Optimized host/vector system for producing protective mono- and multivalent subunit vaccines on the basis of the yeast <i>Kluyveromyces lactis</i>

11905517 ยท 2024-02-20

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to recombinant Kluyveromyces lactis (K. lactis) yeasts which are capable of the highly efficient expression of one or more foreign proteins and are suitable for use as a vaccine for generating a protective immune response against pathogens. The invention provides in particular K. lactis strains for the targeted cloning of foreign antigen-coding nucleic acids into the yeast genome of the K. lactis strain, which is characterized in that the K. lactis strain has integrated expression cassettes for foreign antigens as an alternative or in addition to the KILAC4 locus on the KIURA3-20 locus (KLLA0E22771g) and/or on the KIMET5-1 locus (KLLA0B03938g). The invention further relates to integrative expression vectors and to methods for producing the K. lactis strains of the invention as well as to the use thereof as vaccines.

Claims

1. A Kluyveromyces lactis (K. lactis) strain for targeted cloning of foreign antigen-encoding nucleic acids into the yeast genome of the K. lactis strain, characterized in that the K. lactis strain has integrated expression cassettes for foreign antigens at: i) the KlURA3-20 locus; ii) the KlMET5-1 locus; iii) the KlURA3-20 locus and the KlMET5-1 locus; iv) the KlURA3-20 locus and the KlLAC4 locus; v) the KlMET5-1 locus and the KlLAC4 locus; or vi) the KlURA3-20 locus, the KlMET5-1 locus, and the KlLAC4 locus.

2. The K. lactis strain as claimed in claim 1, characterized in that the expression cassettes contain the K. lactis LAC4-12 promoter or variants of said promoter, including the intergenic region between LAC12 and LAC4, the antigen-encoding region and the AgTEF1 terminator.

3. The K. lactis strain as claimed in claim 1, characterized in that multiple copies of a foreign antigen-encoding nucleic acid are inserted via tandem expression cassettes or multi-expression cassettes at the KlLAC4 locus or at the KlURA3-locus or at the KlMET5-1 locus of the resultant K. lactis strains.

4. The K. lactis strain as claimed in claim 1, characterized in that the gene of the foreign antigen IBDV VP2 is present in the form of a tandem expression cassette at the locus KlLAC4 of the K. lactis strain.

5. The K. lactis strain as claimed in claim 1, characterized in that one or more copies of different foreign antigen-encoding nucleic acids are inserted via single expression cassettes, tandem expression cassettes or multi-expression cassettes at the KlLAC4 locus and/or at the KlURA3-20 locus and/or at the KlMET5-1 locus.

6. The K. lactis strain as claimed in claim 1, characterized in that the encoding genes of the foreign antigens influenza A HA and influenza A M1 are inserted at the KlLAC4 and KlURA3-20 loci of the K. lactis strain and are expressed.

7. The K. lactis strain as claimed in claim 1, characterized in that the K. lactis strain contains, in addition to the genomic KIGAL4 gene, additionally a second ectopic copy of the KIGAL4 gene.

8. The K. lactis strain as claimed in claim 7, characterized in that the ectopic copy of the KIGAL4 gene, which is flanked by the KIGAL4 promoter and KIGAL4 terminator, is integrated in the K. lactis strain at the gene locus KLLA0E13795g (SEQ ID NO: 1).

9. The K. lactis strain as claimed in claim 1, the K. lactis strain having a modified promoter structure of the LAC4-12 promoter that allows reduced or no foreign protein expression under noninduced conditions, characterized in that the basal control region (BCR) of the promoter PLAC4-12-LR2 between ?1065 and ?1540 (SEQ ID NO: 2) is deleted.

10. The K. lactis strain as claimed in claim 9, characterized in that the gene of the foreign antigen influenza A HA is present at the locus KlLAC4 of the K. lactis strain.

11. The K. lactis strain as claimed in claim 1, the K. lactis strain having a modified promoter structure of the LAC4-12 promoter that allows modulation of foreign protein expression, characterized in that the number of binding sites for the activator KlGal4 of the promoter varies and 1, 2, 3 or 4 KlGal4-binding sites are present.

12. The K. lactis strain as claimed in claim 1, characterized in that the gene of the foreign antigen IBDV VP2 is inserted at the locus KlLAC4 of the K. lactis strain.

13. The K. lactis strain as claimed in claim 1, characterized in that the gene function of the alleles Kllac4, Klura3-20 and Klmet5-1 is restored and the K. lactis strain is prototrophic.

14. The K. lactis strain as claimed in claim 1, characterized in that the genes of the foreign antigens BVDV E2 ectodomain, BVDV E2 ectodomain, and BVDV Npro-NS3 are inserted at the loci KlLAC4, KlURA3-20 and KlMet5-1 of the K. lactis strain.

15. A K. lactis strain according to claim 1, wherein said K. lactis strain is selected from the group consisting of: VAK952 DSM 32705; VAK1111 DSM 32696; VAK1118 DSM 32701; VAK1131 DSM 32700; YAK 1171 DSM 32699; VAK1243 DSM 32702; VAK1283 DSM 32697; VAK1395 DSM 32706 and VAK1400 DSM 32698.

16. An integrative expression vector selected from the group consisting of KIpURA3, KIpMET5, KIpMET5-PL4-12-Et, KIpMET5-PL4-12-LR2-Et, KIpMET5-PL4-Et, KIpMET5-PL4-LR2-Et, KIpURA3-PL4-12-Et, KIpURA3-PL4-12-LR2-Et, KIpURA3-PL4-Et and KIpURA3-PL4-LR2-Et.

17. A pharmaceutical composition containing a K. lactis strain as claimed in claim 1.

Description

(1) The invention is more particularly elucidated below on the basis of the drawings and exemplary embodiments.

(2) FIG. 1 shows the characterization of a newly generated K. lactis background strain having two KIGAL4 copies. The presence of the second ectopic KIGAL4 copy at the identified integration site was checked and the effect of the integration on yeast growth was analyzed. A: Diagram of the integration site of the ectopic KIGAL4 copy. The integration site is indicated and the gene names are given. B: Agarose gel of PCR-amplified fragments, using the primers VK183 (5-GAGCCCACCACCTGCTCCTG-3) (SEQ ID No.: 9) and VK184 (5-CTGATGTATTGCGCTCCTTACTAAC-3) (SEQ ID No.: 10), of the KIAVT3 locus of a yeast strain with (VAK1110) and without (VAK367) an additionally integrated, ectopic KIGAL4 gene. The respectively expected fragment sizes are given on the right in the diagram. C: Drop test with serial tenfold dilutions (Start-OD 1) on glucose (YPD) or lactose (YPLac). The incubation was carried out at and 37? C. in each case. The growth of yeast strains having a KIGAL4 copy at the native gene locus (VAK1139), at the ectopic gene locus and deleted KIGAL4 at the native gene locus (VAK1110), having no KIGAL4 copy (?KIgal4; VAK964) or having two KIGAL4 copies (VAK1168) were compared. What is shown is that the defined integration of a further KIGAL4 gene only leads to marginal growth defects: said defects are only visible at 37? C. and under inducing conditions. What is clearer is the growth defect in the case of complete deletion of KIGAL4.

(3) FIG. 2 shows the western blot analysis with proteins of an IBDV-VP2-producing K. lactis strain having an additional, ectopic KIGAL4 copy. The effect of an additional KIGAL4 copy on the LAC4-12 promoter-dependent recombinant protein production was analyzed by Western blotting. The test strain used was a yeast strain having an IBDV-VP2 expression cassette, which yeast strain was compared with other IBDV-VP2 yeast strains. The presence (+) or absence (?) of an ectopic KIGAL4 copy and of a tandem IBDV-VP2 expression cassette (see below) are indicated above. In strain VAK911, the ectopic copy was introduced by linearization of the plasmid pLI-1 by means of BstEII (Krijger et al. 2012 and WO 2013107436), and in strain VAK1130, the ectopic KIGAL4 copy was at the KIAVT3 locus (see FIG. 1). Yeast strain VAK367 was included as wild-type control without a foreign gene. The yeast strains were cultivated in YPLac for 15 h after a preliminary culture in YPD. 20 ?g in each case of the protein extract were analyzed per yeast strain by means of SDS-PAGE. The immunoblotting was carried out using anti-IBDV rabbit serum (1:8000) and HRP-conjugated anti-rabbit antibody from goat (1:10 000). Multimeric (agg.) and monomeric (mon.) IBDV-VP2 are indicated on the right by arrows, nonspecific bands by asterisks. What is shown is that the ectopic expression of an additional KIGAL4 gene leads to a strong increase in foreign antigen concentration, as does the presence of a tandem expression cassette (see also below).

