Genetic engineering of fungi to modulate tryptamine expression
11905535 ยท 2024-02-20
Assignee
Inventors
- Thomas HENLEY (New York, NY, US)
- Modassir Choudhry (New York, NY)
- Jose FERNANDEZ-GOMEZ (New York, NY, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/1205
CHEMISTRY; METALLURGY
C12Y207/01
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N9/12
CHEMISTRY; METALLURGY
Abstract
Provided herein are methods for modulating the psilocybin biosynthesis pathway in fungi or other organisms. Also provided are genetically modified fungi and organisms with induced and/or increased expression of psilocybin and psilocin and psilocybin and/or psilocin compositions generated by the provided methods.
Claims
1. A genetically modified Basidiomycota fungus, comprising an expressed exogenous PsiD gene or an expressed exogenous PsiH gene, or both, and wherein the genetically modified Basidiomycota fungus produces an increased production of a compound selected from the group consisting of: ##STR00010## and any combination thereof, as compared to production of the same compound(s) in a comparable control Basidiomycota fungus without the expressed exogenous PsiD gene or the expressed exogenous PsiH gene, or both, and wherein the genetically modified Basidiomycota fungus comprises at least 200% more psilocybin measured by dry weight of the genetically modified Basidiomycota fungus compared to an amount of psilocybin in a comparable control Basidiomycota fungus without the expressed exogenous PsiD gene or the expressed exogenous PsiH gene, or both.
2. The genetically modified Basidiomycota fungus of claim 1, comprising the expressed exogenous PsiD gene that is comprised in a plasmid and is operably linked to a 35S, GPD, EFla, Actin or CcDED1 promoter.
3. The genetically modified Basidiomycota fungus of claim 1, wherein the genetically modified Basidiomycota fungus is a Conocybe, Gymnopilus, Paneolus, Pluteus, or Stropharia fungus.
4. The genetically modified Basidiomycota fungus of claim 1, comprising the expressed exogenous PsiH gene that results in increased: tryptamine-4-hydroxylation in the genetically modified Basidiomycota fungus compared to a comparable control Basidiomycota fungus without said expressed exogenous PsiH gene.
5. The genetically modified Basidiomycota fungus of claim 2, wherein the plasmid further comprises a barcode, a reporter gene, or a selection marker.
6. The genetically modified Basidiomycota fungus of claim 2, wherein the plasmid is delivered into the genetically Basidiomycota fungus via electroporation, microinjection, mechanical cell deformation, lipid nanoparticles, AAV, lentivirus, agrobacterium mediated transformation, biolistic particle bombardment, or protoplast transformation.
7. The genetically modified Basidiomycota fungus of claim 1 that results in an increased production of DMT, a derivative thereof, or an analog thereof, compared to production of the DMT, derivative thereof, or analog thereof in a comparable control Basidiomycota fungus without the expressed exogenous PsiD gene or the expressed exogenous PsiH gene, or both.
8. The genetically modified Basidiomycota fungus of claim 1, comprising the expressed exogenous PsiD gene that results in an increased production of psilocybin compared to production of psilocybin in a comparable control Basidiomycota fungus without the expressed exogenous PsiD gene or the expressed exogenous PsiH gene, or both.
9. The genetically modified Basidiomycota fungus of claim 1, comprising the expressed exogenous PsiD gene that results in an increased production of psilocin, compared to production of psilocin in a comparable control Basidiomycota fungus without the expressed exogenous PsiD gene or the expressed exogenous PsiH gene, or both.
10. The genetically modified Basidiomycota fungus of claim 1 that results in an increased production of psilocybin and psilocin compared to production of psilocybin and psilocin in a comparable control Basidiomycota fungus without the expressed exogenous PsiD gene or the expressed exogenous PsiH gene, or both.
11. The genetically modified Basidiomycota fungus of claim 1, comprising the expressed exogenous PsiD gene.
12. The genetically modified Basidiomycota fungus of claim 1, comprising the expressed exogenous PsiD gene that has a sequence comprising SEQ ID NO: 1.
