Polyanionic acids to improve recovery and minimize system loss

11912983 ยท 2024-02-27

Assignee

Inventors

Cpc classification

International classification

Abstract

The present technology relates to a method of separating a sample comprising oligonucleotides. The method includes injecting a polyphosphonic acid at a concentration of between about 0.01 M to about 1 M into the sample comprising oligonucleotides. The method also includes flowing the sample and polyphosphonic acid through a liquid chromatography column and separating the oligonucleotides.

Claims

1. A method of performing solid phase extraction comprising: injecting a sample comprising oligonucleotides into a solid phase extraction cartridge comprising a stationary phase, wherein the oligonucleotides are retained by the stationary phase; washing the solid phase extraction cartridge with a polyphosphonic acid at a concentration of between about 0.01 M to about 1 M to elute the oligonucleotides from the solid phase extraction cartridge.

2. The method of claim 1, wherein the concentration of polyphosphonic acid is between about 0.01 M to about 0.1 M.

3. The method of claim 2, wherein the concentration of polyphosphonic acid is between about 20 mM to about 50 mM.

4. The method of claim 3, wherein the concentration of polyphosphonic acid is between about 30 mM to about 40 mM.

5. The method of claim 1, wherein between about 1 pg to about 1 mg of the polyphosphonic acid is injected into the sample.

6. The method of claim 1, wherein the polyphosphonic acid is etidronic acid.

7. The method of claim 1, wherein the polyphosphonic acid is nitrilotri(methylphosphonic acid).

8. The method of claim 1, wherein walls of the solid phase extraction cartridge are formed of plastic.

9. The method of claim 1, wherein the sample comprises phosphorylated oligonucleotides.

10. The method of claim 9, wherein the phosphorylated oligonucleotides comprise nucleotides and at least one nucleotide is adenosine triphosphate.

11. The method of claim 1, wherein the polyphosphonic acid is etidronic acid at pH of 8.5 and the oligonucleotide comprises nucleotides and at least one nucleotide is adenosine triphosphate.

12. The method of claim 1, wherein the polyphosphonic acid is a bisphosphonic acid.

13. The method of claim 12, wherein the bisphosphonic acid is selected from the group consisting of clodronic acid, pamidronic acid, alendronic acid, neridronic acid, and olpadronic acid.

14. The method of claim 1, wherein the solid phase extraction cartridge is a packed syringe.

15. The method of claim 1, wherein the solid phase extraction cartridge is a well plate.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The technology will be more fully understood from the following detailed description taken in conjunction with the accompanying drawings, in which:

(2) FIG. 1 is a flow chart of a method of separating a sample, according to an illustrative embodiment of the technology.

(3) FIG. 2 is a flow chart of a method of performing solid phase extraction, according to an illustrative embodiment of the technology.

(4) FIG. 3A is a chromatogram showing the recovery of GEM 91 oligonucleotide from a WAX SPE plate using MeOH and TEA, according to an illustrative embodiment of the technology.

(5) FIG. 3B is a chromatogram showing the recovery of GEM 91 oligonucleotide from a WAX SPE plate using etidronic acid, according to an illustrative embodiment of the technology.

(6) FIG. 4A is a linear calibration curve prepared for a 25-mer oligonucleotide GEM 91 prepared in water, according to an illustrative embodiment of the technology.

(7) FIG. 4B is a linear calibration curve prepared for a 25-mer oligonucleotide GEM 91 prepared in etidronic acid, according to an illustrative embodiment of the technology.

(8) FIG. 5A is a chromatogram showing absorbance over time of a set of five 30 second injections of ATP on a stainless steel frit using etidronic acid to passivate the frit, according to an illustrative embodiment of the technology.

(9) FIG. 5B is a chromatogram showing absorbance over time of a set of five 30 second injections of ATP on a stainless steel frit using citric acid to passivate the frit, according to an illustrative embodiment of the technology.

(10) FIG. 5C is a chromatogram showing absorbance over time of a set of five 30 second injections of ATP on a stainless steel frit using nitric acid to passivate the frit, according to an illustrative embodiment of the technology.

(11) FIG. 5D is a chromatogram showing absorbance over time of a set of five 30 second injections of ATP on a stainless steel frit using nitrilotri(methylphosphoric acid) to passivate the frit, according to an illustrative embodiment of the technology.

(12) FIG. 6A is a chromatogram showing the longevity of a single injection of etidronic acid followed by 20 injections of ATP spaced one minute apart, according to an illustrative embodiment of the technology.

(13) FIG. 6B is a chromatogram showing the longevity of a single injection of nitrilotri(methylphosphoric acid) followed by 20 injections of ATP spaced one minute apart, according to an illustrative embodiment of the technology.

(14) FIG. 7A are extracted ion chromatograms for Man-7 with two Man-6-Phosphate residues (Man7-PP; 1015.840.2 m/z) as obtained from a sample containing (bottom) and not containing etidronic acid (top), according to an illustrative embodiment of the technology.

