Optimized host/vector system for producing protective mono- and multivalent subunit vaccines on the basis of the yeast <i>Kluyveromyces lactis</i>
11905517 ยท 2024-02-20
Assignee
Inventors
- Hans Caspar H?HRLIMANN (Leipzig, DE)
- Martina Behrens (Halle, DE)
- Mandy GEBAUER (Schwerin, DE)
- Karin BREUNIG (Berlin, DE)
- Sven-Erik Behrens (Halle, DE)
Cpc classification
C12N2760/16134
CHEMISTRY; METALLURGY
C12N2720/10034
CHEMISTRY; METALLURGY
C12N2770/24334
CHEMISTRY; METALLURGY
A61K9/0019
HUMAN NECESSITIES
A61K9/006
HUMAN NECESSITIES
International classification
A61K9/00
HUMAN NECESSITIES
Abstract
The invention relates to recombinant Kluyveromyces lactis (K. lactis) yeasts which are capable of the highly efficient expression of one or more foreign proteins and are suitable for use as a vaccine for generating a protective immune response against pathogens. The invention provides in particular K. lactis strains for the targeted cloning of foreign antigen-coding nucleic acids into the yeast genome of the K. lactis strain, which is characterized in that the K. lactis strain has integrated expression cassettes for foreign antigens as an alternative or in addition to the KILAC4 locus on the KIURA3-20 locus (KLLA0E22771g) and/or on the KIMET5-1 locus (KLLA0B03938g). The invention further relates to integrative expression vectors and to methods for producing the K. lactis strains of the invention as well as to the use thereof as vaccines.
Claims
1. A Kluyveromyces lactis (K. lactis) strain for targeted cloning of foreign antigen-encoding nucleic acids into the yeast genome of the K. lactis strain, characterized in that the K. lactis strain has integrated expression cassettes for foreign antigens at: i) the KlURA3-20 locus; ii) the KlMET5-1 locus; iii) the KlURA3-20 locus and the KlMET5-1 locus; iv) the KlURA3-20 locus and the KlLAC4 locus; v) the KlMET5-1 locus and the KlLAC4 locus; or vi) the KlURA3-20 locus, the KlMET5-1 locus, and the KlLAC4 locus.
2. The K. lactis strain as claimed in claim 1, characterized in that the expression cassettes contain the K. lactis LAC4-12 promoter or variants of said promoter, including the intergenic region between LAC12 and LAC4, the antigen-encoding region and the AgTEF1 terminator.
3. The K. lactis strain as claimed in claim 1, characterized in that multiple copies of a foreign antigen-encoding nucleic acid are inserted via tandem expression cassettes or multi-expression cassettes at the KlLAC4 locus or at the KlURA3-locus or at the KlMET5-1 locus of the resultant K. lactis strains.
4. The K. lactis strain as claimed in claim 1, characterized in that the gene of the foreign antigen IBDV VP2 is present in the form of a tandem expression cassette at the locus KlLAC4 of the K. lactis strain.
5. The K. lactis strain as claimed in claim 1, characterized in that one or more copies of different foreign antigen-encoding nucleic acids are inserted via single expression cassettes, tandem expression cassettes or multi-expression cassettes at the KlLAC4 locus and/or at the KlURA3-20 locus and/or at the KlMET5-1 locus.
6. The K. lactis strain as claimed in claim 1, characterized in that the encoding genes of the foreign antigens influenza A HA and influenza A M1 are inserted at the KlLAC4 and KlURA3-20 loci of the K. lactis strain and are expressed.
7. The K. lactis strain as claimed in claim 1, characterized in that the K. lactis strain contains, in addition to the genomic KIGAL4 gene, additionally a second ectopic copy of the KIGAL4 gene.
8. The K. lactis strain as claimed in claim 7, characterized in that the ectopic copy of the KIGAL4 gene, which is flanked by the KIGAL4 promoter and KIGAL4 terminator, is integrated in the K. lactis strain at the gene locus KLLA0E13795g (SEQ ID NO: 1).
9. The K. lactis strain as claimed in claim 1, the K. lactis strain having a modified promoter structure of the LAC4-12 promoter that allows reduced or no foreign protein expression under noninduced conditions, characterized in that the basal control region (BCR) of the promoter PLAC4-12-LR2 between ?1065 and ?1540 (SEQ ID NO: 2) is deleted.
