Fluorescent fusion polypeptide capable of detecting phosphorylation of cellular membrane receptors by GRKs (G-protein receptor kinases) and/or receptor tyrosine kinases (RTKs)
11905324 ยท 2024-02-20
Assignee
Inventors
- Patricia Villace Lozano (Derio-Bizkaia, ES)
- Rosa Maria Mella Lopez (Derio-Bizkaia, ES)
- Danel Kortazar Zaballa (Derio-Bizkaia, ES)
- Jorge Gamiz Mata (Derio-Bizkaia, ES)
- Aida Clarisa Salado Pogonza (Derio-Bizkaia, ES)
Cpc classification
C07K2319/60
CHEMISTRY; METALLURGY
G01N2333/726
PHYSICS
International classification
C07K14/715
CHEMISTRY; METALLURGY
G01N33/50
PHYSICS
Abstract
The authors of the present invention designed a new fluorescent fusion polypeptide comprising a membrane localization peptide, a peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors by GRKs or RTKs, a vesicularization peptide and a fluorescent peptide. This biosensor is formed by two peptides targeted to two different cellular compartments, allowing the detection of the translocation of GRKs (G-protein receptor kinases) and/or beta-arrestin or Receptor tyrosine kinases (RTKs) from the cell cytoplasm to the cell cytoplasmic membrane in vivo by monitoring the distribution of the fluorescent polypeptide within the cellular cytoplasm. In this sense, the biosensor translocation within the cell shall be due to a change in its 3D conformation that hides or exposes the location signals in both ends of the polypeptide triggered by the binding of the peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors to the phosphorylated G-protein or tyrosine receptors.
Claims
1. A fluorescent fusion polypeptide capable of changing its localization and fluorescence intensity within a cell from the cell cytoplasmic membrane to the retention vesicles, upon an increase in translocation of beta-arrestin from the cell cytoplasm to the cell cytoplasmic membrane, comprising a membrane localization peptide consisting of the extracellular domain of interleukin-2 receptor of SEQ ID NO: 3; a peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors by GRKs or RTKs consisting of the phosphorylated receptor binding peptide from b-arrestin of SEQ ID NO: 2; a vesicularization peptide consisting of the Clathrin and beta-adaptin peptide from arrestin; and a fluorescent peptide wherein: a. the membrane localization peptide is located at the N-terminus of the fluorescent fusion polypeptide and is physically bound, through a linker, to the fluorescent peptide, which in turn is physically bound, through a linker, to the peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors by GRKs or RTKs; and b. the peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors by GRKs or RTKs is physically bound, through a linker, to the vesicularization peptide, which in turn is located at the C-terminus of the fluorescent fusion polypeptide; and wherein the term membrane localization peptide means a peptide whose natural intracellular localization is in the plasma membrane.
2. The fluorescent fusion polypeptide of claim 1, wherein the vesicularization peptide consisting of the Clathrin and beta-adaptin peptide from arrestin consists of SEQ ID NO: 4.
3. The fluorescent fusion polypeptide of claim 1, wherein: c. the membrane localization peptide is the extracellular domain of interleukin-2 receptor of SEQ ID NO: 3; and d. the vesicularization peptide consisting of the Clathrin and beta-adaptin peptide from arrestin consists of SEQ ID NO: 4.
4. The fluorescent fusion polypeptide of claim 1, wherein the fluorescent peptide is selected from the group consisting of GFP, YFP, turboGFP, turboRFP, turboRFP602 and turboRFP650.
5. A nucleic acid molecule comprising a polynucleotide sequence coding for a polypeptide as defined in claim 1.
6. A cell comprising the fluorescent polypeptide as defined in claim 1.
7. The cell of claim 6, wherein said cell is cell line U2OS (Human bone osteosarcoma cell line).
8. A method for detecting or recruiting beta arrestin, or both, comprising contacting the fluorescent polypeptide of claim 1 with a cell and monitoring the distribution of the polypeptide within cellular cytoplasm of the cell.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1) The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments and together with the description illustrate the disclosed compositions and methods.
(2)
(3) Negative control. (B) Substance P 1 M stimulated cells. (C) Dose response curve.
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
DETAILED DESCRIPTION OF THE INVENTION
(12) Unless expressly specified otherwise, the term comprising is used in the context of the present document to indicate that further members may optionally be present in addition to the members of the list introduced by comprising. It is, however, contemplated as a specific embodiment of the present invention that the term comprising encompasses the possibility of no further members being present, i.e. for the purpose of this embodiment comprising is to be understood as having the meaning of consisting of.
Definitions
(13) In the context of the present invention, the term fusion polypeptide refers to a hybrid polypeptide comprising a combination of at least four peptides from different proteins that are combined into the same polypeptide structure.
(14) In the context of the present invention, the term membrane localization peptide is intended to mean a peptide whose natural intracellular localization is in the plasma membrane.
(15) As used herein, the term peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors by GRKs or RTKs is intended to mean a peptide or protein domain that has the ability to interact with the G-protein or tyrosine receptors only when these are phosphorylated. A clear example of such peptide is the phosphorylated receptor binding peptide from b-arrestin of SEQ ID 2.