(15) FIG. 7B is a mass spectrum of a Man-7 glycan containing two Man-6-Phosphate residues as obtained from an etidronic containing sample diluent, according to an illustrative embodiment of the technology.

(16) FIG. 8A is a chromatogram showing the effect of etidronic acid addition to eliminate nonspecific binding with isocitric acid, where the sample of isocitric acid is reconstituted in water, according to an illustrative embodiment of the technology.

(17) FIG. 8B is a chromatogram showing the effect of etidronic acid addition to eliminate nonspecific binding with isocitric acid, where the sample of isocitric acid is reconstituted in water and 0.1 mM etidronic acid, according to an illustrative embodiment of the technology.

(18) FIG. 8C is a chromatogram showing the effect of etidronic acid addition to eliminate nonspecific binding with isocitric acid, where the sample of isocitric acid is reconstituted in water and 1 mM etidronic acid, according to an illustrative embodiment of the technology.

(19) FIG. 8D is a chromatogram showing the effect of etidronic acid addition to eliminate nonspecific binding with isocitric acid, where the sample of isocitric acid is reconstituted in water and 10 mM etidronic acid, according to an illustrative embodiment of the technology.

(20) FIG. 8E is a chromatogram showing the effect of etidronic acid addition to eliminate nonspecific binding with isocitric acid, where the sample of isocitric acid is reconstituted in water and 100 mM etidronic acid, according to an illustrative embodiment of the technology.

(21) FIG. 9A is a chromatogram showing absorbance over time of three different concentration levels of 25 mer phosphorothioate oligonucleotide, including a titanium frit deactivated with inert coating of hybrid organic-inorganic silica, according to an illustrative embodiment of the technology.

(22) FIG. 9B is a chromatogram showing absorbance over time of three different concentration levels of 25 mer phosphorothioate oligonucleotide, including a stainless steel frit, according to an illustrative embodiment of the technology.

(23) FIG. 10A, FIG. 10B, FIG. 10C, FIG. 10D, FIG. 10E, FIG. 10F, FIG. 10G, FIG. 10H, and FIG. 10I are chromatograms showing absorbance over time of three different concentration levels of 25-mer phosphorothioate oligonucleotide injected on a sonicated stainless steel frit with various acids, according to an illustrative embodiment of the technology.

(24) FIG. 11A is a chromatogram showing injections of adenosine 5-,-methylene) diphosphate (AMPcP) with experimental conditions including a stainless steel frit conditioned that was first conditioned with 510 L injections of 0.6M NH.sub.4 etidronate with pH 7, according to an illustrative embodiment of the technology.

(25) FIG. 11B is a chromatogram showing injections of adenosine 5-,-methylene) diphosphate (AMPcP) with experimental conditions including a stainless steel frit sonicated in 1% phosphoric acid for 15 minutes, according to an illustrative embodiment of the technology.

DETAILED DESCRIPTION

(26) The present technology solves the problems of the prior art by addressing the non-specific binding issues that plague the analysis of analytes, particularly oligonucleotides, and especially when the analyte concentration is low, for example at concentrations in the few PPB or PPM range. By addressing the non-specific binding issues of oligonucleotide analysis, analyte recovery can be increased.

(27) Referring to FIG. 1, the technology relates to a method 100 of separating a sample that includes an oligonucleotide or a glycan. The method includes injecting a polyphosphonic acid into the sample (105). The sample can include one or more oligonucleotides, one or more glycans, or a combination thereof.

(28) When the sample includes oligonucleotides, different forms of oligonucleotides can be present in the sample. For example, the sample can include any combination of antisense oligonucleotides (ASOs), small interfering RNAs (siRNA), small hairpin RNAs (shRNAs), micro RNAs (miRNAs), or any other form of oligonucleotide.

(29) The polyphosphonic acid can be injected into the sample (105) at a concentration that is a molar excess. A molar excess of polyphosphonic acid is a concentration that is, for example, double or triple the concentration of the oligonucleotides or analytes in the sample. The polyphosphonic acid can be injected into the sample (105) at a concentration that is a molar excess relative to the oligonucleotide. For example, if the oligonucleotide concentration is 20 mM, a molar excess of polyphosphonic acid may be 40 mM or greater. In certain embodiments, the concentration of polyphosphonic acid can be between about 0.01 M to about 1 M. In some embodiments, the concentration of polyphosphonic acid is between about 0.01 M to about 0.1 M. In some embodiments, the concentration of polyphosphonic acid is between about 20 mM to about 50 mM or between about 30 mM to about 50 mM.

(30) Alternatively, the concentration of polyphosphonic acid can be expressed in grams. In some embodiments, between about 1 pg to about 1 mg of polyphosphonic acid can be injected into the sample.