13. The genetically modified Basidiomycota fungus of claim 1, comprising the expressed exogenous PsiD gene that comprises at least 200% more psilocin measured by dry weight of the genetically modified Basidiomycota fungus compared to an amount of psilocin in a comparable control Basidiomycota fungus without the expressed exogenous PsiD gene or the expressed exogenous PsiH gene, or both.
14. The genetically modified Basidiomycota fungus of claim 1, comprising the expressed exogenous PsiH gene that has a sequence comprising SEQ ID NO: 2.
15. The genetically modified Basidiomycota fungus of claim 1, comprising the expressed exogenous PsiH gene that has a sequence comprising SEQ ID NO: 9.
16. A pharmaceutical composition comprising cells of the genetically modified Basidiomycota fungus of claim 1 and a pharmaceutically acceptable diluent, excipient, or carrier.
17. A pharmaceutical composition comprising cells of the genetically modified Basidiomycota fungus of claim 11 and a pharmaceutically acceptable diluent, excipient, or carrier.
18. A kit comprising a packaging and cells of the genetically modified Basidiomycota fungus of claim 1.
19. A kit comprising a packaging and the pharmaceutical composition of claim 16.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:
(2)
(3)
(4)
(5)
(6)
(7)
DETAILED DESCRIPTION
(8) As used in the specification and claims, the singular forms a, an, and the include plural references unless the context clearly dictates otherwise. For example, the term a chimeric transmembrane receptor polypeptide includes a plurality of chimeric transmembrane receptor polypeptides.
(9) The term about or approximately means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which can depend in part on how the value can be measured or determined, i.e., the limitations of the measurement system. For example, about can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, about can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated, the term about meaning within an acceptable error range for the particular value should be assumed.
(10) As used herein, a cell can generally refer to a biological cell. A cell can be the basic structural, functional and/or biological unit of a living organism. A cell can originate from any organism having one or more cells. Some non-limiting examples include: a prokaryotic cell, eukaryotic cell, a bacterial cell, an archaeal cell, a cell of a single-cell eukaryotic organism, a protozoa cell, a cell from a plant, an algal cell, seaweeds, a fungal cell, an animal cell, a cell from an invertebrate animal, a cell from a vertebrate animal, a cell from a mammal, and the like. Sometimes a cell is not originating from a natural organism (e.g. a cell can be a synthetically made, sometimes termed an artificial cell).
(11) The term gene, as used herein, refers to a nucleic acid (e.g., DNA such as genomic DNA and cDNA) and its corresponding nucleotide sequence that can be involved in encoding an RNA transcript. The term as used herein with reference to genomic DNA includes intervening, non-coding regions as well as regulatory regions and can include 5 and 3 ends. In some uses, the term encompasses the transcribed sequences, including 5 and 3 untranslated regions (5-UTR and 3-UTR), exons and introns. In some genes, the transcribed region can contain open reading frames that encode polypeptides. In some uses of the term, a gene comprises only the coding sequences (e.g., an open reading frame or coding region) necessary for encoding a polypeptide. In some cases, genes do not encode a polypeptide, for example, ribosomal RNA genes (rRNA) and transfer RNA (tRNA) genes. In some cases, the term gene includes not only the transcribed sequences, but in addition, also includes non-transcribed regions including upstream and downstream regulatory regions, enhancers and promoters. A gene can refer to an endogenous gene or a native gene in its natural location in the genome of an organism. A gene can refer to an exogenous gene or a non-native gene. A non-native gene can refer to a gene not normally found in the host organism but which can be introduced into the host organism by gene transfer. A non-native gene can also refer to a gene not in its natural location in the genome of an organism. A non-native gene can also refer to a naturally occurring nucleic acid or polypeptide sequence that comprises mutations, insertions and/or deletions (e.g., non-native sequence).
