MICROORGANISM WITH INCREASED CARBON MONOXIDE AVAILABILITY AND 2,3-BDO PRODUCTION USING THE SAME

20240060065 ยท 2024-02-22

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a microorganism with increased carbon monoxide availability and use thereof.

Claims

1. An acetyl-CoA synthase variant, in which histidine at position 636 from the N-terminus of acetyl-CoA synthase derived from a microorganism of the genus Eubacterium is substituted with another amino acid.

2. The acetyl-CoA synthase of claim 1, wherein another amino acid is selected from lysine or arginine.

3. The acetyl-CoA synthase of claim 1, wherein the variant comprises SEQ ID NO: 3.

4. The acetyl-CoA synthase of claim 1, wherein the variant is encoded by a polynucleotide in which adenine (A) at position 1907 of the acsB gene is substituted with guanine (G).

5. The acetyl-CoA synthase of claim 1, wherein the amino acids at positions 475 and 476 from the N-terminus of the variant are aspartic acid (D).

6. A microorganism comprising the protein variant of claim 1.

7. The microorganism of claim 6, wherein the microorganism is Eubacterium limosum.

8. The microorganism of claim 6, wherein the microorganism comprises alsS and alsD genes.

9. The microorganism of claim 6, wherein the microorganism comprises alsS; alsD; and bdh or budC genes.

10. A method for preparing a compound, comprising: culturing the microorganism of claim 6.

11. The method of claim 10, wherein the compound is selected from acetoin and 2,3-butanediol.

12. A method for removing carbon monoxide gas, comprising: culturing a microorganism comprising the protein variant of claim 1 under gas conditions containing carbon monoxide (CO).

Description

BRIEF DESCRIPTION OF DRAWINGS

[0069] FIGS. 1A-1E show the growth of E. limosum wild type (WT), ECO1, or ECO2 strains under various CO syngas conditions. FIG. 1A is the growth profiling of E. limosum WT or ECO1 strain under the CO 60% syngas condition, FIG. 1B is a comparison of the growth rate according to the CO concentrations, FIG. 1C is the adaptive laboratory evolution of E. limosum ECO1 strain under the CO 66% syngas condition, FIG. 1D is the growth profiling of E. limosum WT, ECO, and ECO2-P strains under CO 66% syngas conditions, and FIG. 1E is the relative growth rate of E. limosum WT, ECO1, and ECO2-P according to the CO concentrations. Error bars represent standard deviations (P; population).

[0070] FIGS. 2A-2B are a comparison of the isolation and CO gas consumption rates of ECO2 single strains. FIG. 2A is the growth rate of ECO2 single colony under the CO 66% syngas condition, and FIG. 2B is the result of confirming the optical density or CO gas consumption of E. limosum ECO1 and ECO2-S6. Error bars represent standard deviations.

[0071] FIGS. 3A-3D are a hypothesis for the H636R mutation in the ECO2 CODH/ACS complex. FIG. 3A is a structural change of the CODH/ACS complex, FIG. 3B is a hypothesis for the conformational change of the ECO2 CODH/ACS complex, FIG. 3C is a vector construct for expressing CODH/ACS complex in E. limosum WT, and FIG. 3D is the growth profiling of several CODH/ACS-expressing E. limosum in mixed nutrient culture (66% CO+5 g/L glucose). Error bars represent standard deviations.

[0072] FIGS. 4A-4B are a comparison of the biomass increase rate and the CO gas absorption rate of the ECO1 strain and the ECO2-S6 strain. FIG. 4A is a comparison of microbial biomass increase rate, and FIG. 4B is a comparison of CO gas absorption rate. Error bars represent standard deviations.

[0073] FIGS. 5A-5C predict the structure of the ACS protein of E. limosum microorganisms using the AlphaFold2 structure prediction program. FIG. 5A is a comparison of the structure of the ACS protein of M. thermoacetica microorganism and the ACS protein of E. limosum, FIG. 5B is a comparison of the E. limosum WT and ECO2 strains for the amino acid residue at position 636 in which the mutation occurred, and FIG. 5C is a comparison of the structure of the ACS protein having H636R mutation with the wild type and variant.

[0074] FIGS. 6A-6B are a comparison of Hierarchical clustering (H-clustering) distance analysis and Principal component analysis (PCA) between transcript data under a CO 44% condition and a CO 66% syngas condition of E. limosum ECO1 strain and ECO2 strain, thereby showing similarity and reproducibility between biological replicates. FIG. 6A shows the H-clustering result, and FIG. 6B shows the PCA analysis result.

[0075] FIGS. 7A-7B are a comparison of the transcript expression levels of E. limosum ECO1 strain and ECO2 strain under CO 44% and CO 66% syngas conditions through differentially expressed genes (DEGs) analysis. FIG. 7A shows the number of genes whose transcriptional expression level was increased or decreased significantly (p-value 0.01 or less, log.sub.2 Foldchange of 1 or more 1 or less) in the ECO2 strain compared to the ECO1 strain under the CO 44% syngas condition, and FIG. 7B shows the number of genes whose transcriptional expression level was increased or decreased significantly (p-value 0.01 or less, log.sub.2 Foldchange of 1 or more and 1 or less) in the ECO2 strain compared to the ECO1 strain under the CO 66% syngas condition.

[0076] FIGS. 8A-8B show the characteristics of the proteins encoded by genes with significantly increased or decreased transcriptional expression levels (p-value 0.01 or less, log.sub.2 Foldchange of 1 or more 1 or less) in E. limosum ECO1 strain and ECO2 strain under the CO 44% condition and CO 66% syngas condition through Cluster of Orthologous Groups of proteins (COGs) analysis. FIG. 8A shows the categories of characteristics of the proteins with increased or decreased transcriptional expression levels in the ECO2 strain compared to the ECO1 strain under the CO 44% syngas condition, and FIG. 8B shows the categories of characteristics of the proteins with increased or decreased transcriptional expression levels in the ECO2 strain compared to the ECO1 strain under the CO 66% syngas condition.

[0077] FIGS. 9A-9B are the transcriptome profiling involved in pyruvate metabolism of ECO1 or ECO2-S6 strains. FIG. 9A is the transcriptome profiling involved in glycolysis/glycogenolysis, TCA and pentose phosphate (PP) pathways, and FIG. 9B is the transcriptome profiling of genes involved in pyruvate oxidation and various amino acid metabolisms.

