Recombinant virus capable of stably expressing target proteins

11904010 ยท 2024-02-20

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a method to generate a recombinant virus that can stably express target proteins. The recombinant virus of the present invention is useful for producing an immunogenic composition or vaccine.

Claims

1. A recombinant virus comprising an expression cassette in the genome of the recombinant virus, wherein the expression cassette comprises a first polynucleotide encoding at least one polypeptide of interest, and a second polynucleotide which is an essential gene of the recombinant virus or a functional fragment thereof, and wherein the first polynucleotide is functionally linked to the second polynucleotide with the first polynucleotide being located upstream of the second polynucleotide, and wherein said second polynucleotide is the only copy of said essential gene or functional fragment thereof that is active in the recombinant virus, and wherein the first polynucleotide and the second polynucleotide are within the same open reading frame (ORF).

2. The recombinant virus of claim 1, wherein the second polynucleotide is an endogenous essential gene of the recombinant virus; or wherein the second polynucleotide is exogenous, and the endogenous essential gene of the recombinant virus has been silenced.

3. The recombinant virus of claim 1, wherein the first polynucleotide encodes an antigenic polypeptide or a therapeutic polypeptide.

4. The recombinant virus of claim 3, wherein the antigenic polypeptide is selected from the group consisting of an FMDV antigen, a PRRSV antigen, a DEV antigen, and a PRV antigen.

5. The recombinant virus of claim 4, wherein the first polynucleotide comprises the P1 gene, 2A gene and 3C gene of FMDV.

6. The recombinant virus of claim 4, wherein the antigenic polypeptide is an FMDV antigen.

7. The recombinant virus of claim 1, wherein the recombinant virus is derived from herpesviridae.

8. The recombinant virus of claim 7, wherein the virus derived from herpesviridae is EHV-1.

9. The recombinant virus of claim 1, wherein the recombinant virus is derived from EHV-1, and the first polynucleotide comprises the P1 gene, 2A gene and 3C gene of FMDV.

10. The recombinant virus of claim 1, wherein the essential gene encodes a protein selected from the group consisting of a capsid protein, a DNA replication related protein, a DNA helicase, a DNA replicase, a receptor binding protein, and an Egress-related protein.

11. The recombinant virus of claim 1, wherein the first polynucleotide is linked to the second polynucleotide via a linker; or wherein the first polynucleotide is directly linked to the second polynucleotide.

12. The recombinant virus of claim 11, wherein the linker can be a flexible linker or a 2A gene.

13. The recombinant virus of claim 12, wherein the linker is a 2A gene.

14. The recombinant virus of claim 1, wherein the expression cassette further comprises regulatory elements.

15. The recombinant virus of claim 14, wherein the regulatory element is a promoter.

16. The recombinant virus of claim 15, wherein the promoter is a CMV5 promoter.

17. A recombinant virus comprising an expression cassette in the genome of the recombinant virus, wherein the expression cassette comprises a first polynucleotide encoding at least one polypeptide of interest, and a second polynucleotide which is an essential gene of the recombinant virus or a functional fragment thereof; wherein the first polynucleotide is functionally linked to the second polynucleotide with the first polynucleotide being located upstream of the second polynucleotide; wherein said second polynucleotide is the only copy of said essential gene or functional fragment there that is active in the recombinant virus; wherein the first polynucleotide and the second polynucleotide are within the same ORF; and wherein the recombinant virus is derived from EHV-1, the first polynucleotide comprises the P1 gene, 2A gene and 3C gene of FMDV, and the essential gene is EHV-1 ORF43 gene or EHV-1 ORF54 gene.

18. A recombinant virus, comprising an expression cassette in the genome of the recombinant virus, wherein the expression cassette comprises a first polynucleotide encoding at least one polypeptide of interest, and a second polynucleotide which is an essential gene of the recombinant virus or a functional fragment thereof; wherein the first polynucleotide is functionally linked to the second polynucleotide with the first polynucleotide being located upstream of the second polynucleotide; wherein said second polynucleotide is the only copy of said essential gene or functional fragment there that is active in the recombinant virus; wherein the first polynucleotide and the second polynucleotide are within the same ORF; wherein the expression cassette further comprises regulatory elements; and wherein the expression cassette comprises a P1-2A-3C-2A-ORF43 construct or a P1-2A-3C-2A-ORF54 construct.

