A BIOMATERIAL WITH A HIGH GLYCOSAMINOGLYCAN/HYDROXYPROLINE RATIO, COMPOSITION, METHODS AND APPLICATIONS
20240058507 ยท 2024-02-22
Inventors
Cpc classification
C08L5/08
CHEMISTRY; METALLURGY
A61L2430/38
HUMAN NECESSITIES
A61L27/3834
HUMAN NECESSITIES
C08L89/06
CHEMISTRY; METALLURGY
C08L5/08
CHEMISTRY; METALLURGY
C08L89/06
CHEMISTRY; METALLURGY
International classification
Abstract
A composition comprising a glycosaminoglycan component, and one or more extracellular matrix components forming a precipitate with the glycosaminoglycan component, wherein the precipitate has a glycosaminoglycan to hydroxyproline ratio from about 1:10 to about 100:1. In particular, it is a GAG-rich composition with controllable and high glycosaminoglycan (GAG) content that mimics the extracellular matrix (ECM) of GAG-rich native tissues. Also provided is a method of making and using the aforesaid composition. Further provided is a method of treating a tissue disorder in a subject using the aforesaid composition. The composition may be used as scaffolds for applications such as microcarriers, 3D culture substrates, swelling agent, volume filling agent, replacement of nucleus pulposus, cartilage, and other GAG-rich tissues.
Claims
1. A composition comprising a glycosaminoglycan component, and one or more extracellular matrix components forming a precipitate with the glycosaminoglycan component, wherein the precipitate has a glycosaminoglycan to hydroxyproline ratio from about 1:10 to about 100:1.
2. The composition according to claim 1, wherein the one or more extracellular matrix components are selected from the group consisting of collagen, hyaluronic acid, fibronectin, laminin, a core protein, a link protein, a peptide, a derivative thereof, a salt thereof, and a combination thereof.
3. The composition according to claim 1, wherein the one or more extracellular matrix components comprise collagen, hyaluronic acid, a derivative thereof, and/or a salt thereof, and at least one extracellular matrix component has a functional group reacting with the glycosaminoglycan component for forming the precipitate.
4. The composition according to claim 1, wherein the glycosaminoglycan component is selected from sulfated glycosaminoglycan, heparin/heparan sulfate, chondroitin sulfate, dermatan sulfate, keratan sulfate, a derivative thereof, or a combination thereof.
5. The composition according to claim 1, wherein the one or more extracellular matrix components have one or more amino groups for reacting with the glycosaminoglycan component to form the precipitate, and the one or more extracellular matrix components are positively charged or neutral.
6. The composition according to claim 1, wherein the extracellular matrix components comprise aminated collagen, and aminated hyaluronic acid.
7. The composition according to claim 6, wherein the collagen is aminated by an amination reagent selected from ethylenediamine (EDA), tris(2-aminoethyl) amine (TAEA), L-arginine, metformin, or a polyamine, and preferably the amination reagent is ethylenediamine or tris(2-aminoethyl) amine.
8. The composition according to claim 1, wherein the precipitate has the glycosaminoglycan to hydroxyproline ratio of from 1:1 to 100:1, from 1:1 to 50:1, preferably 5:1 or 27:1.
9. The composition according to claim 1, wherein the precipitate shows GAG retention within 1 to 100 days for 1% to 99%, preferably 50%.
10. The composition according to claim 1, wherein the precipitate is in the form of small nano-sized beads like structure, micro-scale aggregation, or bottlebrush like structure.
11. The composition according to claim 1, wherein the precipitate has the glycosaminoglycan to hydroxyproline ratio of 5:1 for promoting chondrogenic differentiation of stem cells, or of 7:1 for promoting discogenic differentiation of stem cells.
12. A method of making a composition of claim 1, comprising the steps of: (i) providing one or more extracellular matrix components, optionally the one or more extracellular matrix components are aminated by an amination reagent; (ii) purifying the one or more extracellular matrix components optionally by dialysis; (iii) providing an aqueous solution of one or more extracellular matrix components; (iv) mixing the aqueous solution of step (iii) with a glycosaminoglycan component to form a precipitate, optionally followed by shaking or vortexing; and (v) collecting the precipitate; wherein the precipitate has a glycosaminoglycan to hydroxyproline ratio from about 1:10 to about 100:1.
13. The method of claim 12, wherein the amination reagent is a cationic chemical comprising at least two primary amino groups.
14. The method of claim 13, wherein the amination reagent is ethylenediamine (EDA), tris(2-aminoethyl) amine (TAEA), L-arginine, metformin, a polyamine, or a combination thereof.
15. A method of treating a tissue disorder in a subject comprising administering the composition according to claim 1 to the subject, wherein the composition serves as a swelling agent and/or a volume filing agent for implanting into a GAG-rich tissue in the subject.
16. The method of claim 15, wherein the GAG-rich tissue is nucleus pulposus (NP) or cartilage.
17. A method of culturing a tissue having abundant glycosaminoglycans, comprising a step of providing the composition of claim 1 as a substrate, a cell-free scaffold, or a cell-microcarrier.
18. The method of claim 17, wherein the tissue is nucleus pulposus (NP) or cartilage.
19. A device comprising the composition of claim 1.
20. The device of claim 19, further comprising stem cells, or cells isolated from cartilage, bones and nucleus pulposus.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0044] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058] D: aCol(TAEA)-GAG coprecipitate; E: Col-aHA-GAG coprecipitate; F: aCol(EDA)-aHA-GAG coprecipitate; G: aCol(TAEA)-aHA-GAG coprecipitate, H: Cell viability of bNPCs encapsulated in Co-ppts; scale bar=100 m.
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065] aCol(EDA)-aHA-GAG coprecipitate; H: aCol(TAEA)-aHA-GAG coprecipitate, scale bar=100 m.
[0066]
[0067]
[0068]
[0069] aCol-aHA-GAG, E: Diameter of microspheres overtime change of size of the scaffolds, scale bar=500 m.
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0090] As used herein, the GAG-rich biomaterial refers to the formation of a nanofibrous scaffold with high GAGS density. GAGS refer to the heparin/heparan sulfate, chondroitin sulfate/dermatan sulfate, and keratan sulfate, or any combinations of these moieties.
[0091] As used herein, ECM refers to the extracellular matrix materials, and ECM component may be provided in pure, isolated, partially isolated, recombinant or synthetic form. ECM component includes but not limited to HA, collagen, fibronectin, laminin, a core protein, a link protein, as well as a peptide, a derivative thereof, a salt thereof, and/or a combination thereof. The peptide includes, but not limited to, a self-assembled peptide (SAM) and a synthetic peptide such as a functional epitope of ECM component. The functional epitope of ECM component includes, but not limited to, Arg-Gly-Asp(RGD) peptide, Arg-Gly-Asp-Ser (RGDS), Gly-Arg-Gly-Asp-S er-Pro (GRGDSP) for fibronectin, GFOGER for collagen, and IKVAV for laminin.
Materials for Fabrication of GAG-Rich Composition
[0092] A. ECM Materials
[0093] The ECM component used for the composition must be able to provide support to the cells and interact with the cells to allow cell growth, permitting cell migration and penetration without introducing toxicity. The ECM component used can be collagen, such as type I, II, and III, or hyaluronic acid, hyaluronan, hyaluronic acid sodium salt from bovine vitreous humor, rooster comb, Streptococcus equi or streptococcus zooepidemicus, other ECM component such as fibronectin, laminin, a core protein, a link protein, and peptides include self-assembled peptides (SAM) and synthetic peptide such as functional epitopes of ECM including but not limited to Arg-Gly-Asp(RGD) peptide, Arg-Gly-Asp-Ser (RGDS), Gly-Arg-Gly-Asp-Ser-Pro (GRGDSP) for fibronectin, GFOGER for collagen, and IKVAV for laminin. The ECM component can be derived from either natural or synthetic sources, and it can be induced to solid form under specific conditions and support cell survival and growth. The ECM component can be produced from isolation or extraction from various animal sources, such as rat tail, porcine skin, bovine tendon, or human placenta.