[0078] FIG. 10 is a comparison of the transcriptional expression levels of major metabolic circuits related to the growth of acetogen microorganisms based on transcript data of ECO1 and ECO2 strains under the CO 44% and CO 66% syngas conditions.

[0079] FIG. 11 is the energy conservation system of ECO1 or ECO2-S6 and transcriptome profiling of the Wood-Ljungdahl pathway.

[0080] FIGS. 12A-12D relate to the development of E. limosum producing 2,3-BDO. FIG. 12A shows the design of 2,3-BDO production pathway of E. limosum using an inducible promoter, FIG. 12B is a phylogenetic tree of 10 BDH enzymes, FIG. 12C is a measurement result of acetoin or 2,3-BDO production in 9 BDH-expressing E. limosum strains, and FIG. 12D is a vector construct for constitutive expression of genes related to the 2,3-BDO metabolic pathway. Error bars represent standard deviations.

[0081] FIGS. 13A-13D relate to the production of 2,3-BDO using CO in a recombinant strain. FIG. 13A is the growth profiling and acetate production of WT expressing the 2,3-BDO metabolic pathway under the CO 44% syngas condition, FIG. 13B is growth profiling and acetate production of ECO2-S6 expressing the 2,3-BDO metabolic pathway under the CO 66% syngas condition, FIG. 13C is the production of acetoin and 2,3-BDO from WT expressing the 2,3-BDO metabolic pathway under the CO 44% syngas condition, and FIG. 13D is a result of confirming the production of acetoin and 2,3-BDO from ECO2-S6 expressing the 2,3-BDO metabolic pathway under the CO 66% syngas condition.

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

[0082] Hereinafter, the present invention will be described in detail by way of Examples and Experimental Examples. However, these Examples and Experimental Examples are given for illustrative purposes only, and the scope of the present invention is not intended to be limited to or by these Examples and Experimental Examples.

Example 1. Materials and Methods

Example 1-1. Media Preparation and Bacterial Cultivation

[0083] Wild-type Eubacterium limosum ATCC 8486 was obtained from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany).

[0084] The E. limosum ECO1 strain was obtained from a previous adaptive laboratory evolution (ALE) study based on wild-type E. limosum (Kang S, Song Y, Jin S, Shin J, Bae J, Kim D R, Lee J-K, Kim S C, Cho S and Cho B-K (2020) Adaptive Laboratory Evolution of Eubacterium limosum ATCC 8486 on Carbon Monoxide. Front. Microbiol. 11:402. doi: 10.3389/fmicb.2020.00402), and the strain was deposited at the Korean Collection of Type Cultures of Korea Research Institute of Bioscience and Biotechnology with Accession No. KCTC 14201 BP on Jun. 4, 2020.

[0085] All strains were cultivated under strictly anaerobic conditions at 37 C. in a 100 mL modified DSMZ 135 medium. For autotrophic cultivation, a 50 mL headspace was filled with CO 44% syngas (CO 44%, CO.sub.2 22%, H.sub.2 2%, and N.sub.2 balance), CO 66% syngas (CO 66%, CO.sub.2 22%, H.sub.2 2%, and N.sub.2 balance), CO 60% (CO 60%, and N.sub.2 balance), CO 80% (CO 80%, and N.sub.2 balance), or CO 100% at a pressure of 200 kPa. For heterotrophic cultivation, 5 g.Math.L.sup.1 glucose was added to the modified DSMZ 135 medium.

[0086] The wild-type or ECO2 strains were cultivated in 100 mL of DSMZ 135 medium without sodium bicarbonate under CO syngas conditions for CO fermentation. The pre-cultivated microbes were inoculated into a gas-lift fermenter with a 700 mL working volume with the continuous addition of CO syngas. The pH of 6.5 was maintained using 5 N KOH and 1 N HCl during fermentation.

Example 1-2. Adaptive Laboratory Evolution (ALE)

[0087] ALE was performed under 66% CO syngas conditions using the ECO1 strain disclosed in Kang S, Song Y, Jin S, Shin J, Bae J, Kim D R, Lee J-K, Kim S C, Cho S and Cho B-K (2020) Adaptive Laboratory Evolution of Eubacterium limosum ATCC 8486 on Carbon Monoxide. Front. Microbiol. 11:402. doi: 10.3389/fmicb.2020.00402

[0088] After inoculating the ECO1 strain, passage transfer was conducted by adjusting the initial inoculation to an optical density (OD) of 0.01. The growth rate was calculated based on the OD value between the inoculation and passage transfer points.

Example 1-3. Metabolite Analysis by High-Performance Liquid Chromatography (HPLC)

[0089] Analysis samples were prepared by filtering the cultures with 0.2 m Minisart RC15 syringe filters (Sartorius, Gttingen, Germany). All metabolites were detected by an index detector (Waters, Milford, MA, USA) using 0.6 mL.Math.min.sup.1 solvent (0.007 N H.sub.2SO.sub.4) flow rate.

Example 1-4. Measurement of CO Consumption Rate by Gas Chromatography

[0090] CO and CO.sub.2 were quantified using a gas chromatography (Shimadzu, Japan) equipped with a ShinCarbon ST Micropaked column (1 mm2 m, 1/16, 100/120 mesh) (Restek, Bellefonte, PA, USA) and a thermal conductivity detector. Detection was based on a carrier gas (helium or nitrogen gas) at a flow rate of 30 mL.Math.min.sup.1. The initial oven temperature was 30 C. for 1 min, and the temperature was increased at a rate of 5 C..Math.min.sup.1 until 100 C. The temperature of the injector and detector was set to 100 C.

Example 1-5. Whole-Genome Re-Sequencing (WGS)

[0091] To extract genomic DNA, all strains were prepared under heterotrophic conditions. The cells were then frozen in liquid nitrogen and ground using a mortar and pestle. After treating 600 L of nuclei lysis solution (Promega, Madison, WI, USA), the samples were incubated at 80 C. for 5 min.