10. The K. lactis strain as claimed in claim 9, characterized in that the gene of the foreign antigen influenza A HA is present at the locus KlLAC4 of the K. lactis strain.
11. The K. lactis strain as claimed in claim 1, the K. lactis strain having a modified promoter structure of the LAC4-12 promoter that allows modulation of foreign protein expression, characterized in that the number of binding sites for the activator KlGal4 of the promoter varies and 1, 2, 3 or 4 KlGal4-binding sites are present.
12. The K. lactis strain as claimed in claim 1, characterized in that the gene of the foreign antigen IBDV VP2 is inserted at the locus KlLAC4 of the K. lactis strain.
13. The K. lactis strain as claimed in claim 1, characterized in that the gene function of the alleles Kllac4, Klura3-20 and Klmet5-1 is restored and the K. lactis strain is prototrophic.
14. The K. lactis strain as claimed in claim 1, characterized in that the genes of the foreign antigens BVDV E2 ectodomain, BVDV E2 ectodomain, and BVDV Npro-NS3 are inserted at the loci KlLAC4, KlURA3-20 and KlMet5-1 of the K. lactis strain.
15. A K. lactis strain according to claim 1, wherein said K. lactis strain is selected from the group consisting of: VAK952 DSM 32705; VAK1111 DSM 32696; VAK1118 DSM 32701; VAK1131 DSM 32700; YAK 1171 DSM 32699; VAK1243 DSM 32702; VAK1283 DSM 32697; VAK1395 DSM 32706 and VAK1400 DSM 32698.
16. An integrative expression vector selected from the group consisting of KIpURA3, KIpMET5, KIpMET5-PL4-12-Et, KIpMET5-PL4-12-LR2-Et, KIpMET5-PL4-Et, KIpMET5-PL4-LR2-Et, KIpURA3-PL4-12-Et, KIpURA3-PL4-12-LR2-Et, KIpURA3-PL4-Et and KIpURA3-PL4-LR2-Et.
17. A pharmaceutical composition containing a K. lactis strain as claimed in claim 1.
Description
(1) The invention is more particularly elucidated below on the basis of the drawings and exemplary embodiments.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
EXEMPLARY EMBODIMENTS
Example 1: Generation of a Host Strain Having Two KIGAL4 Gene Copies, Stably Integrated, at Noncoupled Gene Loci
(16) A second KIGAL4 gene copy without a selection marker was inserted at a different gene locus (ectopically). It was possible to locate the insertion in the KIAVT3 gene (KLLA0E13795g) by sequencing (Klavt3::KIGAL4-1, SEQ ID No.: 1) (
(17) To use VAK1111 for the targeted integration of an expression cassette at the LAC4 locus in analogy to VAK367-D4, the lac4::ScURA3 disruption was introduced, which makes it possible in one step, under selection for lactose growth, to integrate the desired foreign gene between LAC4 promoter and LAC4 reading frame by means of Klp vector technology without a marker (Krijger et al. (2012)). The resultant strain VAK1123 only differs from VAK367-D4 by the second, ectopic KIGAL4 gene copy.
Example 1.1: Improved Productivity of a Yeast Vaccine Strain Having an Additionally Integrated KIGAL4 Gene
(18) In one exemplary embodiment, the IBDV-oVP2.sub.T2S (Arnold et al. (2012)) gene was inserted into the LAC4 locus of the strain VAK1123 (resultant strain VAK1130). It was possible to establish an increased production of IBDV-VP2 compared to the otherwise isogenic strain having only one KIGAL4 copy (VAK910). As comparison, strain VAK1118, which bears only one KIGAL4 gene, but two CDS VP2.sub.IBDV copies (see below), is additionally shown (
Example 2: P.SUB.LAC4-12LR2 Promoter Having Reduced Basal Activity for Optimizing the Expression of Antigens Having a Cytopathic Effect
(19) Heterologous protein production in microorganisms is problematic when this leads to a cytopathic effect (CPE). Therefore, the task faced is to find a way to decouple the antigen production phase from the biomass accumulation phase. Owing to the inducible LAC4 promoter, this is partially possible by a fed-batch fermentation process, but is hampered because the promoter P.sub.LAC4-12 is not completely closed down under noninducing conditions. In the case of antigens having a very strong CPE, what occurs is a reduction in the growth rate and an induction of the cellular stress response, with disadvantageous effects on antigen production. This problem is aggravated by the doubling of the KIGAL4 gene dose and/or the increase in the number of antigen-encoding sequences (see below). The solution was to delete the basal control region (BCR) of the promoter P.sub.LAC4-12 (
Example 2.1: Inhibition of the Basal (Noninduced) Expression of Antigen by a Modified Promoter
(20) After integration of a tandem IBDV-VP2 expression cassette into VAK1124 (resultant yeast strain: VAK1131; see below and
Example 3: Versatile Vector System for the Targeted Integration of Multiple Expression Cassettes into the K. lactis Genome
(21) As before for VAK367-D4 (Krijger et al. (2012), WO 20101054649), the yeast strain VAK367 forms the genetic background of all K. lactis strains described here. This strain background has a need for uracil and methionine (uracil-and-methionine auxotrophy) owing to mutations in two genes, KIURA3 (KLLA0E22771g) and KIMET5 (KLLA0B03938g), which are referred to as alleles Klura3-20 (absent base pair at position +345) and Klmet5-1 (G2555A; and A3682T); the alleles are thus nonfunctional gene variants.
