYQ (SEQ ID NO: 38), FGDREFYXDWWNA (SEQ ID NO: 39) and LLYYHD (SEQ ID NO: 40), where X is any amino acid; (ii) at least one amino acid motif selected from the group consisting of APTLCYQ (SEQ ID NO: 38), FGDREFYXDWWNA (SEQ ID NO: 39) and LLYYHD (SEQ ID NO: 40), where X is K or Q; or (iii) at least one amino acid motif selected from the group consisting of ESPLSSDXIFXQSHAGLXNLCXWLXAVNXRLIIENLMKYGXLI (SEQ ID NO: 41) and GFIIEQYINPIVXNSXHPL (SEQ ID NO: 42), wherein X is any amino acid.

10. A plant cell comprising the modified polynucleotide of claim 1.

11. A soybean seed comprising the cell of claim 10, wherein the soybean seed has an increased oil content compared to a seed comprising the comparable polynucleotide without the modification.

12. The soybean seed of claim 11, wherein the oil content is increased by at least 5%.

13. A plant cell comprising the modified polynucleotide of claim 3.

14. A soybean seed comprising the cell of claim 13, wherein the soybean seed has an increased oil content compared to a seed comprising the comparable polynucleotide without the modification.

15. The soybean seed of claim 14, wherein the oil content is increased by at least 5%.

16. A plant cell comprising the modified polynucleotide of claim 6.

17. A soybean seed comprising the cell of claim 16, wherein the soybean seed has an increased oil content compared to a seed comprising the comparable polynucleotide without the modification.

18. The soybean seed of claim 17, wherein the oil content is increased by at least 5%.

19. A polypeptide encoded by the polynucleotide of claim 1.

20. A method for increasing the oil content of a soybean cell comprising a polynucleotide encoding a DGAT1 polypeptide, the method comprising a. inducing a break in the genome of the soybean cell and repairing the break, wherein the repair of the break results in at least one nucleotide substitution in the polynucleotide, the substitution encoding a non-asparagine at the position corresponding to position 473 of SEQ ID NO:2, to produce a modified polynucleotide encoding a modified polypeptide; b. expressing the modified polypeptide in the soybean cell using an endogenous promoter of the polynucleotide, wherein the fatty acid content of the soybean cell is increased compared to a soybean cell expressing a comparable polypeptide without the substitutions.

Description

BRIEF DESCRIPTION OF THE DRAWINGS AND SEQUENCE LISTING

(1) The disclosure can be more fully understood from the following detailed description and the accompanying drawings and Sequence Listing that form a part of this application, which are incorporated herein by reference.

(2) FIG. 1 is a graph showing DGAT protein level in tobacco leaf with expression of DGAT variants. DGAT1b mod is soybean DGAT1b with 14 amino acid substitutions (SEQ ID NO:26). A significant difference between DGAT variant and wild type DGAT at P<0.05 was found in the four DGAT variants. A significant difference between DGAT variant and wild type DGAT at P<0.05 is marked with asterisks.

(3) FIG. 2 is a graph showing the oil content in tobacco leaf expressing different DGAT variants. DGAT1b mod is soybean DGAT1b with 14 amino acid substitutions (SEQ ID NO:26). A significant difference between DGAT variant and wild type DGAT at P<0.05 was found in the four DGAT variants. A significant difference between DGAT variant and wild type DGAT at P<0.05 is marked with asterisks.

(4) FIG. 3. is a graph showing the oil content in tobacco leaf tobacco leaf expressing different DGAT variants. A single amino acid substitution in GmDGAT1a and GmDGAT1b increases oil content in tobacco leaf transient expression. GmDGAT1b mod is soybean DGAT1b with 14 amino acid substitutions (SEQ ID NO:26). A significant difference between DGAT variant and wild type DGAT at P<0.05 was found in the twelve DGAT variants.

(5) FIG. 4A-D is a sequence alignment of plant DGAT amino acid sequences with the amino acid substitutions which correspond to the positions described herein marked with stars.

(6) FIG. 5 is a graph showing the oil content in tobacco leaf expressing different DGAT variants. Changes of two to four amino acids in DGAT increases oil content in tobacco leaf transient expression. GmDGAT1b mod is soybean DGAT1b with 14 amino acid substitutions (SEQ ID NO:26). A significant difference between DGAT variant and wild type DGAT at P<0.05 was found in the 8 (marked with asterisks) of the 12 DGAT variants.

(7) FIG. 6 is a photograph showing the oil content in tobacco leaf expressing different DGAT variants. The combination of 3 amino acid substitutions with N-terminal deletion at AA25-44 increases oil more than either 3 amino acid substitution or the N-terminal deletion at AA25-44 alone and is higher than GmDGAT1b mod with 14 amino acid substitutions (SEQ ID NO:26).

(8) The sequence descriptions summarize the Sequence Listing attached hereto. The Sequence Listing contains one letter codes for nucleotide sequence characters and the single and three letter codes for amino acids as defined in the IUPAC IUB standards described in Nucleic Acids Research 13:3021 3030 (1985) and in Biochem. J. 219(2):345 373 (1984).

(9) FIG. 7 is a graph showing the oil content from GmDGAT1b wild type (SEQ ID NO:2), GmDGAT1b mod (SEQ ID NO:2), and empty vector expressed in tobacco leaf and compare three different TAG isolation and quantification procedures, including TLC/GC-FID, SPE/GC-FID, and HPLC-ELSD. Samples were analyzed with each of the three analysis methods. GmDGAT1b mod is soybean DGAT1b with 14 amino acid substitutions (SEQ ID NO:26).

(10) FIG. 8 is a graph showing the oil content in tobacco leaf expressing additional DGAT1 variants analyzed with the HPLC-ELSD and SPE/GC-FID procedures. Single amino acid substitutions in GmDGAT1b increases oil content in tobacco leaf transient expression system. GmDGAT1b mod is soybean DGAT1b with 14 amino acid substitutions (SEQ ID NO:26). A significant difference between DGAT variants and wild type DGAT at p<0.05 was found in the 4 (marked with an asterisks) of the 8 DGAT variants.

(11) FIG. 9 is a graph showing the oil content in tobacco leaf expressing different DGAT variants analyzed with the SPE/GC-FID procedure. Changes of one to four amino acids in DGAT increases oil content in tobacco leaf transient expression. GmDGAT1b mod is soybean DGAT1b with 14 amino acid substitutions (SEQ ID NO:26). A significant difference between DGAT variants and wild type DGAT at p<0.05 was found in the 6 (marked with asterisks) of the 7 DGAT variants.

(12) FIG. 10 is a graph showing the oil/protein ratio in tobacco leaf expressing different DGAT variants from FIG. 9. GmDGAT1b mod is soybean DGAT1b with 14 amino acid substitutions (SEQ ID NO:26). A significant difference between DGAT variants and wild type DGAT at p<0.05 was found in the 2 (marked with asterisks) of the 7 DGAT variants.

(13) TABLE-US-00001 TABLE 1 List of sequences used in this application Nucleotide Polypeptide Sequence SEQ ID NO: SEQ ID NO: Glycine max GmDGAT1b 1 2 Glycine max GmDGAT1a 3 4 Glycine max GmDGAT1C 5 6 Brassica napus BnDGAT1a 7 8 Gossypium hirsutum GhDGAT1 9 10 Helianthus annuus HaDGAT1 11 12 Hordeum vulgare DGAT1 13 14 Oryza sativa DGAT1 15 16 Sorghum bicolor DGAT1b 17 18 Triticum aestivum DGAT1 19 20 Zea mays DGAT1-2 21 22 Elaeis guineensis DGAT1-1 23 24 Glycine max GmDGAT1a with 25 48 bp deletion Glycine max GmDGAT1B with 26 60 bp deletion Glycine max GmDGAT1b mod 27 Glycine max GmDGAT1a mod 28 Glycine max GmDGAT1b genomic 29 Glycine max GmDGAT1a genomic 30 GM-DGAT-CR1 31 GM-DGAT-CR3 32 GM-DGAT-CR4 33 DGAT1a WOL1469 34 DGAT1a WOL1470 primer 35 DGAT1b WOL1471 primer 36 DGAT1b WOL1472 primer 37 DGAT polypeptide motif 38 DGAT polypeptide motif 39 DGAT polypeptide motif 40 DGAT polypeptide motif 41 DGAT polypeptide motif 42

DETAILED DESCRIPTION

(14) Compositions and methods related to modified plants, such as soybean plants, producing seeds high in oil are provided. The seeds may also have increased amounts of protein. Suitable plants include oil-seed plants, such as palm, canola, sunflower and soybean as well as, without limitation, rice, cotton, sorghum, wheat, maize, alfalfa and barley. Plants, such as soybean plants, that have been modified using genomic editing techniques to produce seeds having a desirable fatty acid content are provided. The inventors found that providing particular amino acid substitutions, or combinations of amino acid substitutions, as well as particular deletions in diacylglycerol acyltransferase (DGAT) alleles using genomic editing technology as described herein provided a DGAT protein with higher activity and increased stability. Plant cells containing the modified DGAT sequences show increased fatty acid or oil content.

(15) The modified sequences, plants, seeds and cells disclosed herein are produced by genomic editing techniques which facilitate the editing of the DGAT alleles, such as provided in SEQ ID NOs: 1-30. The sense strand or the complement thereof may be edited.

(16) A DGAT, DGAT1, DGAT1a or DGAT1b or a DGAT-modified plant, DGAT1-modified plant, DGAT1a-modified plant or DGAT1b-modified plant generally refers to a modified or mutant plant or plant cell that has one or more nucleotide changes or deletions in a genomic region that encodes a polypeptide that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to one of SEQ ID NOS: 1-24 or an allelic variant thereof. DGAT1a and DGAT1b may also be written as DGAT1A and DGAT1B, respectively. The nucleotide changes in the sequences encoding a DGAT polypeptide disclosed herein can include modifications that result in one or more amino acid substitutions at an amino acid corresponding to those listed in Table 2, either alone or in any combination. Amino acids corresponding to those listed in Table 2, for example, are shown with an asterisk in FIG. 4. The modified DGAT sequences when expressed in cells, plants and seeds may show an increase in oil and may be more stable, show an increase in specific activity or any combination thereof. An increase in protein and fatty acid content in the plant cell or in a seed comprising the plant cell may also result from expression of the modified polynucleotides disclosed herein. The polynucleotides may also have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity, such as according to parameters disclosed herein, to their corresponding genomic nucleotide sequence, such as SEQ ID NO: 29 or 30.

(17) TABLE-US-00002 TABLE 2 Positions for amino acid substitutions in DGAT sequences GmDGAT1B GmDGAT1a GmDGAT1C BnDGAT1a GhDGAT1 HaDGAT1 HvDGAT1 (SEQ ID NO: 2) (SEQ ID NO: 4) (SEQ ID NO: 6) (SEQ ID NO: 8) (SEQ ID NO: 10) (SEQ ID NO: 12) (SEQ ID NO: 14) Soy Soy Soy Canola Cotton Sunflower Barley S58 S55 D71 E64 D63 A68 P181 P175 S194 S188 S186 S194 R147 A210 A204 A233 A217 A215 V223 A176 T216 T210 T229 T223 A221 S229 V182 D258 D252 E271 E258 E271 E224 S264 S258 T277 S264 S262 D277 T230 K328 K322 K341 K328 K326 N341 K294 L364 L358 L377 L364 L362 L377 L330 D387 D381 E400 D387 E385 E400 E353 I440 I434 M453 L440 L438 I453 I406 R467 R461 R480 Q465 Q480 K433 I479 I473 I492 A478 I477 F492 F445 S24 T24 S32 S30 D26 S24 A23 S34 S31 D42 D40 A36 S44 L244 S238 S257 S251 S249 S257 S210 C355 C349 C368 C355 S353 C368 C321 N473 N467 N486 N472 N471 N486 N439 OsDGAT1 SbDGAT1b TaDGAT1 ZmDGAT1-2 EgDGAT1-1 (SEQ ID NO: 16) (SEQ ID NO: 18) (SEQ ID NO: 20) (SEQ ID NO: 22) (SEQ ID NO: 24) Rice Sorghum Wheat Maize Palm S78 E57 L61 G51 G60 T215 T192 R187 G170 S197 A244 A221 A216 A199 P226 L250 V227 V222 V205 N232 D292 D269 E264 E247 H266 T298 T275 T270 T253 S272 K362 K339 K334 K317 K336 L398 L375 L370 V353 L372 E421 E398 E393 E376 E395 I474 I451 I446 I429 I448 R501 N478 K473 K456 K475 F513 F490 F485 F468 F487 A44 G23 K27 G21 P26 A54 K33 P37 A31 S36 G278 S255 S250 S233 S260 A389 C366 S361 C344 C363 N507 N484 N479 N462 N481

(18) The substitutions may include one or more of the following with respect to the corresponding position in SEQ ID NO:2: S24A, S34A, S58N, P181A, A210V, T216V, L244A, D258E, S264T, K328N, C355S, L364V, D387E, I440M, R467Q, N473S, and I479S.

(19) In some embodiments the polynucleotides disclosed herein may be isolated polynucleotides. An isolated polynucleotide generally refers to a polymer of ribonucleotides (RNA) or deoxyribonucleotides (DNA) that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. An isolated polynucleotide in the form of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.