(4) FIG. 3 illustrates the effect of LR2 deletion in the LAC4-12 promoter on noninduced, recombinant protein production and on yeast growth on glucose. The unmodified LAC4-12 promoter also exhibits a basal expression of the GOI (gene of interest) under noninducing conditions. This is particularly problematic in the case of cytotoxically acting foreign antigens. What was tested with these experiments was whether a deletion in the BC region (LR2 deletion) of the LAC4-12 promoter can reduce or even completely suppress recombinant protein production under noninducing conditions. A: Diagram of a LAC4-12 promoter (P.sub.LAC4-12). The basal control region (BCR), the LR2 deletion and the four KIGal4-binding sites (upstream activating sequence: U1, U2, U4, U5) and also the encoding nucleic acid sequence of the foreign gene (GOI) are drawn in. B: Western blotting of IBDV-VP2 yeast strains, with (VAK1131) and without (VAK1130) LR2 deletion, after cultivation under noninducing conditions (YP 3% EtOH). VAK1111 was used as wild-type control without a foreign gene. For each yeast strain, 50 ?g of protein extract were loaded onto a 12% SDS gel. The immunoblotting was carried out using anti-IBDV rabbit serum (1:5000) and HRP-conjugated anti-rabbit antibody from goat (1:10 000). The loading control KlNop1 was detected using mouse anti-Nop1 antibody (1:5000) and HRP-conjugated anti-mouse antibody from goat (1:10 000). C: Drop test with serial tenfold dilutions (Start-OD 1) on YPD, YPD containing 0.5% glucose and YPLac. The incubation was carried out at 30? C. and 37? C. in each case. The growth of the yeast strains bearing an influenza A HA foreign gene at the LAC4 locus, with (VAK1243) and without (VAK952) LR2 deletion, was compared. The yeast strain VAK367 was used as wild-type controls without a foreign gene. What is shown is that the LR2 deletion prevents the unwanted, basal foreign protein expression. Furthermore, what is shown is that the LR2 deletion improves the growth of a yeast strain expressing a cytotoxic protein (influenza hemagglutinin, HA), both under noninducing conditions and under inducing conditions. This is particularly clear at 37? C.

(5) FIG. 4 shows the K/p vectors which can be used for integrating protein expression cassettes into different loci of the K. lactis genome. Whereas the use of the LAC4 locus (Klp3 vector system) has already been described (WO 20101054649 and WO 2013107436), the use of the KIURA3 and KIMET5 loci is new. A: Diagram of the different Klp vectors with their respective integration site in the genome. B & C: Expression cassettes and flanking ends in the KlpURA3 (B) and KlpMET5 (C) vectors that are newly described here. The different DNA sequence segments and relevant restriction sites are indicated. GOI: foreign gene (gene of interest). D: Western blotting analysis of foreign protein expression in yeast strains constructed with the aid of the Klp vectors (A, B & C). Here, the foreign gene is Etx.B-HA. The yeast house-keeping KINop1 protein (KLLA0C04389g) was detected as loading control. The yeast strains were cultivated in YPLac (+U) for 4 h after a preliminary culture in YPD (+U). For each yeast strain, 30 ?g of protein extract were loaded onto a 12% SDS-PAGE. The immunoblotting was carried out using monoclonal mouse anti-HA (1:5000) and anti-KINop1 (1:5000; Santa Cruz, TX, USA) antibodies and also HRP-conjugated anti-mouse antibody from goat (1:10 000; Jackson ImmunoResearch, PA, USA). What is shown is that, similarly to the LAC4 locus (WO 20101054649 and WO 2013107436), both KIURA3 and KIMET5 loci are usable for heterologous gene expression.

(6) FIG. 5 shows the production of different, recombinant proteins in the same yeast strain. Said yeast strain (VAK1234) was constructed using the KlpURA3 and Klp3-MCS vectors. Western blotting analysis with proteins of a tandem IBDV VP2-expressing yeast strain (see below) into which an additional expression cassette, with Etx.B-HA as foreign gene, was introduced with the aid of the KlpURA3 vector (VAK1234). The controls used were yeast strains bearing only the expression cassette with Etx.B-HA at the LAC4 (VAK899) or KIURA3 locus (VAK1235) or only the tandem IBDV-VP2 expression cassette at the LAC4 locus (VAK1171) in the genome. The yeast strains were cultivated in YPLac for 6 h after a preliminary culture in YPD. For each yeast strain, 30 ?g of protein extract were loaded onto a 12% SDS-PAGE. The detection of the proteins in the immunoblot was carried out using mouse anti-HA antibody (1:5000; Santa Cruz, TX, USA) and HRP-conjugated anti-mouse antibody from goat (1:10 000) for Etx.B-HA and using rabbit anti-IBDV antiserum (1:5000; Granzow et al. (1997)) and HRP-conjugated anti-rabbit antibody from goat (1:10 000; Jackson ImmunoResearch, PA, USA) for IBDV-VP2. What is shown is that both foreign proteins are expressed in the same yeast cell. Surprisingly, the expression level of one antigen is not limited upon coexpression of another antigen. This is clear in the comparison of the expression levels in monovalent and bivalent strains (see also FIG. 12).

(7) FIG. 6 shows the differently induced LAC4-12 promoter variants for expression cassettes in Klp vectors. The expression cassettes of the Klp vectors were provided with different variants of the LAC4-12 promoter. The effect of the promoter variants on the strength of induction of protein synthesis was tested on the basis of the analysis of yeast strains containing the corresponding expression cassettes with Etx.B-HA as foreign gene. A: Schematic representation of the promoter variant, the associated KlpURA3 vectors with Etx.B-HA as foreign gene and the yeast strains created therefrom. BCR: binding region of the transcription activators KICat8 and KISip4, transcription activators under noninducing conditions; U1, U2, U4, U5: binding regions for the transcription activator KIGal4 (upstream activating sequence). B: Western blotting analysis for characterizing the LAC4-12 promoter variants in the yeast strains created using the KIpURA3 vector (A). The yeast strains were cultivated in YPLac for 4 h after a preliminary culture in YPD. For each yeast strain, 30 lag of protein extract were loaded onto a 12% SDS-PAGE. The immunoblotting was carried out using monoclonal mouse anti-HA (1:5000) and anti-Nop1 (1:5000) antibody and also HRP-conjugated anti-mouse antibody from goat (1:10 000). What is shown is that the expression rate of the foreign gene varies depending on the nature of the promoter used.

(8) FIG. 7 shows the effect of doubling the number of foreign gene copies by means of a tandem expression cassette on recombinant protein production. The effect on recombinant protein production (IBDV-VP2) by increasing the number of foreign gene copies by means of a tandem expression cassette was tested. A: Schematic representation of the tandem expression cassette. DNA segments and relevant restriction sites are indicated. GOI: foreign gene (gene of interest). B: The tandem construct derived from (A) for random integration with the aid of an ScURA3 selection marker is depicted. C: Western blotting analysis for comparing IBDV-VP2 protein production in a yeast strain (VAK1118) having a tandem expression cassette (A) and a yeast strain (VAK910) having an expression cassette containing only one foreign gene copy. The yeast strains were cultivated in YPLac for 3 h or 6 h after a preliminary culture in YPD. For each yeast strain, 60 lag of protein extract were loaded onto a 12% SDS-PAGE. The immunoblotting was carried out using anti-IBDV rabbit serum (1:10 000) and HRP-conjugated anti-rabbit antibody from goat (1:10 000). Aggregated (agg.) and monomeric (mon.) IBDV-VP2 are indicated on the right by arrows, nonspecific bands by asterisks. D: Western analysis of yeast strains having a randomly integrated tandem IBDV-VP2 expression cassette (B) in comparison with a KIp3-MCS-generated yeast strain having one expression cassette (VAK910) and also the yeast strain derived therefrom having additional KIGAL4-1 copies (pLI-1). The yeast strains were cultivated in YPLac for 8 h after a preliminary culture in YPD. The immunoblotting was carried out as described under (b). What is shown is that the use of a tandem expression cassette significantly increases the foreign protein expression rate.