(31) The polyphosphonic acid is injected into the sample and not into the mobile phase. Generally, injecting additives (including polyphosphonic acids) into a mobile phase can result in ion suppression, i.e., an adverse effect on detector (e.g., mass spectrometer) response due to reduced ionization efficiency because the additives contend with the analyte for ionization. This results in the presence of species other than the analyte of interest being detected by the mass spectrometer. In contrast, injecting a polyphosphonic acid into a sample, instead of a mobile phase, removes the risk of ion suppression because the polyphosphonic acid elutes early (i.e., in the void volume) during chromatographic separation and thus can be excluded from mass spectrometric analysis (i.e., by sending the early eluting compounds/additives/polyphosphonic acid to waste).

(32) Phosphonates and polyphosphonic acids of varying molecular properties can be used in this technology. The chemical structures described by Diab et al, Bisphosphonates: Pharmacology and Use in the Treatment of Osteoporosis, Osteoporosis (Fourth Edition), 2013, pages 1859-1872 and Bishop et al., Bisphosphonates, Osteogenesis Imperfecta, 2014, pages 495-500 can be used in this technology and are hereby incorporated herein by reference. Log D values should be given consideration along with the pKa of the phosphonic acid moieties. The pKa properties of the phosphonic acid moieties should be considered relative to the experimental conditions employed. In practice, it is desired to have one or more of the acidic groups of the phosphonic acid species ionized at the experimental pH, such that chromatographic retention of the phosphonate does not occur. In practice, the pH and concentration at which a phosphonate is employed should be considered to optimize its utility.

(33) The polyphosphonic acid can be a bisphosphonic acid. In some embodiments, the bisphosphonic acid can have Formula I:

(34) ##STR00001##
where R.sub.1 and R.sub.2 are each independently be selected from the group consisting of OH, H, (C.sub.1-C.sub.20)alkyl, halogen, amine, and (C.sub.1-C.sub.20)amine. In some embodiments, R.sub.1 and R.sub.2 can be optionally substituted.

(35) Examples of bisphosphonic acids include etidronic acid, clodronic acid, pamidronic acid, alendronic acid, neridronic acid and olpadronic acid. The chemical structures of exemplary bisphosphonic acids are shown below.

(36) ##STR00002##

(37) In some embodiments, R.sub.1 and R.sub.2 are each independently be selected from the group consisting of H, OH, a cycloalkane, and a heterocycloalkane. In some embodiments, the cycloalkane and heterocycloalkane can be optionally substituted. Examples include, tiludronate acid, risedronate acid, and zoledronate acid. The chemical structures of exemplary bisphosphonic acids are shown below.

(38) ##STR00003##

(39) In some embodiments, triphosphonic acids can be used. For example, the polyphosphonic acid can be nitrilotri(methylphosphonic acid). The chemical structure of nitrilotri(methylphosphonic acid) is shown below.

(40) ##STR00004##

(41) Referring back to FIG. 1, the method of separating a sample comprising oligonucleotides and/or glycans also includes flow the sample and polyphosphonic acid through a liquid chromatography column (110) and separating the sample/oligonucleotides/glycans (115). The liquid chromatography column can be formed of metal. In some embodiments, the liquid chromatography column is formed of plastic, for example, PEEK.

(42) When the sample includes oligonucleotides, the sample can include any oligonucleotide, for example, the sample can include antisense oligonucleotides (ASOs), small interfering RNAs (siRNA), small hairpin RNAs (shRNAs), and micro RNAs (miRNAs) as well as Aptamers and messenger RNAs (mRNAs). The sample can include oligonucleotides that range from about 20 to about 80 nucleotides, for example, the oligonucleotide can be about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, or 80 nucleotides long. In some embodiments, the oligonucleotide is an mRNA having a length of about 1,500 or more nucleotides long.

(43) In some embodiments, the sample includes a phosphorylated oligonucleotide, e.g., an oligonucleotide that has been phosphorylated at one or both ends. In some embodiments, the oligonucleotide has a 5 phosphate or a 3 phosphate. The oligonucleotides present in the sample can include nucleotides where at least one nucleotide within the oligonucleotide is adenosine triphosphate (ATP). The structure of ATP is shown below.

(44) ##STR00005##

(45) In some embodiments, the polyphosphonic acid is etidronic acid at a pH of 8.5 and the oligonucleotide include nucleotides where at least one nucleotide is ATP.

(46) Referring to FIG. 2, in another aspect the technology features a method of performing solid phase extraction (200). The method 200 includes injecting a sample into a solid phase extraction (SPE) cartridge (205). The sample includes oligonucleotides, for example, any oligonucleotide described herein, and/or glycans. The SPE cartridge includes a stationary phase. The oligonucleotides and/or glycans are retained by the stationary phase. One of skill in the art will understand how to select a stationary phase material that will retain an oligonucleotide and/or glycan of interest.