(20) The terms polynucleotide, polynucleotide sequence, nucleic acid sequence, nucleic acid fragment, and isolated nucleic acid fragment encompass nucleotide sequences and the like. A polynucleotide may be a polymer of RNA or DNA that is single- or double-stranded, that optionally contains synthetic, non-natural or altered nucleotide bases. A polynucleotide in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA, synthetic DNA, or mixtures thereof. Nucleotides (usually found in their 5-monophosphate form) are referred to by a single letter designation as follows: A for adenylate or deoxyadenylate (for RNA or DNA, respectively), C for cytidylate or deoxycytidylate, G for guanylate or deoxyguanylate, U for uridylate, T for deoxythymidylate, R for purines (A or G), Y for pyrimidines (C or T), K for G or T, H for A or C or T, I for inosine, and N for any nucleotide.

(21) A regulatory element generally refers to a transcriptional regulatory element involved in regulating the transcription of a nucleic acid molecule such as a gene or a target gene. The regulatory element is a nucleic acid and may include a promoter, an enhancer, an intron, a 5-untranslated region (5-UTR, also known as a leader sequence), or a 3-UTR or a combination thereof. A regulatory element may act in cis or trans, and generally it acts in cis, i.e. it activates expression of genes located on the same nucleic acid molecule, e.g. a chromosome, where the regulatory element is located. The nucleic acid molecule regulated by a regulatory element does not necessarily have to encode a functional peptide or polypeptide, e.g., the regulatory element can modulate the expression of a short interfering RNA or an anti-sense RNA.

(22) An enhancer element is any nucleic acid molecule that increases transcription of a nucleic acid molecule when functionally linked to a promoter regardless of its relative position. An enhancer may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter.

(23) A repressor (also sometimes called herein silencer) is defined as any nucleic acid molecule which inhibits the transcription when functionally linked to a promoter regardless of relative position.

(24) Promotors which may be useful in the methods and compositions provided include those containing cis elements, promoters functional in a plant cell, tissue specific and tissue-preferred promotors, developmentally regulated promoters and constitutive promoters. Promoter generally refers to a nucleic acid fragment capable of controlling transcription of another nucleic acid fragment. A promoter generally includes a core promoter (also known as minimal promoter) sequence that includes a minimal regulatory region to initiate transcription, that is a transcription start site. Generally, a core promoter includes a TATA box and a GC rich region associated with a CAAT box or a CCAAT box. These elements act to bind RNA polymerase II to the promoter and assist the polymerase in locating the RNA initiation site. Some promoters may not have a TATA box or CAAT box or a CCAAT box, but instead may contain an initiator element for the transcription initiation site. A core promoter is a minimal sequence required to direct transcription initiation and generally may not include enhancers or other UTRs. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. Core promoters are often modified to produce artificial, chimeric, or hybrid promoters, and can further be used in combination with other regulatory elements, such as cis-elements, 5UTRs, enhancers, or introns, that are either heterologous to an active core promoter or combined with its own partial or complete regulatory elements. Endogenous promotors are those sequences that are operably connected to a polypeptide coding sequence in the native gene and which regulate transcription of the polypeptide coding sequence in the plant. An endogenous promotor of a modified polynucleotide is one which is operably connected to and regulates or controls transcription of the unmodified version of the polynucleotide in the native, unmodified or wild-type plant.

(25) The term cis-element generally refers to transcriptional regulatory element that affects or modulates expression of an operably linked transcribable polynucleotide, where the transcribable polynucleotide is present in the same DNA sequence. A cis-element may function to bind transcription factors, which are trans-acting polypeptides that regulate transcription.

(26) Promoter functional in a plant is a promoter capable of initiating transcription in plant cells whether or not its origin is from a plant cell.

(27) Tissue-specific promoter and tissue-preferred promoter are used interchangeably to refer to a promoter that is expressed predominantly but not necessarily exclusively in one tissue or organ, but that may also be expressed in one specific cell.

(28) Developmentally regulated promoter generally refers to a promoter whose activity is determined by developmental events.

(29) Constitutive promoter generally refers to promoters active in all or most tissues or cell types of a plant at all or most developing stages. As with other promoters classified as constitutive (e.g. ubiquitin), some variation in absolute levels of expression can exist among different tissues or stages. The term constitutive promoter or tissue-independent are used interchangeably herein.

(30) Variant promotors can be used in the methods and compositions disclosed herein. A variant promoter as used herein, is the sequence of the promoter or the sequence of a functional fragment of a promoter containing changes in which one or more nucleotides of the original sequence is deleted, added, and/or substituted, while substantially maintaining promoter function. One or more base pairs can be inserted, deleted, or substituted internally to a promoter. In the case of a promoter fragment, variant promoters can include changes affecting the transcription of a minimal promoter to which it is operably linked. Variant promoters can be produced, for example, by standard DNA mutagenesis techniques or by chemically synthesizing the variant promoter or a portion thereof.

(31) Provided are sequences which are heterologous nucleotide sequences which can be used in the methods and compositions disclosed herein. A heterologous nucleotide sequence generally refers to a sequence that is not naturally occurring with the sequence of the disclosure. While this nucleotide sequence is heterologous to the sequence, it may be homologous, or native, or heterologous, or foreign, to the plant host. However, it is recognized that the instant sequences may be used with their native coding sequences to increase or decrease expression resulting in a change in phenotype in the transformed seed. The terms heterologous nucleotide sequence, heterologous sequence, heterologous nucleic acid fragment, and heterologous nucleic acid sequence are used interchangeably herein.

(32) Provided are functional fragments of the sequences disclosed herein. A functional fragment refers to a portion or subsequence of the sequence described in the present disclosure in which the active properties of the full-length sequence is retained. Fragments can be obtained via methods such as site-directed mutagenesis and synthetic construction. For example, for promoter sequences described or used herein, the functional fragments operate to promote the expression of an operably linked heterologous nucleotide sequence, forming a recombinant DNA construct (also, a chimeric gene). For example, the fragment can be used in the design of recombinant DNA constructs to produce the desired phenotype in a transformed plant. Recombinant DNA constructs can be designed for use in co-suppression or antisense by linking a promoter fragment in the appropriate orientation relative to a heterologous nucleotide sequence.

(33) A nucleic acid fragment that is functionally equivalent to the sequences of the present disclosure is any nucleic acid fragment that is capable of being expressed in a similar manner to the Target sequences of the present disclosure.

(34) In some aspects of the present disclosure, the fragments of polynucleotide sequences disclosed herein (such as SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 26, 29 or 30) can comprise at least about 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 7775, 800, 825, 850, 875, 900, 925, 950, 1000, 1025, 1050, 1075, 1100, 1125, 1150, 1175, 1200, 1225, 1250, 1275, 1300, 1325, 1350, 1375, 1400, 1420, 1450, 1475 or 1500 contiguous nucleotides, or at least about 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 7775, 800, 825, 850, 875, 900, 925, 950, 1000, 1025, 1050, 1075, 1100, 1125, 1150, 1175, 1200, 1225, 1250, 1275, 1300, 1325, 1350, 1375, 1400, 1420, 1450, 1475 or 1500 contiguous nucleotides of nucleic acid sequences encoding polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23. In another aspect of the present disclosure, the fragments can comprise at least about 250 contiguous nucleotides, or at least about 300 contiguous nucleotides, or at least about 350 contiguous nucleotides, or at least about 400 contiguous nucleotides, or at least about 450 contiguous nucleotides, or at least about 500 contiguous nucleotides, or at least about 550 contiguous nucleotides, or at least about 600 contiguous nucleotides, or at least about 650 contiguous nucleotides, or at least about 700 contiguous nucleotides, or at least about 750 contiguous nucleotides, or at least about 800 contiguous nucleotides, or at least about 850 contiguous nucleotides, or at least about 900 contiguous nucleotides, or at least about 950 contiguous nucleotides, or at least about 1000 contiguous nucleotides, or at least about 1050 contiguous nucleotides, or at least about 1110 contiguous nucleotides, or at least about 1150 contiguous nucleotides, or at least about 1200, or at least about 1250 contiguous nucleotides, or at least about 1300 contiguous nucleotides or at least about 1350 contiguous nucleotides and further may include a sequence encoding an amino acid modification corresponding to the substitutions described herein.

(35) Provided are sequences that are a full complement or a full-length complement of those disclosed herein, such as the nucleotide coding sequences in Table 1 containing the modifications disclosed herein. The terms full complement and full-length complement are used interchangeably herein, and refer to a complement of a given nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary.

(36) Provided are sequences that are substantially similar or corresponding substantially to those disclosed herein which can be used in the methods and compositions described herein. The terms substantially similar and corresponding substantially as used herein refer to nucleic acid fragments wherein changes in one or more nucleotide bases do not affect the ability of the nucleic acid fragment to mediate gene expression or produce a certain phenotype. These terms also refer to modifications of the nucleic acid fragments of the instant disclosure such as deletion or insertion of one or more nucleotides that do not substantially alter the functional properties of the resulting nucleic acid fragment relative to the initial, unmodified fragment. It is therefore understood, as those skilled in the art will appreciate, that the disclosure encompasses more than the specific exemplary sequences.

(37) Provided are compositions and methods that includes materials, steps, features, components, or elements that consist essentially of a particular component. The transitional phrase consisting essentially of generally refers to a composition, method that includes materials, steps, features, components, or elements, in addition to those literally disclosed, provided that these additional materials, steps, features, components, or elements do not materially affect the basic and novel characteristic(s) of the claimed subject matter, e.g., one or more of the claimed sequences.

(38) Isolated promoter sequences can be comprised in the methods and compositions, such as a recombinant DNA construct, of the present disclosure and can be modified to provide a range of constitutive expression levels of the heterologous nucleotide sequence. Thus, less than the entire promoter regions may be utilized and the ability to drive expression of the coding sequence retained. However, it is recognized that expression levels of the mRNA may be decreased with deletions of portions of the promoter sequences. Likewise, the tissue-independent, constitutive nature of expression may be changed.

(39) Modifications of the isolated promoter sequences of the present disclosure can provide for a range of constitutive expression of the heterologous nucleotide sequence. Thus, they may be modified to be weak constitutive promoters or strong constitutive promoters. Generally, by weak promoter is intended a promoter that drives expression of a coding sequence at a low level. By low level is intended levels about 1/10,000 transcripts to about 1/100,000 transcripts to about 1/500,000 transcripts. Conversely, a strong promoter drives expression of a coding sequence at high level, or at about 1/10 transcripts to about 1/100 transcripts to about 1/1,000 transcripts. Similarly, a moderate constitutive promoter is somewhat weaker than a strong constitutive promoter like the maize ubiquitin promoter.

(40) In addition to modulating gene expression, the expression modulating elements disclosed herein are also useful as probes or primers in nucleic acid hybridization experiments. The nucleic acid probes and primers hybridize under stringent conditions to a target DNA sequence. A probe is generally referred to an isolated/synthesized nucleic acid to which, is attached a conventional detectable label or reporter molecule, such as for example, a radioactive isotope, ligand, chemiluminescent agent, bioluminescent molecule, fluorescent label or dye, or enzyme. Such detectable labels may be covalently linked or otherwise physically associated with the probe. Primers generally referred to isolated/synthesized nucleic acids that hybridize to a complementary target DNA strand which is then extended along the target DNA strand by a polymerase, e.g., a DNA polymerase. Primer pairs often used for amplification of a target nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other conventional nucleic-acid amplification methods. Primers are also used for a variety of sequencing reactions, sequence captures, and other sequence-based amplification methodologies. Primers are generally about 15, 20, 25 nucleotides or more, and probes can also be longer about 30, 40, 50 and up to a few hundred base pairs. Such probes and primers are used in hybridization reactions to target DNA or RNA sequences under high stringency hybridization conditions or under lower stringency conditions, depending on the need.

(41) Moreover, the skilled artisan recognizes that substantially similar nucleic acid sequences encompassed by this disclosure are also defined by their ability to hybridize, under moderately stringent conditions (for example, 0.5SSC, 0.1% SDS, 60 C.) with the sequences exemplified herein, or to any portion of the nucleotide sequences reported herein and which are functionally equivalent to the promoter of the disclosure. Estimates of such homology are provided by either DNA-DNA or DNA-RNA hybridization under conditions of stringency as is well understood by those skilled in the art (Hames and Higgins, Eds.; In Nucleic Acid Hybridisation; IRL Press: Oxford, U.K., 1985). Stringency conditions can be adjusted to screen for moderately similar fragments, such as homologous sequences from distantly related organisms, to highly similar fragments, such as genes that duplicate functional enzymes from closely related organisms. Post-hybridization washes partially determine stringency conditions. One set of conditions uses a series of washes starting with 6SSC, 0.5% SDS at room temperature for 15 min, then repeated with 2SSC, 0.5% SDS at 45 C. for 30 min, and then repeated twice with 0.2SSC, 0.5% SDS at 50 C. for 30 min. Another set of stringent conditions uses higher temperatures in which the washes are identical to those above except for the temperature of the final two 30 min washes in 0.2SSC, 0.5% SDS was increased to 60 C. Another set of highly stringent conditions uses two final washes in 0.1SSC, 0.1% SDS at 65 C.

(42) In some embodiments, substantially similar nucleic acid sequences encompassed by this disclosure are those sequences that are at least about or about 80% identical to the nucleic acid fragments reported herein or which are at least about or about 80% identical to any portion of the nucleotide sequences reported herein. Nucleic acid fragments which are at least 90% or at least 95% identical to the nucleic acid sequences reported herein, or which are at least 90% or at least 95% identical to any portion of the nucleotide sequences reported herein are also provided. It is well understood by one skilled in the art that many levels of sequence identity are useful in identifying related polynucleotide sequences. Useful examples of percent identities are those listed above, or also preferred is any integer percentage from 70% to 100%, such as at least, at least about or about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100%. In some embodiments, the sequences may have at least about or about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% percent identity to positions 247 to 1512 of SEQ ID NO: 1, or to a sequence encoding positions 108-504 of SEQ ID NO: 2, or corresponding thereto.