[0094] The anionic ECM component, which can be a proteoglycan or GAG of different types, such as heparin/heparan sulfate, chondroitin sulfate/dermatan sulfate, and keratan sulfate. The aminated ECM components can offer a binding site to anionic GAGS similar to that the GAGS link to the hyaluronan chain in the native proteoglycan structure. These ECM components can form interaction in such a way that leads to a change in the components and structure of the composition such as the volume, ultra-structure, morphology, ECM density, GAG/HYP ratio, GAG retention ability, mechanical property and stability, biocompatibility, etc.
[0095] B. Chemical Modification Reagent
[0096] The chemical modification reaction refers to using chemical groups of ECM component that react with primary amines (NH2) and introduce the positively charged amino groups to the ECM chain. The chemical groups of ECM component can react with the primary amines refer to the carboxylic groups. The amination reagents can be from diverse origins; in preferred embodiments, chemicals are abundant of amino groups and non-toxic include but not limited to ethylenediamine (EDA), Tris(2-aminoethyl) amine (TAEA), L-arginine, Metformin, polypeptide, and polyamines. The reaction can be induced and crosslinked by crosslinker EDC, EDC/NHS, or other reagents that has good biocompatibility. The resulting solution can be dialysis or centrifugation to remove the unreacted chemical reagents.
Amination Modification
[0097] The chemical modification method includes exposing the species such as HA or collagen reacting with amination reagents in specific amination reagents, pH, molar ratio, concentration, temperature, crosslinker, the concentration of crosslinker, and reaction time. The amination reagents used are chemicals that contain amino groups such as ethylenediamine (EDA), Tris(2-aminoethyl) amine (TAEA), L-arginine, Metformin, and polyamines, etc. Crosslinker used include 1-ethyl-3(3-dimethylaminopropyl) carbodiimide (EDC) in DI water and EDC/N-Hydroxy succinimide (NHS) (1 mM-100 mM) in 2-(N-morpholino) ethane sulfonic acid (IVIES) buffer solution. ECMs, amination reagents, and crosslinker are mixed thoroughly. In addition, the unreacted amination chemicals can be removed by dialysis. Aminated ECMs are collected after complete dialysis removing the unreacted chemicals.
[0098] The conditions of different amination reagents are adjusted for maintaining the high positive charge of aminated ECM components. The liquid-form amination reagents are diluted by hydrochloric acid (HCl) at a concentration between 0.01 M to 8 M, preferably 6-8 M, and this process must be operated on ice as the dilution process is exothermic. pH and concentration of the amination reagents diluted in HCl is adjusted by HCl and DI water under a pH meter. Moreover, the solid-form amination reagents are dissolved in IVIES buffer.
[0099] The amination reaction process is initiated by controlling the temperature, the pH, the ratios of reactants, crosslinker of the liquid environment at the appropriate time. The temperature of the amination reaction is raised from 4 C. to 10 C., 20 C., 37 C., and preferably 4-20 C. The reaction environment is maintained at pH between 1 to 13, preferably between 5-6 for both liquid-form and solid-form amination reagents. The positive charge of the aminated ECM components can be increased by increasing the ratio of amination reagents to ECM components. The molar ratios of amination reagents to ECMs are between 1:1 to 5000:1, preferably 50:1 to 5000:1. The crosslinker is responsible for crosslinking the carboxylic groups of ECMs and amino amination reagents. The crosslinker of the reaction is EDC or EDC/NHS. The reaction time is controlled between 0.5 h to 24 h, preferably 2-16 h.
[0100] The aminated ECM components can be purified by a dialysis tube or high-speed centrifugation in a microtube with a dialysis membrane, preferably a dialysis tube. The aminated ECM components are dialyzed against liquid such as DI water, phosphate-buffered saline, and dilute acetic acid solution for 2-4 days, and change fresh dialyzing solution 4 times/day. The aminated ECM components are stabilized by collecting the solution from the dialysis tube, keeping the solution at 4 C. or freeze-drying and storing it in 20 C.
[0101] The surface charge of the aminated ECM components can be controlled by at least one of the following parameters: composition, chemical groups of ECM components, the concentration of the ECM components, and amino group density, and concentration of amination reaction reagents. The ECM components suitable for amination include collagen, HA, and other ECM components, and the concentration of ECM components can be controlled at a range between about 0.01 mg/ml to 30 mg/ml. The amination reaction chemicals include ethylenediamine (EDA), Tris(2-aminoethyl) amine (TAEA), L-arginine, Metformin, and polyamines, etc. The concentration of amination reagents can be controlled at a range from 0.001 to 10 M, or preferably 0.25 M to 2.5 M for EDA, 0.15 M to 1 M for TAEA, and 0.1 M to 2 M for L-arginine and Metformin. Increasing the concentration of the amino group increases the positive charge of the aminated ECM components.
Method of Making GAG-Rich Composition
[0102] The method of forming GAG-rich composition process includes mixing the components together, vortex and centrifugation. The GAG-rich coprecipitate can be fabricated by different aminated ECM components mixture. The surface charge density of ECM components depends on the amination reagent concentration during the amination process that ECM components reacted with a high concentration of amination reagents have higher GAGS incorporation. The size, GAGS retention property, and mechanical property of the composition can be controlled by the components of the mixture, ratio, and concentration of the components, surface charge density, pH, and vortex speed, etc.
[0103] The system for producing GAG-rich composition includes a unit for mixing the components for gelation of the coprecipitate; and a platform for collecting the coprecipitates. The aminated ECM components and anionic GAGS are mixed and evenly distributed throughout the solution before co-precipitation. The gelation process can be accelerated by shaking or vortex. The coprecipitates are collected after centrifugation and removing the supernatant.
[0104] The gel formation process of the composition is also initiated by controlling the temperature, the pH, and the aminated ECM components concentration. The gelation process of the GAG-rich coprecipitates is maintained at a temperature between 4 C. to 37 C., or more preferably between 20 to 37 C. The pH of the gel formation process is maintained from 1 to 13, preferably 7. The coprecipitates can be formed by mixing the aminated ECM components and anionic GAGS in a short time, for example, within a range between 10 s to 30 minutes depending on the aminated ECM components concentration. The gelation speed can be controlled as fast as immediately after the optional shaking or vortex, or raising the temperature of the mixture to 37 C., or increasing the concentration of aminated ECM components and GAGS. The diameter of the coprecipitates formed controlled at a range between 0.002 mm to 50 mm. The gelled coprecipitates are collected by the gravity action or centrifugation. The free aminated ECM components and GAGS are gentle flushing with a liquid such as culture medium, DI water, or phosphate-buffered saline.
[0105] The size, GAG/HYP ratio, GAG retention property, and mechanical properties of the composition can be controlled by at least one of the following parameters: composition and concentration of aminated ECMs, the combination of two or more aminated ECM components together, amination conditions of the aminated ECM components, the ratio of the aminated ECM components to GAGS, and ratio of two aminated ECM components. For example, the initial aminated ECM components concentration can be controlled at a range between 0.01 to 30 mg/ml, using two or more aminated ECM components, preferably aHA and aCol mixed, the ratio of the aminated ECM components to GAGS can range from 1:10 to 10:1, preferably 1:2, the ratio of the aCol and aHA is range from 8:1 to 1:8, preferably 1:2-1:8, aHA are aminated by ethylenediamine (EDA), Tris(2-aminoethyl) amine (TAEA), L-arginine, Metformin, polypeptide, and polyamines, preferably aHA(TAEA) with TAEA concentration at a range of 0.5 M-1M. Similarly, the amination condition of aCol is reacted with ethylenediamine (EDA), Tris(2-aminoethyl) amine (TAEA), L-arginine, Metformin, polypeptide, and polyamines, preferably aCol(EDA) with EDA concentration at a range of 0.25 M-2.5 M and aCol(TAEA) with TAEA concentration at a range of 0.015 M-1M.