(22) These mutated alleles were used in order to use further loci for targeted integration besides the integration site LAC4 already developed with the Klp3/Klp3-MCS (Krijger et al. (2012)) and to thereby generate multivalent vaccine strains (
(23) Further loci can be analogously developed as integration sites by mutagenesis and selection for auxotrophy for alternative growth substances.
Example 3.1: Vectors KlpURA3 and KIpMET5 for the Targeted Integration of Expression Cassettes (Having an Inducible LAC4-12 Promoter) at the KIURA3 (KLLA0E22771g) and/or KIMET5 (KLLA0B03938g) Loci of K. lactis Strains Having the Klura3-20 and/or Klmet5-1 Allele
(24) The integrative expression vectors KlpURA3 (SEQ ID No.: 3) and KIpMET5 (SEQ ID No.: 4) were constructed by means of suitable gene fragments (KIMET5/KIURA3 targeting sequences) which allow a targeted restoration of the functionality of the Klura3-20 and Klmet5-1 alleles, respectively.
(25) The KIpMET5 expression vector contains the expression cassette consisting of the LAC4-12 promoter (P.sub.LAC4-12 or the variants thereof), the encoding nucleic acid sequence of the antigen to be expressed and the AgTEF1 terminator; it is flanked upstream by the genomic KIMET5 fragment having an introduced ScCYC1 terminator and downstream by the KIAIM18 promoter having a downstream KIAI M18 gene. The KlpURA3 expression vector contains the expression cassette consisting of the LAC4-12 promoter (P.sub.LAC4-12 or the variants thereof), the encoding nucleic acid sequence of the antigen to be expressed and the AgTEF1 terminator; it is flanked upstream by KLLAOE22749g having an associated promoter and downstream by the KIURA3 promoter having a downstream KIURA3 fragment (
(26) In each case, the antigen-encoding sequence is cloned between promoter and terminator via AscI and NotI restriction sites. By Eco91I or KpnI restriction of the resultant plasmid, the entire expression cassette is separated from the KlpURA3 vector backbone, and by HindIII or BoxI restriction of the resultant plasmid, the entire expression cassette is separated from the KIpMET5 vector backbone, and the restriction material is transformed into K. lactis host strains having a Klura3-30 and/or Klmet5-1 allele. The foreign gene-containing expression cassette integrated in this way into KIURA3-20 or KIMET5-1 thus exactly corresponds to that which is also integrable into LAC4 in VAK367-D4 with the Klp3-MCS vector (WO 20101054649). Checking for uracil-prototrophic and/or methionine-prototrophic transformants is carried out in a standard manner via colony PCR using the primers MAB6 and VK211 for KlpMET5 transformants, and the primers MAB6 and VK71 for KlpURA3 transformants. Integration of the expression cassette at the correct target site between KIURA3 or KIMET5 and the respectively adjacent gene yields products of 1652 bp in size for KIpMET5 transformants and of 1307 bp in size for KlpURA3 transformants. No indications were obtained that the functionality of the neighboring genes is impaired by the insertion.