(43) In one embodiment, the nucleotide sequences or isolated or modified sequences of the present disclosure comprise at least one modification disclosed herein and comprise a nucleotide sequence having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% sequence identity, based on the Clustal V method of alignment with pairwise alignment default parameters (KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4), when compared to the nucleotide sequence of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 26, 29 or 30 or encode polypeptides having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% sequence identity of SEQ ID NOS: 2, 4, 6, 10, 12, 1,4 16, 18, 20, 22, 24, 27 or 28. It is known to one of skilled in the art that a 5 UTR region can be altered (deletion or substitutions of bases) or replaced by an alternative 5UTR while maintaining promoter activity.

(44) In one embodiment, the polypeptide sequences or isolated or modified sequences of the present disclosure comprise a polypeptide sequence having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% sequence identity of SEQ ID NOS: 2, 4, 6, 8 10, 12, 1,4 16, 18, 20, 22, 24, 27 or 28.

(45) Provided are substantially similar sequences useful in compositions and methods provided herein. A substantially similar sequence generally refers to variants of the disclosed sequences such as those that result from site-directed mutagenesis, as well as synthetically derived sequences. A substantially similar promoter sequence of the present disclosure also generally refers to those fragments of a particular promoter nucleotide sequence disclosed herein that operate to promote the constitutive expression of an operably linked heterologous nucleic acid fragment. These promoter fragments comprise at least about 20 contiguous nucleotides, at least about 50 contiguous nucleotides, at least about 75 contiguous nucleotides, at least about 100 contiguous nucleotides of the particular promoter nucleotide sequence disclosed herein or a sequence that is at least 95 to about 99% identical to such contiguous sequences. The nucleotides of such fragments will usually include the TATA recognition sequence (or CAAT box or a CCAAT) of the particular promoter sequence. Such fragments may be obtained by use of restriction enzymes to cleave the naturally occurring promoter nucleotide sequences disclosed herein; by synthesizing a nucleotide sequence from the naturally occurring promoter DNA sequence; or may be obtained through the use of PCR technology. Variants of these promoter fragments, such as those resulting from site-directed mutagenesis, are encompassed by the compositions of the present disclosure.

(46) Provided are sequences which contain one or more degenerate codons to those provided in the sequence listing. Codon degeneracy generally refers to divergence in the genetic code permitting variation of the nucleotide sequence without affecting the amino acid sequence of an encoded polypeptide. Accordingly, the instant disclosure relates to any nucleic acid fragment comprising a nucleotide sequence that encodes all or a substantial portion of the amino acid sequences set forth herein. The skilled artisan is well aware of the codon-bias exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. Therefore, when synthesizing a nucleic acid fragment for improved expression in a host cell, it is desirable to design the nucleic acid fragment such that its frequency of codon usage approaches the frequency of preferred codon usage of the host cell.

(47) Sequence alignments and percent identity calculations may be determined using a variety of comparison methods designed to detect similar or identical sequences including, but not limited to, the MEGALIGN program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, WI). Unless stated otherwise, multiple alignment of the sequences provided herein were performed using the Clustal V method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal V method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. After alignment of the sequences, using the Clustal V program, it is possible to obtain percent identity and divergence values by viewing the sequence distances table on the same program; unless stated otherwise, percent identities and divergences provided and claimed herein were calculated in this manner.

(48) Alternatively, the Clustal W method of alignment may be used. The Clustal W method of alignment (described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci. 8:189-191 (1992)) can be found in the MegAlign v 6.1 program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Default parameters for multiple alignment correspond to GAP PENALTY=10, GAP LENGTH PENALTY=0.2, Delay Divergent Sequences=30%, DNA Transition Weight=0.5, Protein Weight Matrix=Gonnet Series, DNA Weight Matrix=IUB. For pairwise alignments the default parameters are Alignment=Slow-Accurate, Gap Penalty=10.0, Gap Length=0.10, Protein Weight Matrix=Gonnet 250 and DNA Weight Matrix=IUB. After alignment of the sequences using the Clustal W program, it is possible to obtain percent identity and divergence values by viewing the sequence distances table in the same program.

(49) In one embodiment the % sequence identity is determined over the entire length of the molecule (nucleotide or amino acid). A substantial portion of an amino acid or nucleotide sequence comprises enough of the amino acid sequence of a polypeptide or the nucleotide sequence of a gene to afford putative identification of that polypeptide or gene, either by manual evaluation of the sequence by one skilled in the art, or by computer-automated sequence comparison and identification using algorithms such as BLAST (Altschul, S. F. et al., J. Mol. Biol. 215:403-410 (1993)) and Gapped Blast (Altschul, S. F. et al., Nucleic Acids Res. 25:3389-3402 (1997)). BLASTN generally refers to a BLAST program that compares a nucleotide query sequence against a nucleotide sequence database.

(50) The present disclosure provides genes, mutated genes, modified genes, chimeric genes and recombinant expression constructs. Gene includes a nucleic acid fragment that expresses a functional molecule such as, but not limited to, a specific protein, including regulatory sequences preceding (5 non-coding sequences) and following (3 non-coding sequences) the coding sequence. Native gene generally refers to a gene as found in nature with its own regulatory sequences.

(51) A mutated gene or modified gene is a gene that has been altered through human intervention. Such a mutated gene or modified gene has a sequence that differs from the sequence of the corresponding non-mutated gene by at least one nucleotide addition, deletion, or substitution. In certain embodiments of the disclosure, the mutated gene comprises an alteration that results from a guide polynucleotide/Cas endonuclease system as disclosed herein. A mutated or modified plant is a plant comprising a mutated or modified gene.

(52) Chimeric gene or recombinant expression construct, which are used interchangeably, includes any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources.

(53) A mutated polynucleotide or modified polynucleotide is a polynucleotide that has been altered through human intervention. Such a mutated polynucleotide or modified polynucleotide has a sequence that differs from the sequence of the corresponding non-mutated or modified polypeptide by at least one nucleotide addition, deletion, or substitution. In certain embodiments of the disclosure, the mutated polynucleotide comprises an alteration that results from a guide polynucleotide/Cas endonuclease system as disclosed herein. A mutated or modified plant is a plant comprising a mutated or modified polynucleotide.

(54) Coding sequence generally refers to a polynucleotide sequence which codes for a specific amino acid sequence. Regulatory sequences refer to nucleotide sequences located upstream (5 non-coding sequences), within, or downstream (3 non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.

(55) An intron is an intervening sequence in a gene that is transcribed into RNA but is then excised in the process of generating the mature mRNA. The term is also used for the excised RNA sequences. An exon is a portion of the sequence of a gene that is transcribed and is found in the mature messenger RNA derived from the gene, but is not necessarily a part of the sequence that encodes the final gene product.

(56) The 5 untranslated region (5UTR) (also known as a translational leader sequence or leader RNA) is the region of an mRNA that is directly upstream from the initiation codon. This region is involved in the regulation of translation of a transcript by differing mechanisms in viruses, prokaryotes and eukaryotes.

(57) The 3 non-coding sequences refer to DNA sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3 end of the mRNA precursor.

(58) RNA transcript generally refers to a product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When an RNA transcript is a perfect complimentary copy of a DNA sequence, it is referred to as a primary transcript or it may be a RNA sequence derived from posttranscriptional processing of a primary transcript and is referred to as a mature RNA. Messenger RNA (mRNA) generally refers to RNA that is without introns and that can be translated into protein by the cell. cDNA generally refers to a DNA that is complementary to and synthesized from an mRNA template using the enzyme reverse transcriptase. The cDNA can be single-stranded or converted into the double-stranded by using the Klenow fragment of DNA polymerase I. Sense RNA generally refers to RNA transcript that includes mRNA and so can be translated into protein within a cell or in vitro. Antisense RNA generally refers to a RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks expression or transcripts accumulation of a target gene. The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e. at the 5 non-coding sequence, 3 non-coding sequence, introns, or the coding sequence. Functional RNA generally refers to antisense RNA, ribozyme RNA, or other RNA that may not be translated but yet has an effect on cellular processes.

(59) The term operably linked or functionally linked generally refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.

(60) The terms initiate transcription, initiate expression, drive transcription, and drive expression are used interchangeably herein and all refer to the primary function of a promoter. As detailed throughout this disclosure, a promoter is a non-coding genomic DNA sequence, usually upstream (5) to the relevant coding sequence, and its primary function is to act as a binding site for RNA polymerase and initiate transcription by the RNA polymerase. Additionally, there is expression of RNA, including functional RNA, or the expression of polypeptide for operably linked encoding nucleotide sequences, as the transcribed RNA ultimately is translated into the corresponding polypeptide.

(61) The term expression, as used herein, generally refers to the production of a functional end-product e.g., an mRNA or a protein (precursor or mature).

(62) The term expression cassette as used herein, generally refers to a discrete nucleic acid fragment into which a nucleic acid sequence or fragment can be cloned or synthesized through molecular biology techniques.

(63) Expression or overexpression of a gene involves transcription of the gene and translation of the mRNA into a precursor or mature protein. Antisense inhibition generally refers to the production of antisense RNA transcripts capable of suppressing the expression of the target protein. Overexpression generally refers to the production of a gene product in transgenic organisms that exceeds levels of production in normal or non-transformed organisms. Co-suppression generally refers to the production of sense RNA transcripts capable of suppressing the expression or transcript accumulation of identical or substantially similar foreign or endogenous genes (U.S. Pat. No. 5,231,020). The mechanism of co-suppression may be at the DNA level (such as DNA methylation), at the transcriptional level, or at post-transcriptional level.

(64) As stated herein, suppression includes a reduction of the level of enzyme activity or protein functionality (e.g., a phenotype associated with a protein) detectable in a transgenic plant when compared to the level of enzyme activity or protein functionality detectable in a non-transgenic or wild type plant with the native enzyme or protein. The level of enzyme activity in a plant with the native enzyme is referred to herein as wild type activity. The level of protein functionality in a plant with the native protein is referred to herein as wild type functionality. The term suppression includes lower, reduce, decline, decrease, inhibit, eliminate and prevent. This reduction may be due to a decrease in translation of the native mRNA into an active enzyme or functional protein. It may also be due to the transcription of the native DNA into decreased amounts of mRNA and/or to rapid degradation of the native mRNA. The term native enzyme generally refers to an enzyme that is produced naturally in a non-transgenic or wild type cell. The terms non-transgenic and wild type are used interchangeably herein.

(65) Altering expression or modulating expression generally refers to the production of gene product(s) in plants in amounts or proportions that differ significantly from the amount of the gene product(s) produced by the corresponding wild-type plants (i.e., expression is increased or decreased).

(66) Transformation as used herein generally refers to both stable transformation and transient transformation.

(67) Stable transformation generally refers to the introduction of a nucleic acid fragment into a genome of a host organism resulting in genetically stable inheritance. Once stably transformed, the nucleic acid fragment is stably integrated in the genome of the host organism and any subsequent generation. Host organisms containing the transformed nucleic acid fragments are referred to as transgenic organisms.

(68) Transient transformation generally refers to the introduction of a nucleic acid fragment into the nucleus, or DNA-containing organelle, of a host organism resulting in gene expression without genetically stable inheritance.

(69) The term introduced means providing a nucleic acid (e.g., expression construct) or protein into a cell. Introduced includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell, and includes reference to the transient provision of a nucleic acid or protein to the cell. Introduced includes reference to stable or transient transformation methods, as well as sexually crossing. Thus, introduced in the context of inserting a nucleic acid fragment (e.g., a recombinant DNA construct/expression construct) into a cell, means transfection or transformation or transduction and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).

(70) Genome as it applies to plant cells encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components (e.g., mitochondrial, plastid) of the cell.

(71) Genetic modification generally refers to modification of any nucleic acid sequence or genetic element by insertion, deletion, or substitution of one or more nucleotides in an endogenous nucleotide sequence by genome editing or by insertion of a recombinant nucleic acid, e.g., as part of a vector or construct in any region of the plant genomic DNA by routine transformation techniques. Examples of modification of genetic components include, but are not limited to, polypeptide coding sequences, promoter regions, 5 untranslated leaders, introns, genes, 3 untranslated regions, and other regulatory sequences or sequences that affect transcription or translation of one or more nucleic acid sequences.

(72) In an embodiment the seeds, such as soybean seeds, have an increased oil or fatty acid content as described herein, and optionally modified amounts of fatty acids, such as at least a 5%, 10%, 15%, 20%, 25%, 30%, 40%, or 50% increase in oleic acid content expressed by weight as a proportion of the total fatty acid content as described herein. The seeds, such a soybean seeds may have an increased protein content of at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20% or 25% by weight.

(73) In an embodiment, this disclosure concerns host cells comprising either the recombinant DNA constructs of the disclosure as described herein or isolated polynucleotides of the disclosure as described herein. Examples of host cells which can be used to practice the disclosure include, but are not limited to, yeast, bacteria, and plants.

(74) Plasmid vectors comprising the instant recombinant DNA construct can be constructed. The choice of plasmid vector is dependent upon the method that will be used to transform host cells. The skilled artisan is well aware of the genetic elements that must be present on the plasmid vector in order to successfully transform, select and propagate host cells containing the chimeric gene.

