<i>Corynebacterium </i>for producing L-lysine by fermentation

11905540 ยท 2024-02-20

Assignee

Inventors

Cpc classification

International classification

Abstract

A method for producing L-lysine by fermentation, comprising modifying a gene for coding an NCBI reference sequence NP_601029.1 and/or NP_599350.1 on a Corynebacterium bacterial chromosome to enable the activity and/or expression quantity of NP_601029.1 and/or NP_599350.1 to be reduced; replacing a promoter of one or more genes on the Corynebacterium bacterial chromosome with a EP5 promoter, and fermenting bacteria obtained by modification to produce L-lysine. Also provided are methods and applications derived from the method, and bacteria and promoter that can used in the methods and the applications.

Claims

1. A promoter, wherein the promoter has the polynucleotide sequence of SEQ ID NO: 5.

2. An expression cassette or vector comprising the promoter of claim 1.

3. A host cell, comprising the expression cassette or vector of claim 2, or is obtained by transforming with the expression cassette or vector of claim 2.

4. The host cell of claim 3, which is a Corynebacterium bacteria.

5. The host cell of claim 4, wherein the Corynebacterium bacteria is Corynebacterium glutamicum or Corynebacterium pekinense.

6. The host cell of claim 4, wherein one or more promoters of one or more genes on the chromosome of the Corynebacterium bacteria are replaced with the promoter having the polynucleotide sequence of SEQ ID NO: 5, and the one or more genes are selected from the group consisting of aspartate kinase gene (lysC), diaminopimelate decarboxylase gene (lysA), D-2-hydroxyisocaproate dehydrogenase gene (ddh), and phosphogluconate dehydrogenase gene (gnd).

7. The host cell of claim 6, wherein 4 promoters of 4 genes on the chromosome of the Corynebacterium bacteria are replaced with the promoter having the polynucleotide sequence of SEQ ID NO: 5, and the 4 genes are aspartate kinase gene (lysC), diaminopimelate decarboxylase gene (lysA), D-2-hydroxyisocaproate dehydrogenase gene (ddh), and phosphogluconate dehydrogenase gene (gnd).

8. The host cell of claim 6, wherein a gene encoding NCBI reference sequence NP_601029.1 on the chromosome of the Corynebacterium bacteria is knocked out, and the amino acid sequence of NCBI reference sequence NP_601029.1 is shown in SEQ ID NO: 1.

9. The host cell of claim 8, wherein the nucleotide sequence of the gene encoding NCBI reference sequence NP_601029.1 is shown in SEQ ID NO: 2.

10. The host cell of claim 6, wherein a gene encoding NCBI reference sequence NP_599350.1 on the chromosome of the Corynebacterium bacteria is knocked out, and the amino acid sequence of NCBI reference sequence NP_599350.1 is shown in SEQ ID NO: 3.

11. The host cell of claim 10, wherein the nucleotide sequence of the gene encoding NCBI reference sequence NP_599350.1 is shown in SEQ ID NO: 4.

12. A method for producing L-lysine by fermentation, comprising a step of fermenting the host cell of claim 6 to produce L-lysine.

Description

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

(1) The following embodiments further illustrate the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art and commercially available common instruments and reagents. For reference, please refer to Molecular Cloning Experiment Guide (3rd Edition) (Science Press), Microbiology Experiment (4th Edition) (Higher Education Press) and manufacturer's instructions for the corresponding instruments and reagents.