19. A recombinant virus, comprising an expression cassette in the genome of the recombinant virus, wherein the expression cassette comprises a first polynucleotide encoding at least one polypeptide of interest, and a second polynucleotide which is an essential gene of the recombinant virus or a functional fragment thereof; wherein the first polynucleotide is functionally linked to the second polynucleotide with the first polynucleotide being located upstream of the second polynucleotide; wherein said second polynucleotide is the only copy of said essential gene or functional fragment there that is active in the recombinant virus; wherein the first polynucleotide and the second polynucleotide are within the same ORE; and wherein the expression cassette comprises a CMV-P1-2A-3C-2A-ORF43-BGH construct as shown in SEQ ID NO.: 8, or a CMV-P1-2A-3C-2A-ORF54-BGH construct as shown in SEQ ID NO.: 9.

20. A method for preparing a recombinant virus of claim 1, comprising constructing an expression cassette in the genome of the recombinant virus, wherein the expression cassette comprises a first polynucleotide encoding at least one polypeptide of interest, and a second polynucleotide which is an essential gene of the recombinant virus or a functional fragment thereof, and wherein the first polynucleotide is functionally linked to the second polynucleotide with the first polynucleotide being located upstream of the second polynucleotide, and wherein said second polynucleotide is the only copy of said essential gene or functional fragment thereof that is active in the recombinant virus.

21. An immunogenic, pharmaceutical, or vaccine composition, comprising: a. the recombinant virus of claim 1, and/or b. the polypeptide of interest expressed by the recombinant virus of claim 1, and c. optionally a pharmaceutical- or veterinary-acceptable carrier or excipient.

22. A method of immunizing, treating or preventing an animal, against a disease caused by a pathogen in said animal, said method comprising the step of administering to the animal the recombinant virus of claim 1 or the immunogenic, pharmaceutical or vaccine composition of claim 21.

23. The immunogenic, pharmaceutical, or vaccine composition of claim 21, wherein the carrier is suitable for oral, intradermal, intramuscular, or intranasal application.

24. The method of claim 22, wherein the animal is a food producing animal.

25. The method of claim 24, wherein the food producing animal is swine or cattle.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

(2) FIG. 1. Illustration of essential gene translocation concept. A: an essential gene was deleted and translocated with target gene; and B: the target gene can also be inserted at the upstream of the essential gene at its original location.

(3) FIG. 2. The design of FMDV P12A3C cassette.

(4) FIG. 3. The construction procedure of the transfer plasmid was illustrated. The target gene P12A3C was synthesized and cloned into vector pUC19-CMV5-ORF1/3-linker, resulting in pUC19-CMV5-P12A3C. EHV-1 essential gene ORF43 or ORF54 was also synthesized and cloned into pUC19-CMV5-P12A3C, resulting in the final transfer plasmid, which was used to generate recombinant EHV-1.

(5) FIG. 4. Gel electrophoresis result of CMV5-P12A3C2AORF43-BGH. Digestion of transfer plasmid with restriction enzyme I-CeuI. After digestion, a target fragment around 7 kb was released and used for recombination.

(6) FIG. 5. The gene ORF43 or ORF54 was deleted from EHV-1 vector and the deletion mutant virus was unable to replicate in vitro. As a control, EHV-1 wild type could be easily rescued and propagated well 2 days after transfection. Since the rescued virus contains EGFP gene, the plaques show green fluorescence.

(7) FIG. 6. Gene structure of the recombinant EHV-1 with ORF43 gene translocation. ORF43 gene was deleted from its original position and translocated to the downstream of FMDV P12A3C gene.

(8) FIG. 7. Confirmation of FMDV protein expression and EHV-1 ORF71 restoration by IFA. The recombinant viruses with EHV-1 ORF43 or ORF54 translocation could be rescued after transfection. The expression of FMDV target protein was confirmed by IFA. EHV-1 gp2 was stained to show to the presence of EHV-1 plaques.

(9) FIG. 8. A series of recombinant EHV-1 were constructed with regular design, but cannot express target protein stably. (A) negative EHV-1 plaques were found by dual IFA; (B) sequencing of the negative plaques showed random genetic changes, including single nucleotide acid deletion, resulting in an out of frame mutation of the downstream genes.