Properties of GAG-rich composition
[0106] The novel composition is fabricated by naturally occurring ECM component, HA, collagen, and GAGS, suggesting good biocompatibility that supports cell survival and proliferation. The GAG/HYP ratio of the aCol-aHA-GAG coprecipitates is high and controllable with the range of 3.5:1 to 39.1:1, significantly higher than existing scaffolds. Also, the aCol-aHA-GAG coprecipitate shows high GAG retention ability (20%-60%) within 24 h and 10%-40% within 7 days, solving the problem of quickly GAG elution from solid meshwork. The aCol-aHA-GAG coprecipitate shows nano-size beads like structure in SEM and bottlebrush like structure in TEM, highly structurally mimic the native GAG-rich tissue such as native NP. The aCol-aHA-GAG coprecipitate can be used for cell-free and cell-carrier scaffolds, and the shape, size, the orientation of the cell encapsulated aCol-aHA-GAG coprecipitates can be controlled. The aCol-aHA-GAG coprecipitate also shows good biocompatibility, high cell viability (>93%), maintenance of cell phenotype in protein and gene level, and comparable mechanical properties to that of the native NP. In addition, the aCol-aHA-GAG coprecipitate promotes the stem cell differentiation into the chondrogenic and NP-like linage, maintain the scaffold volume by the GAG-water interaction, mimic the pericellular matrix of the native cartilage and NP, enhance the gene expression of the chondrogenic markers and discogenic markers. Last but not least, the aCol-aHA-GAG coprecipitate shows good biocompatibility in vivo that can integrate with the native cells and tissue and maintain the high GAG content for at least one month.
[0107] The GAG/HYP ratio and GAG retention of the aCol-aHA-GAG coprecipitate is high and controllable by adjusting the TAEA concentration of aHA(TAEA) amination, EDA and TAEA concentration in aCol(EDA) and aCol(TAEA) amination, aCol/GAG ratio, and aCol/aHA ratio. By optimization, the GAG/HYP ratio can be controlled from 0 to 39.1:1. Also, the GAG retention ability can be controlled at a range from 20%-60% within 24 h and 10%-40% within 7 days release.
[0108] The ultrastructure of the aCol-aHA-GAG coprecipitates can be controlled by at least one of the following parameters: the composition, the aCol/aHA ratio, pH, culture temperature, and culture time. The ultrastructure of the coprecipitates are varied form with different components that aCol(EDA)-GAG and aCol(TAEA)-GAG showed nano-size (20-40 nm) beads like structure while aCol(EDA)-aHA-GAG and aCol(TAEA)-aHA-GAG show both small nano-size (20-40 nm) beads like and large aggregates(100 nm-500 nm) structure in SEM. Furthermore, aCol(EDA)-GAG and aCol(TAEA)-GAG show thin and tight fibers while the aCol(EDA)-aHA-GAG and aCol(TAEA)-aHA-GAG show large aggregates(100 nm-2 m) and bottlebrush like (50 nm-200 nm in length)structure in TEM. The beads like and bottlebrush like ultrastructure of the aCol-aHA-GAG coprecipitate are similar to that of the native NP, suggesting that these biomaterials highly structurally mimic the native GAG-rich tissue.
[0109] The aCol-aHA-GAG coprecipitate can be used for cell-carrier by mixing the aminated ECMs, GAGS, and cells together. The shape, size, GAG/HYP ratio, cell density, matrix density of the cell encapsulated coprecipitates can be controlled. Cells used in encapsulation can be isolated from GAG-rich tissues, such as native NP, cartilage, neurological tissue, and other tissues, from human or larger animals, such as bovine and sheep. The shape and size can be controlled by centrifuge and transfer to tubes with different shapes. The cell density can be controlled at 1E4-11E6 cells/mg aCol, preferably 5E4-51E6 cells/mg aCol. The coprecipitates showed high cell viability>93% and maintenance of bNPC phenotypes, such as SNAP25 and KRT8 in protein level and SNAP25, KRT8, CDH2, and SOSTDC1 in gene level. The elastic modulus of the acellular coprecipitates is 0.78-1.12 KPa, and that of the bNPCs-encapsulated coprecipitates is 10.54-12.38 KPa, which is comparable to the native NP (3.21 KPa) and AF (16.31 KPa).
[0110] The aCol-aHA-GAG coprecipitate can also be used for the hMSCs differentiation 3D culture system. The types of stem cells can be induced pluripotent stem cells (iPSCs), embryonic stem cells (ESCs), and adult stem cells, such as mesenchymal stem cells, hematopoietic stem cells, neural stem cells, epithelial stem cells, and skin stem cells. Specifically, the mesenchymal stem cells can be derived from different sources, such as bone marrow, fat (adipose tissue), amniotic fluid (the fluid surrounding a fetus), or umbilical cord tissue (Wharton's Jelly). Stem cells can be induced to differentiation into the chondrocytes or NPC-like linage by adding the induction medium containing growth factors, such as TGF-03 for chondrogenic differentiation and TGF-1 and/or GDFS for discogenic differentiation. The cell density can be controlled at 1E4-11E6 cells/mg aCol, preferably 5E4-51E6 cells/mg aCol. Upon chondrogenic differentiation, the coprecipitates promote the stem cell differentiation into the chondrocytes-like cells, increase the scaffold volume by the GAG-water interaction, mimic the lacuna circle and the nanobeads-fiber ultrastructure of the native cartilage, and enhance the gene expression of the chondrogenic phenotypes, such as Col2, ACAN, and SOX9. Upon discogenic differentiation, the coprecipitates maintain their volume, mimic the lamella circle, small fibers, and the brush structures as that of the native NP, and enhance the expression of discogenic markers, such as Col2, ACAN, PAX1, and FOXF1.
[0111] The aCol-aHA-GAG coprecipitate show good biocompatibility in vivo that can integrate with the native cells and tissue. The coprecipitates can be subcutaneously implanted in a mouse. The coprecipitates can be acellular or cell encapsulated. After 1-month post-implantation, the coprecipitates integrate with the native skin cells and tissues without any signs of inflammation or foreign body reaction. In addition, the high GAG content is maintained after 1 month.
[0112]
Examples
[0113] The present invention will be further understood by reference to the following non-limiting examples.
Example 1 Amination of Collagen
Materials and Methods
[0114] Rat-tail collagen type I solution in acetic acid, which mainly consists of triple helical monomers, pH=6 ethylenediamine solution (EDA) solution diluted in 6 M HCl, and 2 M EDC solution in DI water were mixed together. All procedures were done in an ice-bath to prevent collagen gel formation. The mixture was maintained and reacted at room temperature overnight with 60 r/min shaking. To remove the unreacted reagent, the solution was then dialyzed using a dialysis tube against 0.023 M acetic acid at room temperature for 6 hours and then at 4 C. for 2 days, changed fresh 0.023 M acetic acid 4 times every day.
[0115] The carboxyl groups of collagen triple-helical chain were reacted with the amino groups of EDAs, which was shown in
Example 2 Controlling Parameters of the Amination of Collagen
Materials and Methods
[0116] Rat-tail collagen solution type I was mixed and reacted with different amination reagents (EDA, TAEA, L-arginine, and Metformin) in the presence of different crosslinkers (EDC and EDC/NHS) as described in Example 1. The concentration of aminated reagents used in amination was controlled at 0.025 M to 2 M for EDA, 0.015 M to 1 M for TAEA, and 0.1 M to 2 M for L-arginine and Metformin. The crosslinker concentration was controlled at 1 mM to 100 mM for EDC in DI water and 1 mM to 100 mM for EDC/NHS in 0.5 M MES buffer. The pH during the reaction was adjusted to a range from 1 to 10. The mixture was reacted under 4 C. to 20 C. overnight. The aCol under different conditions were collected after removing the unreacted reagents by dialysis.
[0117] 1 mg Col and aCol with different amination reagents were freeze-dried and added to 200 mg dry potassium bromide. Mixed thoroughly in a mortar and pressed into tablets by tablet press. The chemical structure change during amination was directly analyzed by Perkin-Elmer spectrum-100 FTIR spectrometer (Perkin-Elmer Instruments, USA) with a universal ATR (attenuated total reflectance) sampling accessory. The sample was scanned 16 times, and the FTIR spectrum was recorded in the range of 4000 cm.sup.1 to 450 cm.sup.1 with a resolution of 2 cm.sup.1.
[0118] Zeta potential was performed to detect the surface charge of Col and aCol. 50 l Col or aCol were added to quartz plate, and zeta potential was measured using Smoluchowski model under dynamic laser by the DelsaMax PRO light scattering Analyzer (Beckman Coulter).