(47) The method 200 also includes washing the SPE cartridge with a polyphosphonic acid (210). The polyphosphonic acid is at a concentration of between about 0.01 M to about 1 M. The polyphosphonic acid elutes the oligonucleotides and/or glycans from the SPE cartridge.

(48) As described above with respect to FIG. 1, a molar excess of polyphosphonic acid can be used. A molar excess is a concentration that is, for example, double or triple the concentration of the oligonucleotides or analytes in the sample. For example, the concentration of polyphosphonic acid can be between about 0.01 M to about 1 M. In some embodiments, the concentration of polyphosphonic acid is between about 0.01 M to about 0.1 M. In some embodiments, the concentration of polyphosphonic acid is between about 20 mM to about 50 mM or between about 30 mM to about 50 mM.

(49) Alternatively, the concentration of polyphosphonic acid can be expressed in grams. In some embodiments, between about 1 pg to about 1 mg of polyphosphonic acid can be injected into the sample.

(50) The polyphosphonic acid can be any of those as described with respect to FIG. 1 above, for example, etidronic acid or nitrilotri(methylphosphonic acid). As described above, the sample can include phosphorylated oligonucleotides, for example, oligonucleotides having nucleotides where at least one nucleotide is ATP.

(51) In some embodiments, the walls of the SPE cartridge are formed of plastic, for example PEEK. The SPE cartridge can be a packed syringe or a well plate.

(52) Kits

(53) The technology can be provided in kits. For example, in some aspects the technology relates to kits for use in the separation of oligonucleotides and/or glycans using liquid chromatography. The kit can include a chromatography column packed with a stationary phase suitable to separate oligonucleotides and/or glycans. The kit can also include a vial comprising a polyphosphonic acid. The polyphosphonic acid can be any of those described herein. The kit can also include instructions for separating a sample comprising oligonucleotides and/or glycans. The instructions can be, for example, any one of the methods described herein.

(54) In another aspect, the technology relates to kits for use in solid phase extraction of oligonucleotides and/or glycans. The kit can include a solid phase extraction cartridge packed with a stationary phase suitable to separate oligonucleotides and/or glycans. The kit can also include a vial comprising a polyphosphonic acid. The polyphosphonic acid can be any of those described herein. The kit can also include instructions for separating a sample comprising oligonucleotides and/or glycans. The instructions can be, for example, any one of the methods described herein.

(55) In yet another aspect, the technology relates to kits for use in sample preparation of a biological material, such as, for example, but not limited to, oligonucleotides, glycans, or any phosphorylated compound. The kit can include glassware (e.g., sample vials, flasks, beakers, etc.) as well as a vial comprising a polyphosphonic acid. The polyphosphonic acid can be any of those described herein. The kit can also include instructions for sample preparation or preparing a calibration curve for the biological material.

(56) In some embodiments, the solid phase extraction cartridge is a packed syringe. In some embodiments, the solid phase extraction cartridge is a well plate, for example, a 96-well plate.

EXAMPLES

Example 1: Recovery of GEM 91 Oligonucleotide from WAX SPE Plate

(57) A sample comprising GEM 91, an antisense 25-mer oligonucleotide phosphorothioate, a therapeutic agent for AIDS, was separated using weak ion exchange (WAX) solid phase extraction (SPE). The SPE was performed using well plates following the protocol below:

(58) Condition: 2200 L MeOH

(59) Equilibrate: 3200 L of 50 mM NH.sub.4Ac (pH 5.5)

(60) Load: 200 L GEM 91 oligonucleotide

(61) Wash 1: 2200 L NH.sub.4Ac (pH 5.5)

(62) Wash 2: 1200 L 20% MeOH

(63) Elute: 250 L 50 mM TEA (triethylamine)/20% MeOH (pH 12.2)

(64) Samples were analyzed using LC/MS employing the conditions detailed below. As shown in FIG. 3A, only 14% of the GEM 91 oligonucleotides was recovered. Recovery was calculated based upon a comparison to a sample of known concentration that was not passed through the SPE device.

(65) The following conditions were used in this LC/MS analysis:

(66) LC Conditions:

(67) Mobile Phase A: 15 mM TEA, 400 mM HFIP (hexafluoro-2-propanol) pH 7.8

(68) Mobile Phase B: 50% Mobile Phase A/50% Methanol pH 7.8

(69) Injection volume: 10 L

(70) Column: Acquity BEH C18 1.7 m, 2.150 mm

(71) Temperature: 60 C.