(12) The term nucleotide, as used herein, generally refers to a base-sugar-phosphate combination. A nucleotide can comprise a synthetic nucleotide. A nucleotide can comprise a synthetic nucleotide analog. Nucleotides can be monomeric units of a nucleic acid sequence (e.g. deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)). The term nucleotide can include ribonucleoside triphosphates adenosine triphosphate (ATP), uridine triphosphate (UTP), cytosine triphosphate (CTP), guanosine triphosphate (GTP) and deoxyribonucleoside triphosphates such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such derivatives can include, for example, [S]dATP, 7-deaza-dGTP and 7-deaza-dATP, and nucleotide derivatives that confer nuclease resistance on the nucleic acid molecule containing them. The term nucleotide as used herein can refer to dideoxyribonucleoside triphosphates (ddNTPs) and their derivatives. Illustrative examples of dideoxyribonucleoside triphosphates can include, but are not limited to, ddATP, ddCTP, ddGTP, ddITP, and ddTTP. A nucleotide can be unlabeled or detectably labeled by well-known techniques. Labeling can also be carried out with quantum dots. Detectable labels can include, for example, radioactive isotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels and enzyme labels. Fluorescent labels of nucleotides can include but are not limited fluorescein, 5-carboxyfluorescein (FAM), 27-dimethoxy-45-dichloro-6-carboxyfluorescein (JOE), rhodamine, 6-carboxyrhodamine (R6G), N,N,N,N-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 4-(4dimethylaminophenylazo) benzoic acid (DABCYL), Cascade Blue, Oregon Green, Texas Red, Cyanine and 5-(2-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS). Specific examples of fluorescently labeled nucleotides can include [R6G]dUTP, [TAMRA]dUTP, [R110]dCTP, [R6G]dCTP, [TAMRA]dCTP, [JOE]ddATP, [R6G]ddATP, [FAM]ddCTP, [R110]ddCTP, [TAMRA]ddGTP, [ROX]ddTTP, [dR6G]ddATP, [dR110]ddCTP, [dTAMRA]ddGTP, and [dROX]ddTTP available from Perkin Elmer, Foster City, Calif.; FluoroLink DeoxyNucleotides, FluoroLink Cy3-dCTP, FluoroLink Cy5-dCTP, FluoroLink Fluor X-dCTP, FluoroLink Cy3-dUTP, and FluoroLink Cy5-dUTP available from Amersham, Arlington Heights, Ill.; Fluorescein-15-dATP, Fluorescein-12-dUTP, Tetramethyl-rodamine-6-dUTP, IR770-9-dATP, Fluorescein-12-ddUTP, Fluorescein-12-UTP, and Fluorescein-15-2-dATP available from Boehringer Mannheim, Indianapolis, Ind.; and Chromosome Labeled Nucleotides, BODIPY-FL-14-UTP, BODIPY-FL-4-UTP, BODIPY-TMR-14-UTP, BODIPY-TMR-14-dUTP, BODIPY-TR-14-UTP, BODIPY-TR-14-dUTP, Cascade Blue-7-UTP, Cascade Blue-7-dUTP, fluorescein-12-UTP, fluorescein-12-dUTP, Oregon Green 488-5-dUTP, Rhodamine Green-5-UTP, Rhodamine Green-5-dUTP, tetramethylrhodamine-6-UTP, tetramethylrhodamine-6-dUTP, Texas Red-5-UTP, Texas Red-5-dUTP, and Texas Red-12-dUTP available from Molecular Probes, Eugene, Oreg. Nucleotides can also be labeled or marked by chemical modification. A chemically-modified single nucleotide can be biotin-dNTP. Some non-limiting examples of biotinylated dNTPs can include, biotin-dATP (e.g., bio-N6-ddATP, biotin-14-dATP), biotin-dCTP (e.g., biotin-11-dCTP, biotin-14-dCTP), and biotin-dUTP (e.g. biotin-11-dUTP, biotin-16-dUTP, biotin-20-dUTP).
(13) References to a percentage sequence identity between two nucleotide sequences means that, when aligned, that percentage of nucleotides are the same in comparing the two sequences. This alignment and the percent homology or sequence identity can be determined using software programs known in the art, for example those described in section 7.7.18 of Current Protocols in Molecular Biology (F. M. Ausubel et al., eds., 1987) Supplement 30 (incorporated by reference). A preferred alignment is determined by the Smith-Waterman homology search algorithm using an affine gap search with a gap open penalty of 12 and a gap extension penalty of 2, BLOSUM matrix of 62. The Smith-Waterman homology search algorithm is disclosed in Smith & Waterman (1981) Adv. Appl. Math. 2: 482-489 (incorporated by reference).