Results
[0119] The aCol with different amination reagents, reagents concentration, and crosslinkers were studied in detail. The mechanism of amination reaction of aCol with different reagents was shown in
[0120] FTIR was used to investigate the structural variation during the amination process. As shown in
Example 3 Amination of Hyaluronic Acid
Materials and Methods
[0121] Hyaluronic acid (HA) sodium salt was aminated using the same method as aCol in example 1. HA powder dissolved in DI water with different HA densities: 1 mg/ml to 4 mg/ml and used for the production of aHA with different amination reagents: EDA, TAEA. Similarly, EDA concentration was controlled at a range from 0.25 to 2 M, and that of TAEA was 0.15 M to 1 M. HA solution, EDA or TAEA, and crosslinker mixed together and reacted overnight at room temperature. The aHA was obtained after dialysis against DI water. FTIR and zeta potential were also used to investigate the changing of chemical bonds and surface charge during the amination process.
Results
[0122] Hyaluronic acid is a polymer of disaccharides and is composed of repeated D-glucuronic acid and N-acetyl-D-glucosamine structures. Hence, HA is abundant in carboxyl groups that can react with the amino groups. As shown in
[0123] The FTIR spectra of HA and aHA were shown in
Example 4 Production of GAG-Rich Composition and Ultrastructural Characterization
Materials and Methods
[0124] GAG solution was prepared by dissolving chondroitin-6-sulfate from shark cartilage in DI water. aCol, either with or without aHA reacted by different amination reagents, was mixed with GAG (in excess) and vortex for 1 min. The coprecipitates were collected by centrifugation at 16100 g for 2 mins.
[0125] The coprecipitates after three times rinsing with DI water were solubilized by 200 l 0.6 U papain solution at pH 6.5 containing 50 mM phosphate buffer (PB), 5 mM L-cysteine and 5 mM EDTA at 60 C. for overnight. The amount of GAG in the digested coprecipitate samples was diluted and detected by the dimethyl methylene blue (DMMB) method (Barbosa, Garcia et al. 2003). Briefly, 100 l diluted samples were mixed with 1 ml 0.9% (w/v) DMMB solution and shaking the mixture on a shaker for 30 mins. The DMMB-GAGs complexes were collected by centrifugation at 14000 g for 10 mins and dissolved into the complex dissociation reagent. Absorbance at 656 nm of samples and standards were measured under a microplate reader. GAGS were quantified by a calibration curve of chondroitin sulfate standard between 1.25 and 40 pg/ml. Part of the digested samples was acidified with hydrochloric acid and hydrolyzed in a hydrolysis tube at a 120 C. heater for 4 h treatment. The hydrolyzed samples were neutralized to pH 6-7, and HYP content was measured by the chloramine T-dimethylaminobenzaldehyde (DMAB) method (Woessner 1961). HYP content was quantified using a calibration curve between 2.5 and 400 pg/ml, and the absorbance of the samples were detected at 557 nm. The GAG/HYP ratio was calculated by the GAG and HYP content of the same sample.
[0126] Scanning electron microscopy (SEM) was used to measure the ultrastructure of the co-precipitates immediately after fabrication (pH=3, pH=7) (Chan, Hui et al. 2007). Coprecipitates were prepared by mixing the aCol and GAGS with or without aHA. NaOH was added to aCol to give a final solution with neutral pH before collection by 16000 g 2 mins centrifugation. Samples were rinsed with DI water three times to remove free GAGS, fixed with 4% Paraformaldehyde (PFA) at 4 C. for an overnight treatment, and dehydrated using gradient ethanol (10%, 30%, 50%, 70%, 90%, 95% and 100%, 15 mins each conc.). And then, samples were dried by critical point drying and fractured to reveal the internal structure of the coprecipitates, sputter-coated by gold, and imaged using field emission SEM (S-4800, Hitachi, Tokyo).
Results
[0127] aCol-GAG
[0128]
SEM
[0129] The ultrafine fibrous structure of different aCol-GAG coprecipitates immediately after fabrication as shown in
aHA-aCol-GAG
[0130] To further increase the GAG content, aHA was also reacted and added to form the coprecipitates. The repeated carboxylic groups reacted with amino groups can increase the positive charge density in coprecipitates. The incorporation of the aHA(EDA) was significantly increased the GAG content to 5.5:1-6:1 when aHA reaction crosslinked by EDC but not EDC/NHS(
Example 5 Optimization of the GAG Content in GAG-Rich Composition and Characterization of Retention and Other Properties
Materials and Methods
[0131] As mentioned in example 4, aCol-aHA (TAEA)-GAG showed the highest GAG/HYP ratio. The concentration of TAEA used in aHA amination was controlled between 0.01 M to 1 M, and that of EDC was controlled at 1 mM, 10 mM and 100 mM. In addition, various concentrations of EDA (0.025 M, 0.1 M, 0.125 M, 0.25 M, 0.5 M, 1 M, and 2 M), TAEA (0.15 M to 1 M) and aCol/aHA ratio (1:0.5-1:8) were used. The GAG/HYP ratio was used as a critical parameter and measured using the same method as described in example 4.
[0132] All coprecipitates, Col-GAG, aCol(EDA)-GAG, aCol(TAEA)-GAG, Col-aHA-GAG, aCol(EDA)-aHA-GAG, aCol(TAEA)-aHA-GAG were formed with 200 pg Col or aCol(EDA) or aCol(TAEA), 400 g aHA, and 400 g chondroitin-6-sulfate GAGS and immersed in 1 ml Dulbecco's Modified Eagle Medium(DMEM) Low Glucose (pH 7.2). GAGS were released in a shaking shaker (37 C., 180 rpm) over 7 days. At chosen time points (0.5, 1, 2, 4, 8, 12 and 24 h, 3, 5 and 7 days), 200 l of the eluent in each sample was collected with the same volume of fresh DMEM-LG medium replacement, and the collected samples were stored in 20 C. for subsequent measurement of GAG content as described in example 4. The percentage of GAG retention in different coprecipitates at different time points was calculated. During the GAG release process, the gross appearance pictures of coprecipitates in different groups were taken at 0, 1, 3, 7, and 14 days. SEM was used to measure the ultra-structure of the coprecipitates immediately after fabrication. The diameter distribution of different samples was calculated by 100 random measurements of SEM images using Image-J software (National Institutes of Health, USA). Also, the GAG release curve and SEM images of native bovine tail annulus fibrosus (AF), nucleus pulposus (NP), and intervertebral disc (IVD) were measured and used as control.
[0133] Transmission electron microscopy (TEM) was used to measure the inner ultrastructure of the native bovine tail annulus fibrosus (AF), nucleus pulposus (NP), and coprecipitates immediately after fabrication. Coprecipitates were rinsed with DI water three times to remove the free GAGS, fixed with 4% PFA at 4 C. for overnight treatment. And then, samples were cut into 100 nm ultra-thin, spread to a TEM grid, and imaged using TEM (Philips CM100 TEM).
Results
GAG/HYP Ratio
[0134] The amination and formation conditions of aCol-aHA-GAG were optimized to form coprecipitates with a high GAG/HYP ratio. The GAG/HYP ratio increased as the concentration of TAEA used in aHA increased (
GAG Retention
[0135]
[0136]
SEM
[0137] The ultrafine fibrous structure of native AF, native NP, and coprecipitates immediately after fabrication as shown in
TEM
[0138] The ultrastructure of native AF, native NP, and coprecipitates were also verified by TEM and shown in
[0139] Furthermore, the bottlebrush structures showed dose-dependent that the higher the aHA ratio, the more the bottlebrush distributed in the TEM images (
Example 6 Cell Viability, Cell Phenotype Maintenance and Histological Staining of Cell Encapsulated in GAG-Rich Composition
Materials and Methods
[0140] Bovine nucleus pulpous cells(bNPCs) were extracted from the bovine tail and cultured in (Sigma-Aldrich) in Dulbecco's modified Eagle's medium with low-glucose (DMEM-LG) (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco) and 1% penicillin/streptomycin (P/S) (Gibco) at 37 C. in a humidified incubator with 5% CO2. bNPCs of passage 2 were encapsulated in coprecipitates by thoroughly mixing with aHA, aCol, and GAGS. The bNPCs encapsulated coprecipitates after 3 days, 7 days, 10 days and 14 days culture were collected and stained with 1:1000 calcein-AM and ethidium homodimer-1 in PBS for 1 hour at 37 C.