(10) FIG. 9. Illustration of a representative dual IFA result, showing the plaques that can express both target FMDV protein and EHV-1 proteins.

(11) FIG. 10. Detection of FMDV VLP from different passage levels of the recombinant viruses.

(12) FIG. 11. A: Illustration of the target gene expression cassette and the primer location; B: PCR results from different passage levels of the recombinant viruses.

(13) FIG. 12. In vitro single step growth kinetics of recombinant EHV-1 compared with parental EHV-1.

EXAMPLES

(14) The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

(15) In the study, unless any exception is noted, all materials are commercially available and were purchased from QIAGEN, Promega, Thermo Fisher and BIO-RAD.

Example 1: Construction of the Recombinant EHV-1 of the Invention which can Stably Express FMDV Antigens

(16) 1.1 Construction of FMDV P1-2A-3C Gene Expression Cassette

(17) To express FMDV VLP, a gene expression cassette P1-2A-3C, derived from FMDV serotype 0 strain (GenBank ID: JN998085), was designed. In this study, FMDV P1-2A-3C gene expression cassette was chemically synthesized by Genscript based on the nucleotide sequences of P1 gene (SEQ ID NO: 1), 2A gene (SEQ ID NO: 2) and 3C gene (SEQ ID NO: 3). The nucleotide sequence of the synthetic P1-2A-3C gene expression cassette used in the study is shown by SEQ ID NO: 4. The design of P1-2A-3C cassette was illustrated in FIG. 2.

(18) 1.2 Construction of Transfer Plasmids

(19) A transfer vector pUC19-CMV5-ORF1/3-linker (Genscript), which contains homologous flanking regions for the two-step Red-mediated recombination, the kanamycin resistant gene as well as promoter and BGH poly A signal, was used in the study.

(20) To generate transfer plasmids, P1-2A-3C gene (SEQ ID NO: 4) was inserted into the transfer vector at site of ORF1/3. Then, ORF43 gene (SEQ ID NO:5) and ORF54 gene (SEQ ID NO:6) were chemically synthesized and cloned into the downstream of P1-2A-3C gene (SEQ ID NO: 4), resulting in transfer plasmids pUC19-CMV5-P12A3C2AORF43 and pUC19-CMV5-P12A3C2AORF54, respectively. The construction procedure of the transfer plasmid pUC19-CMV5-P12A3C2AORF43 was illustrated in FIG. 3.

(21) The transfer plasmids were digested by restriction enzyme I-CeuI (NEB), two fragments around 7 kb containing CMV5-P12A3C2AORF43-BGH (SEQ ID NO. 8) and CMV5-P12A3C2AORF54-BGH (SEQ ID NO. 9) were released respectively, which then were gel purified (Invitrogen) and confirmed via gel electrophoresis. The released fragments were used for further recombination. The gel electrophoresis result of CMV5-P12A3C2AORF43-BGH was illustrated in FIG. 4.

(22) 1.3 Construction of EHV-1 Viral Vector

(23) EHV-1 vaccine strain RacH (Patel, J R and Heldens, J, 2005) was used as the viral vector to express serotype 0 FMDV gene P12A3C in this study. RacH strain has lost its virulence in the natural host, namely horse, and has since been used as a modified live vaccine (MLV) in both Europe and the USA (Patel, J R and Heldens, J, 2005). RacH viral genome was constructed as bacterial artificial chromosome (BAC) by replacing the most part of ORF71 gene (encoding for gp2) with mini-F replicon sequence, and the Bacmid was designated as pRacH (Rudolph and Osterrieder, 2002, Virology 293, 2002, 356-367; U.S. Pat. No. 7,482,441B2).

(24) In this study, the essential genes ORF43 gene and ORF54 gene were deleted from pRacH respectively, and the pRacH with deleted ORF43 gene (shown as EHV-1-delORF43 P1 in FIG. 5) and the pRacH with deleted ORF54 gene (shown as EHV-1-delORF54 P1 in FIG. 5) were identified by restriction fragment length polymorphism (RFLP) analysis.

(25) By transfecting the EHV-1-delORF43 P1 and EHV-1-delORF54 P1 into MDBK cells, it was confirmed that the deletion mutants were unable to replicate in cell culture. The results were shown below in FIG. 5.