(27) Primers:
(28) MAB6: 5-CCCAGATGCGAAGTTAAGTG-3 (SEQ ID No.: 11) VK71: 5-TACAACAGATCACGTGATCTTTTTGTAAG-3 (SEQ ID No.: 12) VK211: 5-GATTTCGTAACCCTATTGTTCATGAATG-3 (SEQ ID No.: 13)
Example 3.2: Expression of a Foreign Antigen after Integration of the Encoding Gene Cassette at the KIURA3 or KIMET5 Locus
(29) A foreign gene under the control of the P.sub.LAC4-12 promoter is induced approximately equally strongly by lactose after integration at the LAC4, KIURA3 and KIMET5 locus. The heat-labile, nontoxic, enterotoxin subunit B (Etx.B) from E. coli and an (HA).sub.3 epitope at the C-terminus (Etx.B-HA) was used as test protein for evaluating the vector system. The encoding sequence was cloned into the vectors KIpMET5, KlpURA3 and Klp3-MCS and integrated at the gene loci KIMET5 (VAK1251), KIURA3 (VAK1235) and LAC4 (VAK899) (
Example 3.3: Coexpression of Two Foreign Antigens in the Same Yeast Cell
(30) The possibility of producing different heterologous proteins under the control of the P.sub.LAC4-12 promoter in the same yeast strain via the new vector system was able to be shown by the construction of a yeast strain having an Etx.B-HA expression cassette at the KIURA3 locus and an expression cassette at the LAC4 locus having two VP2iBpv copies present as a tandem (VAK1234;
Example 4: LAC4 Promoter Variants for Modulating Recombinant Protein Synthesis Under Similar Induction Conditions
(31) The immunogenic effect of antigens is often based on the assembling of multiple proteins in a nonstoichiometric ratio. To make this possible in yeast-based vaccines, variants of the P.sub.LAC4-12LR2 promoter were generated (
Example 4.1: Expression of a Foreign Antigen Under the Control of Various LAC4 Promoter Variants
(32) Expression of Etx.B-HA under the control of four LAC4-12 promoter variants. What were tested were four LAC4 promoter variants differing in the number of binding sites for the transcription activator KIGal4 and the presence/absence of a control region for basal expression under noninducing conditions (basal control region, BCR;
Example 5: Raising of Antigen Production by Increasing the Copy Number of the Antigen-Encoding Gene
(33) The above-described vector system was therefore modified in order to rapidly and efficiently connect multiple gene copies in series and to introduce this expression cassette in one step at one of the three gene loci (
(34) To produce a tandem expression cassette integrable at the LAC4 locus, three PCR-amplified fragments are fused by any desired Klp3(-MCS)-GOI template in one step (in-fusion cloning): (1 and 2) expression cassette containing P.sub.LAC4-LR2 and T.sub.TEF (primers: VK30 & VK31, and VK32 & VK33) and (3) LAC4 targeting sequence (VK34 & VK35)). After restriction, for example using HpaI, the tandem expression cassette can be integrated into the lac4::URA3 locus as described (
(35) Primers:
(36) VK30: TATAGGGCGAATTGGAGCTCCGCCGGCGGAAGAGGTAACGCCTTTTGTTAAC-3 (SEQ ID No.: 15) VK31: 5-CTAAACGGAACTCGCATTTAAATCTCGTTTTCGACACTGGATGG-3 (SEQ ID No.: 16) VK32: 5-GCGAGTTCCGTTTAGACGCGTTTAAACTTGTTTAATTATTATGGGGCAGGCGAG A-3 (SEQ ID No.: 17) VK33: 5-CGGGGAATGCGCTGCTTTTCGACACTGGATGGCGGCGTTA-3 (SEQ ID No.: 18) VK34: 5-GCAGCGCATTCCCCGGGTACCGCTCTCGACTAGGTGATTAGCG-3 (SEQ ID No.: 19) VK35: 5-AAAAGCTGGGTACCGGGCCCACTAGTCGAGAGTTAACCGTGACTACAGCTA-3 (SEQ ID No.: 20)
Example 5.1: Successful Use of the Multicopy Strategy
(37) The strategy was confirmed using IBDV-VP2 as antigen and a Klp3-derived expression cassette containing two IBDV-VP2-encoding sequences (CDS-VP2/BEN) in tandem. The tandem IBDV-VP2 expression cassette (
Example 6: Tools for Producing Prototrophy in K. lactis Strains for Simplified Fermentation in Synthetic Medium and Complete Medium
(38) In studies carried out, it had become apparent that uracil-auxotrophic yeast strains grow more poorly in complete medium than uracil-prototrophic strains, an effect which could be neutralized only in part by the addition of uracil. To simplify the fermentation of the vaccines strains, to facilitate the establishment of the production processes and to make them more cost-efficient and to avoid growth effects due to insufficient uptake of methionine and/or uracil, what should therefore be found are ways of rapidly and reproducibly achieving the neutralization of these auxotrophies that are required for strain construction. For the reconstitution of KIURA3 from Klura3-20, a DNA fragment is generated via PCR with the aid of the primers VK67 and VK69 and the wild-type KIURA3 gene as template (
(39) Primers
(40) VK67: 5-GACATCACTGTCTCTTCCCCTTAATGATC-3 (SEQ ID No.: 22) VK69: 5-TCAGCAAGCATCAATAATCCCCTTGGTTC-3 (SEQ ID No.: 23) VK74: 5-GAAAGAAAGACGTTGGTCTCTACGCTTG-3 (SEQ ID No.: 24) VK75: 5-AGATTATAAGTTCCTGGGGCTTTACCCAC-3 (SEQ ID No.: 25)
Example 7: Protective Immunization by Optimized, Inactivated Vaccine Yeasts
(41) The modifications and optimizations of the K. lactis vaccine platform that were carried out as per Examples 1 to 5 were validated in various vaccination studies.