(9) FIG. 8 shows the gene fragments for restoring the gene function of the alleles Klura3-20 and Klmet5-1 (A). Schematically depicted are the gene loci and the gene fragments, amplified using the specified primers, for KIURA3 (A) and KIMET5 (B). The mutations of the alleles Klura3-20 (A) and Klmet5-1 (B) reconstituted with these gene fragments by homologous recombination are shown as stars below the genes. The restriction sites with which the subcloned fragments are cut out are drawn in. This diagram illustrates the strategy of generating prototrophic foreign gene-expressing yeast strains at the URA3 or METS locus.

(10) FIG. 9 illustrates, in combination with Table 1 and Table 2, the protective immunization of chickens against vvIBDV in a classic prime-boost vaccination scheme. In two experiments (A and B), groups of at least 16 SPF chickens were vaccinated subcutaneously according to a prime-boost method with lyophilized and heat-inactivated yeast cells of the genetically optimized tandem IBDV-VP2 K. lactis yeast strain VAK1127. The first vaccination took place two weeks after hatching (prime), and the second (boost) two weeks after that. Two weeks after the boost, a virus challenge with a vvIBDV strain (very virulent 89163/7.3) was effected. One subject group serving as infection control was subjected to a mock treatment in which only PBS or adjuvant was administered. In experiment 1 (A), the wild-type yeast (VAK367) was also administered as control. At least seven chickens per group served as control without virus challenge, and at least five in experiment 2 (B). Sera were obtained just before the first administration, before and after the challenge, and otherwise at ten-day intervals. The strength of seroconversion was determined by means of ELISA (ProFLOK IBD Plus, Synbiotics). The converted titers according to the kit information are shown. A: Experiment 2 was performed in the same way as experiment 1 (A). The mean value of the ELISA titers from 12 animals is shown with standard deviation. Both experiments show a strong development of titers of anti-IBDV VP2 antibodies in the case of the VAK1127-vaccinated animals. The associated tables summarize the results of the protection of the vaccinated animals against challenge with the vvIBDV: in both vaccination experiments, it was possible to achieve complete protection against the viral infection.

(11) FIG. 10 shows the effect of the genetic modifications for restoring prototrophy on the amount of recombinant protein production and immunogenicity of a tandem IBDV-VP2 yeast strain. The auxotrophic tandem IBDV-VP2 yeast strain VAK1127 and the prototrophic yeast strain VAK1171 derived therefrom were compared with regard to efficiency of recombinant protein production and immunogenicity. A: Western blotting analysis for ascertaining the IBDV-VP2 content in freshly harvested yeast material. The yeast strains were cultivated in YPLac for 8 h after a preliminary culture in YPD. 40 ?g of protein extract per yeast strain were loaded onto a 12% SDS-PAGE. The immunoblotting was carried out using anti-IBDV rabbit antiserum (1:10 000) and HRP-conjugated anti-rabbit antibodies from goat (1:10 000). Aggregated (agg.) and monomeric (mon.) IBDV-VP2 are indicated on the right by arrows, nonspecific bands by asterisks. B: Western blotting analysis for ascertaining the IBDV-VP2 content in lyophilized, heat-inactivated yeast material which was used afterwards in an immunization study in BALB/c mice (C). The yeast strains were cultivated in YPLac for 15 h after a preliminary preculture in YPD. For each yeast strain, 10 ?g of protein extract were loaded onto a 12% SDS-PAGE, otherwise the immunoblotting was carried out as (A) above and the bands are indicated correspondingly. C: Testing of the immunogenicity of the two yeast strains VAK1127 and VAK1171 in the immunization experiment in BALB/c mice. Groups of five mice each were vaccinated three times subcutaneously using 0.1 mg (dry weight) of the above-analyzed (B) yeast material. The control used was a wild-type strain (VAK367) without antigen. The first administration was carried out using CFA (complete Freund's adjuvant) as adjuvant, and the further two, at two-week intervals, using IFA (incomplete Freund's adjuvant) as adjuvant. One week after the third administration, the mice were euthanized and bled. The sera were analyzed by IBDV-VP2 ELISA (IDEXX). The absorption at 650 nm, correlating with the anti-IBDV-VP2 antibody titer, is shown with standard error. A monoclonal anti-IBDV-VP2 antibody (pos. mab64) was used as positive control for the ELISA, and either sample buffer (neg. 1) or a nonspecific antibody (neg. 2) was used as negative control. What is shown is that both strains exhibit a similar level of foreign protein expression and exhibit immunogenic potential.

(12) FIG. 11 shows, in combination with Table 3, the protective immunization of SPF chickens against vvIBDV by means of a single, subcutaneous administration with genetically optimized IBDV-VP2 vaccine yeast. Groups of at least 18 SPF chickens were vaccinated singly subcutaneously with 10 mg of heat-inactivated cells of the genetically optimized tandem IBDV-VP2 K. lactis yeast strain VAK1171 two weeks after hatching. The controls used were animals vaccinated with PBS or 10 mg of VAK367. They were vaccinated two times, two weeks and four weeks after hatching. All animals were challenged with vvIBDV six weeks after hatching. The sera were analyzed by ELISA (ProFLOK IBD Plus, Synbiotics) as described above. The antibody titers ascertained are shown. The individual points represent individual antibody titers of the twelve chickens analyzed per group, and the bar represents the mean value with standard deviation. In the case of the controls, only the antibody titer of the surviving chickens were ascertained after the challenge. What is shown is that just a one-shot vaccination with the yeast subunit vaccine VAK 1171 achieves complete protection against a subsequent exposure to vvIBDV.

(13) FIG. 12 shows the characterization of the strains VAK952 and VAK1283. (A) The yeast strains VAK952 (monovalent HA) and VAK1283 (bivalent HA, M1) were preincubated in a shake flask in YPD and subsequently induced in YPL for 6 h. The optical density at 600 nm was measured and 30 OD unit of the culture was harvested, the pellet was disrupted using glass beads, and the soluble protein fraction (LF) and the insoluble protein fraction (P, Pellet) were examined in an immunoblot. The primary antibody used was ?-HA1 or ?-M1 and the secondary antibody used was ?-mouse-IR-Dye800CW. The signal was generated via an infrared imaging system (LI-COR Biosciences). (B, C) The yeast strains were preincubated in a shake flask in YPD and subsequently induced in YPL over a period of 24 h. At the specified time points, the optical density of the yeast culture was determined and 30 OD units were harvested. (B) The pellets of VAK1283 were disrupted using glass beads and analyzed in an immunoblot. (C) The values measured for the optical density of VAK952 and VAK1283 were combined as a growth curve as a function of time and averaged from at least two independent experiments. (D) For the dot test, the yeast strains were cultivated on YPD-containing nutrient agar plates at 30? C. for 48 h. Starting with 1 OD unit, the yeasts were serially diluted and subsequently dripped onto YPD-containing or YPL-containing nutrient agar plates. The plates were cultivated at 30? C. for 48 h and subsequently photographed. Ponceau S: staining of total yeast protein of the respective fraction, loading control. What is shown is that VAK952 (monovalent HA) and VAK1283 (bivalent HA, M1) express the HA protein in comparable quantities. Furthermore, what is shown is that VAK1283 and VAK952 have comparable growth properties, with VAK1283 having slight advantages.