(2) Embodiment 1 Down-Regulation of NCgl1751 Gene Expression

(3) According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were synthesized for amplifying two end fragments of the encoding region of NCgl1751 gene as the upstream and downstream homology arm fragments. Primers were designed as follows (synthesized by Shanghai Yingjun Company):

(4) TABLE-US-00001 P1: (SEQIDNO:6) 5'CCCAAGCTTCGACAGGGCTTGGATTG3'(HindIII) P2: (SEQIDNO:7) 5'ATGGAGAAATACGTCAAGGTTTTTCCTGCTCTTTAACACC3' P3: (SEQIDNO:8) 5'GGTGTTAAAGAGCAGGAAAAACCTTGACGTATTTCTCCAT3' P4: (SEQIDNO:9) 5'CGGGATCCCGGTGGGTTTGTTGATGT3'(BamHI)

(5) Using Corynebacterium glutamicum ATCC13032 as a template, and P_1/P2 and P3/P4 as primer pair respectively, PCR amplification were carried out to obtain 660 bp of the upstream homology arm fragment and 780 bp of the downstream homology arm fragment. Then the primers P1/P4 were used for OVER PCR to obtain a 1440 bp of whole homology arm fragment, both ends of which contains Hind III and BamHI restriction sites, respectively. After the PCR reactions, the amplified products were recovered by electrophoresis. The needed 1400 bp of DNA fragment was recovered by a column DNA gel recovery kit, digested by restriction enzyme, and ligated with the shuttle plasmid pk18mobsacB plasmid to obtain a knock-out plasmid. The plasmid contains a kanamycin resistance marker.

(6) The knock-out plasmid was electrotransformed into the patented lysine producing strain YP97136 (the construction method can be referred to WO2014121669A1; the existence of wild type NCgl1751 gene on the chromosome of the strain was confirmed by sequencing). Single colonies produced by culturing were identified by PCR, respectively, using the following primers (synthesized by Shanghai Yingjun Company):

(7) TABLE-US-00002 P5: (SEQIDNO:10) 5'GGTAGTCCCACATCATCTCT3' P6: (SEQIDNO:11) 5'ATGCCCTGGTTGGTTCT3'

(8) Strains with bands of 1000 bp and 740 bp amplified by PCR are positive strains, and the strains with only a band of 1000 bp are the original bacteria. Positive strains were cultured on kanamycin-containing medium and kanamycin-free medium, respectively. The strains grown on kanamycin-free medium but not kanamycin-containing medium were further identified by PCR using the P5/P6 primers. Strains amplified with a band of 740 bp is a genetically engineered strains with the encoding region of the Ncg11751 gene being knocked out, which was named YPL-1-001.

(9) Embodiment 2 Down-Regulation of NCgl0097 Gene Expression

(10) According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were synthesized for amplifying the two end fragments of the encoding region of NCgl0097 gene as the upstream and downstream homology arm fragments. Primers were designed as follows (synthesized by Shanghai Yingjun Company):

(11) TABLE-US-00003 P7: (SEQIDNO:12) 5'CCCAAGCTTCGCAGCAGGTATGTAGTCAC3'(HindIII) P8: (SEQIDNO:13) 5'CACTTCATAGGGTTGAATACAGCACGCGCACGGAAAGCCA3' P9: (SEQIDNO:14) 5'TGGCTTTCCGTGCGCGTGCTGTATTCAACCCTATGAAGTG3' P10: (SEQIDNO:15) 5'GCTCTAGAGCGGGCATCCACAATCAT3'(XbaI)

(12) Using Corynebacterium glutamicum ATCC13032 as a template, and P7/P8 and P9/P10 as primer pair respectively, PCR amplification were carried out to obtain 740 bp of the upstream homology arm fragment and 640 bp of the downstream homology arm fragment. Then the primers P7/P8 were used for OVER PCR to obtain a 1380 bp of whole homology arm fragment, both ends of which contains Hind III and Xba I restriction sites, respectively. After the PCR reactions, the amplified products were recovered by electrophoresis. The needed 1380 bp of DNA fragment was recovered by a column DNA gel recovery kit, digested by restriction enzyme, and ligated with the shuttle plasmid pk18mobsacB plasmid to obtain a knock-out plasmid. The plasmid contains a kanamycin resistance marker, and a recombinant whose plasmid is integrated into the genome can be selected by kanamycin screening.