Example 7.1: Immunogenicity of an Optimized K. lactis Platform, Using the Example of an IBDV-VP2 Yeast Strain (VAK1127)
(42) The VAK1127 strain contains a tandem IBDV-VP2 expression cassette (SEQ ID No.: 21), two KIGAL4 copies and the LR2 deletion in the LAC4 promoter. To characterize the immunogenicity of the yeast strain, immunization experiments were carried out in the target organism chicken. In challenge experiments, complete protection of SPF chickens against the very virulent (vv) IBDV strain 89163/7.3 (AFSSA, Ploufragan, France) that has been well characterized by Eterradossi and colleagues (1997) was achieved (Table 1 and 2). To this end, in the two experiments independently carried out, 1 mg of lyophilized, heat-inactivated (2 h, 90? C.) yeast (VAK1127) with incomplete Freund's adjuvant (IFA) was administered two times (
(43) The immunogenicity of the vaccine yeasts is not influenced by the genetic back-mutation to antigen-bearing prototrophic yeast strains. It was possible to demonstrate this in a vaccination experiment in mouse with the aid of the auxotrophic form or prototrophic form of an IBDV-VP2 yeast strain (
Example 7.2: Complete Protection by Vaccination in a One-Shot Scheme
(44) A one-shot vaccination, i.e., vaccination by a single administration of the vaccine, is normally not effective with subunit vaccines owing to lack of immunogenicity. However, the antibody titer-developing data obtained using the optimized strain VAK1127 in the prime/boost method (
Example 7.3: Improved Protection of a Bivalent Yeast Vaccine Compared to a Monovalent Yeast Vaccine when Used Against Influenza a Virus Infections
(45) To vaccinate against influenza virus type A, three different vaccines strains were generated. Firstly, VAK952 (DSM 32705) was generated, which expresses the major antigen of an influenza A strain (Puerto Rico/8/1934; PR8/34), the HA (hemagglutinin) gene. In VAK952, the gene is integrated into the genome into the LAC4 locus as described by Krijger et al. (2012) and Arnold et al. (2012). Secondly, VAK1283 (DSM 32697) was generated. Here, in addition to the HA gene from PR8/34 in the LAC4 locus, the M1 gene is additionally integrated into the URA3 locus. The M1 gene encodes a further important influenza A antigen which is distinctly more conserved than HA. Reports already published were able to show that combining both antigens can raise the immunogenicity of a vaccine against influenza A and also achieve a cross-protectivity against different influenza viruses. To also validate this aspect with a bivalent yeast vaccine, a further strain (VAK1395; DSM 32706) was generated, which likewise contains the M1 gene in the URA3 locus and where the HA gene from PR8/34 is replaced with the HA gene of the influenza virus California/4/2009. The comparable expression of HA and the additional expression of M1 of the respective strains was checked; it was also shown that the strains exhibit a comparable growth, with VAK1283 having slight advantages over VAK952 (
(46) TABLE-US-00001 TABLE 1 Indications for exposure protection in vaccinated SPF chickens Histopathological Vaccination (a) bursal lesion Yeast strain VP2 amount per assessment bu/bod index (c) Morbidity Mortality (VAK) vaccine dose Adjuvant 0 1 2 3 4 Exposed Unexposed (%) (d) (%) (e) 367 none IFA 1 7 2.80 ? 1.32 5.36 ? 0.65 6/10 (60) 4/10 (40) 1127 4.1 ? 0.25 ?g IFA 8 1 4.40 ? 0.76 4.89 ? 0.63 0/10 0/10 PBS IFA 10 4.08 ? 1.91 4.92 ? 0.94 10/10 (100) 8/10 (80)