(26) 1.4 Construction of the Recombinant EHV-1 of the Invention

(27) The recombinant EHV-1 of the invention was constructed via a two-step Red-mediated recombination strategy (Tischer B K et al, BioTechniques 2006 (40), 191-197). Particularly, the transfer plasmids obtained in the step 1.2 were digested to release the fragments of CMV5-P12A3C2AORF43-BGH (SEQ ID NO. 8) and CMV5-P12A3C2AORF54-BGH (SEQ ID NO. 9) respectively. The two released fragments were electroporated into E. coli competent cells containing EHV-1-delORF43 P1 and EHV-1-delORF54 P1, respectively. The gene structure of the recombinant virus was illustrated in FIG. 6. Recombinant clones were then selected on chloramphenicol and kanamycin double resistant LB agar plates. The recombinant Bacmid DNA was extracted and analyzed by both PCR and RFLP methods. In the 2nd step of Red recombination, 1% arabinose was used to induce expression of the homing endonuclease I-SceI, resulting in the cleavage of the I-SceI restriction site upstream of the kanamycin gene and, ultimately, the excision of the kanamycin cassette.

(28) 1.5 Virus Rescue and Purification

(29) To rescue the recombinant EHV-1, the recombinant Bacmid DNA was extracted and transfected into MDBK cells (Sigma) in a 6-well plate using lipofectamine 3000 (Thermo Fisher). After transfection, cells were observed daily to check formation of both GFP-positive and -negative plaques. The transfected cells together with the culture supernatant were frozen and thawed twice, cleared by centrifugation and the recombinant virus, defined as passage 1, was stored at 80 C. for later analysis. Limiting dilution or plaque purification was performed to separate the GFP-negative recombinant virus, in which mini-F containing EGFP gene was removed and the missing ORF71 was restored via intra-molecular homologous recombination mechanism. Each round of the limiting dilution was recognized as one passage.

Example 2: Expression and Detection of the FMDV Protein

(30) 2.1 IFA, Sucrose Gradient Centrifugation and Western Blot

(31) To confirm the expression of FMDV proteins, indirect fluorescence assay (IFA) was performed using monoclonal antibody against FMDV VP1 (Jeno-Biotech, Cat #9172). MDBK cells were infected and overlaid with 1.5% Methyl Cellulose. Three days after infection, cells were washed with 1PBS, fixed with 4% Formaldehyde, permeated by 0.1% Trition X-100, and stained with the corresponding antibodies. The expression of FMDV protein was confirmed by IFA (FIG. 7).

(32) For western blot analysis, the infected cell pellets were lysed and mixed with 4LDS sample buffer (Invitrogen) and Nupage 10 reducing reagent (Invitrogen). After heating at 85 C. for the proteins were separated on the NuPAGE gels (Invitrogen) and transferred to PVDF membrane (Lifetech). After membrane blocking, the membrane was incubated with anti-FMDV VP1 mAb (1st antibody, Jeno-Biotech) for 1 h, and then with anti-mouse IgG-HRP (2nd antibody, Santa-Cruz) for 1 h after washing. The image was developed after applying the membrane with Supersignal West Femto Maximum Sensitivity substrate (Thermo Scientific).

(33) To confirm the formation of FMDV VLP, infected cell culture was pre-cleared by centrifugation and concentrated by ultrafiltration using Amicon Ultra-15 mL centrifuge filter (Merk, Ultracel-100 KDa), then applied to 10%-60% sucrose gradient ultracentrifugation at 53,720 g for 22h at 10 C. The sucrose gradient was separated to 14 fractions from up to down. The proteins in each fraction were analyzed by western blot using anti-FMDV VP1 mAb as described above.

Example 3: Study of Stability of the FMDV Protein Expression

(34) 3.1 FMDV P1-2A-3C Gene Cannot be Stably Expressed with Regular Design

(35) Different recombinant EHV-1 as controls (with different promoters and insertion sites) were constructed with a regular design of directly introducing FMDV P1-2A-3C gene into EHV-1 viral vector. The results of the genetic stability testing of different recombinant EHV-1 are summarized in the table below.