[0141] Cell encapsulated coprecipitates on days 3, 7, 10, and 14 and native NP tissues were fixed in 4% PFA, and then were paraffin-embedded and sectioned at 10 m thickness for subsequent histological Hematoxylin/eosin (H&E) staining and histochemical Safranin-O staining. The paraffin sections were de-waxed in a 70 C. oven and followed by two changes of xylene. The sections were serially rehydrated using gradient ethanol, and stained with hematoxylin for 12 minutes, counter-stained with eosin for 5 mins. The sections were eventually mounted with Depex after dehydration and xylene wash. To reveal areas rich in GAGS, Safranin-O staining was performed. The paraffin sections were treated in the same process as previously described. The bNPCs nuclei were first stained with hematoxylin QS for 5 minutes and then further stained with fast-green (FCF) solution to reveal non-collagen proteins, followed stained with 1.5% Safranin-O solution for 35 minutes and mounted with Depex. Images of samples stained with H&E and safranin 0 were captured using an inverted microscope.
[0142] Similarly, bNPCs encapsulated coprecipitates on days 3, 7, 10, and 14 were harvested and embedded into cryo-matrix, followed by cut into 15 m sections. Samples were blocked in 1% BSA/10% normal goat serum/0.3 M glycine in 0.1% PBS-Tween for 1 h and then incubated with primary antibodies SNAP25 and KRT8 (in a humidified chamber for overnight at 4 C. And then incubated with secondary antibodies (Alexa Fluor 647-tagged anti-rabbit; Alexa Fluor 647-tagged anti-mouse) or Alex Fluor 488-taged F-actin and followed by mounting with mounting medium containing DAPI. The live/dead and immunofluorescence staining were acquired with confocal microscopy using a Leica SP8 Confocal Microscope and Imaging software Leica Application Suite (LAS) X.
[0143] To quantify of the expression of the phenotypic marker genes, the total RNA of bNPCs encapsulated in GAG-rich scaffolds was extracted by using the RNeasy Mini Kit (QIAGEN, Germany). Reverse transcription was carried out with a High-capacity Reverse Transcription Kit (Applied Biosystems). qPCR was then performed using the transcribed cDNA, the primers for Col2, ACAN, KRT8, SNAP25, CDH2, SOSTDC1, and GAPDH, the Power SYBR Green PCR Master Mix (Applied Biosystems), and a StepOnePlus Real-Time PCR System (Life Technologies). The primer sequences are listed in Table.1. The gene expression data were analyzed by the comparative CT method. Data were initially normalized to GAPDH, after which each gene was further normalized to the expression level of the monolayer culture.
TABLE-US-00001 TABLE1 TheprimersusedintheqRT-PCR. Forward Reverse Gene Primer(5to3) Primer(5to3) COL2 CGGGTGAACGTGGAGAGACA GTCCAGGGTTGCCATTGGAG (SEQIDNO.1) (SEQIDNO.2) KRT8 ACCAGGAGCTCATGAATGTC TCGCCCTCCAGCAGCTT AA (SEQIDNO.4) (SEQIDNO.3) SNAP25 GGCTTCATCCGCAGGGTAA GCTCCAGGTTTTCATCCATT (SEQIDNO.5) TC (SEQIDNO.6) CDH2 GCCATCAAGCCAGTTGGAA TGCAGATCGAACCGGGTACT (SEQIDNO.7) (SEQIDNO.8) ACAN GGCATCGTGTTCCATTACA ACTCGTCCTTGTCTCCATAG G (SEQIDNO.10) (SEQIDNO.9) SOSTDC1 GTTCAAGTAGGCTGCCGAG GCACTGGCCGTCTGAGATG AA (SEQIDNO.12) (SEQIDNO.11) GAPDH TGCCGCCTGGAGAAACC CGCCTGCTTCACCACCTT (SEQIDNO.13) (SEQIDNO.14)
Results
Cell Viability
[0144]
Histological
[0145] The H&E staining revealed the tissue anatomy, cell density, morphology, and distribution in which the bNPCs resided at Day 3, 7, 10, and 14 as well as native tissue. In native NP, round bNPCs are interspersed individually at a low concentration. bNPCs in collagen-GAG and collagen groups were elongated over time while the cells in aHA-collagen-GAG were still round. In aCol(EDA)-GAG, aCol(TAEA)-GAG, aCol(EDA)-aHA-GAG, aCol(TAEA)-aHA-GAG groups, cells were located in lacunae-like structures or form clusters in the collagen matrix (
[0146]
Cellular Phenotype Maintenance
[0147] In native NP, actin was distributed as a weak ring around the periphery of cells (
[0148] This actin pattern continued up to day 7 in aCol(EDA)-GAG, aCol(TAEA)-GAG, aCol(EDA)-aHA-GAG, aCol(TAEA)-aHA-GAG groups while the actin became longer and appeared as patches in Col and Col-GAG groups. On days 10 and 14, cells were elongated, and some stress fibers were observed in Col and Col-GAG groups but no obvious stress fibers in aCol(EDA)-GAG, aCol(TAEA)-GAG, aCol(EDA)-aHA-GAG, aCol(TAEA)-aHA-GAG groups. In Col-aHA-GAG groups showed the same round actin expression at all time points as native NP, suggesting that the actin maintains its pattern in the scaffold.
[0149] SNAP25 and KRT8 were reported as two potential phenotype markers of bNPCs and showed highly positive signals in native NP tissue (
[0150] RT-qPCR
[0151] To study the phenotype maintenance of bNPCs in Co-ppts, the chondrogenic phenotypic markers Col2 and ACAN, and a series of non-chondrogenic phenotypic markers including SNAP25, KRT8, CDH2, and SOSTDC1 were investigated (
[0152] The SNAP25, KRT8, CDH2, and SOSTDC1 were specific NPCs phenotype markers. The SNAP25 expression was downregulated from day 3 to day 10 but increased from day 10 to day 14. The expression of SNAP25 in aCol(EDA)-aHA-GAG was significantly higher than in other groups. The KRT8 expression of Col-GAG and Col-aHA-GAG was 15.3 and 120-fold at day 3 and rapidly downregulated to 0.8 and 0.6 at day 7. From day 7 to day 14, KRT 8 of aCol(EDA)-aHA-GAG was significantly higher than other groups. The same trend was found in CDH2 expression, Col-GAG and Col-aHA-GAG were 2.4 and 4.7-fold at day 3 and decreased to 0.6 and 0.4 on day 7. The CDH2 expression of aCol(EDA)-GAG and aCol(TAEA)-GAG was significantly higher than Col-GAG, and aCol(EDA)-aHA-GAG was significantly higher than Col-aHA-GAG from day 7 to day 10. The SOSTDC1 expression of Col-aHA-GAG was 75.3 at day and 1.0 at day 7. The SOSTDC1 expression of aCol(EDA)-aHA-GAG was significantly higher than other groups from day 7 to day 14 (p<0.001). These results suggested that the Co-ppts with aCol and aHA can maintain the bNPCs phenotype markers (SNAP25, KRT8, CDH2, and SOSTDC1).
Example 7 Elastic Modulus Measurement of Acellular and Cell Encapsulated GAG-Rich Composition
Materials and Methods
[0153] All coprecipitates, Col-GAG, aCol(EDA)-GAG, aCol(TAEA)-GAG, Col-aHA-GAG, aCol(EDA)-aHA-GAG, aCol(TAEA)-aHA-GAG were formed with 200 Kg of Col or aCol(EDA) or aCol(TAEA), 400 Kg of aHA, and 400 Kg of chondroitin-6-sulfate GAGS with or without bNPCs encapsulation were cut into 2 mm cylinder by 2 mm punch, native AF and native NP used as control. The elastic modulus was measured by the microplate compression method (Chan, Li et al. 2008).