(47) TABLE-US-00002 TABLE 2 Indications for exposure protection in vaccinated SPF chickens Histopathological Vaccination (a) bursal lesion Yeast strain VP2 amount per assessment bu/bod index (c) Morbidity Mortality (VAK) vaccine dose Adjuvant 0 1 2 3 4 Exposed Unexposed (%) (d) (%) (e) 1127 4.1 ? 0.71 ?g IFA 6 5.10 ? 0.78 4.81 ? 1.20 0/9 (0) 0/9 (0) PBS IFA 8 4.09 ? 1.87 5.32 ? 0.85 9/9 (100) 7/9 (78)
(48) TABLE-US-00003 TABLE 3 Indications for exposure protection in vaccinated SPF chickens Histopathological Vaccination (a) bursal lesion Yeast strain VP2 amount per assessment bu/bod index (c) Morbidity Mortality (VAK) vaccine dose Adjuvant 0 1 2 3 4 Exposed Unexposed (%) (d) (%) (e) PBS none MF59 9 3.73 ? 1.92 4.77 ? 1.02 9/9 (100) 6/9 (66) VAK367 none MF59 10 4.09 ? 1.58 3.60 ? 0.89 10/10 (100) 9/10 (90) VAK1171 35 ? 4.2 ?g IFA 10 4.48 ? 0.37 3.96 ? 1.02 0/10 (0) 0/10 (0)
Explanatory Notes for Table 1 (a) The chickens were vaccinated subcutaneously with 1 mg of yeast (or PBS) and IFA as adjuvant two weeks after hatching. Two weeks after vaccination, they were boosted in the same manner. Another two weeks later, the viral exposure test was carried out via the oculonasal route with 10.sup.4 EID vvIBDV (very virulent 89163/7.3). Inactivated, whole yeast of the strain VAK1127 was used as vaccine yeast, and a group which was only vaccinated with PBS and IFA was used as the infection control. A group in which wild-type yeast without antigen (VAK367) was administered acted as the control for the yeast effect alone. (b) The histopathological bursal lesion assessment was carried out using a scale of 0-4: 0: no lesions; 1: 5-25% of follicles affected; 2: 26-50% of follicles affected; 3: 51-75% of follicles affected; 76-100% bursal damage (loss of structure). (c) The mean value of the bursa-to-body weight index (bu/bod) was calculated using the formula: (bursa weight/body weight)*1000. The nonexposed control group consisted of at least seven chickens, the exposed group ten. The standard deviation is given. (d) Morbidity is represented as the number of morbid chickens per number of chickens in the group overall. The percentage of morbid chickens is shown between parentheses. (e) Mortality is represented as the number of dead chickens per number of chickens in the group overall. The percentage of dead chickens is shown between parentheses.
Explanatory Notes for Table 2 (a) The chickens were vaccinated subcutaneously with 1 mg of yeast (or PBS) and IFA as adjuvant two weeks after hatching. Two weeks after vaccination, they were boosted in the same manner. Another two weeks later, the viral exposure test was carried out via the oculonasal route with 10 4 EID vvIBDV (very virulent 89163/7.3). Inactivated, whole yeast of the strain VAK1127 was used as vaccine yeast, and a group which was only vaccinated with PBS and IFA was used as the infection control. (b) The histopathological bursal lesion assessment was carried out using a scale of 0-4: 0: no lesions; 1: 5-25% of follicles affected; 2: 26-50% of follicles affected; 3: 51-75% of follicles affected; 76-100% bursal damage (loss of structure). (c) The mean value of the bursa-to-body weight index (bu/bod) was calculated using the formula: (bursa weight/body weight)*1000. The nonexposed control group consisted of at least five chickens, the exposed group nine. The standard deviation is given. (d) Morbidity is represented as the number of morbid chickens per number of chickens in the group overall. The percentage of morbid chickens is shown between parentheses. (e) Mortality is represented as the number of dead chickens per number of chickens in the group overall. The percentage of dead chickens is shown between parentheses.