(72) TABLE-US-00001 Flow (mL/min) % A % B initial 0.5 75 25 1.0 0.5 75 25 2.0 0.5 5 95 3.0 0.5 5 95 3.5 0.5 75 25 4 0.5 75 25

(73) MS Conditions:

(74) TABLE-US-00002 Name Q1/Q3 Cone Collision GEM 91 A 863.1/95 60 58 GEM 91 B 971.0/95 60 68
Negative ESI Mode
Capillary Voltage2 kV
Source Offset50
Desolvation Temperature400 C
Desolvation Gas800 L/hr
Cone Gas10 L/hr
Source Temp120 C

(75) The same SPE was performed again, but this time using etidronic acid to elute/wash the GEM 91 oligonucleotide from the well plate. FIG. 3B shows that 90% of the GEM 91 oligonucleotides was recovered when etidronic acid was used to elute/wash the oligonucleotides from the well plate.

(76) A comparison of FIG. 3A to FIG. 3B shows that the MRM (multiple-reaction monitoring) chromatograms produced when etidronic acid is used have TIC (total ion current) signal count that is an order of magnitude better than when the SPE was done with MeOH and TEA (compare MRM of 4 Channels ESTIC 4.74e5 of FIG. 3B to MRM of 4 Channels ESTIC 2.24e4 of FIG. 3A).

Example 2: Generation of Calibration Curve for 25-Mer Oligonucleotide GEM 91

(77) Generation of a linear calibration curve is the most fundamental task in any quantitative bioanalytical study. Nonspecific binding of an analyte will render many of the lower concentration samples below the limit of detection and therefore dramatically impact results. In the example shown in FIGS. 4A and 4B, a standard curve is prepared for a 25-mer oligonucleotide GEM 91. Oligonucleotides are particularly prone to nonspecific binding. The samples of FIGS. 4A and 4B were prepared in glass sample vials. In the calibration curve in FIG. 4A, the standard being analyzed is an aqueous solution. It can be observed that the lower region of the curve is not detected because of the loss of signal due to the analyte being nonspecifically bound. When the same analyte is prepared in etidronic acid, FIG. 4B, the nonspecific binding of the analyte is eliminated, and the full linear dynamic range becomes useful data.

Example 3: Passivation of Stainless Steel Frits by Injection

(78) Example 3 shows the passivation of stainless steel frits using different acids for the separation and detection of ATP (adenosine triphosphate). Injections were done every thirty seconds. The ATP and acid were injected onto a metal frit. The ATP sample used has a concentration of 55 ng/L. A 0.2 L injection injects 10 ng of ATP onto the stainless steel frit. The ATP sample is in 50% acetonitrile with 10 mM buffer pH 6.8 ammonium acetate.

(79) Referring to FIG. 5A, ATP is initially injected onto the stainless steel frit, five injections are made every 30 seconds. There is little to no signal due to the ATP interacting with the metal surface of the frit. However, there is a bit of a signal increase over the set of five injections. This is likely due to the ATP interacting with the metal surface of the frit, allowing later injections of ATP to elute without as much interference from the metallic surface, as at least a portion of the metallic surface has been passivated with prior ATP injections. However, since ATP is the analyte of interest, this is not an ideal situation.

(80) Next, etidronic acid at a pH of 8.5 is injected onto the stainless steel frit, five injections every 30 seconds. Due to etidronic acid being fully charged (having two negative charges per phosphate), the etidronic acid has a good potential to be absorbed to the metal. The increased signal that is initially observed during the etidronic acid injections is the ATP eluting from the stainless steel frit as the etidronic acid displaces any ATP that has adhered to the metallic frit in the previous injection.

(81) Still referring to FIG. 5A, after the injections of etidronic acid, ATP was again injected into the stainless steel frit, five injections every 30 seconds. The second set of ATP injections shows a much larger and more consistent signal than the first set. This indicates that the etidronic acid from the prior injection has adhered to the metallic surface of the frit and the ATP can elute without interference from the metal.

(82) Water was then injected into the system and a third set of ATP injections, five injections every 30 seconds, was made. The third injection of ATP is still much larger than the first injection, but smaller than the second ATP injection. As can be seen from the third injection of ATP, the first injection in the five injection series is smaller and it gradually increases as each 30 second injection is made. This is likely due to the etidronic acid wearing off of the metallic frit. However, this second set of ATP injections after etidronic acid was used to passivate the frit, still provides good results and is much better than the initial set of ATP injections.

(83) FIG. 5B is similar to FIG. 5A, except that citric acid is used instead of etidronic acid. As can be seen from a comparison of FIG. 5B to FIG. 5A, citric acid is not as good at passivating the metallic frit as etidronic acid. The second and third injections of ATP show increasing signal strength over the five injections, indicating that ATP is adhering to the metallic surface and not eluting through the frit. In other words, the citric acid did not passivate the metallic frit to the same extent that the etidronic acid passivated the metallic frit. Moreover, the signal strength of the ATP in FIG. 5A with the etidronic acid is about 0.015 AU while the signal strength of the ATP in FIG. 5B when citric acid is used in a degree of magnitude less, at about 0.006 AU.