(14) FIG. 13 illustrates the antibody titer in the serum of BALB/c mice after immunization with VAK952 (monovalent HA) and VAK1283 (bivalent HA, M1) before and after exposure infection. Both yeast strains were preincubated in a shake flask with YPD and subsequently induced in YPL for 12 h (VAK952) or 6 h (VAK1283). Thereafter, the cultures were harvested, freeze-dried and the yeast material was inactivated at 90? C. for 2 h. For the immunization, 9-week old, female BALB/c mice were vaccinated subcutaneously twice (prime-boost) or once (one shot) with 2 mg of yeast (VAK952, VAK1283) or with 1 mg of VAK1283 or twice with PBS (without adjuvant), at an interval of three weeks. The adjuvant used was AddaVax. Three or six weeks after the last administration, the animals were infected intranasally with 5?MLD.sub.50 of the influenza A/PR/8/34 (H1N1) virus. The infection control used was mock-infected animals (Mock), to which only PBS without virus was administered intranasally. Three or six weeks after the last administration and during the exposure infection, the serum of the animals was obtained and tested for neutralizing antibodies (nAb) in a VNT. nAb titer.sub.50: serum dilution which reduces the number of plaques by 50% in comparison with the virus-free control. The log.sub.2 of the corresponding serum dilution is specified. Owing to the logarithmic plot, the value: log.sub.2(2)=1 was assigned to serum samples without detectable antibodies. mAb: test system control (?-H1 (H37-66)). What is shown is that both immunization schemes lead to a significant induction of neutralizing Ab. Furthermore, it is clear that the neutralizing anti-HA antibody titers obtained in the case of the primer-boost vaccination experiments and one-shot vaccination experiments do not significantly differ for VAK952 and VAK1283.

(15) FIG. 14 shows the exposure infection with influenza A/PR/8/34 (H1N1) after immunization with VAK952 (monovalent HA) and VAK1283 (bivalent HA, M1). Three or six weeks after the last administration (see FIG. 13 for the immunization scheme), the BALB/c mice were infected intranasally with 5?MLD.sub.50 of the influenza A/PR/8/34 (H1N1) virus. The infection control used was mock-infected animals (Mock), to which only PBS without virus was administered intranasally. Thereafter, the survival (A), the weight (B) and clinical symptoms (C) of the animals were examined multiple times every day over a period of 14 days. In the case of the clinical symptoms, a score of 0-4 was defined, which was averaged for each group (0: no anomalies; 1: slightly shaggy coat; 2: shaggy coat, reduced activity; 3: shaggy coat, 15% loss of body weight; 4: shaggy coat, >20% loss of body weight). What is shown is that the prime-boost immunization method with VAK952 does not provide optimal protection against a virus exposure, whereas this is the case for VAK1283. With both vaccines, the one-shot scheme generates optimal protection with 2 mg of administered vaccine. When 1 mg is administered, a similar protection rate is achieved with VAK1283 as with 2 mg of VAK952 in the prime-boost method.

EXEMPLARY EMBODIMENTS

Example 1: Generation of a Host Strain Having Two KIGAL4 Gene Copies, Stably Integrated, at Noncoupled Gene Loci

(16) A second KIGAL4 gene copy without a selection marker was inserted at a different gene locus (ectopically). It was possible to locate the insertion in the KIAVT3 gene (KLLA0E13795g) by sequencing (Klavt3::KIGAL4-1, SEQ ID No.: 1) (FIG. 1). The resultant strain is called VAK1111. The independent meiotic segregation of the two KIGAL4 copies, which are on chromosome E (ectopic copy) and D (genomic copy), was confirmed by a crossing experiment. Moreover, in the same experiment, the number of exactly two KIGAL4-1 gene copies in the genome was established.

(17) To use VAK1111 for the targeted integration of an expression cassette at the LAC4 locus in analogy to VAK367-D4, the lac4::ScURA3 disruption was introduced, which makes it possible in one step, under selection for lactose growth, to integrate the desired foreign gene between LAC4 promoter and LAC4 reading frame by means of Klp vector technology without a marker (Krijger et al. (2012)). The resultant strain VAK1123 only differs from VAK367-D4 by the second, ectopic KIGAL4 gene copy.

Example 1.1: Improved Productivity of a Yeast Vaccine Strain Having an Additionally Integrated KIGAL4 Gene

(18) In one exemplary embodiment, the IBDV-oVP2.sub.T2S (Arnold et al. (2012)) gene was inserted into the LAC4 locus of the strain VAK1123 (resultant strain VAK1130). It was possible to establish an increased production of IBDV-VP2 compared to the otherwise isogenic strain having only one KIGAL4 copy (VAK910). As comparison, strain VAK1118, which bears only one KIGAL4 gene, but two CDS VP2.sub.IBDV copies (see below), is additionally shown (FIG. 2).

Example 2: P.SUB.LAC4-12LR2 Promoter Having Reduced Basal Activity for Optimizing the Expression of Antigens Having a Cytopathic Effect

(19) Heterologous protein production in microorganisms is problematic when this leads to a cytopathic effect (CPE). Therefore, the task faced is to find a way to decouple the antigen production phase from the biomass accumulation phase. Owing to the inducible LAC4 promoter, this is partially possible by a fed-batch fermentation process, but is hampered because the promoter P.sub.LAC4-12 is not completely closed down under noninducing conditions. In the case of antigens having a very strong CPE, what occurs is a reduction in the growth rate and an induction of the cellular stress response, with disadvantageous effects on antigen production. This problem is aggravated by the doubling of the KIGAL4 gene dose and/or the increase in the number of antigen-encoding sequences (see below). The solution was to delete the basal control region (BCR) of the promoter P.sub.LAC4-12 (FIG. 3A) (Mehlgarten et al. (2015)) between ?1065 and ?1540 (LR2 deletion; P.sub.LAC4-12-LR2; SEQ ID No.: 2). Said deletion was introduced into the starting strains VAK367 (one KIGAL4 copy) and VAK1111 (two KIGAL4 copies) at the genomic LAC4 locus together with the lac4::ScURA3 disruption. The resultant strains VAK1109 and VAK1124 are suitable for the expression of antigens having CPE. The promoter P.sub.LAC4-12LR2WaS also inserted into the integrative vectors KlpURA3-Et and KIpMET5-Et (see below).

Example 2.1: Inhibition of the Basal (Noninduced) Expression of Antigen by a Modified Promoter

(20) After integration of a tandem IBDV-VP2 expression cassette into VAK1124 (resultant yeast strain: VAK1131; see below and FIG. 7 for an explanation of the term tandem expression cassette), it was possible to show that the LR2 deletion in the LAC4-12 promoter leads to a strong reduction in VP2 protein production under noninducing conditions (FIG. 3B). With strains expressing the influenza A antigen hemagglutinin (VAK952 without LR2 deletion in the promoter, VAK1243 with LR2 deletion in the promoter), it was possible to show that the cytopathic effect of the influenza A HA antigen is suppressed and growth under noninducing conditions is improved as a result of the LR2 deletion (FIG. 3C).

Example 3: Versatile Vector System for the Targeted Integration of Multiple Expression Cassettes into the K. lactis Genome

(21) As before for VAK367-D4 (Krijger et al. (2012), WO 20101054649), the yeast strain VAK367 forms the genetic background of all K. lactis strains described here. This strain background has a need for uracil and methionine (uracil-and-methionine auxotrophy) owing to mutations in two genes, KIURA3 (KLLA0E22771g) and KIMET5 (KLLA0B03938g), which are referred to as alleles Klura3-20 (absent base pair at position +345) and Klmet5-1 (G2555A; and A3682T); the alleles are thus nonfunctional gene variants.

(22) These mutated alleles were used in order to use further loci for targeted integration besides the integration site LAC4 already developed with the Klp3/Klp3-MCS (Krijger et al. (2012)) and to thereby generate multivalent vaccine strains (FIG. 4A). Selection is achieved by restoring the gene function of these mutated genes without additional insertion of a selection marker. To this end, new integration vectors were created. In said vectors, the expression cassettes (under the control of the LAC4-12 promoter or the variants thereof in each case) are flanked by gene segments which allow the upstream integration of the KIURA3 gene and downstream integration of the KIMET5 gene by homologous recombination and restore the wild-type sequences of these genes at the same time.