(16) It is noted that the nucleotide sequence coding for the phosphorylated receptor binding peptide of SEQ ID NO: 2 is as follows:
(17) TABLE-US-00001 (SEQIDNO:1) atggacagctacctgctgatgtggggcctgctgaccttcatcatggtgcccggctgccag 60 gccgagctgtgcgacgacgacccccctgagatcccccacgccaccttcaaagccatggcc 120 tacaaagaaggcaccatgctgaactgcgagtgcaagcggggcttccggcggatcaagagc 180 ggcagcctgtacatgctgtgcaccggcaacagcagccacagcagctgggacaaccagtgc 240 cagtgcaccagcagcgccacccggaacaccaccaaacaggtcacaccccagcccgaggaa 300 cagaaagagcgcaagaccaccgagatgcagagccccatgcagcccgtggaccaggcctct 360 ctgcccggccactgcagagagcccccaccttgggagaacgaggccaccgagcggatctac 420 cacttcgtggtcggacagatggtgtactaccagtgcgtgcagggctaccgggccctgcac 480 agaggacctgccgagagcgtgtgcaagatgacccacggcaagacccggtggacccagccc 540 cagctgatctgcaccggcgagatggaaaccagccagttccccggcgaggaaaagccccag 600 gccagccctgagggcagacccgagagcgagacaagctgcctggtgacaaccaccgacttc 660 cagatccagaccgagatggccgccacaatggaaacctccatcttcaccaccgacctgcag 720 gtggccgtggccggctgcgtgttcctgctgatctctgtgctgctcctgagcggcctgacc 780 tggcagcggagacagagaaagagcggccggaccatcgggatccaactagttgtcgaccag 840 cagcagcagcagcagggaattctgcagtcgacggtaccaatggtgggtgaggatagcgag 900 ctgatcaccgagaacatgcacatgaaactgtacatggagggcaccgtgaacaaccaccac 960 ttcaagtgcacatccgagggcgaaggcaagccctacgagggcacccagaccatgaagatc 1020 aaggtggtcgagggcggccctctccccttcgccttcgacatcctggctaccagcttcatg 1080 tacggcagcaaagccttcatcaaccacacccagggcatccccgacttctttaagcagtcc 1140 ttccctgagggcttcacatgggagagaatcaccacatacgaagacgggggcgtgctgacc 1200 gctacccaggacaccagcctccagaacggctgcctcatctacaacgtcaagatcaacggg 1260 gtgaacttcccatccaacggccctgtgatgcagaagaaaacactcggctgggaggccagc 1320 accgagatgctgtaccccgctgacagcggcctgagaggccatggccagatggccctgaag 1380 ctcgtgggcgggggctacctgcactgctccctcaagaccacatacagatccaagaaaccc 1440 gctaagaacctcaagatgcccggcttccacttcgtggaccacagactggaaagaatcaag 1500 gaggccgacaaagagacctacgtcgagcagcacgagatggctgtggccaagtactgcgac 1560 ctccctagcaaactggggcacagcagatctcgagtaggcggcggcggctatggccgtgaa 1620 gacctggatgtgctgggcttgtccttccgcaaagacctgggcggcctcattgaatttggc 1680 ggcggccggcttcggctgaag 1701 (SEQIDNO:2): MetAspSerTyrLeuLeuMetTrpGlyLeuLeuThrPheIleMetVal ProGlyCysGlnAlaGluLeuCysAspAspAspProProGluIlePro HisAlaThrPheLysAlaMetAlaTyrLysGluGlyThrMetLeuAsn CysGluCysLysArgGlyPheArgArgIleLysSerGlySerLeuTyr MetLeuCysThrGlyAsnSerSerHisSerSerTrpAspAsnGlnCys GlnCysThrSerSerAlaThrArgAsnThrThrLysGlnValThrPro GlnProGluGluGlnLysGluArgLysThrThrGluMetGlnSerPro MetGlnProValAspGlnAlaSerLeuProGlyHisCysArgGluPro ProProTrpGluAsnGluAlaThrGluArgIleTyrHisPheValVal GlyGlnMetValTyrTyrGlnCysValGlnGlyTyrArgAlaLeuHis ArgGlyProAlaGluSerValCysLysMetThrHisGlyLysThrArg TrpThrGlnProGlnLeuIleCysThrGlyGluMetGluThrSerGln PheProGlyGluGluLysProGlnAlaSerProGluGlyArgProGlu SerGluThrSerCysLeuValThrThrThrAspPheGlnIleGlnThr GluMetAlaAlaThrMetGluThrSerIlePheThrThrAspLeuGln ValAlaValAlaGlyCysValPheLeuLeuIleSerValLeuLeuLeu SerGlyLeuThrTrpGlnArgArgGlnArgLysSerGlyArgThrIle GlyIleGlnLeuValValAspGlnGlnGlnGlnGlnGlnGlyIleLeu GlnSerThrValProMetValGlyGluAspSerGluLeuIleThrGlu AsnMetHisMetLysLeuTyrMetGluGlyThrValAsnAsnHisHis PheLysCysThrSerGluGlyGluGlyLysProTyrGluGlyThrGln ThrMetLysIleLysValValGluGlyGlyProLeuProPheAlaPhe AspIleLeuAlaThrSerPheMetTyrGlySerLysAlaPheIleAsn HisThrGlnGlyIleProAspPhePheLysGlnSerPheProGluGly PheThrTrpGluArgIleThrThrTyrGluAspGlyGlyValLeuThr AlaThrGlnAspThrSerLeuGlnAsnGlyCysLeuIleTyrAsnVal LysIleAsnGlyValAsnPheProSerAsnGlyProValMetGlnLys LysThrLeuGlyTrpGluAlaSerThrGluMetLeuTyrProAlaAsp SerGlyLeuArgGlyHisGlyGlnMetAlaLeuLysLeuValGlyGly GlyTyrLeuHisCysSerLeuLysThrThrTyrArgSerLysLysPro AlaLysAsnLeuLysMetProGlyPheHisPheValAspHisArgLeu GluArgIleLysGluAlaAspLysGluThrTyrValGluGlnHisGlu MetAlaValAlaLysTyrCysAspLeuProSerLysLeuGlyHisSer ArgSerArgValGlyGlyGlyGlyTyrGlyArgGluAspLeuAspVal LeuGlyLeuSerPheArgLysAspLeuGlyGlyLeuIleGluPheGly GlyGlyArgLeuArgLeuLys
(18) As used herein, the term vesicularization peptide is intended to mean a short peptide chain that directs the transport of the polypeptide to the retention vesicles. Preferably such vesicularization peptide is the Clathrin and beta-adaptin peptide from arrestin. More preferably, the peptide sequence for the Clathrin and beta-adaptin peptide from arrestin is as follows (from hereinafter SEQ ID NO: 4):
(19) TABLE-US-00002 TyrGlyArgGluAspLeuAspValLeuGlyLeuSer PheArgLysAspLeuGlyGlyLeuIleGluPheGly GlyGlyArgLeuArgLeuLys
(20) As used herein, the term fluorescent peptide is intended to mean a fluorescent peptide that has fluorescent capacities. Fluorescent peptide domains are characterized by having a specific excitation spectrum and emission spectrum.