(84) FIG. 5C is similar to FIGS. 5A and 5B, except that nitric acid is used to passivate the metallic frit. As can be seen from a comparison of FIG. 5C to FIG. 5A, nitric acid is not as good at passivating the metallic frit as etidronic acid. The second and third injections of ATP show increasing signal strength over the five injections, indicating that ATP is adhering to the metallic surface and not eluting through the frit. In other words, the nitric acid did not passivate the metallic frit to the same extent that the etidronic acid passivated the metallic frit. Moreover, the signal strength of the ATP in FIG. 5A with the etidronic acid is about 0.015 AU while the signal strength of the ATP in FIG. 5C when nitric acid is used in a degree of magnitude less, at about between 0.0010 to about 0.0035 AU.

(85) FIG. 5D is similar to FIGS. 5A, 5B, and 5C except that nitrilotri(methylphosphoric acid) is used to passivate the metallic frit. As can be seen from a comparison of FIG. 5D to FIG. 5A, nitrilotri(methylphosphoric acid) is a good passivator. The second and third injections of ATP are relatively flat, each injection having an absorbance of about 0.015 AU. Similar to FIG. 4A, during the third set of injections of ATP, the first injection in the five injection series is smaller and it gradually increases as each 30 second injection is made. This is likely due to the nitrilotri(methylphosphoric acid) wearing off of the metallic frit. However, this second set of ATP injections after nitrilotri(methylphosphoric acid) was used to passivate the frit, still provides good results and is much better than the initial set of ATP injections.

Example 4: Longevity Following a Single Injection

(86) Example 4 relates to how long a single 2 L injection of etidronic acid or nitrilotri(methylphosphoric acid) (NTMPA) passivation lasts. FIGS. 6A and 6B show a two L injection of etidronic acid (FIG. 6A) and NTMPA (FIG. 6B) followed by 20 ATP injections (0.2 L per injection) spaced one minute apart. Similar to Example 2, a stainless steel frit was used for Example 3.

(87) FIGS. 6A and 6B show that the passivation provided by etidronic acid or nitrilotri(methylphosphoric acid) is temporary. As can be seen from FIGS. 6A and 6B, the absorbance of ATP slowly decreases with each injection of ATP. This shows that the effects of the passivation slowly wear off.

Example 5: High Recovery, High Sensitivity of Phosphoglycan Analysis

(88) Anionic glycans can be difficult to analyze by liquid chromatography because of their propensity to adsorb to metal surfaces. While multiply sialylated analytes can be difficult to recover, this challenge is most obvious with phosphorylated glycans. Nevertheless, it is critical to have accurate assays for the characterization and quantitation of phosphorylated glycans, given that they can be found as post-translational modifications on proteins of therapeutic value and can be of direct impact to cellular uptake. Enzyme replacement therapies for lysosomal storage disorders are a defining example of a therapeutic class wherein phosphorylated glycans frequently represent a critical quality attribute. With the instant technology, it has been discovered that polyphosphonic acids, including but not limited to etidronic acid, can be added to samples to dramatically improve the recovery of phosphorylated glycans during an LC-based analysis. As shown in this example, a standard N-glycan sample preparation technique leads to the detection of little to no phosphorylated glycan. If etidronic acid is instead added to the sample prior to its injection onto an LC-MS system, 10 to 1000 increases in sample recovery and sensitivity can be achieved.

(89) N-Glycans were prepared from recombinant glucuronidase using a GlycoWorks RapiFluor-MS N-Glycan kits according to manufacturer recommendations. Aqueous samples were prepared to the point of being derivatized with RapiFluor-MS and 4 L of 500 mM etidronic Acid (neutralized with ammonium hydroxide) was added to a 40 L volume of the reaction mixture. Solid phase extraction was not employed and a 1 L volume of aqueous sample was injected onto a 2.150 mm ACQUITY UPLC Glycan BEH Amide 1.7 m 130 column (commercially available from Waters Technologies Corporation, Milford, MA) heated to a temperature of 60 C. An LC-fluorescence-MS analysis was thereby performed using an ACQUITY UPLC H-Class Bio outfitted with a fluorescence detector and XEVO G2-XS QTof mass spectrometer (commercially available from Waters Technologies Corporation, Milford, MA). To ensure that the non-volatile components of the sample were not eluted into the mass spectrometer, chromatographic effluent was diverted to waste for the first 3 minutes of the run. Selective detection of a mannose 7 glycan containing two man-6-phosphate residues was achieved through a visualization of extracted ion chromatograms (1015.840.2 m/z). Gradient and flow rate conditions were as follows:

(90) TABLE-US-00003 % C 50 mM ammonium Time Flow Rate formate % D (min) (mL/min) (pH 4.4) acetonitrile Curve Initial 0.400 25.0 75.0 Initial 11.66 0.400 46.0 54.0 6 12.16 0.200 100.0 0.0 6 13.16 0.200 100.0 0.0 6 14.36 0.200 25.0 75.0 6 15.86 0.400 25.0 75.0 6 18.33 0.400 25.0 75.0 6

(91) FIGS. 7A and 7B show LC-MS analysis of phosphorylated Man-7 Glycan as facilitated with sample diluent containing etidronic acid. FIG. 7A are extracted ion chromatograms for Man-7 with two Man-6-Phosphate residues (Man7-PP; 1015.840.2 m/z) as obtained from a sample containing (bottom) and not containing etidronic acid (top). FIG. 7B is a mass spectrum of a Man-7 glycan containing two Man-6-Phosphate residues as obtained from an etidronic containing sample diluent.