(75) I. Gene Editing

(76) In some embodiments, gene editing may be facilitated through the induction of a double-stranded break (DSB) or single-strand break, in a defined position in the genome near the desired alteration. DSBs can be induced using any DSB-inducing agent available, including, but not limited to, TALENs, meganucleases, zinc finger nucleases, Cas9-gRNA systems (based on bacterial CRISPR-Cas systems), guided cpf1 endonuclease systems, and the like. In some embodiments, the introduction of a DSB can be combined with the introduction of a polynucleotide modification template.

(77) A polynucleotide modification template can be introduced into a cell by any method known in the art, such as, but not limited to, transient introduction methods, transfection, electroporation, microinjection, particle mediated delivery, topical application, whiskers mediated delivery, delivery via cell-penetrating peptides, or mesoporous silica nanoparticle (MSN)-mediated direct delivery.

(78) The polynucleotide modification template can be introduced into a cell as a single stranded polynucleotide molecule, a double stranded polynucleotide molecule, or as part of a circular DNA (vector DNA). The polynucleotide modification template can also be tethered to the guide RNA and/or the Cas endonuclease. Tethered DNAs can allow for co-localizing target and template DNA, useful in genome editing and targeted genome regulation, and can also be useful in targeting post-mitotic cells where function of endogenous HR machinery is expected to be highly diminished (Mali et al. 2013 Nature Methods Vol. 10: 957-963.) The polynucleotide modification template may be present transiently in the cell or it can be introduced via a viral replicon.

(79) A modified nucleotide or edited nucleotide refers to a nucleotide sequence of interest that comprises at least one alteration when compared to its non-modified nucleotide sequence. Such alterations include, for example: (i) replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, or (iv) any combination of (i)-(iii).

(80) The term polynucleotide modification template includes a polynucleotide that comprises at least one nucleotide modification when compared to the nucleotide sequence to be edited. A nucleotide modification can be at least one nucleotide substitution, addition or deletion. Optionally, the polynucleotide modification template can further comprise homologous nucleotide sequences flanking the at least one nucleotide modification, wherein the flanking homologous nucleotide sequences provide sufficient homology to the desired nucleotide sequence to be edited.

(81) The process for editing a genomic sequence combining DSB and modification templates generally comprises: providing to a host cell, a DSB-inducing agent, or a nucleic acid encoding a DSB-inducing agent, that recognizes a target sequence in the chromosomal sequence and is able to induce a DSB in the genomic sequence, and at least one polynucleotide modification template comprising at least one nucleotide alteration when compared to the nucleotide sequence to be edited. The polynucleotide modification template can further comprise nucleotide sequences flanking the at least one nucleotide alteration, in which the flanking sequences are substantially homologous to the chromosomal region flanking the DSB.

(82) The endonuclease can be provided to a cell by any method known in the art, for example, but not limited to transient introduction methods, transfection, microinjection, and/or topical application or indirectly via recombination constructs. The endonuclease can be provided as a protein or as a guided polynucleotide complex directly to a cell or indirectly via recombination constructs. The endonuclease can be introduced into a cell transiently or can be incorporated into the genome of the host cell using any method known in the art. In the case of a CRISPR-Cas system, uptake of the endonuclease and/or the guided polynucleotide into the cell can be facilitated with a Cell Penetrating Peptide (CPP) as described in WO2016073433 published May 12, 2016.

(83) As used herein, a genomic region is a segment of a chromosome in the genome of a cell that is present on either side of the target site or, alternatively, also comprises a portion of the target site. The genomic region can comprise at least 5-10, 5-15, 5-20, 5-25, 5-30, 5-35, 5-40, 5-45, 5-50, 5-55, 5-60, 5-65, 5-70, 5-75, 5-80, 5-85, 5-90, 5-95, 5-100, 5-200, 5-300, 5-400, 5-500, 5-600, 5-700, 5-800, 5-900, 5-1000, 5-1100, 5-1200, 5-1300, 5-1400, 5-1500, 5-1600, 5-1700, 5-1800, 5-1900, 5-2000, 5-2100, 5-2200, 5-2300, 5-2400, 5-2500, 5-2600, 5-2700, 5-2800. 5-2900, 5-3000, 5-3100 or more bases such that the genomic region has sufficient homology to undergo homologous recombination with the corresponding region of homology.

(84) TAL effector nucleases (TALEN) are a class of sequence-specific nucleases that can be used to make double-strand breaks at specific target sequences in the genome of a plant or other organism. (Miller et al. (2011) Nature Biotechnology 29:143-148).

(85) Endonucleases are enzymes that cleave the phosphodiester bond within a polynucleotide chain. Endonucleases include restriction endonucleases, which cleave DNA at specific sites without damaging the bases, and meganucleases, also known as homing endonucleases (HEases), which like restriction endonucleases, bind and cut at a specific recognition site, however the recognition sites for meganucleases are typically longer, about 18 bp or more (patent application PCT/US12/30061, filed on Mar. 22, 2012). Meganucleases have been classified into four families based on conserved sequence motifs, the families are the LAGLIDADG, GIY-YIG, HNH, and His-Cys box families. These motifs participate in the coordination of metal ions and hydrolysis of phosphodiester bonds. HEases are notable for their long recognition sites, and for tolerating some sequence polymorphisms in their DNA substrates. The naming convention for meganuclease is similar to the convention for other restriction endonuclease. Meganucleases are also characterized by prefix F-, I-, or PI- for enzymes encoded by free-standing ORFs, introns, and inteins, respectively. One step in the recombination process involves polynucleotide cleavage at or near the recognition site. The cleaving activity can be used to produce a double-strand break. For reviews of site-specific recombinases and their recognition sites, see, Sauer (1994) Curr Op Biotechnol 5:521-7; and Sadowski (1993) FASEB 7:760-7. In some examples the recombinase is from the Integrase or Resolvase families.

(86) Zinc finger nucleases (ZFNs) are engineered double-strand break inducing agents comprised of a zinc finger DNA binding domain and a double-strand-break-inducing agent domain. Recognition site specificity is conferred by the zinc finger domain, which typically comprising two, three, or four zinc fingers, for example having a C2H2 structure, however other zinc finger structures are known and have been engineered. Zinc finger domains are amenable for designing polypeptides which specifically bind a selected polynucleotide recognition sequence. ZFNs include an engineered DNA-binding zinc finger domain linked to a non-specific endonuclease domain, for example nuclease domain from a Type IIs endonuclease such as Fokl. Additional functionalities can be fused to the zinc-finger binding domain, including transcriptional activator domains, transcription repressor domains, and methylases. In some examples, dimerization of nuclease domain is required for cleavage activity. Each zinc finger recognizes three consecutive base pairs in the target DNA. For example, a 3 finger domain recognized a sequence of 9 contiguous nucleotides, with a dimerization requirement of the nuclease, two sets of zinc finger triplets are used to bind an 18 nucleotide recognition sequence.

(87) Genome editing using DSB-inducing agents, such as Cas9-gRNA complexes, has been described, for example in U.S. Patent Application US 2015-0082478 A1, published on Mar. 19, 2015, WO2015/026886 A1, published on Feb. 26, 2015, WO2016007347, published on Jan. 14, 2016, and WO201625131, published on Feb. 18, 2016, all of which are incorporated by reference herein.

(88) The term Cas gene herein refers to a gene that is generally coupled, associated or close to, or in the vicinity of flanking CRISPR loci in bacterial systems. The terms Cas gene, CRISPR-associated (Cas) gene are used interchangeably herein. The term Cas endonuclease herein refers to a protein encoded by a Cas gene. A Cas endonuclease herein, when in complex with a suitable polynucleotide component, is capable of recognizing, binding to, and optionally nicking or cleaving all or part of a specific DNA target sequence. A Cas endonuclease described herein comprises one or more nuclease domains. Cas endonucleases of the disclosure includes those having a HNH or HNH-like nuclease domain and/or a RuvC or RuvC-like nuclease domain. A Cas endonuclease of the disclosure includes a Cas9 protein, a Cpf1 protein, a C2c1 protein, a C2c2 protein, a C2c3 protein, Cas3, Cas 5, Cas7, Cas8, Cas10, or complexes of these.

(89) As used herein, the terms guide polynucleotide/Cas endonuclease complex, guide polynucleotide/Cas endonuclease system, guide polynucleotide/Cas complex, guide polynucleotide/Cas system, guided Cas system are used interchangeably herein and refer to at least one guide polynucleotide and at least one Cas endonuclease that are capable of forming a complex, wherein the guide polynucleotide/Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) the DNA target site. A guide polynucleotide/Cas endonuclease complex herein can comprise Cas protein(s) and suitable polynucleotide component(s) of any of the four known CRISPR systems (Horvath and Barrangou, 2010, Science 327:167-170) such as a type I, II, or III CRISPR system. A Cas endonuclease unwinds the DNA duplex at the target sequence and optionally cleaves at least one DNA strand, as mediated by recognition of the target sequence by a polynucleotide (such as, but not limited to, a crRNA or guide RNA) that is in complex with the Cas protein. Such recognition and cutting of a target sequence by a Cas endonuclease typically occurs if the correct protospacer-adjacent motif (PAM) is located at or adjacent to the 3 end of the DNA target sequence. Alternatively, a Cas protein herein may lack DNA cleavage or nicking activity, but can still specifically bind to a DNA target sequence when complexed with a suitable RNA component. (See also U.S. Patent Application US 2015-0082478 A1, published on Mar. 19, 2015 and US 2015-0059010 A1, published on Feb. 26, 2015, both are hereby incorporated in its entirety by reference).

(90) A guide polynucleotide/Cas endonuclease complex can cleave one or both strands of a DNA target sequence. A guide polynucleotide/Cas endonuclease complex that can cleave both strands of a DNA target sequence typically comprise a Cas protein that has all of its endonuclease domains in a functional state (e.g., wild type endonuclease domains or variants thereof retaining some or all activity in each endonuclease domain). Non-limiting examples of Cas9 nickases suitable for use herein are disclosed in U.S. Patent Appl. Publ. No. 2014/0189896, which is incorporated herein by reference.

(91) Other Cas endonuclease systems have been described in PCT patent applications PCT/US16/32073, filed May 12, 2016 and PCT/US16/32028 filed May 12, 2016, both applications incorporated herein by reference.

(92) Cas9 (formerly referred to as Cas5, Csn1, or Csx12) herein refers to a Cas endonuclease of a type II CRISPR system that forms a complex with a crNucleotide and a tracrNucleotide, or with a single guide polynucleotide, for specifically recognizing and cleaving all or part of a DNA target sequence. Cas9 protein comprises a RuvC nuclease domain and an HNH (HNH) nuclease domain, each of which can cleave a single DNA strand at a target sequence (the concerted action of both domains leads to DNA double-strand cleavage, whereas activity of one domain leads to a nick). In general, the RuvC domain comprises subdomains I, II and III, where domain I is located near the N-terminus of Cas9 and subdomains II and III are located in the middle of the protein, flanking the HNH domain (Hsu et al, Cell 157:1262-1278). A type II CRISPR system includes a DNA cleavage system utilizing a Cas9 endonuclease in complex with at least one polynucleotide component. For example, a Cas9 can be in complex with a CRISPR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA). In another example, a Cas9 can be in complex with a single guide RNA.

(93) Any guided endonuclease can be used in the methods disclosed herein. Such endonucleases include, but are not limited to Cas9 and Cpf1 endonucleases. Many endonucleases have been described to date that can recognize specific PAM sequences (see for exampleJinek et al. (2012) Science 337 p 816-821, PCT patent applications PCT/US16/32073, filed May 12, 2016 and PCT/US16/32028 filed May 12, 2016 and Zetsche B et al. 2015. Cell 163, 1013) and cleave the target DNA at a specific position. It is understood that based on the methods and embodiments described herein utilizing a guided Cas system one can now tailor these methods such that they can utilize any guided endonuclease system.

(94) The guide polynucleotide can also be a single molecule (also referred to as single guide polynucleotide) comprising a crNucleotide sequence linked to a tracrNucleotide sequence. The single guide polynucleotide comprises a first nucleotide sequence domain (referred to as Variable Targeting domain or VT domain) that can hybridize to a nucleotide sequence in a target DNA and a Cas endonuclease recognition domain (CER domain), that interacts with a Cas endonuclease polypeptide. By domain it is meant a contiguous stretch of nucleotides that can be RNA, DNA, and/or RNA-DNA-combination sequence. The VT domain and/or the CER domain of a single guide polynucleotide can comprise a RNA sequence, a DNA sequence, or a RNA-DNA-combination sequence. The single guide polynucleotide being comprised of sequences from the crNucleotide and the tracrNucleotide may be referred to as single guide RNA (when composed of a contiguous stretch of RNA nucleotides) or single guide DNA (when composed of a contiguous stretch of DNA nucleotides) or single guide RNA-DNA (when composed of a combination of RNA and DNA nucleotides). The single guide polynucleotide can form a complex with a Cas endonuclease, wherein the guide polynucleotide/Cas endonuclease complex (also referred to as a guide polynucleotide/Cas endonuclease system) can direct the Cas endonuclease to a genomic target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) the target site. (See also U.S. Patent Application US 2015-0082478 A1, published on Mar. 19, 2015 and US 2015-0059010 A1, published on Feb. 26, 2015, both are hereby incorporated in its entirety by reference.)