Results
[0154] The reduced elastic modulus of the native tissue and GAG-rich scaffold was detected as an indicator for its physicochemical structural changes. As shown in
[0155] (Col-GAG), 0.70 Kpa (aCol(EDA)-GAG), 0.81 Kpa (aCol(TAEA)-GAG), 1.47 Kpa (Col-aHA-GAG), 0.78Kpa (aCol(EDA)-aHA-GAG), 1.12 Kpa (aCol(TAEA)-aHA-GAG). After bNPCs encapsulated, the stiffness of scaffolds was increased to 26.33 Kpa(Col), 10.85 Kpa(Col-GAG), 15.65 Kpa (aCol(EDA)-GAG), 11.73 Kpa (aCol(TAEA)-GAG), 9.33 Kpa (Col-aHA-GAG), 12.38 Kpa (aCol(EDA)-aHA-GAG), 10.54 Kpa (aCol(TAEA)-aHA-GAG). The elastic modulus of bNPCs-encapsulated GAG scaffolds was lower than native AF and higher than native NP. These results indicated that the stiffness of the GAG-rich scaffolds was comparable to the native IVD, which can mechanically mimic the native tissue.
Example 8 Osteogenic Differentiation of hMSCs in Scaffolds with Different GAG Contents
Materials and Methods
[0156] Human MSCs (P2) purchased from ReachBio LLC (DBA: ReachBio Research Labs, USA) were cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco) containing low glucose and supplemented with 10% FBS (Gibco), 100 U/ml P/S (Gibco), and 2 mM 1-glutamine (Gibco) at 37 C. in a humidified incubator with 5% CO2, with regularly changed every 3-4 days. Cells at passage 5 were used for subsequent microencapsulation and investigation.
[0157] hMSCs were microencapsulated into scaffolds which were varied in GAG/HYP ratio: (I) Collagen (Col, GAG/HYP ratio 0); (II)Col-GAG (GAG/HYP ratio 1.5:1); (III) aCol(EDA)-GAG, named aCol-GAG (GAG/HYP ratio 4.9:1); (IV) aCol(EDA)-aHA-GAG, named aCol-aHA-GAG (with GAG/HYP ratio 6.8:1). Microencapsulation of hMSCs into Col microspheres was prepared as previously described(Hui, Cheung et al. 2008, Li, Choy et al. 2015). Briefly, hMSCs at a cell density of 5E5 cells/ml were mixed with NaOH neutralized type I Col solution (BD Biosciences, Bedford, MA, USA) to a final concentration of 2 mg/ml. Droplets of 4 l of the mixture were pipetted to a Petri dish (Sterilin Ltd., Newport, UK) and incubated at 37 C. For scaffold II, the GAG at a final concentration of 1 mg/ml (the initial weight ratio of Col/GAG was 1:2) was mixed with hMSCs (5E5/m1) and Col (2 mg/ml), and 4 l hMSCs-Col-GAG microspheres were formed. For scaffolds I and II, 50 microspheres were aggregated into an F-127 (SigmaAldrich) coated U-shape 96-well plate for the subsequent differentiation. Scaffold III and IV have used another microencapsulation method, called co-precipitation. To microencapsulation of hMSCs into aCol-GAG and aCol-aHA-GAG, 2.5E4 of hMSCs were mixed with 100 g of aCol, 200 g of GAGs, and 400 g of aHA (scaffold IV).
[0158] The hMSCs microencapsulated in the 4 scaffolds were induced to undergo osteogenic differentiation and cultured in an induction medium consisting of DMEM low glucose basal medium that supplemented with 10% FBS (Gibco), 100 U/ml P/S (Gibco), 100 nM dexamethasone (Sigma-Aldrich), 10 ng/ml Bone morphogenetic protein-2 (BMP2, PeproTech, Inc.), 10 mM Beta-glycerophosphate (Sigma-Aldrich Co. LLC), and 50 nM Ascorbic Acid (Fluka, St. Louis, MO, USA) (Cheng, Luk et al. 2011). On time point days 7, 14, and 21, samples were harvested for characterization.
[0159] On days 7, 14, and 21, hMSCs encapsulated in Col, Col-GAG, aCol-GAG, and aCol-aHA-GAG were fixed with 4% PFA for 30 mins and then cut into 10 m paraffin sections. The H&E staining was then used to reveal the cell morphology, and the Von Kossa staining was used to reveal the calcium-GAG region. For the Von Kossa staining, the sections were briefly incubated with 1% silver nitrate solution (Sigma) and were irradiated under ultraviolet light for 1 h. Unreacted silver was removed by incubating with 2% sodium thiosulfate for 5 mins. Nuclear fast red was used as a counterstain.
[0160] On day 21, samples were rinsed with PBS thrice and fixed with 4% PFA(Sigma-Aldrich) 4 C. for overnight. On the one hand, the fixed samples were dehydrated with gradient ethanol (10%, 30%, 50%, 70%, 90%, 95%, and 100%, 30 mins each) and thoroughly dried by critical point drying, followed by sputter-coating gold, and imaged using SEM (S-4800, Hitachi, Tokyo). On the other hand, the fixed samples were then processed to embedding into the epoxy resin and cut ultra-thin sections in 100 nm thickness. And then, the ultra-thin sections were stained with 2% aqueous uranyl acetate and Reynold's lead citrate. The ultrastructure of cells and the precellular matrix were examined with transmitting electron microscopy (TEM, Philips CM100).
[0161] The expression levels of major osteogenic markers, including ALP, BMP2, and RUNX2, were investigated to determine whether the hMSCs differentiation into the osteogenic lineage. Table 2 shows the sequence of the primers used for evaluation. On days 7, 14, and 21, hMSCs-encapsulated constructs were harvested, and the RT-qPCR was performed to measure the gene expression of the ALP, BMP2, and RUNX2.
TABLE-US-00002 TABLE2 TheprimersusedintheRT-PCR. Genename Forwardprimer Reverseprimer hGAPDH GAGTCAACGGATTTGGT TTGATTTTGGAGGGATCTCG CGT (SEQIDNO.16) (SEQIDNO.15) Osteogenicdifferentiation hRUNX2 ACAGTAGATGGACCTCG TGAGGCGGTCAGAGAACAAA GGAAC (SEQIDNO.18) (SEQIDNO.17) hALP CGCACGGAACTCCTGAC GCCACCACCACCATCTCG C (SEQIDNO.20) (SEQIDNO.19) hBMP2 GAGGTCCTGAGCGAGTT TCTCTGTTTCAGGCCGAACA CGA (SEQIDNO.22) (SEQIDNO.21)
Results
[0162] Morphologies Change hMSCs were microencapsulated into the Col, Col-GAG, aCol-GAG, and aCol-aHA-GAG, and the morphologies of these hMSCs-scaffolds were different from each other.
Histological and Histochemical Analysis
[0163]
[0164]
Ultrastructural Analysis
[0165] SEM and EDX were conducted to measure the ultrastructure of the hMSCs-encapsulated scaffolds upon osteogenic differentiation.
[0166]
Real-Time qPCR Analysis
[0167] The gene expression of the osteogenic differentiation phenotype markers including BMP2, RUNX2, and ALP was shown in
[0168] The RUNX2 expression was downregulated over time. Two-way ANOVA showed the RUNX2 expression was significantly different during culture time (p<0.001). Specifically, on day 7, the RUNX2 expression of the Col (8.1-fold) group was significantly higher than the aCol-GAG (5.3-fold) and aCol-aHA-GAG (4.3-fold) groups, suggesting the Col group higher osteogenic differentiation ability in the early stage of osteogenic differentiation.
[0169] Alkaline phosphatase (ALP) is one of the earliest markers for osteoblasts that regulate the mineralization of the matrix. In general, the ALP level was downregulated during osteogenic differentiation from day 7 to day 21. The ALP expression of Col was significantly higher than the aCol-GAG and aCol-aHA-GAG groups rather than the Col-GAG group.