Example 6: Effect of Etidronic Acid Eliminates Nonspecific Binding with Isocitric Acid Analyte

(92) The effect of etidronic acid addition to eliminate nonspecific binding is further demonstrated with the example of LC/MS analysis of isocitric acid. Referring to FIG. 8A, a small area is highlighted at 1.50 minutes where the isocitric acid should elute. A much larger area appears at 2.7 minutes as a large blob. That larger area is the isocitric acid being retained on metallic systems components such as column body and frits, and slowly eluted off as the gradient changes. As the concentration of etidronic acid increases from 0.1 mM to 100 mM (see FIGS. 8B-8E), we can observe that the nonspecific binding of isocitric acid on the systems starts to decrease (as evidenced by the loss of signal at 2.69 minutes) and a well-defined peak for isocitric acid appears at the expected retention time.

(93) The following conditions were used in this LC/MS analysis:

(94) LC Conditions:

(95) Mobile Phase A: 0.1% formic acid in water

(96) Mobile Phase B: 0.1% formic acid in acetonitrile

(97) Injection volume: 3 L

(98) Column: ACQUITY UPLC CSH Phenyl Hexyl 1.7 m, 2.1100 mm

(99) Temperature: 50 C.

(100) TABLE-US-00004 Flow (mL/min) % A % B initial 0.4 98 2 0.5 0.4 98 2 3.0 0.4 75 25 3.1 0.4 5 95 4.1 0.4 5 95 4.2 0.4 98 2
MS Conditions:
Negative ESI Mode, 40-950 m/z
Capillary Voltage2 kV
Source Offset50
Desolvation Temperature400 C
Desolvation Gas800 L/hr
Cone Gas10 L/hr
Source Temp120 C

Example 7: Effect of a Titanium Frit Deactivated with an Inert Coating of Hybrid Organic-Inorganic Silica on Non-Specific Adsorption of 25-Mer Phosphorothioate Oligonucleotide (GEM 91)

(101) Example 7 compares non-specific adsorption of a sample for a titanium frit deactivated with an inert coating of hybrid organic-inorganic silica (FIG. 9A) versus a stainless steel frit (FIG. 9B). The sample was a 25-mer phosphorothioate oligonucleotide and investigated with the following experimental conditions of a mobile phase of 5 mM ammonium acetate with pH 6, a flow rate of 0.2 mL/min, repetitive injection each 0.5 minutes apart, and only a 4.6 mm inner diameter HPLC frit in the sample flow path (no column in this experiment). The injected sample was detected by UV at 260 nm. Three different concentration levels of the sample were injected. In the first 10 injections, 31.1 ng of oligonucleotide was injected, followed by 10 injections of 62.2 ng of oligonucleotide, and followed by 10 injections of 155.5 ng oligonucleotide.

(102) FIG. 9A is a chromatogram showing absorbance over time of three different concentration levels of 25-mer phosphorothioate oligonucleotide, including a titanium frit deactivated with an inert coating of hybrid organic-inorganic silica, according to an illustrative embodiment of the technology. No non-specific adsorption of 25-mer phosphorothioate oligonucleotide was apparent (no signal loss).

(103) FIG. 9B is a chromatogram showing absorbance over time of three different concentration levels of 25-mer phosphorothioate oligonucleotide, including a stainless steel frit, according to an illustrative embodiment of the technology. In contrast to the titanium frit of FIG. 9A, non-specific adsorption was apparent (signal loss) for the stainless steel frit. The first ten, low level injections were completely lost, adsorbed on metal surface. Upon multiple injections, the signal improved due to the saturation of the stainless steel surface with and excess of the sample.

(104) Below is nucleotide sequence for Trecovirsen (GEM91), 25-mer phosphorothioate oligonucleotide:

(105) TABLE-US-00005 CTCTCGCACCCATCTCTCTCCTTCT

Example 8: Effect of Passivation of Stainless Steel Frits with Various Acids

(106) Example 8 displays a series of experiments, that investigated the passivation of stainless steel frits with various acids including etidronic acid. The stainless steel frits were sonicated for 15 minutes at 50 C. in the solution indicated in FIGS. 10A-10I. The sample was a 25-mer phosphorothioate oligonucleotide and investigated with the following experimental conditions of a mobile phase of 5 mM ammonium acetate with pH 6, a flow rate of 0.2 mL/min, repetitive injection each 0.5 minutes, and only a 4.6 mm inner diameter HPLC frit was in the sample flow path (no column in this experiment). The injected sample was detected by UV at 260 nm.