(13) The knockout plasmid was electrotransformed into the patented lysine producing strain YP97136 (the existence of wild type NCgl0097 gene on the chromosome of the strain was confirmed by sequencing). Single colonies obtained by culturing were identified by PCR, respectively, using the following primers (synthesized by Shanghai Yingjun Company):

(14) TABLE-US-00004 P11: (SEQIDNO:16) 5'AACTGGGCTCTTGTTACTG3' P12: (SEQIDNO:17) 5'CGCTGCCGCTTCACGAT3'

(15) Strains with bands of 1195 bp and 645 bp amplified by PCR are positive strains, and the strains with only one band of 1195 bp are the original bacteria. Positive strains were cultured on kanamycin-containing medium and kanamycin-free medium, respectively. The strains grown on kanamycin-free medium but not kanamycin-containing medium were further identified by PCR using the P11/P12 primers. Strain amplified with a band of 645 bp is a genetically engineered strain with the encoding region of the Ncgl0097 gene being knocked out, which was named YPL-1-002.

(16) Embodiment 3 Down-Regulation of Both NCgl1751 and NCgl0097 Genes Expression

(17) Based on the strain YPL-1-001, the encoding region of the Ncgl0097 gene on the genome was knocked out, and the detailed process of knock-out was the same as the above-mentioned Ncgl0097 gene encoding region. The strain was verified by PCR using the identification primers P5/P6 and P11/P12, and the fragments with size of 740 bp and 645 bp (the size of PCR products from original strains were 1000 bp and 1195 bp, respectively) were obtained. The genetically engineered strain with the encoding regions of NCgl1751 and NCgl0097 genes being knocked out was named YPL-1-003 (also named as YP097158), and deposited at China General Microbiological Culture Collection Center (CGMCC) on Aug. 16, 2016, with an accession number of CGMCC No.12856.

(18) Embodiment 4 Promoter of the Present Invention

(19) According to the promoter having polynucleotide sequence of SEQ ID NO: 5 designed by the present inventors, the corresponding polynucleotide was synthesized and ligated into pMD19-T vector, and the obtained new vector T-EP5 was sequenced (sequenced by Shanghai Yingjun Company) and the result is as follows:

(20) TABLE-US-00005 (SEQIDNO:18) GTAACCCGAGGTTAAGTGTATTTTAGGTGAACAAATTTCA GCTTCGGGTAGAAGACcTTCGATGCGCTTCAGAGCTTCTA TTGGGAAATCTGAtACCACTTGATTAAATA GCCTACCCCCGAATTGGGGGATTGGTCATTTTTTGCTGTG AAGGTAGTTTTGATGCATATGACCTGCGTTTATAAAGAAA GTAAACGTGATCAGATCGATATAAAAGAAACAGTTTGTA CTCAGGTTTGAAGCATTTTCTCCGATTCGCCTGGCAAAAA TCTCAATTGTCGCTTACAGTTTTTCTCAACGACAGGCTGC TAAGCTGCTAGTTCGGTGGCCTAGTGAGTGGCGTTTACTT GGATAAAAGTAATCCCATGTCGTGATCAGCCATTTTGGGT TGTTTCCATAGCAATCCAAAGGTTTCGTCTTTCGATACCT ATTCAAGGAGCCTTCGCCTCT

(21) The sequencing result contains the sequence of promoter shown in SEQ ID NO: 5, indicating that this clone is correct. The promoter sequence designed by the present inventors mainly contains two mutations of T->C and C->T (in lower case) compared with the wild-type promoter, and the sequence of promoter shown in SEQ ID NO: 5 is referred as EP5 below.