(14) As used herein, the term plant includes a whole plant and any descendant, cell, tissue, or part of a plant. A class of plant that can be used in the present disclosure can be generally as broad as the class of higher and lower plants amenable to mutagenesis including angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns and multicellular algae. Thus, plant includes dicot and monocot plants. The term plant parts include any part(s) of a plant, including, for example and without limitation: seed (including mature seed and immature seed); a plant cutting; a plant cell; a plant cell culture; a plant organ (e.g., pollen, embryos, flowers, fruits, shoots, leaves, roots, stems, and explants). A plant tissue or plant organ may be a seed, protoplast, callus, or any other group of plant cells that can be organized into a structural or functional unit. A plant cell or tissue culture may be capable of regenerating a plant having the physiological and morphological characteristics of the plant from which the cell or tissue was obtained, and of regenerating a plant having substantially the same genotype as the plant. In contrast, some plant cells are not capable of being regenerated to produce plants. Regenerable cells in a plant cell or tissue culture may be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, silk, flowers, kernels, ears, cobs, husks, or stalks.
(15) As used herein, the term transgene refers to a segment of DNA which has been incorporated into a host genome or is capable of autonomous replication in a host cell and is capable of causing the expression of one or more coding sequences. Exemplary transgenes will provide the host cell, or plants regenerated therefrom, with a novel phenotype relative to the corresponding non-transformed cell or plant. Transgenes may be directly introduced into a plant by genetic transformation, or may be inherited from a plant of any previous generation which was transformed with the DNA segment. In some cases, a transgene can be a barcode. In some cases, a transgene can be a marker.
(16) As used herein, transgenic organisms, generally refer to recombinant organisms in which a desired DNA sequence or genetic locus within the genome of an organism is modified by insertion, deletion, substitution, or other manipulation of nucleotide sequences.
(17) As used herein, the term transgenic plant refers to a plant or progeny plant of any subsequent generation derived therefrom, wherein the DNA of the plant or progeny thereof contains an introduced exogenous DNA segment not naturally present in a non-transgenic plant of the same strain. The transgenic plant may additionally contain sequences which are native to the plant being transformed, but wherein the exogenous gene has been altered in order to alter the level or pattern of expression of the gene, for example, by use of one or more heterologous regulatory or other elements.
(18) A vector can be a polynucleotide (e.g., DNA or RNA) used as a vehicle to artificially carry genetic material into a cell, where it can be replicated and/or expressed. In some aspects, a vector is a binary vector or a Ti plasmid. Such a polynucleotide can be in the form of a plasmid, YAC, cosmid, phagemid, BAC, virus, or linear DNA (e.g., linear PCR product), for example, or any other type of construct useful for transferring a polynucleotide sequence into another cell. A vector (or portion thereof) can exist transiently (i.e., not integrated into the genome) or stably (i.e., integrated into the genome) in the target cell. In some aspects, a vector can further comprise a selection marker or a reporter.
(19) The practice of some methods disclosed herein employ, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which are within the skill of the art. See for example Sambrook and Green, Molecular Cloning: A Laboratory Manual, 4th Edition (2012); the series Current Protocols in Molecular Biology (F. M. Ausubel, et al. eds.); the series Methods In Enzymology (Academic Press, Inc.), PCR 2: A Practical Approach (M. J. MacPherson, B. D. Hames and G. R. Taylor eds. (1995)), Harlow and Lane, eds. (1988) Antibodies, A Laboratory Manual, and Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications, 6th Edition (R. I. Freshney, ed. (2010)).
(20) The present disclosure provides genetically modified organisms producing an increased amount of tryptamine-derived substance, such as psilocybin and psilocin, as well as expression cassettes, vectors, compositions, and materials and methods for producing the same. Provided herein are also methods of making genetically modified organisms utilizing Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), Argonaut, zinc-finger, TALEN or other nuclease based technologies and reagents for generating the genetically modified organisms. Compositions and methods provided herein can be utilized for the generation of fungi or plants with increased tryptamine-derived substance production. Compositions provided herein can be utilized for various uses including but not limited to therapeutic uses, preventative uses, palliative uses, and recreational uses.