Example 9 Chondrogenic Differentiation of hMSCs in Compositions with Different GAG Contents
Materials and Methods
[0170] Human MSCs at passage 4 were used for chondrogenic differentiation and subsequent microencapsulation and investigation. hMSCs were microencapsulated into scaffolds which were varied in GAG/HYP ratio: (I) Collagen (Col, GAG/HYP ratio 0); (II)Col-GAG (GAG/HYP ratio 1.5:1); (III) aCol(EDA)-GAG, named aCol-GAG (GAG/HYP ratio 4.9:1); (W) aCol(EDA)-aHA-GAG, named aCol-aHA-GAG (with GAG/HYP ratio 6.8:1). And the Col concentration used was 2 mg/ml. Hence, in the aCol-GAG and aCol-aHA-GAG groups, 1E5 of hMSCs were mixed with 100 g of aCol, 200 g of GAGs, and 400 g of aHA (scaffold W).
[0171] For chondrogenic differentiation, the induction medium consisted of DMEM high glucose basal medium that supplemented with 100 U/ml P/S (Gibco), 10 ng/ml recombinant human transforming growth factor-3 (TGF-3, Merck, Darmstadt, Germany), 1.25 mg/ml BSA (Sigma-Aldrich Co. LLC), ITS-A premix (Merck & Co), 1 mM sodium pyruvate (Gibco), and 0.35 mM L-proline (Merck & Co. Inc.). On days 7, 14, and 28, samples were harvested for histological staining and ultrastructural analysis as described in Example 7.
TABLE-US-00003 TABLE3 TheprimersusedintheRT-PCR. Genename Forwardprimer Reverseprimer hGAPDH GAGTCAACGGATTTGG TTGATTTTGGAGGGATCTCG TCGT (SEQIDNO.16) (SEQIDNO.15) Chondrogenicdifferentiation SOX9 CGCCATCTTCAAGGCG CCTGGGATTGCCCCGAGTGC CTGC (SEQIDNO.24) (SEQIDNO.23) Col2 GGCAATAGCAGGTTCA CGATAACAGTCTTGCCCCAC CGTACA TT (SEQIDNO.25) (SEQIDNO.26) ACAN ACAGCTGGGGACATTA GTGGAATGCAGAGGTAATTT GTGG (SEQIDNO.28) (SEQIDNO.27)
[0172] The expression levels of major chondrogenic markers, including COL2, ACAN, and SOX9, were investigated to determine whether the hMSCs differentiation into the chondrogenic lineage. Table 3 shows the sequence of the primers used for evaluation. On days 7, 14, and 28, hMSCs-encapsulated constructs were harvested, and the RT-qPCR was performed.
Results
Morphologies Change
[0173] As shown in
Histological and Histochemical Analysis
[0174] As shown in
[0175] The ECM of cartilage is abundant in GAGS, and the Safranin 0 staining was conducted to reveal the GAG-rich cartilage-like regions (
Ultrastructural Analysis
[0176]
[0177] Upon 28 days of chondrogenic differentiation, the morphology of cells and pericellular matrix were varied in 4 scaffolds. In the Col group, the cells were elongated, and the truncated collagen fibrils without nanobeads were found around cells, suggesting no GAGS deposition in the pericellular matrix. The cells were also elongated in the Col-GAG group, but the fibrous meshwork was much like that of the native cartilage, with numerous nanobeads attached to the collagen fibers. On the other hand, cells were more round in the aCol-GAG and aCol-aHA-GAG groups, abundant nanobeads along the Col fiber was found in the pericellular matrix of these two groups, suggesting these two scaffolds have high GAG incorporation were structurally mimicking the native cartilage, and the incorporation of GAG was a benefit for chondrogenic differentiation.
Real-Time qPCR Analysis
[0178] The phenotypic changes of hMSCs in 4 scaffolds upon chondrogenic differentiation were revealed by the expression level of the chondrogenic markers, including SOX9, ACAN, and Col2 (
[0179] The ACAN expression of hMSCs chondrogenic differentiated into 4 scaffolds were shown in
[0180] The Col2 expression of the aCol-GAG and aCol-aHA-GAG groups was significantly higher than that of the Col and Col-GAG groups. These results suggested that the incorporation of GAGS promotes chondrogenic differentiation.
Example 10 Discogenic Differentiation of hMSCs in Compositions with Different GAG Contents
Materials and Methods
[0181] Human MSCs at passage 4 were used for discogenic differentiation and subsequent microencapsulation and investigation. hMSCs were microencapsulated into scaffolds which were varied in GAG/HYP ratio: (I) Collagen (Col, GAG/HYP ratio 0); (II)Col-GAG (GAG/HYP ratio 1.5:1); (III) aCol(EDA)-GAG, named aCol-GAG (GAG/HYP ratio 4.9:1); (W) aCol(EDA)-aHA-GAG, named aCol-aHA-GAG (with GAG/HYP ratio 19.8:1).
[0182] For discogenic differentiation, the induction medium consisted of DMEM high glucose basal medium that supplemented with 100 U/ml P/S (Gibco), 10 ng/ml recombinant Growth Differentiation Factor 5 (GDFS, PeproTech, Inc.), 1.25 mg/ml BSA (Sigma-Aldrich Co. LLC), ITS-A premix (Merck & Co), 1 mM sodium pyruvate (Gibco), and 0.35 mM L-proline (Merck & Co. Inc.). On days 7, 14, and 28, samples were harvested for histological staining and ultrastructural analysis as described in Example 7.
[0183] The expression levels of major chondrogenic markers, including COL2, ACAN, PAX1, and FOXF1 were investigated to determine whether the hMSCs differentiation into the NP-like lineage. Table 4 shows the sequence of the primers used for evaluation. On days 7, 14, and 28, hMSCs-encapsulated constructs were harvested, and the RT-qPCR was performed.
TABLE-US-00004 TABLE4 TheprimersusedintheRT-PCR. Genename Forwardprimer Reverseprimer hGAPDH GAGTCAACGGATTTGG TTGATTTTGGAGGGATCTCG TCGT (SEQIDNO.16) (SEQIDNO.15) Discogenicdifferentiation Col2 GGCAATAGCAGGTTCA CGATAACAGTCTTGCCCCAC CGTACA TT (SEQIDNO.25) (SEQIDNO.26) ACAN ACAGCTGGGGACATTA GTGGAATGCAGAGGTAATTT GTGG (SEQIDNO.28) (SEQIDNO.27) hPAX1 AAGCCGCCCTATTCCT GCGCTTGGTGGGTGAACT ACATC (SEQIDNO.30) (SEQIDNO.29) hFOXF1 AAGCCGCCCTATTCCT GCGCTTGGTGGGTGAACT ACATC (SEQIDNO.32) (SEQIDNO.31)
Results
Morphologies Change
[0184]
Histological and Histochemical Analysis
[0185] The H&E staining (
[0186] The abundance of GAG of hMSCs encapsulated scaffolds was investigated by Safranin 0 staining (
Ultrastructural Analysis
[0187]
Real-Time qPCR Analysis
[0188]
[0189] Paired box 1 (PAX1) is a transcription factor that regulates pattern formation during embryogenesis invertebrates, whereas the Forkhead box F1 (FOXF1) plays an essential role in cell growth, proliferation, and differentiation.
Example 11 In Vivo Biocompatibility of the GAG-Rich Composition
Materials and Methods
[0190] All procedures of the animal study were conducted in the animal unit and approved by the Animal Research Ethics Committee of the University of Hong Kong. Female nude mouse (6-weeks old) with bodyweight of 18-25 g was used. After shaving, an incision was made at the back, and a subcutaneous pocket was created. Acellular samples: (I) Col; (II) Col-GAG; (III) aCol-GAG; (IV) Col-aHA-GAG; and (V) aCol-aHA-GAG, and hMSCs-encapsulated and discogenic differentiation for 28 days samples: (I) Col; (II) Col-GAG; (III) aCol-GAG; and (W) aCol-aHA-GAG was implanted separately. The wound was then closed immediately with an absorbable suture. The scaffolds were retrieved at 1-month post-implantation, fixed in 4% PFA, and sectioned for subsequent H&E and Safranin 0 staining.