(23) Further loci can be analogously developed as integration sites by mutagenesis and selection for auxotrophy for alternative growth substances.

Example 3.1: Vectors KlpURA3 and KIpMET5 for the Targeted Integration of Expression Cassettes (Having an Inducible LAC4-12 Promoter) at the KIURA3 (KLLA0E22771g) and/or KIMET5 (KLLA0B03938g) Loci of K. lactis Strains Having the Klura3-20 and/or Klmet5-1 Allele

(24) The integrative expression vectors KlpURA3 (SEQ ID No.: 3) and KIpMET5 (SEQ ID No.: 4) were constructed by means of suitable gene fragments (KIMET5/KIURA3 targeting sequences) which allow a targeted restoration of the functionality of the Klura3-20 and Klmet5-1 alleles, respectively.

(25) The KIpMET5 expression vector contains the expression cassette consisting of the LAC4-12 promoter (P.sub.LAC4-12 or the variants thereof), the encoding nucleic acid sequence of the antigen to be expressed and the AgTEF1 terminator; it is flanked upstream by the genomic KIMET5 fragment having an introduced ScCYC1 terminator and downstream by the KIAIM18 promoter having a downstream KIAI M18 gene. The KlpURA3 expression vector contains the expression cassette consisting of the LAC4-12 promoter (P.sub.LAC4-12 or the variants thereof), the encoding nucleic acid sequence of the antigen to be expressed and the AgTEF1 terminator; it is flanked upstream by KLLAOE22749g having an associated promoter and downstream by the KIURA3 promoter having a downstream KIURA3 fragment (FIG. 4B, C).

(26) In each case, the antigen-encoding sequence is cloned between promoter and terminator via AscI and NotI restriction sites. By Eco91I or KpnI restriction of the resultant plasmid, the entire expression cassette is separated from the KlpURA3 vector backbone, and by HindIII or BoxI restriction of the resultant plasmid, the entire expression cassette is separated from the KIpMET5 vector backbone, and the restriction material is transformed into K. lactis host strains having a Klura3-30 and/or Klmet5-1 allele. The foreign gene-containing expression cassette integrated in this way into KIURA3-20 or KIMET5-1 thus exactly corresponds to that which is also integrable into LAC4 in VAK367-D4 with the Klp3-MCS vector (WO 20101054649). Checking for uracil-prototrophic and/or methionine-prototrophic transformants is carried out in a standard manner via colony PCR using the primers MAB6 and VK211 for KlpMET5 transformants, and the primers MAB6 and VK71 for KlpURA3 transformants. Integration of the expression cassette at the correct target site between KIURA3 or KIMET5 and the respectively adjacent gene yields products of 1652 bp in size for KIpMET5 transformants and of 1307 bp in size for KlpURA3 transformants. No indications were obtained that the functionality of the neighboring genes is impaired by the insertion.

(27) Primers:

(28) MAB6: 5-CCCAGATGCGAAGTTAAGTG-3 (SEQ ID No.: 11) VK71: 5-TACAACAGATCACGTGATCTTTTTGTAAG-3 (SEQ ID No.: 12) VK211: 5-GATTTCGTAACCCTATTGTTCATGAATG-3 (SEQ ID No.: 13)

Example 3.2: Expression of a Foreign Antigen after Integration of the Encoding Gene Cassette at the KIURA3 or KIMET5 Locus

(29) A foreign gene under the control of the P.sub.LAC4-12 promoter is induced approximately equally strongly by lactose after integration at the LAC4, KIURA3 and KIMET5 locus. The heat-labile, nontoxic, enterotoxin subunit B (Etx.B) from E. coli and an (HA).sub.3 epitope at the C-terminus (Etx.B-HA) was used as test protein for evaluating the vector system. The encoding sequence was cloned into the vectors KIpMET5, KlpURA3 and Klp3-MCS and integrated at the gene loci KIMET5 (VAK1251), KIURA3 (VAK1235) and LAC4 (VAK899) (FIG. 4D). As shown by western blotting, the concentration of the Etx.B-HA protein in all three strains is very similar (FIG. 4D). Therefore, it was not possible to establish any position effect, dependent on the integration site of the expression cassette in the genome, on the amount of recombinant protein production.

Example 3.3: Coexpression of Two Foreign Antigens in the Same Yeast Cell

(30) The possibility of producing different heterologous proteins under the control of the P.sub.LAC4-12 promoter in the same yeast strain via the new vector system was able to be shown by the construction of a yeast strain having an Etx.B-HA expression cassette at the KIURA3 locus and an expression cassette at the LAC4 locus having two VP2iBpv copies present as a tandem (VAK1234; FIG. 5; see below and FIG. 7 for an explanation of the tandem cassette). Compared to yeast strains in which only one of the expression cassettes was present in the genome in each case (VAK1235 or VAK1171), it was not possible to establish any reduction in the protein concentration of Etx.B-HA or VP2EDv in the case of VAK1234.

Example 4: LAC4 Promoter Variants for Modulating Recombinant Protein Synthesis Under Similar Induction Conditions

(31) The immunogenic effect of antigens is often based on the assembling of multiple proteins in a nonstoichiometric ratio. To make this possible in yeast-based vaccines, variants of the P.sub.LAC4-12LR2 promoter were generated (FIG. 6A) which can be differently induced by lactose or galactose. They are characterized by the number of binding sites for the activator KIGal4 (U1, U2, U4, U5; G?decke et al. (1991)) and the presence/absence of the basal control region BCR. In addition to the constructs shown in FIG. 3A, which were inserted into the KlpURA3 vector, it was possible to generate promoter variants having increased promoter strength by insertion of further binding sites. The result of this is synthetic, lactose-inducible promoters for expanding the vector system and it is possible to realize different protein production or gene expression rates under the same induction conditions.

Example 4.1: Expression of a Foreign Antigen Under the Control of Various LAC4 Promoter Variants

(32) Expression of Etx.B-HA under the control of four LAC4-12 promoter variants. What were tested were four LAC4 promoter variants differing in the number of binding sites for the transcription activator KIGal4 and the presence/absence of a control region for basal expression under noninducing conditions (basal control region, BCR; FIG. 6A; SEQ ID No.: 14). Using said promoter variants, the KlpURA3-Et vector variants KlpURA3-PL412-Et, KlpURA3-PL412LR2-Et, KlpURA3-PL4-Et and KlpURA3-PL4LR2 were generated and the Etx.B-HA protein was inserted as test GOI in each case. As described above, the insertion of alternative GOls is possible via the restriction sites AscI and NotI. The expression cassettes were integrated into the KIURA3 locus and the protein concentration of Etx.B-HA was quantified via western blotting (FIG. 6B). What is shown is that, under identical induction conditions (4 h in complete medium containing lactose), the longest promoter variant P.sub.LAC4-12, which comprises the entire intergenic region between the LAC4 and LAC12 gene and contains four KIGal4-binding sites (U1, U2, U4, U5) (G?decke et al. (1991)), leads to the highest protein concentration. If only the two U1 and U2 binding sites proximal to LAC4 are present (?1064 to ?10), the additional deletion of the BCR (?1540 to ?1065) also has a protein-reducing effect under inducing conditions.

Example 5: Raising of Antigen Production by Increasing the Copy Number of the Antigen-Encoding Gene

(33) The above-described vector system was therefore modified in order to rapidly and efficiently connect multiple gene copies in series and to introduce this expression cassette in one step at one of the three gene loci (FIG. 7A).