(21) In the context of the present invention, the linker has at least one amino acid residue, preferably at least two consecutive amino acid residues.
(22) As used herein, the term biosensor is intended to mean a molecular tool or entity that is sensitive to, and can respond to, a physical or chemical stimulus and transmit information about cellular status.
(23) As used herein, the term drug is intended to mean a molecule that potentially acts as an agonist or antagonist or modulator of a signalling pathway.
(24) As used herein stable cell line is intended to mean a cell line that has been transfected or infected with a foreign piece of DNA that has incorporated itself into the genome of the cell.
DESCRIPTION
(25) The present invention confronts the problem of providing tools of precise localization, high dynamic range and as little disturbance of cell physiology as possible that are capable of monitoring a variation in the translocation of GRKs (G-protein receptor kinases) and/or beta-arrestin or Receptor tyrosine kinases (RTKs) from the cell cytoplasm to the cell cytoplasmic membrane in vivo by using High-content screening (HCS) in cell-based systems, wherein these tools do not have the disadvantages of FRET-based biosensors.
(26) In order to solve the above problem, the authors of the present invention designed a new fluorescent fusion polypeptide comprising a membrane localization peptide, a peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors by GRKs or RTKs, a vesicularization peptide and a fluorescent peptide. This biosensor is formed by two peptides targeted to two different cellular compartments, allowing the detection of the translocation of GRKs (G-protein receptor kinases) and/or beta-arrestin or Receptor tyrosine kinases (RTKs) from the cell cytoplasm to the cell cytoplasmic membrane in vivo by monitoring the distribution of the fluorescent polypeptide within the cellular cytoplasm. In this sense, the biosensor translocation within the cell shall be due to a change in its 3D conformation that hides or exposes the location signals in both ends of the polypeptide triggered by the binding of the peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors to the phosphorylated G-protein or tyrosine receptors.
(27) In the basal state, the biosensor is located in one of the compartments; this means that the location peptide directed to the other cellular compartment is hidden by the 3D conformation. When there is a translocation of GRKs (G-protein receptor kinases) and/or beta-arrestin or Receptor tyrosine kinases (RTKs) from the cell cytoplasm to the cell cytoplasmic membrane due to a cellular stimulation, the peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors binds to the phosphorylated G-protein or tyrosine receptors causing a conformational change in the biosensor. At this point the spatial distribution of the different structural elements in the biosensor is modified and the vesicularization peptide directed to the other cellular compartment is exposed by the new 3D conformation so that the whole biosensor is transported to its new location at the new cellular compartment. All this process can be traced in living cells due to the presence of the fluorescent protein in the biosensor.
(28) It is further noted, that the authors of the present invention realized that the order of the peptides within the above mentioned fluorescent fusion polypeptide could not be placed arbitrarily within the polypeptide. This is the case since after numerous experiments the authors concluded that only one combination of elements provided the technical effect of transporting the biosensor to the other cellular compartment, such combination was: a. the membrane localization peptide is located at the N-terminus of the fluorescent fusion polypeptide and is physically bound, optionally through a linker, to the fluorescent peptide, which in turn is physically bound, optionally through a linker, to the peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors by GRKs or RTKs; and b. the peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors by GRKs or RTKs is physically bound, optionally through a linker, to the vesicularization peptide, which in turn is located at the C-terminus of the fluorescent fusion polypeptide;
(29) The authors tested whether such biosensor having the above structure could be employ for detecting and quantifying the translocation of beta-arrestin caused by substance P. As illustrated in the examples disclosed herein, the authors of the present invention constructed a fluorescent fusion polypeptide, capable of detecting and quantifying beta-arrestin successfully, comprising the phosphorylated receptor binding peptide from b-arrestin of SEQ ID 2. Surprisingly, the authors identified that by using as a vesicularization peptide the Clathrin and beta-adaptin peptide from arrestin, the detection signal was significantly better.
(30) The results shown in the examples and drawings presented herein by using the above fusion polypeptide indicate that an increased in the translocation of beta-arrestin induced a conformational change in the biosensor which promoted a redistribution of the fluorescent biosensor. The activity was calculated as an increment of the granularity of the cells transfected with the biosensors of the invention. The fluorescence redistribution of the biosensor was detected by fluorescence using image analysis algorithms. Consequently, the variations in the location of the beta arrestin can be monitored through this hiding and exposition process of location signals and the final localization of the biosensor.