(22) Embodiment 5 EP5 Promoter Regulates the Expression of ddh Gene

(23) Based on the sequence of EP5 mentioned-above and the genome sequence of Corynebacterium glutamicum ATCC13032 published on NCBI, primers were designed for inserting the EP5 fragment in front of the initiation codon ATG of the ddh gene, so that EP5 can promote the expression of ddh gene. The specific design of primers is as follows:

(24) TABLE-US-00006 P13: (SEQIDNO:19) 5'GCTCTAGACGTAGCCAACGAAGTAATC3'(XbaI) P14: (SEQIDNO:20) 5'CTATTCAAGGAGCCTTCGCCTCTATGACCAACATCCGCGT AGCTATC3' P15: (SEQIDNO:21) 5'GATAGCTACGCGGATGTTGGTCATAGAGGCGAAGGCTCCT TGAATAG3' P16: (SEQIDNO:22) 5'CAATTTTGGAGGATTACAAGAACGTAACCCGAGGTTAAGT GTATTTTAG3' P17: (SEQIDNO:23) 5'CTAAAATACACTTAACCTCGGGTTACGTTCTTGTAATCCT CCAAAATTG3' P18: (SEQIDNO:24) 5'CGGAATTCTTTCGGGCGGCAATATAG3'(EcoRI)

(25) A template of Corynebacterium glutamicum ATCC13032, primers of P13/P14 and P17/P18 were used for PCR amplification, and 700 bp of the upstream homology arm fragment and 650 bp of the downstream homology arm fragment were obtained. Then primers P15/P16 were used to amplify a 450 bp of EP5 fragment using T-EP5 as a template. Subsequently, the template of a mixture of above three amplified fragments, and the primers of P13/P18 were used to amplify the whole homology arm fragment with both ends of which containing Xba I and EcoR I restriction sites respectively. After the PCR reaction, the amplified products were recovered by electrophoresis, and the needed 1800 bp of DNA fragment was recovered by a column DNA gel recovery kit, digested by restriction enzyme, and ligated with the shuttle plasmid pk18mobsacB plasmid to obtain an integrated plasmid. The plasmid contains a kanamycin resistance marker, so a recombinant whose plasmid has been integrated into the genome can be obtained by kanamycin screening.

(26) The integrated plasmid was electrotransformed into the lysine producing strain YPL-1-003 (the existence of promoter of the wild type ddh gene on the chromosome of the strain was confirmed by sequencing). Single colonies obtained by culturing were identified by PCR using the P15/P18 primers. The strain with a bahnd of 1100 bp amplified by PCR is positive strain, and the strain without that band amplified is the original bacterium. Positive strain was cultured on kanamycin-containing medium and kanamycin-free medium. The strain grown on kanamycin-free medium but not kanamycin-containing medium was further identified by PCR using the P15/P18 primers, and the strain with a band of 1100 bp amplified is a strain whose EP5 has been integrated in front of the initiation codon of the ddh gene, which was named YPL-1-004.

(27) Embodiment 6 EP5 Promoter Regulates the Expression of lysC Gene

(28) Based on the sequence of EP5 mentioned-above and the genome sequence of Corynebacterium glutamicum ATCC13032 published on NCBI, primers were designed for inserting the EP5 fragment in front of the initiation codon GTG of the lysC gene, so that EP5 can promote the expression of lysC gene. The specific design of primers is as follows:

(29) TABLE-US-00007 P19: (SEQIDNO:25) 5'CGGAATTCCCGCAAGCAGCCACATTC3'(EcoRI) P20: (SEQIDNO:26) 5'CTAAAATACACTTAACCTCGGGTTACCTTTGTGCACCTTT CGATCTAC3' P21: (SEQIDNO:27) 5'GTAGATCGAAAGGTGCACAAAGGTAACCCGAGGTTAAGTG TATTTTAG3' P22: (SEQIDNO:28) 5'CATATTTCTGTACGACCAGGGCCAGAGAGGCGAAGGCTCC TTGAATAG3' P23: (SEQIDNO:29) 5'CTATTCAAGGAGCCTTCGCCTCTCTGGCCCTGGTCGTACA GAAATATG3' P24: (SEQIDNO:30) 5'CCCAAGCTTGTGGTGCCGTCTTCTACAG3'(HindIII)