(95) The term variable targeting domain or VT domain is used interchangeably herein and includes a nucleotide sequence that can hybridize (is complementary) to one strand (nucleotide sequence) of a double strand DNA target site. In some embodiments, the variable targeting domain comprises a contiguous stretch of 12 to 30 nucleotides. The variable targeting domain can be composed of a DNA sequence, a RNA sequence, a modified DNA sequence, a modified RNA sequence, or any combination thereof.

(96) The terms single guide RNA and sgRNA are used interchangeably herein and relate to a synthetic fusion of two RNA molecules, a crRNA (CRISPR RNA) comprising a variable targeting domain (linked to a tracr mate sequence that hybridizes to a tracrRNA), fused to a tracrRNA (trans-activating CRISPR RNA). The single guide RNA can comprise a crRNA or crRNA fragment and a tracrRNA or tracrRNA fragment of the type II CRISPR/Cas system that can form a complex with a type II Cas endonuclease, wherein the guide RNA/Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) the DNA target site.

(97) The terms guide RNA/Cas endonuclease complex, guide RNA/Cas endonuclease system, guide RNA/Cas complex, guide RNA/Cas system, gRNA/Cas complex, gRNA/Cas system, RNA-guided endonuclease, RGEN are used interchangeably herein and refer to at least one RNA component and at least one Cas endonuclease that are capable of forming a complex, wherein the guide RNA/Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) the DNA target site. A guide RNA/Cas endonuclease complex herein can comprise Cas protein(s) and suitable RNA component(s) of any of the four known CRISPR systems (Horvath and Barrangou, 2010, Science 327:167-170) such as a type I, II, or III CRISPR system. A guide RNA/Cas endonuclease complex can comprise a Type II Cas9 endonuclease and at least one RNA component (e.g., a crRNA and tracrRNA, or a gRNA). (See also U.S. Patent Application US 2015-0082478 A1, published on Mar. 19, 2015 and US 2015-0059010 A1, published on Feb. 26, 2015, both are hereby incorporated in its entirety by reference).

(98) The guide polynucleotide can be introduced into a cell transiently, as single stranded polynucleotide or a double stranded polynucleotide, using any method known in the art such as, but not limited to, particle bombardment, Agrobacterium transformation or topical applications. The guide polynucleotide can also be introduced indirectly into a cell by introducing a recombinant DNA molecule (via methods such as, but not limited to, particle bombardment or Agrobacterium transformation) comprising a heterologous nucleic acid fragment encoding a guide polynucleotide, operably linked to a specific promoter that is capable of transcribing the guide RNA in the cell. The specific promoter can be, but is not limited to, a RNA polymerase III promoter, which allow for transcription of RNA with precisely defined, unmodified, 5- and 3-ends (DiCarlo et al., Nucleic Acids Res. 41: 4336-4343; Ma et al., Mol. Ther. Nucleic Acids 3:e161) as described in WO2016025131, published on Feb. 18, 2016, incorporated herein in its entirety by reference.

(99) The terms target site, target sequence, target site sequence, target DNA, target locus, genomic target site, genomic target sequence, genomic target locus and protospacer, are used interchangeably herein and refer to a polynucleotide sequence such as, but not limited to, a nucleotide sequence on a chromosome, episome, or any other DNA molecule in the genome (including chromosomal, chloroplastic, mitochondrial DNA, plasmid DNA) of a cell, at which a guide polynucleotide/Cas endonuclease complex can recognize, bind to, and optionally nick or cleave. The target site can be an endogenous site in the genome of a cell, or alternatively, the target site can be heterologous to the cell and thereby not be naturally occurring in the genome of the cell, or the target site can be found in a heterologous genomic location compared to where it occurs in nature. As used herein, terms endogenous target sequence and native target sequence are used interchangeable herein to refer to a target sequence that is endogenous or native to the genome of a cell and is at the endogenous or native position of that target sequence in the genome of the cell. Cells include, but are not limited to, human, non-human, animal, bacterial, fungal, insect, yeast, non-conventional yeast, and plant cells as well as plants and seeds produced by the methods described herein. An artificial target site or artificial target sequence are used interchangeably herein and refer to a target sequence that has been introduced into the genome of a cell. Such an artificial target sequence can be identical in sequence to an endogenous or native target sequence in the genome of a cell but be located in a different position (i.e., a non-endogenous or non-native position) in the genome of a cell.

(100) Provided are plants and seeds which contain an altered or modified target site or sequence. An altered target site, altered target sequence, modified target site, modified target sequence are used interchangeably herein and refer to a target sequence as disclosed herein that comprises at least one alteration when compared to non-altered target sequence. Such alterations include, for example: (i) replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, or (iv) any combination of (i)-(iii).

(101) Methods for modifying a target site and altering a target site are used interchangeably herein and refer to methods for producing an altered target site.

(102) The length of the target DNA sequence (target site) can vary, and includes, for example, target sites that are at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides in length. It is further possible that the target site can be palindromic, that is, the sequence on one strand reads the same in the opposite direction on the complementary strand. The nick/cleavage site can be within the target sequence or the nick/cleavage site could be outside of the target sequence. In another variation, the cleavage could occur at nucleotide positions immediately opposite each other to produce a blunt end cut or, in other Cases, the incisions could be staggered to produce single-stranded overhangs, also called sticky ends, which can be either 5 overhangs, or 3 overhangs. Active variants of genomic target sites can also be used. Such active variants can comprise at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the given target site, wherein the active variants retain biological activity and hence are capable of being recognized and cleaved by an Cas endonuclease. Assays to measure the single or double-strand break of a target site by an endonuclease are known in the art and generally measure the overall activity and specificity of the agent on DNA substrates containing recognition sites.

(103) A protospacer adjacent motif (PAM) herein refers to a short nucleotide sequence adjacent to a target sequence (protospacer) that is recognized (targeted) by a guide polynucleotide/Cas endonuclease system described herein. The Cas endonuclease may not successfully recognize a target DNA sequence if the target DNA sequence is not followed by a PAM sequence. The sequence and length of a PAM herein can differ depending on the Cas protein or Cas protein complex used. The PAM sequence can be of any length but is typically 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides long.

(104) The terms targeting, gene targeting and DNA targeting are used interchangeably herein. DNA targeting herein may be the specific introduction of a knock-out, edit, or knock-in at a particular DNA sequence, such as in a chromosome or plasmid of a cell. In general, DNA targeting can be performed herein by cleaving one or both strands at a specific DNA sequence in a cell with an endonuclease associated with a suitable polynucleotide component. Such DNA cleavage, if a double-strand break (DSB), can prompt NHEJ or HDR processes which can lead to modifications at the target site.

(105) Methods to modify or alter endogenous genomic DNA are known in the art. In some aspects, methods and compositions are provided for modifying naturally-occurring polynucleotides or integrated transgenic sequences, including regulatory elements, coding sequences, and non-coding sequences. These methods and compositions are also useful in targeting nucleic acids to pre-engineered target recognition sequences in the genome. Modification of polynucleotides may be accomplished, for example, by introducing single- or double-strand breaks into the DNA molecule.

(106) Double-strand breaks induced by double-strand-break-inducing agents, such as endonucleases that cleave the phosphodiester bond within a polynucleotide chain, can result in the induction of DNA repair mechanisms, including the non-homologous end-joining pathway, and homologous recombination. Endonucleases include a range of different enzymes, including restriction endonucleases (see e.g. Roberts et al., (2003) Nucleic Acids Res 1:418-20), Roberts et al., (2003) Nucleic Acids Res 31:1805-12, and Belfort et al., (2002) in Mobile DNA II, pp. 761-783, Eds. Craigie et al., (ASM Press, Washington, DC)), meganucleases (see e.g., WO 2009/114321; Gao et al. (2010) Plant Journal 1:176-187), TAL effector nucleases or TALENs (see e.g., US20110145940, Christian, M., T. Cermak, et al. 2010. Targeting DNA double-strand breaks with TAL effector nucleases. Genetics 186(2): 757-61 and Boch et al., (2009), Science 326(5959): 1509-12), zinc finger nucleases (see e.g. Kim, Y. G., J. Cha, et al. (1996). Hybrid restriction enzymes: zinc finger fusions to Fokl cleavage), and CRISPR-Cas endonucleases (see e.g. WO2007/025097 application published Mar. 1, 2007).

(107) Once a double-strand break is induced in the genome, cellular DNA repair mechanisms are activated to repair the break. There are two DNA repair pathways. One is termed nonhomologous end-joining (NHEJ) pathway (Bleuyard et al., (2006) DNA Repair 5:1-12) and the other is homology-directed repair (HDR). The structural integrity of chromosomes is typically preserved by NHEJ, but deletions, insertions, or other rearrangements (such as chromosomal translocations) are possible (Siebert and Puchta, 2002, Plant Cell 14:1121-31; Pacher et al., 2007, Genetics 175:21-9. The HDR pathway is another cellular mechanism to repair double-stranded DNA breaks, and includes homologous recombination (HR) and single-strand annealing (SSA) (Lieber. 2010 Annu. Rev. Biochem. 79:181-211).

(108) In addition to the double-strand break inducing agents, site-specific base conversions can also be achieved to engineer one or more nucleotide changes to create one or more EMEs described herein into the genome. These include for example, a site-specific base edit mediated by an CG to TA or an AT to GC base editing deaminase enzymes (Gaudelli et al., Programmable base editing of AT to GC in genomic DNA without DNA cleavage. Nature (2017); Nishida et al. Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Science 353 (6305) (2016); Komor et al. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 533 (7603) (2016):420-4.

(109) A targeting method herein can be performed in such a way that two or more DNA target sites are targeted in the method, for example. Such a method can optionally be characterized as a multiplex method. Two, three, four, five, six, seven, eight, nine, ten, or more target sites can be targeted at the same time in certain embodiments. A multiplex method is typically performed by a targeting method herein in which multiple different RNA components are provided, each designed to guide a guide polynucleotide/Cas endonuclease complex to a unique DNA target site.

(110) Plant includes reference to whole plants, plant organs, plant tissues, seeds and plant cells and progeny of same. Plant cells include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores.

(111) Provided are plants which are dicots. The terms dicot and dicotyledonous plant are used interchangeably herein. A dicot of the current disclosure includes the following families: Brassicaceae, Leguminosae, and Solanaceae.

(112) Progeny plants are provided. Progeny comprises any subsequent generation of a plant, and can include F1 progeny, F2 progeny F3 progeny and so on.

(113) The heterologous polynucleotide can be stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant DNA construct. The alterations of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods, by genome editing procedures that do not result in an insertion of a foreign polynucleotide, or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation are also methods of modifying a host genome.

(114) Transient expression generally refers to the temporary expression of often reporter genes such as -glucuronidase (GUS), fluorescent protein genes ZS-GREEN1, ZS-YELLOW1 N1, AM-CYAN1, DS-RED in selected certain cell types of the host organism in which the transgenic gene is introduced temporally by a transformation method. The transformed materials of the host organism are subsequently discarded after the transient gene expression assay.

(115) Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J. et al., In Molecular Cloning: A Laboratory Manual; 2nd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, 1989 (hereinafter Sambrook et al., 1989) or Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K., Eds.; In Current Protocols in Molecular Biology; John Wiley and Sons: New York, 1990 (hereinafter Ausubel et al., 1990).

(116) PCR or Polymerase Chain Reaction is a technique for the synthesis of large quantities of specific DNA segments, consisting of a series of repetitive cycles (Perkin Elmer Cetus Instruments, Norwalk, CT). Typically, the double stranded DNA is heat denatured, the two primers complementary to the 3 boundaries of the target segment are annealed at low temperature and then extended at an intermediate temperature. One set of these three consecutive steps comprises a cycle.

(117) Provided are plasmids, vectors and cassettes which contain one or more of the sequences provided, including any combination of sequence components disclosed in the Examples. The terms plasmid, vector and cassette refer to an extra chromosomal element often carrying genes that are not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA fragments. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3 untranslated sequence into a cell.

(118) Provided are recombinant DNA constructs or recombinant expression constructs which contain the sequences disclosed herein, including any combination of sequence components disclosed in the Examples. The term recombinant DNA construct or recombinant expression construct is used interchangeably and generally refers to a discrete polynucleotide into which a nucleic acid sequence or fragment can be moved. Preferably, it is a plasmid vector or a fragment thereof comprising the promoters of the present disclosure. The choice of plasmid vector is dependent upon the method that will be used to transform host plants. The skilled artisan is well aware of the genetic elements that must be present on the plasmid vector in order to successfully transform, select and propagate host cells containing the chimeric gene. The skilled artisan will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et al., EMBO J. 4:2411-2418 (1985); De Almeida et al., Mol. Gen. Genetics 218:78-86 (1989)), and thus that multiple events must be screened in order to obtain lines displaying the desired expression level and pattern. Such screening may be accomplished by PCR and Southern analysis of DNA, RT-PCR and Northern analysis of mRNA expression, Western analysis of protein expression, or phenotypic analysis.

(119) Further uses for guide RNA/Cas endonuclease systems have been described (See U.S. Patent Application US 2015-0082478 A1, published on Mar. 19, 2015, WO2015/026886 A1, published on Feb. 26, 2015, US 2015-0059010 A1, published on Feb. 26, 2015, US application publication 2017-0306349, filed on Jul. 7, 2014, and US application publication 2017-0226533, filed on Aug. 13, 2014, all of which are incorporated by reference herein) and include but are not limited to modifying or replacing nucleotide sequences of interest (such as a regulatory elements), insertion of polynucleotides of interest, gene knock-out, gene-knock in, modification of splicing sites and/or introducing alternate splicing sites, modifications of nucleotide sequences encoding a protein of interest, amino acid and/or protein fusions, and gene silencing by expressing an inverted repeat into a gene of interest.