(21) Psilocybe mushrooms contain psilocybin in trace amounts (0.1-1.7%) (Table 1). Production of psilocybin is expensive, due to rarity in mushrooms and the expensive synthetic production process. Research price of psilocybin is $7,000 to $10,000 per gram.
(22) TABLE-US-00001 TABLE 1 Psilocybin occurs in trace amounts (0.1-1.7%) in Psilocybe mushrooms Alkaloidal content (%).sup.a Species Psilocybin Psiloscin Bacocystin P. azurescens 1.76 0.38 0.35 P. baceocystis 0.85 0.59 0.10 P. bohemica 1.34 0.11 0.02 P. cubensis 0.63 0.60 0.025 P. cyanescens 0.85 0.36 0.03 P. cyanofibrillosa 0.21 0.04 0.00 P. hongshageaii 0.60 0.10 0.00 P. liniformans 0.16 0.00 0.005 P. pelliculosa 0.12 0.00 0.00 P. samuiensis 0.36 0.21 0.02 P. semilanceata 0.98 0.02 0.36 P. semperviva 0.30 0.07 0.00 P. subcubensis 0.80 0.02 0.00 P. stuntzii 0.36 0.12 0.02 P. campanensis 0.68 0.32 0.00 P. welii 0.61 0.27 0.05 .sup.aAverage content and may vary in different regions due to environmental condit
(23) The structure of psilocybin has been known for 60 years but only recently have the psilocybin biosynthesis enzymes have been identified. This has facilitated the opportunity to now enhance the production of this Psychotropic compound within the mushroom to advance research into psilocybin's medical uses. The yields, potency and efficacy of psilocybin production may be improved by state-of-art plant CRISPR engineering platform. A demonstrated 10-fold increase in Psilocybin production in mushrooms from 1 to 10% (% dry mycelial mass) would be of significant value to the industry.
Genetically Modified Organisms
(24) Provided herein are methods and compositions to modify biosynthesis pathways in organisms to increase production of psilocybin and psilocin in said organism. In embodiments provided herein, using gene editing, the production of early, intermediate, and/or late precursor compounds such as tryptamine and tryptamine derivatives such as dimethyl tryptamine is increased to generate desired end products such as psilocybin and psilocin.
(25) Additionally, provided are methods and compositions for switching off specific pathways of tryptophan consumption using gene editing to generate genetically modified organisms with a higher expression levels of tryptamine and/or tryptamine related substances such as psilocybin and psilocin.
(26) A genetically modified organism as described herein can be a plant, animal, bacteria, yeast or fungus. In some cases, the fungus is a mushroom. Specific mushrooms of the genus Psilocybe, Conocybe, Gymnopilus, Panaeolus, Pluteus, and Stropharia produce psychotropically active tryptamine-derived substance, for instance psilocybin or psilocin as described herein, the production of which is enhanced by the genetic modifications described herein. In some cases, a genetically modified organism as described herein is a mushroom selected from Panaeolus cyanescecens, Panaeolus cubensis and Pleurotus nebrodensis.
(27) In embodiments described herein, are genetically modified cells or organisms that enhance the conversion of L-tryptophan or 4-hydroxy-L-tryptophan to tryptamine. In some cases, the genetically modified cell or organism comprises a genetic modification that suppresses or minimizes alternate pathways of consumption of either 4-hydroxy-L-tryptophan or tryptophan, thereby enhancing the formation of tryptamine and optionally downstream derivatives of tryptamine such as psilocybin and psilocin. In some cases this enhancement is achieved by introducing or upregulating genes associated with the expression or activity of tryptophan decarboxylase PsiD.
(28) In some cases are genetically modified cells or organisms in which an enhancement in the production of psilocin or psilocybin is achieved by introducing or upregulating genes associated with the conversion of tryptamine to 4-hydroxytryptamine, for instance P450 monooxygenase PsiH. In some cases, are genetically modified cells or organisms with an enhanced production of norbaeocystin by upregulation of genes associated with the conversion of tryptamine, tryptophan or 4-hydroxytryptamine to norbaeocystin. In some cases, such an upregulation is achieved by upregulation or introduction of 4-hydroxytryptamine kinase, PsiK, by modifying a promoter or enhancer sequence associated with the gene or knocking-in the gene into the cell or organism.