(107) FIGS. 10A-10I are chromatograms showing absorbance over time of three different concentration levels of 25 mer phosphorothioate oligonucleotide injected on a sonicated stainless steel frit with phosphoric acid (75 mM H.sub.3PO.sub.4) (FIG. 10A) and its buffer (75 mM (NH.sub.4).sub.2HPO.sub.4) titrated to pH 5.7 (FIG. 10B), 10% citric acid (FIG. 10C) and its buffer (10% (NH.sub.4).sub.3 citrate) titrated to pH 7 (FIG. 10D), 0.6M etidronic acid (FIG. 10E) and its buffer (0.6M etidronate NH.sub.4) titrated to pH 7 (FIG. 10F), 10% formic acid (FIG. 10G), 1 mM ethylenediaminetetraacetic acid (EDTA) (FIG. 10H), and 10% nitric acid (FIG. 10I), according to an illustrative embodiment of the technology.

(108) Without wishing to be bound by theory, frit surface passivation is believed either due to excess of the sample that saturates the active adsorption sites or due to adsorption of competitive agents, such as multivalent acids anions (e.g., phosphate, citrate, or etidronate). These ions can be used directly as acids or as buffered solutionssalts (FIGS. 10A-10F). Phosphoric, citric and etidronic acids (including their buffers titrated to pH 5.7-7) are capable of conditioning the frit surface (FIGS. 10A-10F). No significant loss of oligonucleotide signal was observed with the conditioned frits.

(109) No conditioning effect were observed for formic, nitric and EDTA acids (FIG. 10G, FIG. 10H, and FIG. 10I). Formic acid or nitric acid did not have any positive effect on sample recoverythey offered no protection (FIG. 10G and FIG. 10H). EDTA acid did not condition the stainless steel frit surfaces (FIG. 10I).

(110) In after washing the passivated frits with a diluted ammonium hydroxide to wash the frits after conditioning with phosphate/citrate/etidronate and saw partial loss of conditioning. The longevity of the conditioning appeared to be about 100 minutes.

(111) Below is the chemical structure of 1,1-bis(phosphonic acid) (etidronic acid).

(112) ##STR00006##

Example 9: Effect of Stainless Steel Frit Conditioning on Sample Recovery

(113) Example 9 compares stainless steel frit conditioning via sample recovery of adenosine 5-,-methylene) diphosphate (AMPcP), which is sensitive to metal surface adsorption (similar to oligonucleotides). The experimental conditions included a mobile phase of 5 mM ammonium acetate with pH 6, a flow rate of 0.2 mL/minute, and only a 4.6 mm inner diameter HPLC frit in the sample flow path (no column). The experiment was performed by injecting 50 ng of AMPcP in 9 or 10 injection series spaced by 10-minute gaps.

(114) FIG. 11A is a chromatogram showing injections of adenosine 5-,-methylene) diphosphate (AMPcP) with experimental conditions including a stainless steel frit that was first conditioned with five series of 10 L injections (510 L injections) of 0.6M NH.sub.4 etidronate pH 7 solution, which was injected via a liquid chromatography autosampler, according to an illustrative embodiment of the technology.

(115) After the frit conditioning, the AMPcP sample was injected via nine series of 10 injections (910 injections). Based on the experimental results as shown in FIG. 11A, it can be seen that the frit conditioning with 0.6M NH.sub.4 etidronate pH 7 solution is temporary. The recovery was initially good (95%). However, the recovery began to decrease and the peaks began tailing.

(116) FIG. 11B is a chromatogram showing injections of adenosine 5-,-methylene) diphosphate (AMPcP) with including a conditioned stainless steel frit sonicated in 1% phosphoric acid for 15 minutes, according to an illustrative embodiment of the technology.

(117) After the frit conditioning, the AMPcP sample was injected via ten series of 10 injections (1010 injections). In contrast to the conditioning of the FIG. 11A example, the conditioning of the FIG. 11B example appears to be more stable. No loss of recovery was observed during the experiment of FIG. 11B.

(118) Below is the chemical structure of adenosine 5-,-methylene) diphosphate (AMPcP).

(119) ##STR00007##

Additional Embodiments

(120) While a number of examples have been described, the present disclosure is not to be so limited. The present disclosure includes additional non-limiting examples. For example, without wishing to be bound by theory, after washing the passivated frits with a diluted ammonium hydroxide to wash the frits after conditioning with phosphate/citrate/etidronate, the frits may experience a partial loss of conditioning. The longevity of the conditioning could be affected, such as a partial loss of conditioning experiences after about 100 minutes.