<i>Streptomyces </i>sp. SNC087 strain isolated from seawater, method for producing staurosporine using same, method of culturing same, and pure culture medium of same

Abstract

The present invention provides a Streptomyces sp. SNC087 strain (KCCM12505P) that is isolated from seawater and produces staurosporine, a method for producing staurosporine using the same, a method for culturing the same, and a pure culture medium of the same.

Claims

1. A method for producing staurosporine from a culture product by incubating a Streptomyces sp. SNC087 strain (KCCM12505P).

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a photograph showing the morphology of Streptomyces sp. SNC087 strain isolated from seawater in a SYP solid medium.

(2) FIG. 2 illustrates a reverse-phase liquid chromatography (UV 310 nm) of the entire extract of the cultured SNC087 strain, wherein a red arrow indicates staurosporine.

(3) FIG. 3 is liquid chromatography-based chromatogram data measured for the extract of the SNC087 strain obtained in the present invention.

(4) FIG. 4 illustrates comparison results of UV spectrum of a large peak (staurosporine) at 7.6 minutes in the liquid chromatography-based chromatogram of the SNC087 extract obtained in the present invention with In-house database.

(5) FIG. 5 illustrates mass spectrum data of the large peak at 7.6 minutes in the liquid chromatography-based chromatogram of the SNC087 extract obtained in the present invention.

(6) FIG. 6 illustrates NMR data of the SNC087 extract obtained in the present invention.

(7) FIG. 7 illustrates reverse-phase column liquid chromatography results to confirm a content of staurosporine in the crude extract of the SNC087 strain obtained in the present invention and results of calculating the content of staurosporine contained in the extract using the area calculation method.

PREFERRED EMBODIMENTS OF INVENTION

(8) The present inventors prepared an extract using ethyl acetate after liquid culture of the Streptomyces sp. SNC087 strain isolated from seawater, and isolated a staurosporine compound represented by Formula 1 below to identify a structure of the compound, and then the present invention has been completed by evaluating a production amount of the compound.

(9) ##STR00001##

(10) In the present invention, a Streptomyces sp. SNC087 strain isolated from seawater may be provided. Hereinafter, a process of obtaining and identifying the Streptomyces sp. SNC087 strain (hereinafter, referred to as SNC087 strain) according to the present invention will be described in detail.

(11) The present inventors collected seawater near Ilgwang Beach in Gijang-gun, Busan, and then added 100 l of the collected seawater to a Mar4 solid medium (2 g kelp meal, 2 g D-mannitol, 1 g fish meal, 20 g/L KBr, 8 g/L Fe.sub.2(SO.sub.4).sub.3.Math.4H.sub.2O, ml DMSO, 970 ml filtered seawater, 21 g agar) for inoculation, and cultured at 27 C. to produce a single strain, followed by inoculation of the single strain again in a SYP solid medium (10 g starch, 2 g yeast, 4 g peptone, 1 L filtered seawater, 21 g agar), thus to isolate and select pure strains.

(12) The SNC087 strain isolated as described above was observed to have a strain morphology belonging to the typical Streptomyces genus (see FIG. 1).

(13) The Streptomyces sp. SNC087 strain according to the present invention may have a 16S rRNA gene nucleotide sequence represented by SEQ ID NO: 1 and may secrete staurosporine represented by Formula 1 below as a secondary metabolite. The Streptomyces sp. SNC087 strain was deposited with the Korea Microbial Conservation Center on Apr. 30, 2019, and was given the accession number KCCM12505P.

(14) The nucleotide sequence of the 16S rRNA gene of the Streptomyces sp. SNC087 strain according to the present invention is as follows (SEQ ID NO: 1):

(15) TABLE-US-00001 (SEQUENCE) AGCGCAACCCTTGTTCTGTGTTGCCAGCATGCCCTTCGGGGTGATGGGGAC TCACAGGAGACTGCCGGGGTCAACTCGGAGGAAGGTGGGGACGACGTCAAG TCATCATGCCCCTTATGTCTTGGGCTGCACACGTGCTACAATGGCCGGTAC AATGAGCTGCGATGCCGTGAGGCGGAGCGAATCTCAAAAAGCCGGTCTCAG TTCGGATTGGGGTCTGCAACTCGACCCCATGAAGTCGGAGTTGCTAGTAAT CGCAGATCAGCATTGCTGCGGTGAATACGTTCCCGGGCCTTGTACACACCG CCCGTCACGTCACGAAAGTCGGTAACACCCGAAGCCGGTGGCCCAACCCCT TGTGGGAGGGAGCTTCGAA

(16) The 16S rRNA gene sequence of the Streptomyces sp. SNC087 strain showed 99.9% homology with the 16S rRNA gene sequence of Streptomyces sanyensis 219820 strain registered in NCBI GenBank. However, it was confirmed in the examples of the present invention that the strain of the present invention has a production ability of 4 times or more superior to a production amount of staurosporine produced by the strain Streptomyces sanyensis 219820 under the same conditions. Therefore, it is considered that, even with a small difference in genes in an aspect of position of genes, this difference may possibly induce a mutation at the activation site of the gene related to production of staurosporine, and thus may affect the production ability of staurosporine.

(17) Hereinafter, the present invention will be described in more detail with reference to examples, but these examples are merely for facilitating understanding of the subject matters of the present invention and should not be construed as limiting the scope of the present invention.