(30) A template of Corynebacterium glutamicum ATCC13032, and primers of P19/P20 and P23/P24 were used for PCR amplification, and 740 bp of the upstream homology arm fragment and 940 bp of the downstream homology arm fragment were obtained. Then the primers P21/P22 were used to amplify 450 bp of the EP5 fragment using T-EP5 as template. Subsequently, the template of a mixture of above three amplified fragments, and the primers of P19/P24 were used to amplify the whole homology arm fragment with both ends of which containing Hind III and EcoR I restriction sites respectively. After the PCR reaction, the amplified products were recovered by electrophoresis, and the needed 2140 bp of DNA fragment was recovered by a column DNA gel recovery kit, digested by restriction enzyme, and ligated with the shuttle plasmid pk18mobsacB plasmid to obtain an integrated plasmid. The plasmid contains a kanamycin resistance marker, so a recombinant whose plasmid has been integrated into the genome can be selected by kanamycin screening.

(31) The integrated plasmid was electrotransformed into YPL-1-004 (the existence of promoter of the wild type lysC gene on the chromosome of the strain has been confirmed by sequencing). Single colonies produced by culturing were identified by PCR using the P21/P24 primers. The strain with a band of 1400 bp amplified by PCR is positive strains, and the strain without amplified band is the original bacterium. Positive strain was cultured on kanamycin-containing medium and kanamycin-free medium. The strain grown on kanamycin-free medium but not kanamycin-containing medium was further identified by PCR using the P21/P24 primers, and the strain with a band of 1400 bp is a strain whose EP5 has been integrated in front of the initiation codon of the lysC gene, which was named YPL-1-005.

(32) Embodiment 7 EP5 Promoter Regulates the Expression of lysA Gene

(33) Based on the sequence of EP5 mentioned-above and the genome sequence of Corynebacterium glutamicum ATCC13032 published on NCBI, primers were designed for inserting the EP5 fragment in front of the initiation codon ATG of the lysA gene, so that EP5 can promote the expression of lysA gene. The specific design of primers is as follows:

(34) TABLE-US-00008 P25: (SEQIDNO:31) 5'CGGAATTCCGAGGTAGGTTCCGTAGG3'(EcoRI) P26: (SEQIDNO:32) 5'CTAAAATACACTTAACCTCGGGTTACGGGGAGAAATTCTA GCCGAGG3' P27: (SEQIDNO:33) 5'CCTCGGCTAGAATTTCTCCCCGTAACCCGAGGTTAAGTGT ATTTTAG3' P28: (SEQIDNO:34) 5'GTTGCGAGATCAGCTGGTGTCATAGAGGCGAAGGCTCCTT GAATAG3' P29: (SEQIDNO:35) 5'CTATTCAAGGAGCCTTCGCCTCTATGACACCAGCTGATCT CGCAAC3' P30: (SEQIDNO:36) 5'CCCAAGCTTGCCCTCGTTTTCGTACAG3'(HindIII)

(35) A template of Corynebacterium glutamicum ATCC13032, primers of P25/P26 and P29/P30 were used for PCR amplification, and 750 bp of the upstream homology arm fragment and 850 bp of the downstream homology arm fragment were obtained. Then the primers P27/P28 were used to amplify a 450 bp of EP5 fragment using T-EP5 as the template. Subsequently, the template of a mixture of above three amplified fragments, and the primers of P25/P30 were used to amplify the whole homology arm fragment with both ends of which containing Hind III and EcoR I restriction sites respectively. After the PCR reaction, the amplified products were recovered by electrophoresis, and the needed 2050 bp of DNA fragment was recovered by a column DNA gel recovery kit, digested by restriction enzyme, and ligated with the shuttle plasmid pk18mobsacB plasmid to obtain an integrated plasmid. The plasmid contains a kanamycin resistance marker, so a recombinants whose plasmids has been integrated into the genome can be obtained by kanamycin screening.