[0092] The samples were transferred to ice, and 100 g.Math.L.sup.1 of RNase A solution (Qiagen, Hilden, Germany) was added. Protein precipitation buffer (Promega, Madison, WI, USA) was used to precipitate proteins in the samples. After incubating for 10 min on ice, the samples were centrifuged at 16,000g at 4 C. for 10 min. The supernatant was transferred, and ethanol precipitation was performed. Finally, elution buffer was used to dry the pellet, and the genomic DNA concentration was determined using a Qubit dsDNA HS Assay kit (Invitrogen, Waltham, MA, USA). A whole-genome re-sequencing (WGS) library was constructed using a TruSeq Nano DNA library prep kit (Illumina, La Jolla, CA, USA), and library concentration was quantified using a Qubit dsDNA HS Assay kit. Sequencing was performed using the Hiseq2500 rapid-run mode in a 50-cycle single-ended reaction (Illumina, La Jolla, CA, USA).

[0093] All WGS data were analyzed using the CLC Genomics Workbench 6.5.1 (CLC bio, Aarhus, Denmark). Sequencing reads were mapped to the reference genome of E. limosum ATCC 8486 (NZ_CP CP019962.1) using mapping parameters (mismatch cost=2, insertion cost=3, deletion cost=3, length fraction=0.9, and similarity fraction,=0.9). Variants were analyzed using a quality-based variant detection tool in the CLC workbench with the following parameters: neighborhood radius, 5; maximum gap and mismatch count, 5; minimum 157 neighborhood quality, 30; minimum central quality, 30; minimum coverage, 10; minimum 158 variant frequency, 10%; maximum expected alleles, 4; nonspecific matches, ignore; and genetic 159 code, bacterial and plant plastid. The WGS data generated in this study are available in the EMBL European Nucleotide Archive (ENA) under accession number PRJEB51838.

Example 1-6. Transcriptome Analysis

[0094] E. limosum strains were injected with CO syngas and sampled at the mid-exponential stage (0D.sub.600 nm1.0) by centrifugation at 10,000g at 4 C. for 10 min. The pellets were resuspended by 500 L of lysis buffer (20 mM Tris-HCl pH 7.4, 140 mM NaCl, 5 mM MgCl.sub.2, and 20% of Triton X-100), immediately frozen using liquid nitrogen, followed by grinding using a mortar and pestle. Total RNA was isolated using 600 L of TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). To eliminate genomic DNA, DNase I (NEB, Ipswich, MA, USA) was added to 1 g of total RNA and incubated at 37 C. for 10 min. To deplete ribosomal RNA (rRNA) based on the RiboRid method disclosed in Choe D, Szubin R, Poudel S, Sastry A, Song Y, Lee Y, et al. (2021) RiboRid: A low cost, advanced, and ultra-efficient method to remove ribosomal RNA for bacterial transcriptomics. PLoS Genet 17 (9): e1009821, 15 L hybridase complement buffer (90 mM Tris-HCl (pH 7.5) and 200 mM KCl) was added to DNase-treated RNA samples and incubated at 75 C. for 10 min to inactivate DNase I. Anti-rRNA oligo DNA mix (5 pmol.Math.L.sup.1) and 2 L of 50 mM MgCl.sub.2 were added to the samples, heated to 90 C. for 1 s, and cooled to 65 C. using a thermocycler. When the temperature of the samples in the thermocycler reached 65 C., 2 L of Hybridase Thermostable RNase H (Lucigen, Middleton, WI, USA) pre-warmed at room temperature (about 25 C.) was added to the samples and incubated at 65 C. for 20 min, 90 C. for 1 s, and 65 C. for 10 min. Then, long RNA (>200 nt) in samples was isolated using the RNA Clean and Concentrator Kit (Zymo Research, Orange, CA, USA). Finally, DNase I reaction was performed by incubating the eluted samples at 25 C., 30 C., 35 C., 40 C., and 45 C. using a thermocycler. Then, the rRNA-depleted samples were purified using the RNA Clean and Concentrator Kit.

[0095] RNA-seq libraries were constructed using the TruSeq Stranded mRNA Library Prep Kit (Illumina) according to the manufacturer's instructions. RNA-seq was performed in the Hiseq2500 rapid-run mode as a 50-cycle single-ended reaction. All RNA-seq data were analyzed using CLC Genomics Workbench 6.5.1. Sequencing reads were mapped to the reference genome of E. limosum ATCC 8486 (NZ_CP CP019962.1) using mapping parameters (mismatch cost=2, insertion cost=3, deletion cost=3, length fraction=0.9, and similarity fraction=0.9). Raw read counts per gene were calculated using the CLC program to obtain uniquely mapped reads from the sequencing results. Finally, DEseq2 normalization was conducted using read counts per gene (M. I. Love, W. Huber, S. Anders, Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2, Genome Biol 15 (12) (2014) 550). The RNA-seq data generated in this study are available in the EMBL European Nucleotide Archive (ENA) under accession number PRJEB51838.

Example 1-7. Vector Construction

[0096] A modified pJIR750 vector was prepared as disclosed in J. Shin, S. Kang, Y. Song, S. Jin, J. S. Lee, J. K. Lee, D. R. Kim, S. C. Kim, S. Cho, B. K. Cho, Genome Engineering of Eubacterium limosum Using Expanded Genetic Tools and the CRISPR-Cas9 System, ACS Synth Biol 8 (9) (2019) 2059-2068 and S. Kang, Y. Song, S. Jin, J. Shin, J. Bae, D. R. Kim, J. K. Lee, S. C. Kim, S. Cho, B. K. Cho, Adaptive Laboratory Evolution of Eubacterium limosum ATCC 8486 on Carbon Monoxide, Front Microbiol 11 (2020) 402, and digested with Xhol and Xbal for linearization. To construct the CODH/ACS overexpression vector, DNA fragments encoding CODH/ACS clusters from E. limosum wild-type or ECO2 strain were amplified using the primers Inf_CODH_1653_F with the Inf_CODH_1655_R pair.

[0097] For site-directed mutagenesis, DNA fragments were amplified using the primers Inf_CODH_1653_F with Inf_SDM_475_R pairs, or Inf_SDM_475_F with Inf_CODH_1655_R pairs. The PCR templates with the linearized pJIR750 vector were assembled using the In-Fusion HD cloning kit (TaKaRa, Japan). Finally, all plasmids were transformed into Escherichia coli DH5 competent cells (Enzynomics, Daejeon, South Korea) and colonies were selected on LB agar plates containing 30 g.Math.mL.sup.1 of chloramphenicol.