Explanatory Notes for Table 3 (a) The chickens were vaccinated subcutaneously with 10 mg of yeast (or PBS) and IFA as adjuvant two weeks after hatching. Four weeks later, the viral exposure test was carried out via the oculonasal route with 10 4 EID vvIBDV (very virulent 89163/7.3). Inactivated, whole yeast of the strain VAK1171 was used singly yeast vaccine. The infection control used was, firstly, a group vaccinated only with PBS and MF59 and, secondly, a group vaccinated with wild-type yeast and MF59; two weeks after the first vaccination, both were administered a boost containing the same amount of yeast or PBS. (b) The histopathological bursal lesion assessment was carried out using a scale of 0-4: 0: no lesions; 1: 5-25% of follicles affected; 2: 26-50% of follicles affected; 3: 51-75% of follicles affected; 76-100% bursal damage (loss of structure). (c) The mean value of the bursa-to-body weight index (bu/bod) was calculated using the formula: (bursa weight/body weight)*1000. Each group consisted of at least nine chickens. The standard deviation is given. (d) Morbidity is represented as the number of morbid chickens per number of chickens in the group overall. The percentage of morbid chickens is shown between parentheses. (e) Mortality is represented as the number of dead chickens per number of chickens in the group overall. The percentage of dead chickens is shown between parentheses.
Sequences
(49) The patent application contains the following sequences as part of the description:
(50) TABLE-US-00004 SEQ ID. No. Designation 1 K. lactis avt3::LAC9 2 P.sub.LAC4-12-LR2 3 KlpURA3 vector 4 KlpMET5 vector 5 LAC4-12 promoter variant PLAC4-12 6 LAC4-12 promoter variant P.sub.LAC4-12-LR2 7 LAC4-12 promoter variant P.sub.LAC4 8 LAC4-12 promoter variant P.sub.LAC4-LR2 9 Primer sequence VK183 10 Primer sequence VK184 11 Primer sequence MAB6 12 Primer sequence VK71 13 Primer sequence VK211 14 BCR from P.sub.LAC4-12 15 Primer sequence VK30 16 Primer sequence VK31 17 Primer sequence VK32 18 Primer sequence VK33 19 Primer sequence VK34 20 Primer sequence VK35 21 Klp3-tandem-oVP2T2S 22 Primer sequence VK67 23 Primer sequence VK69 24 Primer sequence VK74 25 Primer sequence VK75
REFERENCES
(51) Arnold, M.; Durairaj, V.; Mundt, E.; Schulze, K.; Breunig, K. D. & Behrens, S.-E. Protective Vaccination against Infectious Bursal Disease Virus with Whole Recombinant Kluyveromyces lactis Yeast Expressing the Viral VP2 Subunit, PLoS ONE, Public Library of Science, 2012, 7, e42870 Berthoud, T. K.; Hamill, M.; Lillie, P. J.; Hwenda, L.; Collins, K. A.; Ewer, K. J.; Milicic, A.; Poyntz, H. C.; Lambe, T. & Fletcher, H. A. Potent CD8+ T-cell immunogenicity in humans of a novel heterosubtypic influenza A vaccine, MVA NP+M1, Clinical infectious diseases, Oxford University Press, 2011, 52, 1-7 Bathurst, I. C. Protein expression in yeast as an approach to production of recombinant malaria antigens, The American journal of tropical medicine and hygiene, ASTMH, 1994, 50, Breunig, K. D. Multicopy plasmids containing the gene for the transcriptional activator LAC9 are not tolerated by K. lactis cells, Current genetics, Springer, 1989, 15, 143-148 de Silva; Chandimal, U.; Tanaka, H.; Nakamura, S.; Goto, N. & Yasunaga, T. A comprehensive analysis of reassortment in influenza A virus, Biology open, The Company of Biologists Ltd, 2012, 1, 385-390 Eterradossi, N.; Toquin, D.; Abbassi, H.; Rivallan, G.; Cotte, J. & Guittet, M. Passive Protection of Specific Pathogen Free Chicks Against Infectious Bursal Disease by In-Ovo Injection of Semi-Purified Egg-Yolk Antiviral Immunoglobulins, Zoonoses and Public Health, Wiley Online Library, 1997, 44, 371-383 Gellissen, G. & Hollenberg, C. P. Application of yeasts in gene expression studies: a comparison of Saccharomyces cerevisiae, Hansenula polymorpha and Kluyveromyces lactis-a review, Gene, Elsevier, 1997, 190, 87-97 G?decke, A.; Zachariae, W.; Arvanitidis, A. & Breunig, K. D. Coregulation of the Kluyveromyces lactis lactose permease and ?