[Example 1] Strain Detection and Selection from Seawater

(18) In 2014, seawater was collected at Ilgwang Beach in Gijang-gun, Busan. 100 l of the collected seawater was added to a Mar4 solid medium (2 g kelp meal, 2 g D-mannitol, 1 g fish meal, 20 g/L KBr, 8 g/L Fe.sub.2(SO.sub.4).sub.3.Math.4H.sub.2O, 30 ml DMSO, 970 ml filtered seawater, 21 g agar) for inoculation, and cultured at 27 C. to produce a single strain, followed by inoculation of the obtained strain again in a SYP solid medium (10 g starch, 2 g yeast, 4 g peptone, 1 L filtered sea water, 21 g agar), thus to isolate and select pure strains. As shown in FIG. 1, the purely isolated SNC087 strain was observed in the same morphology as the strains belonging to the genus Streptomyces. In order to identify the strain, 1 ml of the strain cultured at 27 C. for 5 days in the SYP liquid medium was taken and was subjected to extraction of genomic DNA according to the manufacturer's protocol using Tissue Genome DNA Isolation Kit (Cosmogenetech Co., Ltd., Seoul, South Korea). PCR was performed using 27F and 1492R primers for amplification of 16S rRNA gene for species analysis. The PCR product was purified using a PCR purification kit (Cosmogenetech Co., Ltd., Seoul, South Korea), and then, was subjected to analysis of nucleotide sequence using a capillary electrophoresis machine (Applied Biosystems 3730XL). The 16S rRNA gene sequence obtained from the resulting SNC087 strain was compared with information of previously reported strains by utilizing BLAST search of the GenBank/EMBL/DDBJ database. As a result, the 16S rRNA gene sequence of the SNC087 strain showed 99.9% homology with that of Streptomyces sanyensis 219820 strain, whereby the SNC087 strain was determined as a strain belonging to the genus Streptomyces.

[Example 2] Mass Liquid Culture of Streptomyces sp. SNC087 Strain

(19) Each 20 L of SNC087 was incubated in 1 L SYP liquid medium in 2.5-L Ultra Yield Flask at 27 C. and 150 rpm for 7 days while shaking the same, and then 20 L of ethyl acetate was added thereto. After one day, the extracted ethyl acetate layer was obtained. The ethyl acetate layer was dried by a rotary evaporator to obtain 1.5 g of final product.

[Example 3] Confirmation of Production of Staurosporine Compound

(20) 1.5 g of crude extract was analyzed by a reverse-phase column chromatography-mass analyzer (LC-MS) using C18 silica, wherein the analyzer includes 1% formic acid in H.sub.2O and 1% formic acid in acetonitrile and involves a stepwise gradient of 5 to 100% acetonitrile (containing 1% formic acid). As a result of comparing chromatography data at UV 310 nm with In-house UV spectrum database and monitoring MS data, homology between a peak of staurosporine at 7.6 minutes and the peak of staurosporine in the database, MS data values corresponding to a molecular weight of 466 and NMR data could be confirmed. The present inventors could obtain about 1.4 g of staurosporine from the crude extract after 20 L liquid culture of the SNC087 strain.

[Example 4] Identification of Compound

(21) Liquid chromatography-based chromatogram data was obtained for the SNC087 extract obtained in Example 3 as shown in FIG. 3, whereby a large peak (staurosporine) at 7.6 minutes was observed at UV wavelength of 310 nm in the chromatogram confirmation.

(22) Further, as a result of comparing the UV spectrum of the large peak (staurosporine) at 7.6 minutes in the liquid chromatography-based chromatogram of the SNC087 extract as shown in FIG. 4 with In-house database, and examining mass spectrum data of the large peak at 7.6 minutes in the liquid chromatography-based chromatogram of the SNC087 extract as shown in FIG. 5 and NMR data of the SNC087 extract (solvent: DMSO-d6) as shown in FIG. 6, staurosporine represented by Formula 1 below was identified.

(23) ##STR00002##

[Example 5] Calculation of Staurosporine Production Amount from SNC087 Strain

(24) In order to determine a content of staurosporine in the crude extract of SNC087 strain, the present inventors injected 60 g of the crude extract during material purification using reverse-phase column liquid chromatography and calculated the content of staurosporine contained in the extract by an area calculation method. Further, as a result of the calculation shown in FIG. 7, 93% of the injected extract was identified as staurosporine. According to this result, it could be confirmed that 55.8 g of staurosporine is contained in 60 g of the crude extract extracted from the culture solution of the SNC087 strain.

(25) In mass culture of 20 L SNC087 strain attempted by the present inventors, 1.5 g of crude extract was obtained, and 1.4 g of staurosporine could be obtained from the crude extract. This amount showed a high productivity of 70 mg/L of culture solution. When compared to S. sanyensis 219820, which has 99.9% similarity to the SNC087 strain obtained by the present inventors, it could be confirmed that a production amount in the present invention is 4 times or more superior to that of the prior art, that is, 325.1 mg of staurosporine produced by S. sanyensis 219820 in 20 L culture according to the previously reported literature.

(26) Staurosporine is actively used as an anticancer agent in the clinical stage. Further, staurosporine still being studied in many fields has been confirmed to have a yield of 24% after undergoing total synthesis including five stages. With regard to the medium components and culture methods suggested by the present inventors and the obtained SNC087 strain, it could be demonstrated that high yield staurosporine can be obtained by a biological process rather than a chemical method.

(27) As described above, the present invention has been described with reference to preferred embodiments of the present invention, but it will be understood that those skilled in the art can variously modify and change the present invention within a range of the present invention without departing from the spirit and scope of the present invention described in the appended claims.