[0098] To construct the 2,3-butanediol dehydrogenase (BDH) enzyme screening vector, each DNA fragment of the pTet, alsS, and alsD genes from previously constructed plasmids was amplified using PCR with the primer pairs listed in Table 3. Nine BDH enzymes were synthesized using E. limosum ATCC 8486 codon optimization (IDT, Coralville, IA, USA). To regulate the expression of BDHs, the promoter/UTR region in ELIM_c1476 was amplified using the primer pEL1476_1st_F and pEL1476_1st_R pairs. To construct the BDH screening vector, all PCR templates with the linearized pJIR750 vector were assembled using the In-Fusion HD cloning kit.

[0099] To construct the pJIR750::alsSD::Cbbdh vector, each promoter/UTR in E. limosum was amplified using the PCR primers Inf_p0077_u1121_F with Inf_p0077_u1121_R pair or Inf_p1121_u1121_F with Inf_p1121_u1121_R pair. To construct the pJIR750::alsSD vector, the alsS and alsD were amplified using the PCR primers Inf_alsS_p0077_F with Inf_alsS_R or Inf_alsD_p1121_F with Inf_alsD_R pairs. These DNA fragments, including alsS, p0077 parts, p1121 parts, and alsD, with linearized pJIR750 vector (digested by Sacl and Sall), were assembled using the In-Fusion HD cloning kit. To insert the BDH template into the pJIR750::alsSD vector, the vector was digested with the Sall enzyme. The p1476::Cbbdh template and CD0164 terminator in the pMTL82254 vector were prepared using pEL1476_EcoRI_Xhol_F with Sall_term_p1476BDHs_R primer pairs or Sall_term_p1476 BDHs_F with Xhol term primer pairs, respectively. Both BDH and terminator templates with linearized pJIR750::alsSD (digested by Sall) vectors were assembled using the In-Fusion HD cloning kit. All plasmids were transformed into E. coli DH5 competent cells, and colonies were selected on LB agar plates containing 30 g.Math.mL.sup.1 of chloramphenicol.

[0100] The information of the plasmids and primers used is shown in Table 3 below.

TABLE-US-00003 TABLE3 Previousworks Vectornames Note Shinet pJIR750ai ThisplasmidwerepurchasedfromSigma-Aldrich al.,2020, pJIR750modified pJIR750aidigestedbyPvulandselfligationusing ACS T4DNAligase Synthetic pMTL82254 WeamplificationofCD0164,Cpafdxterminator Biology regiontousingtermination Kanget al.,2020, Frontiers in Microbiology Experiments PrimerNames Sequence(5'to3') CODH/ Inf_CODH_1653_F ccATGATACGAATTCCTCGAGAAGAAGTTAATA ACS AAAAAATAAGCCCCTA Over- Inf_CODH_1655_R ttttatTAATCTAGAAAGCTTAATAATTCCTCCAAA expression CTTTTATAATTTA Inf_SDM_475_F ACGTACGTGTAGCAAGACTGAACTCACTGACA GA Inf_SDM_475_R CAGTCTTGCTACACGTACGTTGTAGAT TGGTC BDH pEL1476_EcoRI_XhoI_F tacGAATTCCTCGAGAAAGAAGATTTGCTAAAG screening AAAGAG pEL1476_1st_R GAAAACCTCTTTCAACGAAATAAG bdhA_C.beijerinckii_F TTATTTCGTTGAAAGAGGTTTTCAACCATGGTG AAGGCTGCTCTTTG bdhA_C.beijerinckii_R AACTCGTCTCAAAGTCTTAGGCGGCCGCTCTA GATTAata bdhA_B.sutilis_F TTATTTCGTTGAAAGAGGTTTTCAACCATGGTG AAGGCCGCACGGTG bdhA_B.sutilis_R TCCTGGTCCGGCCCAATTAGGCGGCCGCTCT AGATTAata bdh_L.lactics_F TTATTTCGTTGAAAGAGGTTTTCAACCATGGTG CGTGCGGCCCGTTT bdh_L.lactics_R CGACCGGCAAGGGCCTGTAAGGCGGCCGCT CTAGATTAat adh_T.brockii_F TTATTTCGTTGAAAGAGGTTTTCAACCATGGTG AAAGGCTTTGCGAT adh_T.brockii_R CTGTGGTCATTCTCGCTTAAGGCGGCCGCTCT AGATTAat budC_B.licheniformis_F TTATTTCGTTGAAAGAGGTTTTCAACCATGGTG TCAAAAGTGTCAGG budC_B.licheniformis_R GGGGAATGGTGTTCAACTAAGCGGCCGCTCT AGATTAata budC_K.aerogenes_F TTATTTCGTTGAAAGAGGTTTTCAACCATGGTG AAAAAGGTGGCACT budC_K.aerogenes_R GTGGCATGGTCTTTAATTAGGGCGGCCGCTCT AGATTAat budC_K.pneumoniae_F TTATTTCGTTGAAAGAGGTTTTCAACCATGGTG AAAAAAGTAGCGCT budC_K.pneumoniae_R GGGGAATGGTGTTCAACTAAGGCGGCCGCTC TAGATTAat budC_K.oxytoca_F TTATTTCGTTGAAAGAGGTTTTCAACCATGGTG GCGATTGAGAATAA budC_K.oxytoca_R GAGGCATCGTCTATCGGTAAGGCGGCCGCTC TAGATTAat bdh_C.autoethanogenum_ TTATTTCGTTGAAAGAGGTTTTCAACCATGGTG F AAAGCTGTATTGTG bdh_C.autoethanogenum_ CTGACAAATCCTTATTGTAAGCGGCCGCTCTA R GATTAata 04_tetRO1_F CGGAGCTCGTAATTCTCTATCACTG 04_tetRO1_R CGAGATCTatgaacaaagatattatACTCTATC 01_U3471_alsS_1st_F TATGGAATAGAGGTTAAAAACCATGGTGTTGA CAAAAGCAAC 01_U3471_alsS_2nd_F CCGAGCTCGCAGATCTGATTTTATTTGATTTAT GGAATAGAGGTT 01_alsS_SalI_R CCGTCGACCTAGAGAGCTTTCGTTTTCA 02_SalI_U0077_alsD_SdaI_ CCGTCGACAACTAAACGCAGGAGGTTTACACC F ATGGAAACTAATAGC 02_alsD_R GCGGCTGAGGGTTAGCCTGCAGGTCACTTAC TAAGAATT Constitutive alsS_R ATGATTACGAATTCGAGCTCCTAGAGAGCTTT expression CGTTTTCATGAGTTCC of2,3- Inf_alsS_F TTGTTTCAAGGAGGAActcgaGATGTTGACAAAA BDO GCAACAAAAGAACAAAAATC pathway Inf_P0077_U1121_1st_F GACGTTCTGAGCTCTCTTATTATTATACCACAT TTCGGCTGAGCCTAA Inf_U1121_P0077_2nd_ cgagTTCCTCCTTGAAACAAGACGTTCTGAGCT F CTCTTATTATTA alsS_P0077_U1121_F3 CCGGTAAATGGGATCCATGAAGGAGGGCATC TTCGTG alsD_P1121_U1121_F ACATCtcgagGGATCCCATTTACCGGGCCAAGC alsS_P_U1121_univ TTGTCAACATCtcgagTTCCTCCTTGAAACAAGA CGTTCTGAG alsD_F CGGTACCCGGGGATCCAcgcgtaTGGAAACTAA TAGCTCGTGCGATTG alsD_R ATGCCTGCAGGTCGACCTAACCCTCAGCCGC ACGGATAG EcoRI_term GTCACTTACTAAGAATTCgcaagaccgatcgggccc XhoI_term TAGCAAATCTTCTTTCTCGAGggtcatagctgtttcctg at SalI_term_p1476_BDHs_ AGGTCGACGTCACTTACTAAGAATTCgcaagac F SalI_term_p1476_BDHs_ aggtcgacATGCGGATCCTAAataaaaataagaagc R NotI_XbaI_F TTAGGCGGCCGCTCTAGATTA