(36) The integrated plasmid was electrotransformed into YPL-1-005 (the existence of promoter of the wild type lysA gene on the chromosome of the strains has been confirmed by sequencing). Single colonies obtained by culturing were identified by PCR using the P27/P30 primers. The strain with a band of 1300 bp amplified by PCR is positive strain, and the strain without this band amplified is the original bacteria. Positive strain was cultured on kanamycin-containing medium and kanamycin-free medium. The strain grown on kanamycin-free medium but not kanamycin-containing medium was further identified by PCR using the P27/P30 primers, and a strain with a band of 1300 bp amplified is the strain whose EP5 has been integrated into the front end of the initiation codon of the lysA gene, which was named YPL-1-006.

(37) Embodiment 8 EP5 Promoter Regulates the Expression of gnd Gene

(38) Based on the sequence of EP5 mentioned-above and the genomic sequence of Corynebacterium glutamicum ATCC13032 published on NCBI, primers were designed for inserting the EP5 fragment in front of the initiation codon ATG of the gnd gene, so that EP5 can promote the expression of gnd gene. The specific design of primers is as follows:

(39) TABLE-US-00009 P31: (SEQIDNO:37) 5'CCCAAGCTTTCGCCTGCGTTCCATTCC3'(HindIII) P32: (SEQIDNO:38) 5'CTATTCAAGGAGCCTTCGCCTCTATGCCGTCAAGTACGAT CAATAAC3' P33: (SEQIDNO:39) 5'GTTATTGATCGTACTTGACGGCATAGAGGCGAAGGCTCCT TGAATAG3' P34: (SEQIDNO:40) 5'CGATTTTGCTGACACCGGGCTGTAACCCGAGGTTAAGTGT ATTTTAG3' P35: (SEQIDNO:41) 5'CTAAAATACACTTAACCTCGGGTTACAGCCCGGTGTCAGC AAAATCG3' P36: (SEQIDNO:42) 5'CGGAATTCTGCGCTGGGTTGTTATCTG3'(EcoRI)

(40) A template of Corynebacterium glutamicum ATCC13032, and primers of P31/P32 and P35/P36 were used for PCR amplification, and 720 bp of the upstream homology arm fragment and 700 bp of the downstream homology arm fragment were obtained. Then the primers P33/P34 were used to amplify a 450 bp of EP5 fragment using T-EP5 as a template. Subsequently, the template of a mixture of above three amplified fragments, and the primers of P31/P36 were used while the mixture of the above three amplified fragments was the template to amplify the whole homology arm fragment with both ends of which containing Hind III and EcoR I restriction sites respectively. After the PCR reaction, the amplified products were recovered by electrophoresis, and the needed 1870 bp of DNA fragment was recovered by a column DNA gel recovery kit, digested by restriction enzyme, and ligated with the shuttle plasmid pk18mobsacB plasmid to obtain an integrated plasmid. The plasmid contains a kanamycin resistance marker, so a recombinant whose plasmid has been integrated into the genome can be obtained by kanamycin screening.

(41) The integrated plasmid was electrotransformed into YPL-1-006 (the existence of promoter of the wild type gnd gene on the chromosome of the strain has been confirmed by sequencing). Single colonies obtained by culturing were identified by PCR using the P33/P36 primers. The strain with a band of 1150 bp amplified by PCR is a positive strain, and the strain without amplified band is the original bacteria. Positive strain was cultured on kanamycin-containing medium and kanamycin-free medium. The strain grown on kanamycin-free medium but not kanamycin-containing medium was further identified by PCR using the P33/P36 primers, and a strain with a band of 1150 bp amplified is the strain whose EP5 has been integrated into the front end of the initiation codon of the gnd gene, which was named YPL-1-007.

(42) Embodiment 9 Lysine Fermentation Experiment

(43) The strains constructed in Embodiments 1-3 and 5-8 and the original strains were used for fermentation experiment in a type of BLBIO-5GC-4-H fermentation tank (purchased from Shanghai Bailun Biotechnology Co., Ltd.) with the medium shown in Table 1 and the process shown in Table 2. Each strain was repeated three times (wherein YPL-1-003 was tested 6 times), and the results are shown in Table 3.