(31) Thus, a first aspect of the present invention refers to a fluorescent fusion polypeptide capable of changing its localization within the cell from the cell cytoplasmic membrane to the retention vesicles, upon an increase in the translocation of GRKs (G-protein receptor kinases) and/or beta-arrestin or Receptor tyrosine kinases (RTKs) from the cell cytoplasm to the cell cytoplasmic membrane, comprising a membrane localization peptide, a peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors by GRKs or RTKs, a vesicularization peptide and a fluorescent peptide wherein: a. the membrane localization peptide is located at the N-terminus of the fluorescent fusion polypeptide and is physically bound, optionally through a linker, to the fluorescent peptide, which in turn is physically bound, optionally through a linker, to the peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors by GRKs or RTKs; and b. the peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors by GRKs or RTKs is physically bound, optionally through a linker, to the vesicularization peptide, which in turn is located at the C-terminus of the fluorescent fusion polypeptide;
and wherein the term membrane localization peptide is intended to mean a peptide whose natural intracellular localization is in the plasma membrane.
(32) Preferably, such fluorescent fusion polypeptide is capable of changing its localization within the cell from the cell cytoplasmic membrane to the retention vesicles, upon an increase in the translocation of GRKs (G-protein receptor kinases) and beta-arrestin from the cell cytoplasm to the cell cytoplasmic membrane.
(33) More preferably the fluorescent fusion polypeptide of the first aspect of the invention is characterized by: a. the membrane localization peptide being the extracellular domain of interleukin-2 receptor of SEQ ID 3 or a variant which is at least 90% homologous to this sequence over the entire region based on amino acid identity; and b. the vesicularization peptide being the Clathrin and beta-adaptin peptide from arrestin.
(34) Amino acidic SEQ ID No: 3 is as follows:
(35) TABLE-US-00003 MetAspSerTyrLeuLeuMetTrpGlyLeuLeuThr PheIleMetValProGlyCysGlnAlaGluLeuCys AspAspAspProProGluIleProHisAlaThrPhe LysAlaMetAlaTyrLysGluGlyThrMetLeuAsn CysGluCysLysArgGlyPheArgArgIleLysSer GlySerLeuTyrMetLeuCysThrGlyAsnSerSer HisSerSerTrpAspAsnGlnCysGlnCysThrSer SerAlaThrArgAsnThrThrLysGlnValThrPro GlnProGluGluGlnLysGluArgLysThrThrGlu MetGlnSerProMetGlnProValAspGlnAlaSer LeuProGlyHisCysArgGluProProProTrpGlu AsnGluAlaThrGluArgIleTyrHisPheValVal GlyGlnMetValTyrTyrGlnCysValGlnGlyTyr ArgAlaLeuHisArgGlyProAlaGluSerValCys LysMetThrHisGlyLysThrArgTrpThrGlnPro GlnLeuIleCysThrGlyGluMetGluThrSerGln PheProGlyGluGluLysProGlnAlaSerProGlu GlyArgProGluSerGluThrSerCysLeuValThr ThrThrAspPheGlnIleGlnThrGluMetAlaAla ThrMetGluThrSerIlePheThrThrAspLeuGln ValAlaValAlaGlyCysValPheLeuLeuIleSer ValLeuLeuLeuSerGlyLeuThrTrpGlnArgArg GlnArgLysSerGlyArgThrIle
(36) More preferably the fluorescent fusion polypeptide of the first aspect of the invention is characterized by: a. the membrane localization peptide being the extracellular domain of interleukin-2 receptor of SEQ ID 3; and b. the vesicularization peptide being the Clathrin and beta-adaptin peptide from arrestin, preferably of SEQ ID No: 4.
(37) More preferably the fluorescent fusion polypeptide of the first aspect of the invention is characterized by: a. the membrane localization peptide being the extracellular domain of interleukin-2 receptor of SEQ ID 3; b. the vesicularization peptide being the Chlatrin or beta-adaptin peptide from arrestin, preferably of SEQ ID No: 4; and c. the peptide capable of binding G-protein receptors following phosphorylation of these receptors by GRKs, being the phosphorylated receptor binding peptide from b-arrestin of SEQ ID 2.
(38) In yet another preferred embodiment of the first aspect of the invention, such polypeptide is capable of changing its localization within the cell from the cell cytoplasmic membrane to the retention vesicles, upon an increase in the translocation of Receptor tyrosine kinases (RTKs) from the cell cytoplasm to the cell cytoplasmic membrane.
(39) More preferably the fluorescent fusion polypeptide of the above mentioned preferred embodiment of the invention (the biosensor capable of detecting an increased an increase in the translocation of Receptor tyrosine kinases (RTKs) from the cell cytoplasm to the cell cytoplasmic membrane) is characterized by: a. the membrane localization peptide is the extracellular domain of interleukin-2 receptor of SEQ ID 3 or a variant which is at least 90% homologous to this sequence over the entire region based on amino acid identity; and b. the vesicularization peptide is the Clathrin and beta-adaptin peptide from arrestin.
(40) More preferably the fluorescent fusion polypeptide of the above mentioned preferred embodiment of the invention (the biosensor capable of detecting an increased an increase in the translocation of Receptor tyrosine kinases (RTKs) from the cell cytoplasm to the cell cytoplasmic membrane) is characterized by: a. the membrane localization peptide is the extracellular domain of interleukin-2 receptor of SEQ ID 3; and b. the vesicularization peptide is the Chlatrin and beta-adaptin peptide from arrestin, preferably of SEQ ID No: 4.
(41) More preferably the fluorescent fusion polypeptide of the above mentioned preferred embodiment of the invention (the biosensor capable of detecting an increased an increase in the translocation of Receptor tyrosine kinases (RTKs) from the cell cytoplasm to the cell cytoplasmic membrane) is characterized by: a. the membrane localization peptide being the extracellular domain of interleukin-2 receptor of SEQ ID 3; b. the vesicularization peptide being the Clathrin and beta-adaptin peptide from arrestin, preferably of SEQ ID No: 4; and c. the peptide capable of binding tyrosine-protein receptors following phosphorylation of these receptors by RTKs, being a peptide capable of recognizing the phosphorylated Receptor tyrosine protein.