Example 1-8. Plasmid Transformation to E. limosum

[0101] E. limosum transformants were prepared using electro-transformation methods, using a modified protocol disclosed in J. Shin, S. Kang, Y. Song, S. Jin, J. S. Lee, J. K. Lee, D. R. Kim, S. C. Kim, S. Cho, B. K. Cho, Genome Engineering of Eubacterium limosum Using Expanded Genetic Tools and the CRISPR-Cas9 System, ACS Synth Biol 8 (9) (2019) 2059-2068 and S. Kang, Y. Song, S. Jin, J. Shin, J. Bae, D. R. Kim, J. K. Lee, S. C. Kim, S. Cho, B. K. Cho, Adaptive Laboratory Evolution of Eubacterium limosum ATCC 8486 on Carbon Monoxide, Front Microbiol 11 (2020) 402. To prepare electrocompetent cells, E. limosum WT or ECO2 strains were cultured in 100 mL of DSM 135 medium under heterotrophic conditions. The cells were harvested in the exponential phase (OD approximately 0.5) by centrifugation at 10,000g at 4 C. for 15 min. The pellets were washed with 270 mM sucrose buffer (pH 6.0), and the process was repeated. Finally, the pellets were resuspended in 500 L of sucrose buffer and mixed with 1.0 g plasmids. The mixture samples were transferred to a 0.1 cm-gap Gene Pulser cuvette (Bio-Rad, Hercules, CA, USA). Thereafter, the mixture samples were pulsed at 2.0 kV and immediately resuspended with 0.9 mL of reinforced clostridial medium. The resuspended samples were incubated at 37 C. for 16 h and spread on reinforced clostridial medium agar plates containing 15 g.Math.mL.sup.1 thiamphenicol.

Example 1-9. CO Gas Fermentation

[0102] The gas fermenter used in the present invention was a 1 L scale gas-lift tower fermentor (700 mL of working volume) consisting of a cylinder (300 mm65) and a draft tube (160 mm30) (Fermentec Co., Cheongju, Republic Korea). The medium used was a 700 mL of modified DSM135 medium with controlled composition (2 g.Math.L.sup.1 yeast extract, 2 g.Math.L.sup.1 NH.sub.4Cl, 0.1 g.Math.L.sup.1 MgSO.sub.4.Math.7H.sub.2O, 0.45 g.Math.L.sup.1 cysteine-HCl, 2.35 g.Math.L.sup.1 NaCl, 7.5 g.Math.mL.sup.1 Thiamphenicol), and 14 mL of trace element solution (1.5 g.Math.L.sup.1 nitrilotriacetic acid, 3.0 g.Math.L.sup.1 MgSO.sub.4.Math.7H.sub.2O, 0.5 g.Math.L.sup.1 MnSO.sub.4H.sub.2O, 1.0 g.Math.L.sup.1 NaCl, 0.1 g.Math.L.sup.1 FeSO.sub.4.Math.7H.sub.2O, 0.1 g.Math.L.sup.1 CaCl.sub.2, 0.1 g.Math.L.sup.1 CoCl.sub.2.Math.6H.sub.2O, 137 mg.Math.L.sup.1 ZnSO.sub.4.Math.7H.sub.2O, 10 mg.Math.L.sup.1 CuSO.sub.4.Math.5H.sub.2O, 20 mg.Math.L.sup.1 KAl(SO.sub.4).sub.2.Math.12H.sub.2O, 10 mg.Math.L.sup.1 H.sub.3BO.sub.3, 10 mg.Math.L.sup.1 Na.sub.2MO.sub.4.Math.2H.sub.2O), 7 mL of phosphate buffer (pH 7.0), and 7 mL of Wolfe's vitamin stock solution (4 mg.Math.L.sup.1 biotin, 4 mg.Math.L.sup.1 folic acid, 20 mg.Math.L.sup.1 pyridoxine-HCl, 10 mg.Math.L.sup.1 thiamine-HCl, 10 mg.Math.L.sup.1 riboflavin, 10 mg.Math.L.sup.1 nicotinic acid, 10 mg.Math.L.sup.1 pantothenate, 0.2 mg.Math.L.sup.1 vitamin B12, 10 mg.Math.L.sup.1 p-aminobenzoic acid, 10 mg.Math.L.sup.1 lipoic acid) were added thereto. The microorganisms for gas fermentations were inoculated at an O.D value of 0.1. CO 44% or CO 66% syngas was used for gas fermentation and supplied into the cylinder using a 0.2 mm gas sparger at a gas flow of 0.05 L.Math.min.sup.1. The pH during the gas fermentation was monitored using a pH probe (InPro3253i/SG/120, Mettler Toledo, Columbus, USA), and the fermentation was carried out by adjusting the pH to 6.5 using 5 N KOH and 1 N HCl. The cultivation temperature was maintained at 37 C. by connecting a water bath circulator (DAIHAN, Seoul, Republic Korea).