(34) To produce a tandem expression cassette integrable at the LAC4 locus, three PCR-amplified fragments are fused by any desired Klp3(-MCS)-GOI template in one step (in-fusion cloning): (1 and 2) expression cassette containing P.sub.LAC4-LR2 and T.sub.TEF (primers: VK30 & VK31, and VK32 & VK33) and (3) LAC4 targeting sequence (VK34 & VK35)). After restriction, for example using HpaI, the tandem expression cassette can be integrated into the lac4::URA3 locus as described (FIG. 7). After successful integration of the expression cassette, the first foreign gene copy is regulated by either P.sub.LAC4-12 or P.sub.LAC4-12-LR2 depending on the starting strain and the second is regulated by P.sub.LAC4-LR2. Alternatively, insertion of a selection marker between the two expression cassettes into the restriction sites SmiI, MluI or PmeI and removal of the LAC4 targeting sequence via KpnI give rise to a tandem cassette which can be integrated into the genome in an undirected manner via NHEJ. If the expression cassette is cut out using MreI and AvaI, the compatible ends can be ligated and long, multiple expression cassettes can thereby be generated. By repeated restriction using MreI and AvaI, fragments in which the expression cassettes are arranged in tandem (head to tail) are enriched in the ligation mix. They are transformed and integrated in an undirected manner under selection for the marker.

(35) Primers:

(36) VK30: TATAGGGCGAATTGGAGCTCCGCCGGCGGAAGAGGTAACGCCTTTTGTTAAC-3 (SEQ ID No.: 15) VK31: 5-CTAAACGGAACTCGCATTTAAATCTCGTTTTCGACACTGGATGG-3 (SEQ ID No.: 16) VK32: 5-GCGAGTTCCGTTTAGACGCGTTTAAACTTGTTTAATTATTATGGGGCAGGCGAG A-3 (SEQ ID No.: 17) VK33: 5-CGGGGAATGCGCTGCTTTTCGACACTGGATGGCGGCGTTA-3 (SEQ ID No.: 18) VK34: 5-GCAGCGCATTCCCCGGGTACCGCTCTCGACTAGGTGATTAGCG-3 (SEQ ID No.: 19) VK35: 5-AAAAGCTGGGTACCGGGCCCACTAGTCGAGAGTTAACCGTGACTACAGCTA-3 (SEQ ID No.: 20)

Example 5.1: Successful Use of the Multicopy Strategy

(37) The strategy was confirmed using IBDV-VP2 as antigen and a Klp3-derived expression cassette containing two IBDV-VP2-encoding sequences (CDS-VP2/BEN) in tandem. The tandem IBDV-VP2 expression cassette (FIG. 7A) in the Klp3 vector (plasmid Klp3-tandem-oVP2.sub.T2S, SEQ ID No.: 21) consists of two LAC4 promoter-regulated encoding sequences for VP2.sub.IBDV (CDS-VP2.sub.IBDV) from Klp3-MCS-oVP2.sub.T2S (Arnold et al., (2012)). The promoter sequences consist of the region ?1123 to ?10 of the LAC4 promoter for the first copy, and ?1099 to ?10 for the second copy. Both CDS-VP2.sub.IBDV are flanked at the 3 end by an AgTEF1 terminator. The plasmid Klp3-tandem-oVP2.sub.T2S was cut using HpaI and the restriction material was transformed into strain VAK367-D4. The yeast strain VAK1118 thus generated contains the tandem expression cassette integrated at the LAC4 locus. As shown by western blotting, there is a higher IBDV-VP2 protein concentration in said strain compared to the isogenic strain having only one copy (FIG. 7B). The tandem expression cassette is genetically highly stable: after growth over 78 generations in inducing medium (YNB+Lactose), none of 100 colonies tested by PCR exhibited a genetic change to the expression cassette (data not shown).

Example 6: Tools for Producing Prototrophy in K. lactis Strains for Simplified Fermentation in Synthetic Medium and Complete Medium

(38) In studies carried out, it had become apparent that uracil-auxotrophic yeast strains grow more poorly in complete medium than uracil-prototrophic strains, an effect which could be neutralized only in part by the addition of uracil. To simplify the fermentation of the vaccines strains, to facilitate the establishment of the production processes and to make them more cost-efficient and to avoid growth effects due to insufficient uptake of methionine and/or uracil, what should therefore be found are ways of rapidly and reproducibly achieving the neutralization of these auxotrophies that are required for strain construction. For the reconstitution of KIURA3 from Klura3-20, a DNA fragment is generated via PCR with the aid of the primers VK67 and VK69 and the wild-type KIURA3 gene as template (FIG. 8A). To repair the Klmet5-1 allele, a PCR fragment is analogously generated with the aid of the primers VK74 and VK75 and the wild-type allele KIMET5 as template (FIG. 8B). Transformation of the PCR fragments into the corresponding mutated strains (individually or together) and selection on medium without methionine and/or without uracil led to reconstitution of the wild-type alleles with high efficiency. This process was carried out in order, inter alia, to generate the strains VAK1171 and VAK1400 (see above).

(39) Primers

(40) VK67: 5-GACATCACTGTCTCTTCCCCTTAATGATC-3 (SEQ ID No.: 22) VK69: 5-TCAGCAAGCATCAATAATCCCCTTGGTTC-3 (SEQ ID No.: 23) VK74: 5-GAAAGAAAGACGTTGGTCTCTACGCTTG-3 (SEQ ID No.: 24) VK75: 5-AGATTATAAGTTCCTGGGGCTTTACCCAC-3 (SEQ ID No.: 25)

Example 7: Protective Immunization by Optimized, Inactivated Vaccine Yeasts

(41) The modifications and optimizations of the K. lactis vaccine platform that were carried out as per Examples 1 to 5 were validated in various vaccination studies.

Example 7.1: Immunogenicity of an Optimized K. lactis Platform, Using the Example of an IBDV-VP2 Yeast Strain (VAK1127)

(42) The VAK1127 strain contains a tandem IBDV-VP2 expression cassette (SEQ ID No.: 21), two KIGAL4 copies and the LR2 deletion in the LAC4 promoter. To characterize the immunogenicity of the yeast strain, immunization experiments were carried out in the target organism chicken. In challenge experiments, complete protection of SPF chickens against the very virulent (vv) IBDV strain 89163/7.3 (AFSSA, Ploufragan, France) that has been well characterized by Eterradossi and colleagues (1997) was achieved (Table 1 and 2). To this end, in the two experiments independently carried out, 1 mg of lyophilized, heat-inactivated (2 h, 90? C.) yeast (VAK1127) with incomplete Freund's adjuvant (IFA) was administered two times (FIG. 9A und B) subcutaneously (prime-boost). The administrations were carried out two weeks and four weeks after hatching, and the viral exposure (challenge) was effected six weeks after hatching. After 19 days, high titers of anti-IBDV-VP2 antibodies are already measurable in the case of the VAK1127-vaccinated animals. In the controls, titers of anti-IBDV-VP2 antibodies only occur after challenge with vvIBDV (FIG. 9). In both experiments, complete protection (0% morbidity, 0% mortality) of the VAK1127-vaccinated animals against the challenge with vvIBDV was observed (Table 1 und 2). With these experiments, it was possible to observe protection against vvIBDV using a subunit vaccine in a classic primer-boost vaccination method.

(43) The immunogenicity of the vaccine yeasts is not influenced by the genetic back-mutation to antigen-bearing prototrophic yeast strains. It was possible to demonstrate this in a vaccination experiment in mouse with the aid of the auxotrophic form or prototrophic form of an IBDV-VP2 yeast strain (FIG. 100). The yeast strain VAK1127 (auxotrophic) was, as described above (Example 6; FIG. 8), made prototrophic in two steps using PCR fragments for creating VAK1171. Both strain forms exhibit no significant difference in the expression level of recombinant protein (FIGS. 10A and B). The mice were vaccinated three times subcutaneously with 0.1 mg of heat-inactivated yeast subcutaneously with IFA at two-week intervals. It was not possible to establish any difference in the strength of seroconversion between the auxotrophic IBDV-VP2 strain (VAK1127) and the prototrophic descendant (VAK1171) (FIG. 100).