(36) TABLE-US-00001 TABLE 1 Summary of genetic stability testing of different recombinant EHV-1 P1-2A-3C Insertion Genetic cassette Promoter site Cell line stability SEQ ID NO: 4 CMV ORF1/3 MDBK unstable after P3 SEQ ID NO: 4 EHV-4 gG ORF1/3 MDBK unstable after P4 SEQ ID NO: 4 CMV ORF70 (gG) MDBK unstable after P5

(37) It can be seen that, by using regular design, FMDV P1-2A-3C gene cannot be stably maintained and tended to lose target protein expression during continuous passages, as shown by dual IFA (FIG. 8A). Sequencing analysis also showed that there were random deletions in the insert (FIG. 8B).

(38) 3.2 Essential Gene Translocation to Solve Genetic Stability Issue

(39) To evaluate whether FMDV protein could be stably expressed by the recombinant EHV-1 of the invention, the recombinant EHV-1 of the invention was continuously passaged on MDBK cells with MOI 0.01. After each passaging, fresh MDBK cell monolayers were infected with the recombinant virus with appropriate dilution and overlaid with 1.5% Methyl Cellulose. Three days post infection, dual IFA was performed using a mixture of anti-FMDV VP1 mAb and Caprine anti-EHV-1 pAb (VMRD). Individual plaques were examined under fluorescence microscopy. Plaques that are stained with both FMDV VP1 and EHV-1 antibodies were recognized as positive, while those only showing EHV-1 staining are negative. The positive plaque rate was calculated and compared between different passage levels. A representative dual IFA results was shown in FIG. 9.

(40) At every 5 passages (P5, P10, P15 and P20), viral DNA was extracted from infected cells and the complete insert was PCR amplified (forward primer: taacaccatggcaggcctgttg (SEQ ID NO:10), reverse primer: gagcgattcgcacctcatctcc (SEQ ID NO:11)) using high fidelity Accuprime pfx DNA polymerase (Invitrogen). The PCR product was then sequenced. In addition, the expression of VLP was detected using sucrose gradient centrifugation and western blot every 5 passages (Rational Engineering of Recombinant Picornavirus Capsids to Produce Safe, Protective Vaccine Antigen. PLOS Pathogens. 2013 March; 9(3):e1003255.). The results of FMDV VLP from different passage levels of the recombinant EHV-1 were shown in FIG. 10.

(41) The percentage of FMDV protein positive plaques out of total EHV-1 plaques was calculated and shown in Table 2. The results showed clearly that FMDV protein can be stably expressed during the passage at least till P20.

(42) TABLE-US-00002 TABLE 2 Percentage of FMDV protein positive plaques out of total EHV-1 plaques at each passage Passage Positive rate P5 355/355 (100%) P6 274/274 (100%) P7 155/155 (100%) P8 234/234 (100%) P9 85/85 (100%) P10 173/173 (100%) P11 108/108 (100%) P12 78/78 (100%) P13 175/175 (100%) P14 44/44 (100%) P15 109/109 (100%) P16 202/202 (100%) P17 120/120 (100%) P18 172/172 (100%) P19 295/295 (100%) P20 173/173 (100%)

(43) The viral DNA from each five passages was extracted from the recombinant EHV-1 and PCR was used to amplify the whole insert. The results showed that the whole insert can be amplified with no obvious difference of fragment length (FIG. 11), indicating that no genetic change occurred during continuous virus passage. The PCR product was also sequenced and revealed no genetic changes.

Example 4: In Vitro Growth Kinetics of the Recombinant Viruses

(44) To evaluate the in vitro growth property of the recombinant virus, MDBK cells in 24-well plates were infected by the parental virus and the recombinant virus with MOI of 5. After 2h attachment at 37 C., cells were washed with citrate buffer (pH 3.0). At different time points, culture supernatant was harvested and titrated.

(45) The single step growth kinetics of both recombinant viruses with ORF43 or ORF54 translocation was determined and compared with the parent virus. As can be seen in FIG. 12, the recombinant virus had similar growth kinetics with the parental virus and can reach peak titer at 36h post infection, however, the peak was about 1 log TCID50/mL lower than the parental virus, which was expected, since the expression of the foreign protein will affect the virus growth.

(46) It can be determined from the above experimental data: (1) with regular design, FMDV target protein could not be stably expressed; (2) EHV-1 ORF43 or ORF54 are essential genes for EHV-1 replication; and (3) rEHV-1/FMD constructs of the invention could express target protein with significantly improved stability, while maintaining comparable growth capability to parental EHV-1.

(47) All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as