Example 2. Experimental Results

Example 2-1. Adaptive Laboratory Evolution (ALE) of ECO1 Strain (KCTC 14201 BP) to Improve CO Tolerance

[0103] E. limosum ECO1 strain was a strain obtained from a previous adaptive laboratory evolution (ALE) study based on wild-type E. limosum (Kang S, Song Y, Jin S, Shin J, Bae J, Kim D R, Lee J-K, Kim S C, Cho S and Cho B-K (2020) Adaptive Laboratory Evolution of Eubacterium limosum ATCC 8486 on Carbon Monoxide. Front. Microbiol. 11:402. doi: 10.3389/fmicb.2020.00402), and the strain was deposited at the Korean Collection of Type Cultures of Korea Research Institute of Bioscience and Biotechnology with Accession No. KCTC 14201 BP on June 4, 2020.

[0104] To test the capability of strains to grow under more than 60% CO syngas conditions, both the ECO1 and wild-type strains were cultured using syngas containing 66% CO.

[0105] The biomass of the ECO1 strain was 2-fold higher than that of the wild-type strain under these conditions (FIG. 1a). This result indicates that the ECO1 strain grown under 66% CO syngas conditions can only grow at 35% of the biomass under 44% CO syngas conditions. The growth rates of the ECO1 and wild-type strains dropped from 0.095 h.sup.1 and 0.07 h.sup.1 at 44% CO to 0.022 h.sup.1 and 0.014 h.sup.1 at 66% CO, respectively (FIG. 1b).

[0106] Although it was almost impossible for the wild-type strain to proliferate under 66% CO syngas conditions, the ECO1 strain grew slowly under these conditions. WGS results revealed that the A97E mutation in the acsA gene (ELIM_c1653), which causes the phenotype of the ECO1 strain, existed in approximately 30% of the total ALE population. This mutation frequency indicates that the acsA mutants in the ECO1 population rapidly oxidize CO, causing reduction of the CO concentration in the growth medium (Kang S, Song Y, Jin S, Shin J, Bae J, Kim D R, Lee J-K, Kim S C, Cho S and Cho B-K (2020) Adaptive Laboratory Evolution of Eubacterium limosum ATCC 8486 on Carbon Monoxide. Front. Microbiol. 11:402. doi: 10.3389/fmicb.2020.00402). Thus, it was assumed that this reduction of CO level in selection pressure was not sufficient to complete the ALE. To overcome this, the next round of ALE of the ECO1 population was performed under 66% CO syngas conditions. Each passage was transferred to a fresh medium by adjusting the inoculation to OD of 0.01 at 48 h intervals. Growth rate fluctuation was observed around 150th generations, after which the growth rate was maintained at a 1.5-fold increase compared to that of the first generation. However, cell growth deviated from the exponential phase after approximately 200th generations; hence, the time interval for passage transfer was reduced from 48 to 36 h after 245th generations. Subsequently, no further change in the growth rate was observed, even after passage transfer was continued, thus, the ALE was completed at approximately 390th generations (FIG. 1c). The cell population in the final generation was named as the ECO2 population.

[0107] To confirm the cell growth improvement of the ECO2 population, the growth of the wild-type, ECO1, and ECO2 populations was measured under CO 66% syngas growth conditions.

[0108] As a result, the final biomass of the ECO2 population was 7.93- and 4.38-fold higher than that of the wild-type and ECO1 strains, respectively, under the growth conditions (FIG. 1d). Furthermore, the growth rate of the ECO2 population was 0.11 h.sup.1, which was 7.86- and 5.0-fold higher compared to wild-type and ECO1 strains, respectively. Thus, the growth rate of ECO2 population was about 6.1-fold higher than WT strain under the CO 60% condition. In addition, the population exhibited a high tolerance to CO where its growth rate was approximately 2-fold or higher even at 80% and 100% CO concentrations compared to that of the wild-type strain (FIG. 1e).

Example 2-2. Determination of ALE-Driven Mutations in ECO2 Strain

[0109] Since the ECO2 population showed various genotypes (i.e., mutations), the present inventors made an attempt to determine the driver mutations for elucidating CO tolerance.

[0110] Ten single colonies (ECO2-S1-S10) were isolated from the population and their growth rates were measured. As a result, the ECO2-S6 and ECO2-S8 strains showed the most similar phenotype to the ECO2 population (FIG. 2a).

[0111] To determine the driver mutations that induced phenotypic changes in the ECO2 population under high CO syngas conditions, the genomes of the ECO2 population and ten single colonies were re-sequenced.

[0112] After extracting genomic DNA, sequencing libraries were constructed and sequenced using the Illumina sequencing platform (Experimental section), resulting in the identification of 13 mutations (Table 4).

TABLE-US-00004 TABLE 4 Muta- AA Strains Locus tag Gene tion Type change Description Popula- ELIM_c1655 acsB A1907G SNV His636Arg CODH/ACS tion complex subunit beta S3 ELIM_c1653 acsA C275T SNV Ala92Val CODH catalytic subunit S6 ELIM_c1655 acsB A1907G SNV His636Arg CODH/ACS complex subunit beta S7 ELIM_c1655 acsB A1907G SNV His636Arg CODH/ACS complex subunit beta ELIM c2589 G148A SNV Asp50Asn hypothetical protein ELIM_c2589 C195T SNV hypothetical protein S8 ELIM c1655 acsB A1907G SNV His636Arg CODH/ACS complex subunit beta

[0113] The ECO2-S6 and ECO2-S8 strains showed only the A1907G mutation in the acsB gene (ELIM_c1655), which changed the amino acid residue (H636R) of the acsB protein, encoding ACS of the CODH/ACS complex.

[0114] Because ACS plays a crucial role in synthesizing acetyl-CoA by delivering CO molecules to methyl-CoFeSP, it was hypothesized that the H636R mutation is the key driver mutation that induces phenotypic changes in the ECO2 population. In addition, if the rapid growth rate and high biomass formation of the ECO2 population under the 66% CO syngas condition were caused by a mutation in ACS, the CO gas consumption rate of the ECO2 population would also have increased under these conditions.

[0115] To prove this, the CO gas consumption of the ECO2-S6 strain, which has a genetic mutation in acsB and the most similar phenotype to the ECO2 population, was quantified by gas chromatography.