(44) TABLE-US-00010 TABLE 1 Formula of fermentation medium Product Name Ratio Sugar hydrolyzed from starch 30 g/L Ammonium sulfate 12 g/L Magnesium sulfate 0.87 g/L Molasses 20 g/L Acidified corn syrup 3 ml/L Phosphate 0.4 ml/L Potassium chloride 0.53 g/L Defoamer (2% Defoamer Polyether) 4 ml/L Ferrous sulfate 120 mg/L Manganese sulfate 120 mg/L Nicotinamide 42 mg/L Calcium pantothenate 6.3 mg/L VB1 6.3 mg/L Copper and zinc salt solution 0.6 g/L Biotin 0.88 mg/L

(45) TABLE-US-00011 TABLE 2 Fermentation process Correction Temperature 37 C., air volume 4 L/min, rotating speed 1000 rpm, tank DO100% pressure 0 mpa, calibration after 5 minutes Inoculation 300 ml Culture temperature C. 37 C. volume pH pH 6.9 0.05 Dissolved oxygen DO 10-30% Initial Temperature 37 C., PH 6.9, tank pressure 0 mpa, air volume 3 L/min, condition rotating speed 550 rpm Full process 1. when dissolved oxygen < 30%, increase the rotating speed to control 750 rpm.fwdarw.800 rpm.fwdarw.air volume to 4 L/min.fwdarw.850 rpm.fwdarw.950 rpm in turn; 2. after fermentation for 6 h, increase the tank pressure to 0.01 Mpa; after fermentation for 12 h, increase the tank pressure to 0.02 Mpa.fwdarw.0.03 Mpa.fwdarw.0.04 Mpa.fwdarw.0.05 Mpa. Residual sugar 0.1-0.2% before F12 h; residual sugar was controlled to 0.1-0.05% control combined with DO needs after F12 h. Ammonia & Before F12 h: 0.1-0.15; F12-F32 h: 0.15-0.25; after F32 h: 0.1-0.15 nitrogen control Fed batch 25% ammonium hydroxide, 70% concentrated sugar, 50% ammonium sulfate, 10% Defoamer Poly ether Turnaround About 48 h

(46) TABLE-US-00012 TABLE 3 Results of lysine fermentation experiment (lysine content g/dl) Control Batch YP97136 YPL-1-001 YPL-1-002 YPL-1-003 YPL-1-004 YPL-1-005 YPL-1-006 YPL-1-007 1 18.8 20.0 20.5 21.8 2 18.6 20.1 20.6 22.2 3 18.8 20.2 20.8 22.1 4 22.0 23.5 24.1 24.9 25.7 5 22.2 23.4 24.0 24.8 25.6 6 22.1 23.4 24.1 24.9 25.8 Mean 18.8 20.1 20.6 22.1 23.4 24.1 24.9 25.7 Value

(47) The results are shown in Table 3. Down-regulation of the expression of NCgl1751 and/or NCgl0097 genes in Corynebacterium contributes to the increase in yield of L-lysine. Among them, the synchronously down-regulation of the expression of both NCgl1751 and NCgl0097 genes achieved the greatest improvement of L-lysine production. The insertion of the EP5 promoter in front of the Corynebacterium genes whose increase of expression is beneficial to the yield of L-lysine can regulate the expression of these genes, leading to an increase of the yield of L-lysine production. Moreover, the more EP5 promoters integrated in front of these genes, the more yield of L-lysine increase, indicating the existence of duplicate effect.

(48) While only specific embodiments of the present invention have been described above, those of skill in the art should understood that these are merely provided by way of illustration, and many variations or modifications can be made to these embodiments without departing from the principle and spirit of the invention. Accordingly, the scope of the invention is defined by the appended claims.