(42) It is noted that such peptide capable of recognizing the phosphorylated Receptor tyrosine protein, may comprised a SH2 domain and/or a domain designed in silico, any of these capable of recognizing phosphorylated tyrosin-kinase receptors. Such domains are well known to the skilled person.
(43) In another preferred embodiment of the first aspect of the invention, the fluorescent fusion polypeptide may be selected from any of the following list of compounds consisting of GFP, YFP, turboGFP, turboRFP, turboRFP602 and turboFP650.
(44) A second aspect of the invention refers to a nucleic acid molecule comprising a polynucleotide sequence coding for a polypeptide as defined in any of the previous aspects of the invention.
(45) A third aspect of the invention refers to a biosensor comprising the fusion polypeptide as defined in the first aspect of the invention.
(46) A fourth aspect of the invention refers to a cell comprising the fluorescent fusion polypeptide as defined in the first aspect of the invention, wherein preferably said cell is cell line U2OS (see examples).
(47) In a further aspect, the present invention relates to several uses for the fluorescent fusion polypeptide as defined in the first aspect of the invention. A first use of the biosensor according to the present invention is for detecting and quantifying compounds capable of the translocation of GRKs (G-protein receptor kinases) and/or beta-arrestin or Receptor tyrosine kinases (RTKs) from the cell cytoplasm to the cell cytoplasmic membrane including, but not limited thereto, substance P. As already stated, binding the peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors binds to the phosphorylated G-protein or tyrosine receptors results in a substantial change in the spatial conformation that leads to a change in the intracellular fluorescence localization. This fluorescence translocation can be harnessed for compound quantification by fluorescence. In addition, all this process can be traced in living cells due to the presence of the fluorescent protein in the biosensor.
(48) The employment of the fluorescent fusion polypeptide as defined in the first aspect of the invention further involves its use as a tool for drug screening.
(49) In addition, the fluorescent fusion polypeptide as defined in the first aspect of the invention is useful in the practice of essentially any application for which readout of second messenger transduction is obtained. Such applications are well known in the art. However, more exemplary applications of the present invention include but are not limited to: a. Identifying test compounds that act as agonists, antagonists, inverse agonists or natural ligands of cell surface receptor selected from growth factors, cytokines, G-protein coupled receptors, integrins and calcium ion channels by studying the second messenger movement using fluorescence microscopy devices. In a preferred embodiment, said cell surface receptor is a G-protein coupled receptor (GPCR). b. Expression cloning of peptide agonist, antagonist and inverse agonist of receptors. c. Expression cloning of modulators that change the second messenger intracellular presence. d. Establishing dose-response curves of membrane molecules modulators. e. Determining alterations in membrane molecules and modulators involved in a disease or disorder which signalling cascade depends on these second messengers and thereby the biosensor can be used as a diagnostic tool.
(50) In a preferred embodiment of the invention, the fluorescent fusion polypeptide as defined in first aspect of the invention can be used to generate stable cell lines which allow studying G-protein coupled receptors (GPCR), and the activity of others proteins in living cells. The rapid translocation of the biosensor of the invention allows the quantification of GPCR and ion channel stimulation.
(51) The fluorescent fusion polypeptide and the corresponding biosensor of the present invention can be made by techniques well known by those skilled in the art but as a way of example, they can be constructed as follows. The coding sequences corresponding to the membrane localization peptide, the fluorescent peptide, the peptide capable of binding G-protein or tyrosine receptors following phosphorylation of these receptors by GRKs or RTKs, and the vesicularization peptide can be easily amplified by PCR and cloned into a shuttle plasmid. These coding sequences can be then easily cloned into the final fusion plasmid in the specific order presented herein using the restriction enzyme sites that flanked each sequence.
(52) The following examples merely serve to illustrate the present invention.
EXAMPLES
Example 1. Materials and Methods
(53) Cell Culture of U2OS Cells
(54) Human bone osteosarcoma cell line (DSMZ), derived from ATCC (Catalog No. HTB-96), was grown in Dulbecco's Modified Eagle's Medium Nutrient Mixture F-12 HAM (Sigma-Aldrich) supplemented with 10% Fetal Bovine Serum (Sigma-Aldrich), MEM non-essential amino acids (Sigma-Aldrich), gentamicin (Sigma-Aldrich), GENETICIN 500 g/ml (Sigma-Aldrich) and Puromycin 10 g/ml (Sigma) at 37 C. in a humidified atmosphere supplemented with 5% CO2.
(55) Generation of Recombinant Stable Cell Line
(56) Red -ARRNomad biosensor plasmid was created by subsequent cloning of the Tac cDNA, turboFP602 protein cDNA, (Evrogen), phosphorylated receptor binding peptide from b-arrestin, and the vesicularization peptide (Clathrin and beta-adaptin peptide from arrestin) into the GENETICIN resistant CMV-ptNL vector designed in our lab. Tachykinin receptor 1 (NK1) receptor's cDNA (cDNA.org) was subcloned in a Puromycin resistant vector, CMV-pPuro, designed in our lab using NheI and XhoI restriction enzymes.