[0116] The biomass growth rate was increased about 4.0-fold higher in the ECO2-S6 strain under the CO 66% syngas condition compared to the ECO1 strain (FIG. 4a), and the ECO1 strain showed a maximum CO gas consumption rate of 0.032 mmol.Math.h.sup.1, while the ECO2-S6 strain showed a maximum of 0.081 mmol.Math.h.sup.1, and accordingly, the CO gas consumption rate was increased about 2.5-fold higher in the ECO2-S6 strain under 66% CO syngas condition compared to the ECO1 strain (FIGS. 2b and 4b).

[0117] Consequently, the ECO2-S6 strain with the mutation in the acsB gene showed a high CO gas consumption, which increased CO tolerance, thereby showing a high growth rate under the 66% CO syngas condition.

[0118] The ECO2-S6 strain was deposited at the Korean Collection for Type Cultures of Korea Research Institute of Bioscience and Biotechnology, an International Depositary Authority, under Budapest Treaty on Jul. 14, 2022 with Accession No. KCTC15034BP.

Example 2-3. Effect of H636R Mutation on ACS Function

[0119] The ACS is composed of three domains (ACS Catal. 2020, 10, 17, 9741-9746 Publication Date: Aug. 10, 2020. https://doi.org/10.1021/acscata1.0c03033). Domain 1, where the CO gas tunnel is located, is connected to the CODH. Domain 3 has an A-cluster, where acetyl-CoA is synthesized using CO produced by CODH from CO.sub.2, coenzyme A (CoA-SH), and methyl group held by cobalamin in a corrinoid/FeS protein (CoFeSP). Methyl-CoFeSP is the final product of the methyl branch of the WL pathway. Domain 2 is a bridge that connects domain 1 with domain 3. The CODH/ACS complex operates via a conformational change in the CO tunnel between its open and closed forms. The open conformation led to the opening of the CO gas tunnel from domain 1 to the A-cluster in domain 3, resulting in the transfer of CO from CODH (FIG. 3a).

[0120] To elucidate the mechanism by which the H636R mutation in ACS changed the function of the CODH/ACS complex, the structural differences between the wild-type and mutant proteins were observed.

[0121] The ACS structure was predicted using AlphaFold2. When the predicted structure with the CODH/ACS structure data (6X5K) of Morella thermoacetica were compared, the acsB WT model overlapped with the reference structure (C-RMSD 1.91 ) (FIG. 5a). The model was then used as a reference structure for comparison with the predicted structure of the ACS mutant.

[0122] As a result, in the case of the ACS mutant, it seems that hydrogen bonding was possible as H636 was changed to R636 and was located close to D475 by approximately 2.5 (FIG. 5b). Therefore, as the distance between domains 2 and 3 decreased due to the interaction between R636 and D475, the probability of conformational change of the CO tunnel to an open form increased (FIG. 3b). The structural models suggested that the position of domain 3 was biased toward domain 2 in the ACS mutant compared to that in wild-type ACS (FIG. 5c).

[0123] Based on these results, it was hypothesized that the interaction between R636 and D475 caused functional changes in ACS. To test this hypothesis, wild-type and mutated CODH/ACS were inserted into the pJIR750 vector and transformed into wild-type E. limosum. In addition, both D475 and D476 in the ACS mutant changed to D475V and D476A (FIG. 3c). To alleviate the effect of antibiotics on growth inhibition, growth profiling was performed under mixotrophic conditions by adding 5 g.Math.L.sup.1 of glucose to the media with 66% CO syngas.

[0124] For expressing mutant CODH/ACS (H636R), the maximum OD value was significantly higher than that of the wild-type CODH/ACS (FIG. 3d). Interestingly, strains expressing D475V or D476A mutants showed growth similar to that of the wild-type strain under 66% CO mixotroph conditions (FIG. 3d). These results suggest that the H636R mutation in ACS was a driver mutation for the phenotype of the ECO2-S6 and ECO2-S8 strains, in which the interaction between R636 and D475 increased their high CO tolerance.

Example 2-4. Transcriptome Analysis of ECO2-S6 Strain Under CO Syngas Conditions

[0125] To investigate the changes in the transcription levels of ECO2-S6, RNA sequencing (RNA-seq) was performed under 44% and 66% CO syngas conditions (Experimental section).

[0126] RNA-seq data were obtained using the Illumina platform, obtaining at least 1.010 7 sequencing reads with more than 150 coverage in the E. limosum reference genome. DESeq2 normalization was performed using uniquely mapped reads. RNA-seq results were grouped between biological replicates using H-clustering and PCA (FIGS. 6a and 6b). The RNA-seq results were then normalized to the ECO1 results, and the normalized results were cut-off with an adjusted p-value of 0.01 or less, log.sub.2 FoldChange1, and 1 or less.

[0127] Under 44% CO syngas conditions, the RNA-seq results of the ECO2-S6 strain showed that 335 and 413 genes were up-regulated or down-regulated, respectively (FIG. 7a). In contrast, under 66% CO syngas conditions, 500 and 536 genes in the ECO2-S6 strain were up-regulated or down-regulated, respectively, compared to the ECO1 strain (FIG. 7b).

[0128] Next, genes that changed significantly in each condition were classified according to COG (Clusters of Orthologous Groups) to determine the protein functions altered in the ECO2-S6 strain. Unlike 44% CO syngas conditions, J (translation, ribosomal structure, and biogenesis) and E (amino acid transport and metabolism) categories of the ECO2-S6 strain were up-regulated compared to those of the ECO1 strain under 66% CO syngas conditions (FIGS. 8a and 8b). The amino acid biosynthesis pathways for valine, leucine, and isoleucine were also up-regulated (FIG. 9a).

[0129] To confirm whether such transcriptional changes were caused by the difference in the growth rates of ECO1 and ECO2-S6 strains, it was confirmed that there was almost no difference in gene expression level in glycolysis and TCA related to the growth of acetogen microorganisms, whereas there was a difference in gene expression of the Wood-Ljungdahl pathway, ribosome, and fatty acid biosynthesis related genes, which are related to autotrophic growth, between the ECO2 strain and the ECO1 strain (FIG. 10).

[0130] Thus, the transcription levels of genes involved in acetogenesis were compared. The expression levels of genes encoding the methyl branch in ECO2-S6 increased by 0.75- or 1.46-fold compared to the ECO1 strain under 44% or 66% CO syngas conditions, respectively. In contrast, the transcription levels of genes encoding the carbonyl branch in ECO2-S6 were down-regulated to 0.96- or 0.91-fold under both conditions (FIG. 11). This transcriptional change suggested that the transcription levels of genes encoding the methyl branch increased to obtain methyl-CoFeSP, the substrate of the ACS protein, rapidly produced by the increased enzymatic activity of acetyl-CoA synthesis in the ECO2-S6 strain.