(120) Methods for transforming dicots, primarily by use of Agrobacterium tumefaciens, and obtaining transgenic plants have been published, among others, for cotton (U.S. Pat. Nos. 5,004,863, 5,159,135); soybean (U.S. Pat. Nos. 5,569,834, 5,416,011); Brassica (U.S. Pat. No. 5,463,174); peanut (Cheng et al., Plant Cell Rep. 15:653-657 (1996), McKently et al., Plant Cell Rep. 14:699-703 (1995)); papaya (Ling et al., Bio/technology 9:752-758 (1991)); and pea (Grant et al., Plant Cell Rep. 15:254-258 (1995)). For a review of other commonly used methods of plant transformation see Newell, C. A., Mol. Biotechnol. 16:53-65 (2000). One of these methods of transformation uses Agrobacterium rhizogenes (Tepfler, M. and Casse-Delbart, F., Microbiol. Sci. 4:24-28 (1987)). Transformation of soybeans using direct delivery of DNA has been published using PEG fusion (PCT Publication No. WO 92/17598), electroporation (Chowrira et al., Mol. Biotechnol. 3:17-23 (1995); Christou et al., Proc. Natl. Acad. Sci. U.S.A. 84:3962-3966 (1987)), microinjection, or particle bombardment (McCabe et al., Biotechnology 6:923-926 (1988); Christou et al., Plant Physiol. 87:671-674 (1988)).

(121) There are a variety of methods for the regeneration of plants from plant tissues. The particular method of regeneration will depend on the starting plant tissue and the particular plant species to be regenerated. The regeneration, development and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art (Weissbach and Weissbach, Eds.; In Methods for Plant Molecular Biology; Academic Press, Inc.: San Diego, CA, 1988). This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development or through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil. Preferably, the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants. A transgenic plant of the present disclosure containing a desired polypeptide is cultivated using methods well known to one skilled in the art.

(122) This disclosure also concerns a method of decreasing the expression of at least one nucleic acid such as a heterologous nucleic acid fragment in a plant cell which comprises: (a) transforming a plant cell with the recombinant expression construct described herein; (b) growing fertile mature plants from the transformed plant cell of step (a); (c) selecting plants containing a transformed plant cell wherein the expression of the nucleic acid such as a heterologous nucleic acid fragment is increased or decreased. Transformation and selection can be accomplished using methods well-known to those skilled in the art including, but not limited to, the methods described herein.

(123) The soybean seeds can be processed to produce oil and protein. Methods of processing the soybean seeds to produce oil and protein are provided which include one or more steps of dehulling the seeds, crushing the seeds, heating the seeds, such as with steam, extracting the oil, roasting, and extrusion. Processing and oil extraction can be done using solvents or mechanical extraction.

(124) Products formed following processing include, without limitation, soy nuts, soy milk, tofu, texturized soy protein, soybean oil, soy protein flakes, isolated soy protein. Crude or partially degummed oil can be further processed by one or more of degumming, alkali treatment, silica absorption, vacuum bleaching, hydrogenation, interesterification, filtration, deodorization, physical refining, refractionation, and optional blending to produce refined bleached deodorized (RBD) oil.

(125) The oil and protein can be used in animal feed and in food products for human consumption. Provided are food products and animal feed comprising oils, protein and compositions and described herein which contain or are derived from the modified polynucleotides and modified polypeptides. The food products and animal feed may comprise nucleotides comprising one or more of the modified alleles disclosed herein and the modified polynucleotides, polypeptides and plant cell disclosed herein.

(126) Methods of detecting the modified polynucleotides are provided. Methods of extracting modified DNA from a sample or detecting the presence of DNA corresponding to the modified genomic sequences comprising deletions or substitutions disclosed herein in DGAT1 sequences are provided. Such methods comprise contacting a sample comprising soybean genomic DNA with a DNA primer set, that when used in a nucleic acid amplification reaction, such as the polymerase chain reaction (PCR), with genomic DNA extracted from soybeans produces an amplicon that is diagnostic for either the presence or absence of the modified polynucleotide or modified DGAT1 alleles. The methods include the steps of performing a nucleic acid amplification reaction, thereby producing the amplicon and detecting the amplicon. In some embodiments one of the pair of DNA molecules comprises the wild type sequence where the modification such as a deletion occurs with the second of the pair being upstream or downstream as appropriate and suitably in proximity to the wild type sequence where the modification such as deletion occurs, such that an amplicon is produced when the wild type allele is present, but no amplicon is produced when the modified allele is present.

(127) Probes and primers are provided which are of sufficient nucleotide length to bind specifically to the target DNA sequence under the reaction or hybridization conditions. Suitable probes and primers are at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, and less than 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 2,5 2,4 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, or 12 nucleotides in length. Such probes and primers can hybridize specifically to a target sequence under high stringency hybridization conditions. Preferably, probes and primers have complete or 100% DNA sequence similarity of contiguous nucleotides with the target sequence, although probes which differ from the target DNA sequence but retain the ability to hybridize to target DNA sequence may be also be used. Reverse complements of the primers and probes disclosed herein are also provided and can be used in the methods and compositions described herein.

(128) In some embodiments, one of the pair of DNA molecules comprises the modification or traverses the modification junction, such as, for example, the deletion junctions occurring at position 77 to 78 of SEQ ID NO: 25, or the deletion junctions occurring at position 73 to 74 of SEQ ID NO: 26 with the second DNA molecule of the pair being upstream or downstream of the genomic sequence as appropriate, such that an amplicon is produced when the modified allele is present, but no amplicon is produced when the wild type allele is present. Suitable primers for use in reactions to detect the presence of the modified alleles can be designed based on the junction sequences depicted in FIGS. 1-3 for the modified alleles. The deletion junction sequence can include at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or 30 nucleotides upstream and downstream of the junction, such as provided in SEQ ID NOs: 25 and 26. The modified polynucleotides disclosed herein can include the deletion junction and deletion junction sequences described herein.

(129) Various changes in phenotype are of interest including, but not limited to, one or more of increased stability of the DGAT polypeptide or protein or RNA in the cell, increased expression levels of the DGAT protein or RNA in the cell, increased activity, such as specific activity of the DGAT protein in the cell, increased oil or fatty acid production or oil of fatty acid content of the cell or increased protein content or protein production in the cell.

(130) Methods for extracting and detecting triacylglycerol (TAG), fats or oils from tissues such as leaves, roots and seeds are provided herein. The methods can be used to extract TAG and quantify, measure or detect TAG from the modified leaves or seeds described herein. In some embodiments, the methods include the steps of conducting Solid Phase Extraction (SPE) followed by quantitative gas chromatography. In some embodiments, the methods include the steps of conducting high performance liquid chromatography such as equipped with an evaporative light scattering detector (HPLC-ELSD). TAG is extracted from the tissue, such as leaf or seed tissue, for example using a solvent such as hexane. The methods facilitate an improvement in accuracy of measuring TAG in tissues of at least 1%, 2%, 3%, 4%, 5%, 6%, 7% 8%, 9% or 10% and less than 25%, 20%, 15% or 10%.

(131) For the SPE method, a plate containing a plurality of wells can be used, such as at least 12, 24, 36, 48, 60, 72, 84, or 96 and less than 1026, 512, 256, 128, or 100 wells. Hexane or other solvent can be used to precondition the columns and to load the fractions. Columns can be washed with hexane:dichloromethane:chloroform, such as at an 88:10:4 v/v ratio. Elution of TAG from the columns can be done using a hexane:ethyl acetate blend, at a ratio of at least 95:5, 96:4, and 97:3 hexane:ethyl acetate (v/v) and less than 98:2 and 97:3 hexane:ethyl acetate (v/v). For example, a ratio of 96:4 hexane:ethyl acetate (v/v) can be used. The TAG fraction can be concentrated and resuspended in a solvent such as heptane, derivatization of fatty acids may be carried out for example using trimethylsulfonium hydroxide in methanol, followed by Gas ChromatographyFlame Ionization Detector (GC-FID) for quantification.

(132) For the HPLC-ELSD procedure, the hexane-extracted lipids can be filtered such as through a PTFE filter plate, dried down and resuspended in a solvent such as heptane. A column such as a cyanopropyl column can used to separate lipid species on an HPLC-ELSD. A first phase may include up to 100% hexane (mobile phase A) and a second phase (mobile phase B) may include up to 100% methyl tertiary-butyl ether or a methyl tertiary-butyl ether: isopropanol blend with at least 0%, 0.01%, 0.1%, 0.5%, 1%, 1.5% or 2% and less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or 0.5% isopropanol (v/v) and at least 0%, 0.01%, 0.1%, 0.2%, 0.3%, 0.4% or 0.5% and less than 0.6%, 0.5%, 0.4%, 0.3%, 0.2% or 0.1% (v/v) acetic acid. The gradient can be run for example at 0% to 100% of mobile phase B, with re-equilibration of the column to 0% mobile phase B.

(133) The foregoing invention has been described in detail by way of illustration and example for purposes of clarity and understanding. As is readily apparent to one skilled in the art, the foregoing disclosures are only some of the methods and compositions that illustrate the embodiments of the foregoing invention. It will be apparent to those of ordinary skill in the art that variations, changes, modifications, and alterations may be applied to the compositions and/or methods described herein without departing from the true spirit, concept, and scope of the invention.

(134) All publications, patents, and patent applications mentioned in the specification are incorporated by reference herein for the purpose cited to the same extent as if each was specifically and individually indicated to be incorporated by reference herein.

(135) As used herein and in the appended claims, the singular forms a, an, and the include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to a plant includes a plurality of such plants, reference to a cell includes one or more cells and equivalents thereof known to those skilled in the art, and so forth. Unless expressly stated to the contrary, or is used as an inclusive term. For example, a condition A or B is satisfied by any one of the following: A is true (or present) and B is false (or not present), A is false (or not present) and B is true (or present), and both A and B are true (or present).

Example 1

Evaluation of DGAT Variants in Yeast by Measuring Oil Accumulation

(136) Yeast (Saccharomyces cerevisiae) double mutant (dga1/Iro1) was generated for evaluating soybean DGAT variants. The yeast mutant is DGAT/PDAT double null which accumulates a trace amount of oil and can be complemented by soybean DGAT variants. DGAT variants were cloned into a yeast expression vector between PGK1 promoter and PGK1 terminator. The vector was transformed into yeast using a modified version of Clontech Yeastmaker Yeast Transformation Kit. Total 18 independent colonies were picked for each DGAT variant to start liquid culture. Oil content in yeast was determined by staining yeast cell with a fluorescence lipolytic dye, Nile Red. Nile Red staining was performed in 96-well microtiter plates by adding 5 L of a 0.02 mg per mL stock of Nile Red dissolved in 95% ethanol to 200 mL of a 1:10 dilution of the yeast culture in phosphate-buffered saline (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4, pH 7.4). Staining was done for 5 min, followed by the determination of fluorescence intensity using an excitation wavelength of 489 nm and an emission wavelength of 581 nm. Fluorescence intensity was divided by A600 to correct for differences in cell density, and buffer blanks with no yeast were used to correct for background (Roesler et al 2016 Plant Physiol. 171:878).

(137) Oil content (total fatty acid methyl esters as a percentage of dry weight) and fatty acid composition were determined by quantitative gas chromatography for yeast strains with high Nile Red staining.

Example 2

Evaluation of DGAT Variants in Tobacco Leaf Transient Expression by Measuring Oil Accumulation

(138) DGAT variants were evaluated in planta by Agrobacterium mediated transient expression in tobacco (N. benthamiana) leaves. Gene variants were first cloned into a binary vector between the GM-UBQ promoter and UBQ14 terminator. The constructs also contained DsRed under control of the SCP1 promoter as marker gene. Vectors were transformed into Agrobacterium strain AGL1 by electroporation. Liquid cultures were grown at 28 C overnight in a shaking incubator at 250 rpm. Cells were then pelleted and resuspended in infiltration buffer (5 mM MgSO4, 5 mM MES (pH 5.6), and 150 M acetosyringone). Cultures were then incubated at room temperature for 2-4 hours and diluted to a final OD 600 of 0.2 prior to infiltration. Tobacco plants were grown for approximately 5 weeks before infiltration in a growth chamber under a 16-hour photoperiod, light intensity of 180 mol.Math.m-2.Math.s-1, 24 C/20 C light/dark temperature, and 65% relative humidity. The youngest fully expanded leaf was chosen for infiltration (one leaf per plant). Agrobacterium suspensions were injected into the underside of leaves using a syringe without a needle while applying counter pressure. The Agrobacterium suspension can be seen filling airspaces inside the leaf, which is a visible wetting of the area. Infiltrated leaves were harvested 3 days post-infiltration, frozen on dry ice, and lyophilized. Lipids were extracted from 20 mg dry weight in 2:1 chloroform:methanol after the addition of 0.05 mg tri-C17 TAG as an internal standard. Extracts were loaded on a silica TLC plate and resolved with 70:30:1 hexane:diethylether:acetic acid. The plate was stained with primuline and visualized under UV light. TAG spots were scraped from the plate and derivatized with 5% sulfuric acid in methanol followed by GC-FID. Protein was extracted and analyzed by the Protein Mass Spectrometry.