(57) All the clonings were confirmed by DNA sequencing. Plasmid containing Red ARRNomad biosensor was transfected into U2OS cells using LIPOFECTAMINE LTX (Invitrogen) and positive transfected cells were selected using 500 g/ml GENETICIN (Sigma-Aldrich) the positive clone named C1 was transfected with the puromycin resistant plasmid containing Tachykinin receptor 1 (NK1-pPuro) and the positive clones were selected using 10 g/ml puromicyn (Sigma-Aldrich) and 500 g/ml GENETICIN (Sigma-Aldrich) Resistant clones were obtained by limit dilution. Double stable cell line, termed NK1-Red -ARRNomad biosensor cell line was then tested using Substance P (Sigma-Aldrich) for functional Red -ARRNomad biosensor response.
(58) Development of the Assays
(59) Cells were seeded at 18,000 cells/plate in 96-well black, clear-bottom imaging plates (BD Biosciences) for -arrestin assays. NK1-Red -ARRNomad biosensor cell line was treated with 8 log dilution (n=6) of Substance P (Sigma-Aldrich) ranging from 0 to 1 M in OPTI-MEM media (Gibco) for 24 hours at 37 C., 5% CO2, 95% relative humidity before data acquisition.
(60) Fluorescence Intensity Assay
(61) For fluorescence intensity determinations, changes in the distribution of Red -ARRNomad biosensor were measured using SYNERGY 2 microplate reader (Biotek). OPTI-MEM media with the agonists was removed and replaced by PBS 1 without calcium and magnesium (Sigma-Aldrich) before the data acquisition. TurboFP602 data were acquired with ex/em 590/620 filters.
(62) Image Assay
(63) The image analysis routine of the redistribution of Red -ARRNomad biosensor was developed with a BD PATHWAY 855 High-Content automated image platform (BD Biosciences) using image analysis algorithms with the Attovision bioimaging software (BD). Rhodamine excitation/emission filters used for image acquiring were 548/20 and 570LP. Calculated Nomad biosensor number of vesicles were normalized as percentage of activity compared to the negative control (vehicle H2O).
(64) Inhibition Assay
(65) Cells were seeded at 18,000 cells/plate in 96-well plates for inhibition assay. NK1-Red -ARRNomad biosensor cell line was co-treated with Substance P 100 nM (Sigma-Aldrich) and log dilution of L733,060 hydrochloride (Tocris) ranging from 100 M to 3 M in OPTI-MEM media (Gibco) for 24 hours at 37 C., 5% CO2, 95% relative humidity before data acquisition.
(66) ZFactor and Signal-to-Background Determination
(67) The signal to background (S/B) parameter was calculated as c+c, and Zfactor was calculated using the following formula: Z=1[(3c++3c)/(c+c)].
Example 1. Results
(68) NK1-Red -ARRNomad biosensor cell line stably expressing red -ARRNomad biosensor and Neurokinin receptor 1 has been designed to assay compounds or analyze its capability to modulate NK1 receptor. Before the stimulation mediated by the agonist of interest, the fluorescent biosensor is localized in the cellular membrane, the union of Substance P to Neurokinin 1 receptor leads to a change in the structural folding of Red -ARRNomad Biosensor that promotes its cellular relocation in the vesicular trafficking of the cells.
(69) Fluorescence Intensity Assay
(70) The increase in the fluorescence was detected and analyzed using SYNERGY 2 microplate reader from Biotek. The Ec50 for the Substance P was approx. 5.2010.sup.9 M after a treatment of 24 h with the agonist. The assay was validated with an average of Z=0.70+/0.02 (n=6).
(71) Image Assay
(72) Activation and Red -ARRNomad biosensor change of localization processes were detected and analyzed using BD PATHWAY 855 High-Content Bioimager from BD Biosciences. The Ec50 for the Substance P was approx. 2.9910.sup.9M after a treatment of 24 h with the agonist. The assay was validated with an average of Z=0.79+/0.02 (n=6).
(73) Inhibition Assay NK1-Red -ARRNomad biosensor cell line was co-treated with Substance P 100 nM and increasing concentrations of L733,060 (NKR1 inhibitor) during 24 h. After the treatment, nuclei were stained with DAPI and inhibition of NK1 receptor was detected analyzing Red -ARRNomad biosensor change of localization using BD PATHWAY 855 High-Content Bioimager from BD Biosciences. The Ic50 for L733,060 was Approx. 1.8410.sup.7M after a treatment of 24 h with the agonist. The assay was validated with an average of Z=0.66+/0.02.
Example 2: EP.SUB.4 .Receptor Red .SUB.Arrestin.Nomad Biosensor in the HEK293 Cell Line
Example 2. Results
(74) EP.sub.4 receptor Red .sub.ArrestinNomad biosensor HEK293 cell line transiently expressing red .sub.ArrestinNomad biosensor and prostaglandin E receptor 4 has been designed to assay compounds or analyze its capability to modulate EP.sub.4 receptor. Before the stimulation mediated by the agonist of interest, the fluorescent biosensor is localized in the cellular membrane, the union of PGE2 to EP.sub.4 receptor leads to a change in the structural folding of Red .sub.ArrestinNomad biosensor that promotes its cellular relocation in the vesicular trafficking of the cells. The Ec50 for the PGE2 was 8.6410.sup.9M after a treatment of 24 h with the agonist. The assay was validated with an average of Z=0.67+/0.04 (n=6).
Example 2. Materials and Methods
(75) Cell Culture of HEK293 Cells
(76) HEK293 cells derived from ATCC (Catalog No. CRL-1573), were grown in Dulbecco's Modified Eagle's Mediumhigh glucose (Sigma-Aldrich) supplemented with 10% Fetal Bovine Serum (Sigma-Aldrich), MEM non-essential amino acids (Sigma-Aldrich) and gentamicin (Sigma-Aldrich) at 37 C. in a humidified atmosphere supplemented with 5% CO2.