[0131] In addition, since CODH/ACS activity was high in the ECO2-S6 strain, the transcription levels of genes encoding the carbonyl branch were decreased, balancing the methyl and carbonyl branches. Energy conservation systems, such as the Rnf complex and ATP synthase, were up-regulated in the ECO2-S6 strain compared to those in the ECO1 strain. The transcription levels of the Rnf complex increased by 0.7- to 1.5-fold compared to the ECO1 strain under CO 66% syngas conditions. For ATP synthase, E. limosum has two gene clusters encoding V-type ATP synthase. Interestingly, under 66% CO syngas conditions, the transcription level of the second ATP synthase increased approximately 1.2- to 2.2-fold. Because the expression level of the first cluster was already high, the expression of the second cluster increased significantly in the ECO2-S6 strain under 66% CO syngas conditions.

[0132] Consequently, the transcriptome in the ECO2-S6 strain suggested that the strain regulated the transcriptional balance of the WL pathway by increasing the transcription level of the methyl branch and decreasing that of the carbonyl branch according to the CODH/ACS activity under 66% CO syngas conditions. This result indicates that the phenotype of ECO2-S6 grown under 66% CO syngas conditions was affected by the H636R mutation in ACS and was not affected by increasing transcription levels of the CODH/ACS complex. In addition, it was found that the transcription level of the energy conservation system increased following increased CO conversion.

Example 2-5. Development of 2,3-BDO-Producing Strain Under 66% CO Syngas Conditions

[0133] The ECO2-56 strain showed high biomass formation under 66% CO syngas conditions. The transcription levels of the genes encoding pyruvate metabolism were also increased. Therefore, it was assumed that converting pyruvate to other value-added chemicals would be advantageous in the ECO2-56 strain. Acetoin was previously produced from E. limosum using a vector encoding the acetoin biosynthesis pathway in the previous study. Accordingly, in this Example, it was attempted to express 2,3-butanediol dehydrogenase (BDH) using a Tet-inducible promoter to produce 2,3-BDO using CO as a carbon source (FIG. 12a).

[0134] Unlike acetoin, because one molecule of NAD(P)H is required to convert acetoin to 2,3-BDO, a suitable BDH protein was screened in E. limosum. Subsequently, the BDH protein sequences in ten species capable of producing 2,3-BDO as a native product were compared. The BDH sequences were divided into two groups. The first group had low molecular weight BDH proteins (budC) with approximately 260 aa (27 kDa), comprising mainly Klebsiella pneumoniae. Another group had high molecular weight BDH proteins (bdh) with approximately 360 aa (39 kDa), comprising mainly Clostridium autoethanogenum (FIG. 12b). Since the amino acid sequences of the BDHs of Enterobacter cloacae and K. pneumoniae were the same, nine BDHs were tested in E. limosum. A 2,3-BDO biosynthesis pathway connecting nine BDH enzymes were constructed, followed by transformation into the wild-type strain. Each strain was then cultured under heterotrophic conditions. The highest BDO titer was determined in E. limosum expressing Clostridium beijerinckii BDH, which was used to develop a 2,3-BDO producing strain (FIG. 12c). To construct a strain capable of stably producing 2,3-BDO from CO syngas, the 2,3-BDO biosynthesis pathway was constructed using the promoter/UTR parts of E. limosum (FIG. 12d). The final vector was transformed into wild-type and ECO2-S6 strains.

[0135] To compare the biomass formation and 2,3-BDO production levels of the engineered strains, gas fermentation was performed using a 1 L scale gas-lift fermenter. For the WT strain, fermentation was performed using 44% CO syngas for approximately 30 days. Acetate was produced at approximately 0.66 mg.Math.L.sup.1h.sup.1, and the final titer was approximately 0.55 g.Math.L.sup.1 (FIG. 13a). For 2,3-BDO, about 0.40 mg.Math.L.sup.1h.sup.1 was produced, and the final titer was approximately 0.3 g.Math.L.sup.1 (FIG. 13b). In contrast, the ECO2-S6 strain was cultured under 66% CO syngas for approximately 30 days. Cell growth reached approximately at 2.5 OD, which was 2.1-fold higher than that of the WT strain. Acetate was produced at approximately 16.21 mg.Math.L.sup.1h.sup.1, and the final titer was 11.7 g.Math.L.sup.1 (FIG. 13c). For acetate, 24.8-fold productivity and 23.6-fold titer were increased in the ECO2-S6 strain compared to those in the wild-type strain. In particular, 2,3-BDO production in the ECO2-S6 strain having the highest titer of 1.37 g.Math.L.sup.1 was produced at 2.60 mg.Math.L.sup.1h.sup.1 (FIG. 13d). This result showed 4.5-fold higher productivity and 46.5-fold higher production amount than the WT strain.

[0136] In summary, the E. limosum ECO2-S6 strain with improved CO tolerance through ALE at a high concentration of CO was obtained. This strain improved the function of CODH/ACS through H636R mutations in ACS, resulting in rapid CO conversion to generate biomass. In addition, when the fed-batch CO fermentation was used by introducing the 2,3-BDO biosynthesis pathway into the evolved ECO2-S6 strain, 1.37 g.Math.L.sup.1 of 2,3-BDO was produced at 2.60 mg.Math.L.sup.1h.sup.1 of productivity. Therefore, it can be seen that the ACS H636R mutation of the present invention increases the CODH/ACS activity to impart CO tolerance to the strain and can be effectively used for the production of biomass.

[0137] From the foregoing, a skilled person in the art to which the present invention pertains will be able to understand that the present invention may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present invention. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present invention. The scope of the present invention is therefore indicated by the appended claims rather than by the foregoing description. All changes which come within the meaning and range of equivalency of the claims are to be embraced within the scope of the present invention.

DEPOSITION NOS.

[0138] Depository Institution: Korea Research Institute of Bioscience and Biotechnology

[0139] Accession No.: KCTC 14201 BP

[0140] Deposition Date: 2020 Jun. 4

[0141] Depository Institution: Korea Research Institute of Bioscience and Biotechnology

[0142] Accession No.: KCTC 15034BP

[0143] Deposition Date: 2022 Jul. 14