Example 3

Deletion of amino Acids in N-Terminal of DGAT Improves DGAT Protein Stability and Produces More Oil in Tobacco Leaf

(139) Oil was measured in a tobacco leaf assay according to Example 2. Different DGAT variants were expressed transiently in tobacco leaf under the same soybean UBQ promoter. DGAT protein level was determined by mass spectrometry. The results are presented in FIG. 1. Deletion of AA25-44 at the N-terminus of the DGAT1b WT protein resulted in a 66 percent increase in DGAT protein level, indicating increased DGAT1b stability. The AA25-44 deletion resulted in a similar increase in protein in the GmDGAT1b mod backbone with 14 amino acid substitutions, where a 61 percent increase in protein was observed. The unmodified DGAT1a protein is more stable and expressed at a higher level in tobacco leaf compared to DGAT1b.

(140) Oil content in tobacco leaf expressing different DGAT variants was determined by GC-FID. The results are presented in FIG. 2. Expression of DGAT1b WT increases oil slightly in tobacco leaf. Deletion of AA25-44 in N-terminal of DGAT1b increases oil content in tobacco leaf by 100%. Similarly, Substitution of 14 AA in DGAT1b mod increases oil content by 149%. The stack of AA25-44 deletion with 14 AA substitution provided an increase in oil more than either the AA25-44 deletion or 14 AA substitution. DGAT1b mod and stack of AA25-44 deletion with 14 AA substitution showed a much higher oil content than wild type DGAT1a in tobacco leaves.

Example 4

Substitution of a Single Amino Acid in DGAT Increases Oil Accumulation in Yeast

(141) DGAT variants with a single amino acid substitution at various position was expressed under PGK1 promoter in a yeast double mutant as described in Example 1. Oil content in yeast cells were determined by Nile Red staining. Out of 33 variants in DGAT1b backbone tested, 7 DGAT variants show a significant increase in oil content compared to wild type DGAT1b. Similarly, out of 29 variants in DGAT1a backbone tested, 12 DGAT variants showed a significant increase in oil content compared to wild type DGAT1a in yeast (Table 4). The 15 amino acid substitutions showing positive effect on oil accumulation in either DGAT1a or DGAT1b are listed in Table 3.

(142) TABLE-US-00003 TABLE 3 List of positive single amino acid substitutions in soybean DGAT1a or DGAT1b GmDGAT1B GmDGAT1a (SEQ ID NO: 2) (SEQ ID NO: 4) BAE93461.1 AAS78662.1 S58N * S55N P181A P175A * A210V * A204V T216V * T210V * D258E * D252E * S264T * S258T * K328N K322N * L364V L358V * D387E D381E * I440M * I434M R467Q R461Q * I479S * I473S * T24A * S31A * S238A * * indicates DGAT with a single amino acid substitution shows a significant increase in oil content compared to wild type DGAT at P < 0.05

(143) TABLE-US-00004 TABLE 4 Soybean DGAT with a single amino acid substitution increases oil accumulation in yeast DGAT % of WT oil Allele AA Change content Significance DGAT1b S58N 123.68 * DGAT1b A210V 119.52 * DGAT1b T216V 136.83 * DGAT1b D258E 134.39 * DGAT1b S264T 121.01 * DGAT1b I440M 114.97 * DGAT1b I479S 146.61 * DGAT1a T24A 107.63 * DGAT1a S31A 114.75 * DGAT1a P175A 107.21 * DGAT1a T210V 107.85 * DGAT1a S238A 105.45 * DGAT1a D252E 115.97 * DGAT1a S258T 112.78 * DGAT1a K322N 113.19 * DGAT1a L360V 106.90 * DGAT1a D381E 105.06 * DGAT1a R461Q 109.47 * DGAT1a I473S 111.07 * * indicates DGAT with a single amino acid substitution shows a significant increase in oil content compared to wild type DGAT at P < 0.05

Example 5

Substitution of a Single Amino Acid in DGAT Increases Oil Accumulation in Tobacco Leaf

(144) Four positive amino acid substitutions in DGAT1a and 6 positive amino acid substitutions in DGAT1b backbones were further tested in tobacco leaf transient expression as described in Example 2. The results are presented in FIG. 3. Amino acid changes from Threonine to valine at position 210, aspartate to glutamate at position 252, serine to valine at position 258, and isoleucine to serine in DGAT1a protein increases oil accumulation in tobacco leaves compared to DGAT1a wild type (FIG. 3). The corresponding amino acid substitutions in DGAT1b backbone show a similar oil increase compared against wild type DGAT1b in tobacco leaves.

Example 6

Identification of Positive Amino Acid Substitution in Plant DGAT

(145) Plant DGAT amino acid sequences can be identified from public databases, for example using BLAST (Basic Local Alignment Search Tool) using the soybean DGAT1a and DGTA1b sequences. The DGAT amino acid sequences can be pairwise aligned using alignment software. Corresponding amino acids which can be changed to increase DGAT activity in other plant DGAT proteins are marked with an asterisk in FIG. 4. The modified nucleotides encoding these polypeptides can be expressed in plant cells to produce cells containing modified DGAT polypeptides which show one or more of increased stability, increased specific activity and increased fatty acid content of the cell.

Example 7

Combination of 2-4 Amino Acid Changes in DGAT in Yeast

(146) DGAT variants with 2-4 amino acid changes were expressed in yeast as described in Example 1. The different combinations tested and the results are presented in Table 5. Compared to WT DGAT, 8 out of 19 stack variants show an increase in oil accumulation. The stack variants contain at least one amino acid changes from the list in Table 3 of Example 4.

(147) TABLE-US-00005 TABLE 5 DGAT variants with 2-4 amino acid changes increase oil content in yeast Soybean % of WT oil DGAT Allele Amino Acid Changes content Significance GmDGAT1b T216V I479S 98.75 GmDGAT1b C355S I479S 93.14 GmDGAT1b T216V D258E 98.72 GmDGAT1b T216V S264T 91.90 GmDGAT1b D258E S264T 89.61 GmDGAT1b D258E I479S 128.06 * GmDGAT1b K328N C355S I479S 127.54 * GmDGAT1b C355S N473S I479S 84.80 GmDGAT1b T216V D258E I479S 125.85 * GmDGAT1b S58N I170M S264T 101.39 GmDGAT1b R206K Y231F S264T I440M 70.12 GmDGAT1b T216V K328N C355S I479S 99.37 GmDGAT1b V273L I303V L364V R467K 111.96 * GmDGAT1b T216V D258E S264T I479S 90.85 GmDGAT1a T210V I473S 119.31 * GmDGAT1a C349S I473S 104.03 * GmDGAT1a T210V D252E 107.33 * GmDGAT1a V267L I297V L358V R461K 100.41 GmDGAT1a T210V D252E S258T I473S 125.59 * * indicates DGAT with 2-4 amino acid substitutions show a significant increase in oil content compared to wild type DGAT at P < 0.05

Example 8

Combination of 2-4 Amino Acid Changes in DGAT in Tobacco Leaf Assay

(148) The DGAT1b variants with 2-4 amino acid changes used in Example 7 were also tested in tobacco leaf transient expression. The results are presented in FIG. 5. Seven out of eleven DGAT1b variants with 2-4 amino acid substitutions show more oil accumulation than wild type DGAT1b. One DGAT1b variant with 3 amino acid substitutions, C355S, N473S, and 1479S-increased oil more than the GmDGAT1b mod with 14 amino acid changes.

Example 9

Combination of N-Terminal Deletion with Amino Acid Substitution

(149) The DGAT variant with N-terminal deletion at AA25-44 improves DGAT stability and increase oil accumulation in tobacco transient expression. DGAT variants which combined an N-terminal deletion with amino acid substitutions were tested to determine whether further increases DGAT activity and oil accumulation would occur. As shown in FIG. 6, GmDGAT1b mod with AA25-44 deletion accumulates more oil than either GmDGAT1b mod or GMDGAT1b with AA25-44 deletion. Similarly, GmDGAT1b with stack of C355S, N473S and 1479S substitutions and the AA25-44 deletion increases oil more than either GmDGAT1b with AA25-44 deletion or GmDGAT1b with C355S, N473S and 1479S substitutions. The combination of N-terminal deletion with C-terminal amino acid substitutions can further improve DGAT for higher oil accumulation.

Example 10

Soybean Optimized Expression Cassettes for Guide RNA/Cas Endonuclease based Genome Modification in Soybean Plants

(150) For genome engineering applications, the type II CRISPR/Cas system minimally requires the Cas9 protein and a duplexed crRNA/tracrRNA molecule or a synthetically fused crRNA and tracrRNA (guide RNA) molecule for DNA target site recognition and cleavage (Gasiunas et al. (2012) Proc. Natl. Acad. Sci. USA 109: E2579-86, Jinek et al. (2012) Science 337:816-21, Mali et al. (2013) Science 339:823-26, and Cong et al. (2013) Science 339:819-23). Described herein is a guideRNA/Cas endonuclease system that is based on the type II CRISPR/Cas system and consists of a Cas endonuclease and a guide RNA (or duplexed crRNA and tracrRNA) that together can form a complex that recognizes a genomic target site in a plant and introduces a double-strand-break into the target site.

(151) To use the guide RNA/Cas endonuclease system in soybean, the Cas9 gene from Streptococcus pyogenes M1 GAS (SF370) was soybean codon optimized per standard techniques known in the art. To facilitate nuclear localization of the Cas9 protein in soybean cells, a simian virus 40 (SV40) large T-antigen nuclear localization signal, representing the amino acid molecules of PKKKRKV (with a linker SRAD (SRADPKKKRKV), was added to the carboxyl terminus of the codon optimized Cas9 to facilitate transporting the codon optimized Cas9 protein to the nucleus. The soybean optimized Cas9 gene was operably linked to a soybean constitutive promoter such as the strong soybean constitutive promoter GM-EF1A2 (US patent application 20090133159). or regulated promoter by standard molecular biological techniques.

(152) The second component necessary to form a functional guide RNA/Cas endonuclease system for genome engineering applications is a duplex of the crRNA and tracrRNA molecules or a synthetic fusing of the crRNA and tracrRNA molecules, a guide RNA. To confer efficient guide RNA expression (or expression of the duplexed crRNA and tracrRNA) in soybean, the soybean U6 polymerase Ill promoter and U6 polymerase III terminator were used.

(153) Plant U6 RNA polymerase III promoters have been cloned and characterized from such as Arabidopsis and Medicago truncatula (Waibel and Filipowicz, NAR 18:3451-3458 (1990); Li et al., J. Integrat. Plant Biol. 49:222-229 (2007); Kim and Nam, Plant Mol. Biol. Rep. 31:581-593 (2013); Wang et al., RNA 14:903-913 (2008)). Soybean U6 small nuclear RNA (snRNA) genes were identified herein by searching public soybean variety Williams82 genomic sequence using Arabidopsis U6 gene coding sequence. Approximately 0.5 kb genomic DNA sequence upstream of the first G nucleotide of a U6 gene was selected to be used as a RNA polymerase III promoter for example, GM-U6-13.1 promoter, to express guide RNA to direct Cas9 nuclease to designated genomic site. The guide RNA coding sequence was 76 bp long and comprised a 20 bp variable targeting domain from a chosen soybean genomic target site on the 5 end and a tract of 4 or more T residues as a transcription terminator on the 3 end. The first nucleotide of the 20 bp variable targeting domain was a G residue to be used by RNA polymerase III for transcription. Other soybean U6 homologous genes promoters were similarly cloned and used for small RNA expression.

(154) Since the Cas9 endonuclease and the guide RNA need to form a protein/RNA complex to mediate site-specific DNA double strand cleavage, the Cas9 endonuclease and guide RNA must be expressed in same cells. To improve their co-expression and presence, the Cas9 endonuclease and guide RNA expression cassettes were linked into a single DNA construct.

Example 11

Selection of Soybean DGAT1a and DGAT1b Target Sites to be Cleaved by the Guide RNA/Cas Endonuclease System

(155) Specific gRNAs are designed to target the two soybean DGAT genes (Glyma.13g106100 for DGAT1a and Glyma.17g053300 for DGAT1b). The GM-DGAT-CR1 is targeting the N-terminal region of DGAT1a gene. The GM-DGAT-CR3 is targeting the N-terminal region of the DGAT1b gene. The GM-DGAT-CR4 is targeting downstream of the N-terminal region of both DGAT1a and DGAT1b gene (Table 6).

(156) TABLE-US-00006 TABLE6 GuideRNA/Cas9endonucleasetargetsitesonsoy- beanDGATIaandDGATIbgenesa NameofgRNA-Cas9 endonuclease targetsite Sequences(withoutPAM) GM-DGAT-CR1 GGAATTGAAGAGGCCAGCGG(SEQID NO:31) GM-DGAT-CR3 GCGGCGGTGGAGGTGGCGGA(SEQID NO:32) GM-DGAT-CR4 GGACAGTTCCGGTGATGACT(SEQID NO:33)

(157) The soybean U6 small nuclear RNA promoter, GM-U6-13.1, was used to express the guide RNAs to direct Cas9 nuclease to designated genomic target sites. A soybean codon optimized Cas9 endonuclease expression cassette and a guide RNA expression cassette were linked in the plasmid (RTW1630, RTW1632 or RTW1633).