Example 7.2: Complete Protection by Vaccination in a One-Shot Scheme

(44) A one-shot vaccination, i.e., vaccination by a single administration of the vaccine, is normally not effective with subunit vaccines owing to lack of immunogenicity. However, the antibody titer-developing data obtained using the optimized strain VAK1127 in the prime/boost method (FIG. 9) indicate the possibility of obtaining protection even in a one-shot approach. This was checked by carrying out a one-shot vaccination with the prototrophic yeast strain VAK1171 (FIG. 11; Table 3). To this end, the yeast was administered only singly, in an elevated dose for this purpose (10 mg), and a challenge was then carried out at an interval of 4 weeks. It became apparent that, with VAK1171, complete protection against vvIBDV (0% morbidity, 0% mortality) can actually be achieved using one shot (Table 3). This result could be attributed to the development of high, protective antibody titers, approx. 20 days after vaccination (FIG. 11). The fact that a one-shot vaccination scheme protects against vvIBDV with a high degree of protection shows the strong immunogenic potential of the vaccine used and provides impressive validation of the optimized vaccine platform.

Example 7.3: Improved Protection of a Bivalent Yeast Vaccine Compared to a Monovalent Yeast Vaccine when Used Against Influenza a Virus Infections

(45) To vaccinate against influenza virus type A, three different vaccines strains were generated. Firstly, VAK952 (DSM 32705) was generated, which expresses the major antigen of an influenza A strain (Puerto Rico/8/1934; PR8/34), the HA (hemagglutinin) gene. In VAK952, the gene is integrated into the genome into the LAC4 locus as described by Krijger et al. (2012) and Arnold et al. (2012). Secondly, VAK1283 (DSM 32697) was generated. Here, in addition to the HA gene from PR8/34 in the LAC4 locus, the M1 gene is additionally integrated into the URA3 locus. The M1 gene encodes a further important influenza A antigen which is distinctly more conserved than HA. Reports already published were able to show that combining both antigens can raise the immunogenicity of a vaccine against influenza A and also achieve a cross-protectivity against different influenza viruses. To also validate this aspect with a bivalent yeast vaccine, a further strain (VAK1395; DSM 32706) was generated, which likewise contains the M1 gene in the URA3 locus and where the HA gene from PR8/34 is replaced with the HA gene of the influenza virus California/4/2009. The comparable expression of HA and the additional expression of M1 of the respective strains was checked; it was also shown that the strains exhibit a comparable growth, with VAK1283 having slight advantages over VAK952 (FIG. 12). In vaccination studies in which a prime-boost scheme and one-shot scheme with different yeast concentrations in a mouse model were used in each case, it was shown that VAK952 and VAK1283 each induce comparable titers of virus-neutralizing antibodies (FIG. 13). However, in the challenge experiment, it then became clear that the bivalent VAK1283 vaccine allows maximum protection both in the prime-boost schema and in the one-shot schema, whereas this is not the case with the monovalent VAK952 vaccine. Moreover, with the vaccine VAK1283 in the one-shot experiment at half of the yeast material used, a similar protective effect was achieved as with VAK952 in the prime-boost approach (FIG. 14 and Table 3). In experiments in which VAK1395 was used as vaccine, it was also possible to establish protection against influenza PR8/34. Cross-protection against different influenza variants was thus achieved using a bivalent yeast vaccine.

(46) TABLE-US-00001 TABLE 1 Indications for exposure protection in vaccinated SPF chickens Histopathological Vaccination (a) bursal lesion Yeast strain VP2 amount per assessment bu/bod index (c) Morbidity Mortality (VAK) vaccine dose Adjuvant 0 1 2 3 4 Exposed Unexposed (%) (d) (%) (e) 367 none IFA 1 7 2.80 ? 1.32 5.36 ? 0.65 6/10 (60) 4/10 (40) 1127 4.1 ? 0.25 ?g IFA 8 1 4.40 ? 0.76 4.89 ? 0.63 0/10 0/10 PBS IFA 10 4.08 ? 1.91 4.92 ? 0.94 10/10 (100) 8/10 (80)

(47) TABLE-US-00002 TABLE 2 Indications for exposure protection in vaccinated SPF chickens Histopathological Vaccination (a) bursal lesion Yeast strain VP2 amount per assessment bu/bod index (c) Morbidity Mortality (VAK) vaccine dose Adjuvant 0 1 2 3 4 Exposed Unexposed (%) (d) (%) (e) 1127 4.1 ? 0.71 ?g IFA 6 5.10 ? 0.78 4.81 ? 1.20 0/9 (0) 0/9 (0) PBS IFA 8 4.09 ? 1.87 5.32 ? 0.85 9/9 (100) 7/9 (78)

(48) TABLE-US-00003 TABLE 3 Indications for exposure protection in vaccinated SPF chickens Histopathological Vaccination (a) bursal lesion Yeast strain VP2 amount per assessment bu/bod index (c) Morbidity Mortality (VAK) vaccine dose Adjuvant 0 1 2 3 4 Exposed Unexposed (%) (d) (%) (e) PBS none MF59 9 3.73 ? 1.92 4.77 ? 1.02 9/9 (100) 6/9 (66) VAK367 none MF59 10 4.09 ? 1.58 3.60 ? 0.89 10/10 (100) 9/10 (90) VAK1171 35 ? 4.2 ?g IFA 10 4.48 ? 0.37 3.96 ? 1.02 0/10 (0) 0/10 (0)
Explanatory Notes for Table 1 (a) The chickens were vaccinated subcutaneously with 1 mg of yeast (or PBS) and IFA as adjuvant two weeks after hatching. Two weeks after vaccination, they were boosted in the same manner. Another two weeks later, the viral exposure test was carried out via the oculonasal route with 10.sup.4 EID vvIBDV (very virulent 89163/7.3). Inactivated, whole yeast of the strain VAK1127 was used as vaccine yeast, and a group which was only vaccinated with PBS and IFA was used as the infection control. A group in which wild-type yeast without antigen (VAK367) was administered acted as the control for the yeast effect alone. (b) The histopathological bursal lesion assessment was carried out using a scale of 0-4: 0: no lesions; 1: 5-25% of follicles affected; 2: 26-50% of follicles affected; 3: 51-75% of follicles affected; 76-100% bursal damage (loss of structure). (c) The mean value of the bursa-to-body weight index (bu/bod) was calculated using the formula: (bursa weight/body weight)*1000. The nonexposed control group consisted of at least seven chickens, the exposed group ten. The standard deviation is given. (d) Morbidity is represented as the number of morbid chickens per number of chickens in the group overall. The percentage of morbid chickens is shown between parentheses. (e) Mortality is represented as the number of dead chickens per number of chickens in the group overall. The percentage of dead chickens is shown between parentheses.
Explanatory Notes for Table 2 (a) The chickens were vaccinated subcutaneously with 1 mg of yeast (or PBS) and IFA as adjuvant two weeks after hatching. Two weeks after vaccination, they were boosted in the same manner. Another two weeks later, the viral exposure test was carried out via the oculonasal route with 10 4 EID vvIBDV (very virulent 89163/7.3). Inactivated, whole yeast of the strain VAK1127 was used as vaccine yeast, and a group which was only vaccinated with PBS and IFA was used as the infection control. (b) The histopathological bursal lesion assessment was carried out using a scale of 0-4: 0: no lesions; 1: 5-25% of follicles affected; 2: 26-50% of follicles affected; 3: 51-75% of follicles affected; 76-100% bursal damage (loss of structure). (c) The mean value of the bursa-to-body weight index (bu/bod) was calculated using the formula: (bursa weight/body weight)*1000. The nonexposed control group consisted of at least five chickens, the exposed group nine. The standard deviation is given. (d) Morbidity is represented as the number of morbid chickens per number of chickens in the group overall. The percentage of morbid chickens is shown between parentheses. (e) Mortality is represented as the number of dead chickens per number of chickens in the group overall. The percentage of dead chickens is shown between parentheses.
Explanatory Notes for Table 3 (a) The chickens were vaccinated subcutaneously with 10 mg of yeast (or PBS) and IFA as adjuvant two weeks after hatching. Four weeks later, the viral exposure test was carried out via the oculonasal route with 10 4 EID vvIBDV (very virulent 89163/7.3). Inactivated, whole yeast of the strain VAK1171 was used singly yeast vaccine. The infection control used was, firstly, a group vaccinated only with PBS and MF59 and, secondly, a group vaccinated with wild-type yeast and MF59; two weeks after the first vaccination, both were administered a boost containing the same amount of yeast or PBS. (b) The histopathological bursal lesion assessment was carried out using a scale of 0-4: 0: no lesions; 1: 5-25% of follicles affected; 2: 26-50% of follicles affected; 3: 51-75% of follicles affected; 76-100% bursal damage (loss of structure). (c) The mean value of the bursa-to-body weight index (bu/bod) was calculated using the formula: (bursa weight/body weight)*1000. Each group consisted of at least nine chickens. The standard deviation is given. (d) Morbidity is represented as the number of morbid chickens per number of chickens in the group overall. The percentage of morbid chickens is shown between parentheses. (e) Mortality is represented as the number of dead chickens per number of chickens in the group overall. The percentage of dead chickens is shown between parentheses.
Sequences