Results
Acellular Scaffolds
[0191] The GAG-rich scaffolds showed good biocompatibility up to 1 month after subcutaneous implantation in nude mice (
[0192] Histologically, the GAG contained scaffolds were all showed good biocompatibility that elongated fibroblastic cells were found that integrated with the scaffolds (
hMSCs-Scaffolds
[0193] The hMSCs-encapsulated scaffolds also showed good biocompatibility (
REFERENCES
[0194] Barbosa, I., S. Garcia, V. Barbier-Chassefiere, J. P. Caruelle, I. Martelly and D. Papy-Garcia (2003). Improved and simple micro assay for sulfated glycosaminoglycans quantification in biological extracts and its use in skin and muscle tissue studies. Glycobiology 13(9): 647-653. [0195] Brougham, C. M., T. J. Levingstone, S. Jockenhoevel, T. C. Flanagan and F. J. O'Brien (2015). Incorporation of fibrin into a collagen-glycosaminoglycan matrix results in a scaffold with improved mechanical properties and enhanced capacity to resist cell-mediated contraction. Acta Biomater 26: 205-214. [0196] Caliari, S. R. and B. A. Harley (2014). Collagen-GAG scaffold biophysical properties bias MSC lineage choice in the presence of mixed soluble signals. Tissue Eng Part A 20(17-18): 2463-2472. [0197] Chan, B. P., T. Y. Hui, C. W. Yeung, J. Li, I. Mo and G. C. Chan (2007). Self-assembled collagen-human mesenchymal stem cell microspheres for regenerative medicine. Biomaterials 28(31): 4652-4666. [0198] Chan, W. C., K. L. Sze, D. Samartzis, V. Y. Leung and D. Chan (2011). Structure and biology of the intervertebral disk in health and disease. Orthop Clin North Am 42(4): 447-464, vii. [0199] Cheng, H. W., K. D. K. Luk, K. M. C. Cheung and B. P. Chan (2011). In vitro generation of an osteochondral interface from mesenchymal stem cell-collagen microspheres. Biomaterials 32(6): 1526-1535. [0200] Choy, A. T., K. W. Leong and B. P. Chan (2013). Chemical modification of collagen improves glycosaminoglycan retention of their co-precipitates. Acta Biomater 9(1): 4661-4672. [0201] Grier, W. K., E. M. Iyoha and B. A. C. Harley (2017). The influence of pore size and stiffness on tenocyte bioactivity and transcriptomic stability in collagen-GAG scaffolds. J Mech Behav Biomed Mater 65: 295-305. [0202] Hing, K. (2004). Bone repair in the twenty-first century: Biology, chemistry or engineering?
[0203] Philosophical transactions. Series A, Mathematical, physical, and engineering sciences 362: 2821-2850. [0204] Homicz, M. R., K. B. McGowan, L. M. Lottman, G. Beh, R. L. Sah and D. Watson (2003). A compositional analysis of human nasal septal cartilage. Arch Facial Plast Surg 5(1): 53-58. [0205] Hui, T. Y., K. M. Cheung, W. L. Cheung, D. Chan and B. P. Chan (2008). In vitro chondrogenic differentiation of human mesenchymal stem cells in collagen microspheres: influence of cell seeding density and collagen concentration. Biomaterials 29(22): 3201-3212. [0206] Jana, P., T. Mitra, T. K. R. Selvaraj, A. Gnanamani and P. P. Kundu (2016). Preparation of guar gum scaffold film grafted with ethylenediamine and fish scale collagen, cross-linked with ceftazidime for wound healing application. Carbohydr Polym 153: 573-581. [0207] Kirk, J. F., G. Ritter, I. Finger, D. Sankar, J. D. Reddy, J. D. Talton, C. Nataraj, S. Narisawa, J. L. Millan and R. R. Cobb (2013). Mechanical and biocompatible characterization of a cross-linked collagen-hyaluronic acid wound dressing. Biomatter 3(4). [0208] Li, Y. Y., T. H. Choy, F. C. Ho and P. B. Chan (2015). Scaffold composition affects cytoskeleton organization, cell-matrix interaction and the cellular fate of human mesenchymal stem cells upon chondrogenic differentiation. Biomaterials 52: 208-220. [0209] Liu, M., Y. Xu, C. Huang, T. Jia, X. Zhang, D. P. Yang and N. Jia (2018). Hyaluronic acid-grafted three-dimensional MVVCNT array as biosensing interface for chronocoulometric detection and fluorometric imaging of CD44-overexpressing cancer cells. Mikrochim Acta 185(7): 338. [0210] Mullen, L. M., S. M. Best, S. Ghose, J. Wardale, N. Rushton and R. E. Cameron (2015). Bioactive IGF-1 release from collagen-GAG scaffold to enhance cartilage repair in vitro. J Mater Sci Mater Med 26(1): 5325. [0211] Mwale, F., P. Roughley and J. Antoniou (2004). Distinction between the extracellular matrix of the nucleus pulposus and hyaline cartilage: a requisite for tissue engineering of intervertebral disc. Eur Cell Mater 8: 58-63; discussion 63-54. [0212] Pellegrino, E. D. and R. M. Biltz (1968). Bone carbonate and the Ca to P molar ratio. Nature 219(5160): 1261-1262. [0213] Silagi, E. S., I. M. Shapiro and M. V. Risbud (2018). Glycosaminoglycan synthesis in the nucleus pulposus: Dysregulation and the pathogenesis of disc degeneration. Matrix Biol 71-72: 368-379. [0214] Tian, Y., W. Yuan, J. Li, H. Wang, M. G. Hunt, C. Liu, I. M. Shapiro and M. V. Risbud (2016). TGFbeta regulates Galectin-3 expression through canonical Smad3 signaling pathway in nucleus pulposus cells: implications in intervertebral disc degeneration. Matrix Biol 50: 39-52. [0215] Treppo, S., H. Koepp, E. C. Quan, A. A. Cole, K. E. Kuettner and A. J. Grodzinsky (2000). Comparison of biomechanical and biochemical properties of cartilage from human knee and ankle pairs. J Orthop Res 18(5): 739-748. [0216] van Weeren, P. R. and E. C. Firth (2008). Future tools for early diagnosis and monitoring of musculoskeletal injury: biomarkers and CT. Vet Clin North Am Equine Pract 24(1): 153-175. [0217] Woessner, J. F., Jr. (1961). The determination of hydroxyproline in tissue and protein samples containing small proportions of this imino acid. Arch Biochem Biophys 93: 440-447. [0218] Zhong, S., W. E. Teo, X. Zhu, R. Beuerman, S. Ramakrishna and L. Y. Yung (2005). Formation of collagen-glycosaminoglycan blended nanofibrous scaffolds and their biological properties. Biomacromolecules 6(6): 2998-3004. [0219] Zhou, Y., B. Yang, X. Ren, Z. Liu, Z. Deng, L. Chen, Y. Deng, L. M. Zhang and L. Yang (2012). Hyperbranched cationic amylopectin derivatives for gene delivery. Biomaterials 33(18): 4731-4740.
Patents
[0220] Dan Simionescu, Jeremy J. Mercuri(inventor). Clemson University(assignee). Shape-memory sponge hydrogel biomaterial. U.S. Pat NO. U.S. Pat. No. 9,283,301B1. Mar. 15, 2016. [0221] Ioannis V. Yannas, Philip L. Gordon Chor Huang, Frederick H. Silver, John F. Burke(inventor). Massachusetts Institute of Technology(assignee). Crosslinked collagen-mucopolysaccharide composite materials. U.S. Pat NO. U.S. Pat. No. 4,280,954A. Jul. 28, 1981.
[0222] The foregoing description of the specific embodiments will so fully reveal the general nature of the disclosure that others can, by applying knowledge within the skill of the relevant art(s) (including the contents of the documents cited and incorporated by reference herein), readily modify and/or adapt for various applications such specific embodiments, without undue experimentation, without departing from the general concept of the present disclosure. Such adaptations and modifications are therefore intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance presented herein, in combination with the knowledge of one skilled in the relevant art(s).
[0223] While various embodiments of the present disclosure have been described above, it should be understood that they have been presented by way of examples, and not limitation. It would be apparent to one skilled in the relevant art(s) that various changes in form and detail could be made therein without departing from the spirit and scope of the disclosure. Thus, the present disclosure should not be limited by any of the above-described exemplary embodiments but should be defined only in accordance with the following claims and their equivalents.
[0224] All references cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.