(77) Generation of Transiently Transfected Cell Line
(78) Red .sub.ArrestinNomad biosensor plasmid was created by subsequent cloning of the Tac cDNA, turboFP602 protein cDNA, (Evrogen), phosphorylated receptor binding peptide from b-arrestin, and the vesicularization peptide (Clathrin and beta-adaptin peptide from arrestin) into the GENETICIN resistant CMV-ptNL vector designed in our lab. EP.sub.4 receptor (EP.sub.4) receptor's cDNA (cDNA.org) was subcloned in a Puromycin resistant vector, CMV-pPuro, designed in our lab using NheI and XhoI restriction enzymes.
(79) Transient transfection was performed using phosphate calcium method and the transiently transfected cell line, termed EP.sub.4-Red .sub.ArrestinNomad biosensor cell line was then tested using PGE2 (Sigma-Aldrich) for functional Red .sub.ArrestinNomad biosensor response.
(80) Development of the Assays
(81) Cells were seeded at 20,000 cells/plate in 96-well black, clear-bottom imaging plates (BD Biosciences) for -arrestin assays. EP.sub.4-Red .sub.ArrestinNomad biosensor cell line was treated with 8 log dilution (n=6) of PGE2 (Sigma-Aldrich) ranging from 0 to 10 M in OPTI-MEM media (Gibco) for 24 hours at 37 C., 5% CO2, 95% relative humidity before data acquisition. Fluorescent images were acquired in the BD PATHWAY 855 High-Content automated image platform with a 20 dry objective.
(82) Fluorescence Intensity Assay
(83) For fluorescence intensity determinations, changes in the distribution of Red -ARRNomad biosensor were measured using SYNERGY 2 microplate reader (Biotek). OPTI-MEM media with the agonists was removed and replaced by PBS 1 without calcium and magnesium (Sigma-Aldrich) before the data acquisition. TurboFP602 data were acquired with ex/em 590/620 filters.
(84) ZFactor and Signal-to-Background Determination
(85) The signal to background (S/B) parameter was calculated as c+c, and Zfactor was calculated using the following formula: Z=1[(3.sub.c++3.sub.c)/(.sub.c+.sub.c)]
Example 3: Ca.SUP.2+.-Arrestin Multiplex PAR2 .SUB.Arres-Ca2+.Nomad Biosensor in the U2OS Cell Line
Example 3. Results
(86) Ca.sup.2+-Arrestin Multiplex PAR2 .sub.Arres-Ca2+Nomad biosensor in the U2OS cell line stably expressing green .sub.Ca2+Nomad biosensor, red .sub.ArrestinNomad biosensor and F2R like trypsin receptor 1 has been designed to assay compounds or analyze its capability to modulate PAR2. Before the stimulation mediated by the agonists of interest, the fluorescent biosensor is localized in the cellular membrane, the union of SLIGKV or SLIGRL-NH.sub.2 to PAR2 leads to a change in the structural folding of both Nomad biosensors that promotes their cellular relocation in the vesicular trafficking of the cells.
(87) The increase in the fluorescence was detected and analyzed using the SYNERGY 2 microplate reader from Biotek. The Ec.sub.50 for the agonists was measured after a treatment of 24 h. The assay was validated with Z>0.6 for each agonist.
(88) TABLE-US-00004 EC.sub.50 SLIGKV -Arrestin assay: EC.sub.50 SLIGKV calcium 4.83 10.sup.6M assay: 1.67 10.sup.6M EC.sub.50 SLIGRL-NH2 -Arrestin EC.sub.50 SLIGRL-NH2 calcium assay: 1.27 10.sup.5M assay: 4.06 10.sup.6M Z SLIGKV.sub.-Arrestin: Z SLIGKV.sub.Calcium: 0.68 +/ 0.01 0.85 +/ 0.01 Z SLIGKRL-NH2.sub.-Arrestin: Z SLIGRL-NH2.sub.Calcium: 0.74 +/ 0.01 0.75 +/ 0.01
Example 3. Materials and Methods
(89) Cell Culture of U2OS Cells
(90) Human bone osteosarcoma cell line (DSMZ), derived from ATCC (Catalog No. HTB-96), was grown in Dulbecco's Modified Eagle's Medium Nutrient Mixture F-12 HAM (Sigma-Aldrich) supplemented with 10% Fetal Bovine Serum (Sigma-Aldrich), MEM non-essential amino acids (Sigma-Aldrich), gentamicin (Sigma-Aldrich) at 37 C. in a humidified atmosphere supplemented with 5% CO2.
(91) Generation of Recombinant Stable Cell Line
(92) The plasmid encoding the green .sub.Ca2+Nomad biosensor was transfected into U2OS cells using LIPOFECTAMINE LTX (Thermo Fisher Scientific, Waltham, MA). Resistant clones were obtained by limit dilution, and positively transfected cells were selected using 10 g/ml puromycin (Thermo Fisher Scientific, Waltham, MA). Once this stable cell line was ready, a positive clone was transfected with the plasmid encoding the red .sub.ArrestinNomad biosensor, and the positive clones were selected by limit dilution using 10 g/ml puromycin (Thermo Fisher Scientific, Waltham, MA) and 500 g/ml GENETICIN (Sigma-Aldrich, St. Louis, MO). The cell line co-expressing both biosensors, named .sub.Arres-Ca2+Nomad cell line, was subsequently transfected with the PAR2-CMV-pHygro construction, and resistant clones were obtained by limit dilution and selected using 500 g/ml GENETICIN (Sigma-Aldrich, St. Louis, MO), 10 g/ml puromycin (Thermo Fisher Scientific, Waltham, MA) and 100 g/ml hygromycin B (Thermo Fisher Scientific, Waltham, MA). These cells constitutively expressed green .sub.Ca2+Nomad biosensor, red .sub.ArrestinNomad biosensor and the F2R like trypsin receptor 1, and this triple stable cell line was denominated the PAR2 .sub.Arres-Ca2+Nomad cell line.