(49) The patent application contains the following sequences as part of the description:

(50) TABLE-US-00004 SEQ ID. No. Designation 1 K. lactis avt3::LAC9 2 P.sub.LAC4-12-LR2 3 KlpURA3 vector 4 KlpMET5 vector 5 LAC4-12 promoter variant PLAC4-12 6 LAC4-12 promoter variant P.sub.LAC4-12-LR2 7 LAC4-12 promoter variant P.sub.LAC4 8 LAC4-12 promoter variant P.sub.LAC4-LR2 9 Primer sequence VK183 10 Primer sequence VK184 11 Primer sequence MAB6 12 Primer sequence VK71 13 Primer sequence VK211 14 BCR from P.sub.LAC4-12 15 Primer sequence VK30 16 Primer sequence VK31 17 Primer sequence VK32 18 Primer sequence VK33 19 Primer sequence VK34 20 Primer sequence VK35 21 Klp3-tandem-oVP2T2S 22 Primer sequence VK67 23 Primer sequence VK69 24 Primer sequence VK74 25 Primer sequence VK75

REFERENCES

(51) Arnold, M.; Durairaj, V.; Mundt, E.; Schulze, K.; Breunig, K. D. & Behrens, S.-E. Protective Vaccination against Infectious Bursal Disease Virus with Whole Recombinant Kluyveromyces lactis Yeast Expressing the Viral VP2 Subunit, PLoS ONE, Public Library of Science, 2012, 7, e42870 Berthoud, T. K.; Hamill, M.; Lillie, P. J.; Hwenda, L.; Collins, K. A.; Ewer, K. J.; Milicic, A.; Poyntz, H. C.; Lambe, T. & Fletcher, H. A. Potent CD8+ T-cell immunogenicity in humans of a novel heterosubtypic influenza A vaccine, MVA NP+M1, Clinical infectious diseases, Oxford University Press, 2011, 52, 1-7 Bathurst, I. C. Protein expression in yeast as an approach to production of recombinant malaria antigens, The American journal of tropical medicine and hygiene, ASTMH, 1994, 50, Breunig, K. D. Multicopy plasmids containing the gene for the transcriptional activator LAC9 are not tolerated by K. lactis cells, Current genetics, Springer, 1989, 15, 143-148 de Silva; Chandimal, U.; Tanaka, H.; Nakamura, S.; Goto, N. & Yasunaga, T. A comprehensive analysis of reassortment in influenza A virus, Biology open, The Company of Biologists Ltd, 2012, 1, 385-390 Eterradossi, N.; Toquin, D.; Abbassi, H.; Rivallan, G.; Cotte, J. & Guittet, M. Passive Protection of Specific Pathogen Free Chicks Against Infectious Bursal Disease by In-Ovo Injection of Semi-Purified Egg-Yolk Antiviral Immunoglobulins, Zoonoses and Public Health, Wiley Online Library, 1997, 44, 371-383 Gellissen, G. & Hollenberg, C. P. Application of yeasts in gene expression studies: a comparison of Saccharomyces cerevisiae, Hansenula polymorpha and Kluyveromyces lactis-a review, Gene, Elsevier, 1997, 190, 87-97 G?decke, A.; Zachariae, W.; Arvanitidis, A. & Breunig, K. D. Coregulation of the Kluyveromyces lactis lactose permease and ?-galactoidase genes is achieved by interaction of multiple LAC9 binding sites in a 2.6 kbp divergnent promoter, Nucleic acids research, Oxford University Press, 1991, 19, 5351-5358 Granzow, H.; Birghan, C.; Mettenleiter, T. C.; Beyer, J.; Kanner, B. & Mundt, E. A second form of infectious bursal disease virus-associated tubule contains VP4., Journal of virology, Am Soc Microbiol, 1997, 71, 8879-8885 Kasanga, C. J.; Yamaguchi, T.; Wambura, P. N.; Maeda-Machang'u, A. D.; Ohya, K. & Fukushi, H. Molecular characterization of infectious bursal disease virus (IBDV): diversity of very virulent IBDV in Tanzania, Archives of virology, Springer, 2007, 152, 783-790 Kirchenbaum, G. A. & Ross, T. M. Eliciting broadly protective antibody responses against influenza, Current opinion in immunology, Elsevier, 2014, 28, 71-76 Kirunda, H.; Erima, B.; Tumushabe, A.; Kiconco, J.; Tugume, T.; Mulei, S.; Mimbe, D.; Mworozi, E.; Bwogi, J. & Luswa, L. Prevalence of influenza A viruses in livestock and free-living waterfowl in Uganda, BMC veterinary research, BioMed Central, 2014, 10, 50 Krammer, F. & Palese, P. Influenza virus hemagglutinin stalk-based antibodies and vaccines, Current opinion in virology, Elsevier, 2013, 3, 521-530 Krijger, J.-J.; Baumann, J.; Wagner, M.; Schulze, K.; Reinsch, C.; Klose, T.; Onuma, O. F.; Simon, C.; Behrens, S.-E. & Breunig, K. D. A novel, lactase-based selection and strain improvement strategy for recombinant protein expression in Kluyveromyces lactis, Microbial Cell Factories, 2012, 11, 112 Kumar, K.; Singh, K. C. P. & Prasad, C. B. Immune responses to intermediate strain IBD vaccine at different levels of maternal antibody in broiler chickens, Tropical animal health and production, Springer, 2000, 32, 357-360 Negash, T.; Gelaye, E.; Petersen, H.; Grummer, B. & Rautenschlein, S. Molecular evidence of very virulent infectious bursal disease viruses in chickens in Ethiopia, Avian diseases, BioOne, 2012, 56, 605-610 Rautenschlein, S.; Kraemer, C. H.; Vanmarcke, J. & Montiel, E. Protective efficacy of intermediate and intermediate plus infectious bursal disease virus (IBDV) vaccines against very virulent IBDV in commercial broilers, Avian diseases, BioOne, 2005, 49, 231-237 Remington's Practice of Pharmacy, 13th edition and J. of Pharmaceutical Science & Technology, Vol. 52, No. 5, September-October, pages 238-311 Ridpath, J. F. Emerging pestiviruses infecting domestic and wildlife hosts, Animal Health Research Reviews, Cambridge University Press, 2015, 16, 55-59 RKI, Influenza (Teil 2): Erkrankungen durch zoonotische Influenzaviren [Influenza (part 2): diseases due to zoonotic influenza viruses], 2016 Schrauwen, E. J. A. & Fouchier, R. A. M. Host adaptation and transmission of influenza A viruses in mammals, Emerging microbes & infections, Nature Publishing Group, 2014, 3, e9 Short, K. R.; Richard, M.; Verhagen, J. H.; van Riel, D.; Schrauwen, E. J. A.; van den Brand, J. M. A.; Manz, B.; Bodewes, R. & Herfst, S. One health, multiple challenges: The inter-species transmission of influenza A virus, One health, Elsevier, 2015, 1,1-13 Steel, J.; Lowen, A. C.; Wang, T. T.; Yondola, M.; Gao, Q.; Haye, K.; Garc?a-Sastre, A. & Palese, P. Influenza virus vaccine based on the conserved hemagglutinin stalk domain, MBio, Am Soc Microbiol, 2010, 1, e00018-10 WHO, Influenza (Seasonal), 2016 WHO, Biologicals, Influenza, 2017