-galactoidase genes is achieved by interaction of multiple LAC9 binding sites in a 2.6 kbp divergnent promoter, Nucleic acids research, Oxford University Press, 1991, 19, 5351-5358 Granzow, H.; Birghan, C.; Mettenleiter, T. C.; Beyer, J.; Kanner, B. & Mundt, E. A second form of infectious bursal disease virus-associated tubule contains VP4., Journal of virology, Am Soc Microbiol, 1997, 71, 8879-8885 Kasanga, C. J.; Yamaguchi, T.; Wambura, P. N.; Maeda-Machang'u, A. D.; Ohya, K. & Fukushi, H. Molecular characterization of infectious bursal disease virus (IBDV): diversity of very virulent IBDV in Tanzania, Archives of virology, Springer, 2007, 152, 783-790 Kirchenbaum, G. A. & Ross, T. M. Eliciting broadly protective antibody responses against influenza, Current opinion in immunology, Elsevier, 2014, 28, 71-76 Kirunda, H.; Erima, B.; Tumushabe, A.; Kiconco, J.; Tugume, T.; Mulei, S.; Mimbe, D.; Mworozi, E.; Bwogi, J. & Luswa, L. Prevalence of influenza A viruses in livestock and free-living waterfowl in Uganda, BMC veterinary research, BioMed Central, 2014, 10, 50 Krammer, F. & Palese, P. Influenza virus hemagglutinin stalk-based antibodies and vaccines, Current opinion in virology, Elsevier, 2013, 3, 521-530 Krijger, J.-J.; Baumann, J.; Wagner, M.; Schulze, K.; Reinsch, C.; Klose, T.; Onuma, O. F.; Simon, C.; Behrens, S.-E. & Breunig, K. D. A novel, lactase-based selection and strain improvement strategy for recombinant protein expression in Kluyveromyces lactis, Microbial Cell Factories, 2012, 11, 112 Kumar, K.; Singh, K. C. P. & Prasad, C. B. Immune responses to intermediate strain IBD vaccine at different levels of maternal antibody in broiler chickens, Tropical animal health and production, Springer, 2000, 32, 357-360 Negash, T.; Gelaye, E.; Petersen, H.; Grummer, B. & Rautenschlein, S. Molecular evidence of very virulent infectious bursal disease viruses in chickens in Ethiopia, Avian diseases, BioOne, 2012, 56, 605-610 Rautenschlein, S.; Kraemer, C. H.; Vanmarcke, J. & Montiel, E. Protective efficacy of intermediate and intermediate plus infectious bursal disease virus (IBDV) vaccines against very virulent IBDV in commercial broilers, Avian diseases, BioOne, 2005, 49, 231-237 Remington's Practice of Pharmacy, 13th edition and J. of Pharmaceutical Science & Technology, Vol. 52, No. 5, September-October, pages 238-311 Ridpath, J. F. Emerging pestiviruses infecting domestic and wildlife hosts, Animal Health Research Reviews, Cambridge University Press, 2015, 16, 55-59 RKI, Influenza (Teil 2): Erkrankungen durch zoonotische Influenzaviren [Influenza (part 2): diseases due to zoonotic influenza viruses], 2016 Schrauwen, E. J. A. & Fouchier, R. A. M. Host adaptation and transmission of influenza A viruses in mammals, Emerging microbes & infections, Nature Publishing Group, 2014, 3, e9 Short, K. R.; Richard, M.; Verhagen, J. H.; van Riel, D.; Schrauwen, E. J. A.; van den Brand, J. M. A.; Manz, B.; Bodewes, R. & Herfst, S. One health, multiple challenges: The inter-species transmission of influenza A virus, One health, Elsevier, 2015, 1,1-13 Steel, J.; Lowen, A. C.; Wang, T. T.; Yondola, M.; Gao, Q.; Haye, K.; Garc?a-Sastre, A. & Palese, P. Influenza virus vaccine based on the conserved hemagglutinin stalk domain, MBio, Am Soc Microbiol, 2010, 1, e00018-10 WHO, Influenza (Seasonal), 2016 WHO, Biologicals, Influenza, 2017