(93) Development of the Assays
(94) Cells were seeded at 20,000 cells/plate in 96-well black, clear-bottom imaging plates (BD Biosciences) for Ca.sup.2+ and Arrestin assays. PAR2 .sub.Arres-Ca2+Nomad cell line was treated with 10 log dilution (n=6) of SLIGKV (Sigma-Aldrich) or SLIGRL-NH.sub.2 (Sigma-Aldrich) ranging from 0 to 300 M in OPTI-MEM media (Gibco) for 24 hours at 37 C., 5% CO2, 95% relative humidity before data acquisition. Fluorescent images were acquired in the BD PATHWAY 855 High-Content automated image platform with a 20 dry objective.
(95) Fluorescence Intensity Assay
(96) For fluorescence intensity determinations, changes in the distribution of Red -ARRNomad biosensor were measured using SYNERGY 2 microplate reader (Biotek). OPTI-MEM media with the agonists was removed and replaced by PBS 1 without calcium and magnesium (Sigma-Aldrich) before the data acquisition. TurboFP650 data were acquired with ex/em 590/650 filters and turboGFP lectures were captured with ex/em 485/585 filters.
(97) ZFactor and Signal-to-Background Determination
(98) The signal to background (S/B) parameter was calculated as c+c, and Zfactor was calculated using the following formula: Z=1[(3.sub.c++3.sub.c)/(.sub.c++.sub.c)]
Example 4: High-Content Screening of the PRESTWICK CHEMICAL LIBRARY in NK1R .SUB.Arrestin.Nomad U2OS Cell Line
Example 4. Results
(99) A chemical library comprising 490 compounds was sourced from the PRESTWICK CHEMICAL LIBRARY, and based on the compounds' chemical and pharmacological diversity and their bioavailability and safety for humans, these compounds were used for the screening assay. The reference compound was Substance P. All compounds from the library were dissolved in dimethyl sulfoxide (DMSO) at 5 mM and the reference compound in water at 1 mM. The NK1R.sub.ArrestinNomad U2OS cells were treated with Substance P (positive control) at 10 M, whereas the compounds of the library were tested at 10 M for 24 hours in OPTI-MEM media before image acquisition.
Example 4. Materials and Methods
(100) Image acquisition and analysis: After 24 h of treatment, the cells were fixed with phosphate-buffered saline supplemented with 3.7% formaldehyde for 10 min at room temperature (RT) and permeabilized with 0.3% TRITON-X100 in PBS for 3 min at RT. The cell nuclei were then stained with DAPI for 5 min at RT. Fluorescent images were acquired in the BD PATHWAY 855 High-Content automated image platform with a 20 dry objective. The changes in the fluorescence patterns of the .sub.ArrestinNomad biosensor were processed and quantified using image analysis algorithms with the Attovision bioimaging software in 33 subfields of each well (500-1,000 cells analyzed per well). The excitation and emission filters used were the following: for DAPI, 380/10 and 540/20 and for Rhodamine, 548/20 and 570LP. Arrestin activity was measured by counting the red fluorescent granules and normalizing the result to the cell number. The data were normalized as percentages of activity compared to the positive control (Substance P) after subtracting the value of the vehicle control. Cellular viability was determined by counting the nuclei (DAPI). For each condition, 5 replicates were used. The data were processed using EXCEL and plotted in SIGMAPLOT 11.0.
Example 5. NomadKin U2OS Stable Cell Line Development
Example 5: Results and Materials and Methods
(101) Generation of Recombinant Stable Cell Line
(102) The plasmid encoding the green .sub.KinNomad biosensor was transfected into U2OS cells using LIPOFECTAMINELTX (Thermo Fisher Scientific, Waltham, MA). Resistant clones were obtained by limit dilution, and positively transfected cells were selected using 500 g/ml GENETICIN (Sigma-Aldrich, St. Louis, MO). These cells constitutively expressed green .sub.KinNomad biosensor.
(103) Fluorescent images were acquired in the BD PATHWAY 855 High-Content automated image platform with a 20 dry objective.
Example 6. Anti-TAC Immunofluorescence Assay of Ca.SUP.2+.-Arrestin Multiplex NTSR1 .SUB.Arres-Ca2+.Nomad Biosensor
Example 6. Results
(104) An anti-TAC immunofluorescence assay was performed to trace the localization of .sub.ArrestinNomad biosensor. The membrane localization of the biosensor observed in the control (upper panels) is difuminated in the activated cells (lower panels) with the agonist. The biosensor is relocalized from the plasma membrane to cytosolic vesicles.
Example 6. Materials and Methods
(105) Cells were seeded at 12,000 cells/plate in 96-well black, clear-bottom imaging plates (BD Biosciences). NTSR1 .sub.ArrestinNomad cell line was treated with 1 M of NTS (Sigma-Aldrich) in OPTI-MEM media (Gibco) for 24 hours at 37 C., 5% CO2, 95% relative humidity.
(106) After overnight incubation, cell media was removed and it was performed a 15 minutes incubation with FBS (Sigma-Aldrich) at 4 C. Followed by a 90 minutes incubation at 4 C. with FITC anti-human CD25 antibody (Biolegend) at 1:20 concentration. Cells were then washed twice with PBS (Sigma-Aldrich). Fluorescent images were acquired in the BD PATHWAY 855 High-Content automated image platform (Franklin Lakes, NJ) with a 20 dry objective. The excitation and emission filters used were the following: for FITC, 488/10 and 540/20; and for FP650, 548/20 and 570LP.