Example 12

Delivery of the Guide RNA/Cas9 Endonuclease System DNA to Soybean by Stable Transformation

(158) Soybean somatic embryogenic suspension cultures were induced from a DuPont Pioneer proprietary elite cultivar 93Y21 as follows. Cotyledons (3 mm in length) were dissected from surface sterilized, immature seeds and were cultured for 6-10 weeks in the light at 26 C. on a Murashige and Skoog (MS) media containing 0.7% agar and supplemented with 10 mg/ml 2,4-D (2,4-Dichlorophenoxyacetic acid). Globular stage somatic embryos, which produced secondary embryos, were then excised and placed into flasks containing liquid MS medium supplemented with 2,4-D (10 mg/ml) and cultured in light on a rotary shaker. After repeated selection for clusters of somatic embryos that multiplied as early, globular staged embryos, the soybean embryogenic suspension cultures were maintained in 35 ml liquid media on a rotary shaker, 150 rpm, at 26 C. with fluorescent lights on a 16:8-hour day/night schedule. Cultures were subcultured every two weeks by inoculating approximately 35 mg of tissue into 35 ml of the same fresh liquid MS medium.

(159) Soybean embryogenic suspension cultures were then transformed by the method of particle gun bombardment using a DuPont Biolistic PDS1000/HE instrument (Bio-Rad Laboratories, Hercules, CA). To 50 l of a 60 mg/ml 1.0 mm gold particle suspension were added in order: 30 l of equal amount (30 ng/l) plasmid DNA, 20 l of 0.1 M spermidine, and 25 l of 5 M CaCl2. The particle preparation was then agitated for 3 minutes, spun in a centrifuge for 10 seconds and the supernatant removed. The DNA-coated particles were then washed once in 400 l 100% ethanol and resuspended in 45 l of 100% ethanol. The DNA/particle suspension was sonicated three times for one second each. Then 5 l of the DNA-coated gold particles was loaded on each macro carrier disk.

(160) Approximately 300-400 mg of a two-week-old suspension culture was placed in an empty 6015 mm Petri dish and the residual liquid removed from the tissue with a pipette. For each transformation experiment, approximately 5 to 10 plates of tissue were bombarded. Membrane rupture pressure was set at 1100 psi and the chamber was evacuated to a vacuum of 28 inches mercury. The tissue was placed approximately 3.5 inches away from the retaining screen and bombarded once. Following bombardment, the tissue was divided in half and placed back into liquid media and cultured as described above.

(161) Five to seven days post bombardment, the liquid media was exchanged with fresh media containing 30 mg/ml hygromycin as selection agent. This selective media was refreshed weekly. Seven to eight weeks post bombardment, green, transformed tissue was observed growing from untransformed, necrotic embryogenic clusters. Isolated green tissue was removed and inoculated into individual flasks to generate new, clonally propagated, transformed embryogenic suspension cultures. Each clonally propagated culture was treated as an independent transformation event and subcultured in the same liquid MS media supplemented with 2,4-D (10 mg/ml) and 30 ng/ml hygromycin selection agent to increase mass. The embryogenic suspension cultures were then transferred to agar solid MS media plates without 2,4-D supplement to allow somatic embryos to develop. A sample of each event was collected at this stage for quantitative PCR analysis.

(162) Cotyledon stage somatic embryos were dried-down (by transferring them into an empty small Petri dish that was seated on top of a 10 cm Petri dish containing some agar gel to allow slow dry down) to mimic the last stages of soybean seed development. Dried-down embryos were placed on germination solid media and transgenic soybean plantlets were regenerated. The transgenic plants were then transferred to soil and maintained in growth chambers for seed production. Transgenic events were sampled at somatic embryo stage or TO leaf stage for molecular analysis.

Example 13

Detection of Site-Specific Dropout Mutations Mediated by the Guide RNA/Cas9 System in Stably Transformed Soybean

(163) Genomic DNA was extracted from somatic embryo samples and leaf samples and analyzed by PCR analyses using primers specific respectively to DGAT1a and DGAT1b genes (Tables 7 and 8).

(164) TABLE-US-00007 TABLE 7 PCR primers for the deletion in the N-terminal region of the DGAT1a and DGAT1b genes Target Gene Primer1 SEQ ID NO: Primer2 SEQ ID NO: DGAT1a WOL1469 34 WOL1470 35 DGAT1b WOL1471 36 WOL1009 37

(165) TABLE-US-00008 TABLE 8 Detection of the deletion in the N-terminal region of the DGAT1a and DGAT1b genes PCR band size of Target band containing N- Site Primer set PCR band size of WT terminal deletion DGAT1a WOL1469/ 485 bp (position 34- 437 bp (position 34- WOL1470 518 of SEQ ID NO: 518 SEQ ID NO: 30) 30) DGAT1b WOL1471/ 557 bp (position 11- 497 bp (position 11- WOL1472 567 SEQ ID: 29) 567 SEQ ID: 29)

(166) The PCR bands were cloned into pCR2.1 vector using a TOPO-TA cloning kit (Invitrogen) and multiple clones were sequenced to check for target site sequence changes. The 48 bp dropout of the DGAT1a N-terminal region (corresponding to positions 77 to 124 of SEQ ID NO: 3) and 60 bp deletion of the DGAT1b (corresponding to positions 74 to 133 of SEQ ID NO: 1) N-terminal region were detected in the 2.1 variant, in which the DGAT1b N-terminal region deletion were presented as bi-allelic and the DGAT1a N-terminal region deletion was shown as mono-allelic, with the second DGAT1a allelic as a 1 bp deletion knockout (Table 9). For the 2.2 variant, mono-allelic dropout of the DGAT1a gene was detected, with the second DGAT1a allele as a WT. All other variants were detected either as frameshift knockouts or as WT alleles.

(167) TABLE-US-00009 TABLE 9 N-terminal deletion or knockout variants of the DGAT1a and DGAT1b genes Variant DGAT1a DGAT1b 2.1 48 bp dropout/1 bp del 60 bp dropout/ 60 bp dropout 2.2 48 bp dropout/WT 2 bp del 4.2 WT 1 bp del 4.3 WT WT

Example 14

Expression of Novel DGAT Genes in Soybean Seed

(168) The expression of DGAT variants in soybean was described in detail previously (Roesler et al Plant Physiol. 2016 878-893). Briefly, DGAT variants were cloned into an expression vector flanked by seed specific soybean Ole 2b promoter and soybean MYB2 terminator. The expression vectors containing constructs as listed in Table 10 were introduced into soybean by Ochrobacteria transformation. Transgenic T1 seed oil content was determined by SS-NIR as described previously (Roesler et al Plant Physiol. 2016 878-893). While 75% of T1 seeds are transgenic, 25% of T1 seeds are wild type segregates. The average of all T1 seeds oil content is thus an underestimate of DGAT efficacy. Compared to untransformed 93Y21 wild type, overexpression of Gm-DGAT1b WT under the oleosin promoter does not increase seed oil content significantly. Gm-DGAT1b Mod with 14 amino acid substitutions shows a significant improvement in increasing oil compared to wild type DGAT1b (Table 10). To reduce number of amino acid substitutions to facilitate efficient gene editing, a few DGAT variants with 1-4 amino acid substitutions were tested in transgenic plants for increasing seed oil content. Gm-DGAT1b-I479S, Gm-DGAT1b-C355S-I479S, Gm-DGAT1b-C355S-N473S-I479S, and Gm-DGAT1b-T216V-D258E-S264T-1479S show a significant increase in seed oil content compared to wild type DGAT1b. Overexpression of Gm-DGAT1b-S264T and Gm-DGAT1b-D258E-I479S, however, does not increase seed oil content. In addition, substitution of 14 amino acids or a single amino acid substitution 1473S in DGAT1a backbone increases seed oil content significantly compared to wild type DGAT1b and untransformed 93Y21 (Table 10)

(169) TABLE-US-00010 TABLE 10 DGAT variants increases seed oil content in stable transgenic events Average T1 Signif- Constructs seed oil % icance Wild type 19.75 1.03 93Y21 Gm-Ole2b Gm-DGAT1b-WT Gm-MYB2 19.72 0.97 promoter Term Gm-Ole2b Gm-DGAT1b Mod Gm-MYB2 21.52 0.96 ** promoter Term Gm-Ole2b Gm-DGAT1b-S264T Gm-MYB2 19.88 1.05 promoter Term Gm-Ole2b Gm-DGAT1b-I479S Gm-MYB2 21.01 1.61 ** promoter Term Gm-Ole2b Gm-DGAT1b-D258E- Gm-MYB2 20.06 0.88 promoter I479S Term Gm-Ole2b Gm-DGAT1b-C355S- Gm-MYB2 20.86 1.27 ** promoter I479S Term Gm-Ole2b Gm-DGAT1b-C355S- Gm-MYB2 21.02 0.97 ** promoter N473S-I479S Term Gm-Ole2b Gm-DGAT1b-T216V- Gm-MYB2 21.20 1.24 ** promoter D258E-S264T-I479S Term Gm-Ole2b Gm-DGAT1a Mod Gm-MYB2 20.92 1.37 ** promoter Term Gm-Ole2b Gm-DGAT1a-I473S Gm-MYB2 20.48 1.13 ** promoter Term

Example 15

Deletion Studies of N-Terminal Region of DGAT for Increasing DGAT Protein Stability

(170) The N-terminal region of DGAT before the first conserved membrane domain (e.g. from positions 1-108 of SEQ ID NO: 2) is variable and impacts DGAT protein stability. Different size deletions from one amino acid to 107 amino acids are made in this region. The efficacy of DGAT deletion variants are tested in tobacco leaf transient expression or in stable transgenic expression as described in Example 2 or in Roesler et al Plant Physiol. 2016 878-893. The deletion variants with improved stability are identified based on oil accumulation in tobacco leaf assay or transgenic plants. DGAT polypeptides with deletions ranging from 1 amino acid to 107 amino acids will show improved stability evidenced by increased protein levels or oil content in transformed cells compared with a comparable DGAT not comprising an N-terminal deletion. When expressed in a seed, DGAT polypeptides with deletions ranging from 1 amino acid to 107 amino acids will result in increased oil content in the seed compared with a comparable seed expressing the wild-type or native DGAT sequences.

Example 16

Methods for Separating and Quantifying TAG from Leaf Lipids

(171) In addition to TLC according to Example 2 followed by GC-FID other methods were used to separate lipid classes and quantify TAG. These methods include use of Solid Phase Extraction (SPE) followed by quantitative gas chromatography and high performance liquid chromatography equipped with an evaporative light scattering detector (HPLC-ELSD). Sample collection and lipid extraction methods were modified to enable sample collection and analysis in a 96-well plate format. Approximately 10 mg leaf tissue was sampled into pre-weighed 1.2 ml polypropylene tubes. The tissue was lyophilized and the exact dry weight was obtained. Four monophasic extractions of 100% hexane were used to extract the neutral lipids from lyophilized leaf discs, and were pooled in a clean 96-well plate. For the SPE method, an internal standard, 0.02 mg tri-C17 TAG, was added prior to extraction of neutral lipids. TAG was isolated by SPE using 96-well aminopropyl SPE plates (Thermo). Columns were preconditioned with 1 mL of hexane prior to loading samples as a 0.5 mL hexane fraction. Columns were washed with 1 mL of hexane:dichloromethane: chloroform (88:10:4 v/v), then TAG was eluted with 1 mL of Hexane:ethyl acetate (96:4 v/v). The TAG fraction was concentrated and resuspended in 180 l heptane. Fatty acids were derivatized by the addition of 20 l of approximately 0.25 M trimethylsulfonium hydroxide in methanol (Sigma-Aldrich) was added, followed by GC-FID for quantification. For the HPLC-ELSD procedure, the hexane-extracted lipids were filtered through a PTFE 0.2 m filter plate. Samples were then dried down and resuspended in 80 L of heptane. A cyanopropyl column (Luna 5 M CN 100 2504.6 mm; Phenomenx) was used to separate lipid species on an HPLC-ELSD with hexane as mobile phase A and methyl tertiary-butyl ether (MTBE):isopropanol (95:5 v/v) plus 0.2% acetic acid as mobile phase B, with a gradient of 0% to 100% B, with re-equilibration of the column to 0% B. A standard curve of tri-C17 TAG was run with each sample set to quantify TAG as Oil Content (% of DW).

(172) TAG quantification procedures including TLC/GC-FID procedure of Example 2 were compared by transiently expressing empty vector (EV), GmDGAT1b WT (SEQ ID NO:2), and GmDGAT1b mod (SEQ ID NO:27) in tobacco leaf. The oil content values are shown in (FIG. 7). The SPE and HPLC procedures were found to effectively quantify TAG in the leaves and modified leaves disclosed herein and enabled high-throughput analysis of TAG accumulation.

Example 17

Additional Single to Quadruple Amino Acid Changes in DGAT Increase Oil Content in Tobacco Leaf Assay

(173) Additional GmDGAT1b variants were tested in the tobacco leaf assay and directly compared using the SPE/GC-FID and HPLC-ELSD procedures. Similar trends were observed between the two procedures for any of the samples tested (FIG. 8). Single amino acid substitution variants GmDGAT1b S264T and GmDGAT1b N473S significantly increased oil content in tobacco leaves compared to GmDGAT1b WT (FIG. 8). Using the SPE/GC-FID procedure, single amino acid substitution GmDGAT1b variant S264T, double variants C355S I479S and D258E I479S, triple variant C355S N473S I479S, and quadruple variant T216V D258E S264T I479S all had significant increases in oil content compared to the WT (FIG. 9). The triple GmDGAT1b variant C355S N473S I479S had comparable oil content as GmDGAT1b mod, with 14 amino acid substitutions, and N473S almost reached GmDGAT1b mod oil content levels (FIG. 9). This triple amino acid substitution DmDGAT1b variant C355S N473S I479S also had a significantly increased oil/protein ratio (FIG. 10), suggesting that this variant may have improved DGAT activity. These results show that 1-4 amino acid substitutions are sufficient to improve GmDGAT1b WT in planta.