(29) In some cases are genetically modified cells or organisms in which an enhancement in the production of psilocin or psilocybin is achieved by introducing or upregulating genes associated with the conversion of norbaeocystin to baeocystin, or by increasing production of baeocystin. In some cases the upregulation is achieved by increasing synthesis of a norbaeocystin methyltransferase gene by modifying a promoter or enhancer sequence associated with the gene or knocking-in the gene into the cell or organism.
(30) In certain embodiments, a tryptophan decarboxylase gene as described herein can be PsiD (a representative mRNA sequence is provided in Table 3). In some cases, a gene encoding the tryptophan decarboxylase may comprises a sequence identity from about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or up to about 100% to: SEQ ID NO: 1. Enzyme PsiD may be a 49.6 kDa enzyme and belongs to the PLP-independent phosphatidylserine decarboxylase family. In certain embodiments, PsiD is upregulated in a cell or organism by genetically editing a promoter or enhancer sequence in the gene or associated with the gene. In certain embodiments, PsiD is upregulated or synthesized in a genetically modified cell or organism by introducing a PsiD gene in said cell or organism by use of a gene editing technique described herein.
(31) In some cases a genetically modified cell or organism described herein comprises an upregulation in expression of a P450 monooxygenase PsiH gene (a representative mRNA sequence is provided in Table 3). In some cases, a gene encoding the monooxygenase may comprises a sequence identity from about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or up to about 100% to: SEQ ID NO: 2. In certain embodiments PsiH is upregulated in a cell or organism by genetically editing a promoter or enhancer sequence in the gene or associated with the gene. In certain embodiments, PsiH is upregulated or synthesized in a genetically modified cell or organism by introducing a PsiH gene in said cell or organism by use of a gene editing technique described herein.
(32) In some cases a genetically modified cell or organism described herein comprises an upregulation in expression of 4-hydroxytryptamine kinase PsiK gene (a representative mRNA sequence is provided in Table 3). In some cases, a gene encoding the 4-hydroxytryptamine kinase may comprises a sequence identity from about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or up to about 100% to: SEQ ID NO: 3. In certain embodiments PsiK is upregulated in a cell or organism by genetically editing a promoter or enhancer sequence in the gene or associated with the gene. In certain embodiments, PsiK is upregulated or synthesized in a genetically modified cell or organism by introducing a PsiK gene, for instance the gene of Seq ID NO: 3 in said cell or organism by use of a gene editing technique described herein.
(33) In some cases a genetically modified cell or organism described herein comprises an upregulation in expression of norbaeocystin methyltransferase PsiM gene (a representative mRNA sequence is provided in Table 3). In some cases, a gene encoding the methyltransferase may comprises a sequence identity from about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or up to about 100% to any one of: SEQ ID NO: 4. In certain embodiments PsiM is upregulated in a cell or organism by genetically editing a promoter or enhancer sequence in the gene or associated with the gene. In certain embodiments, PsiM is upregulated or synthesized in a genetically modified cell or organism by introducing a PsiM gene, for instance the gene of Seq ID NO: 4 in said cell or organism by use of a gene editing technique described herein. In certain cases, a class I methyltransferase gene or a derivative thereof comprising a Rossmann-fold, with the amino sequence GVDIGTGAS (SEQ ID NO: 21) is introduced in the cell or organism to increase psilocybin production.
(34) Other putative transcriptional regulators and transporter that affect the production and accumulation of produced psilocybin in fungi or other organisms can be modified in organisms and cells described herein. In some cases, the putative transcriptional regulators may promote the transcription or translation of a methyltransferase, hydroxylase, monooxygenase, kinase, or decarboxylase described herein, for instance PsiD, PsiH, PsiK or PsiM. In some cases, the putative transcriptional regulators can promote down-regulate the transcription or translation of enzymes, such as a methyltransferase, hydroxylase, monooxygenase, kinase, or decarboxylase described herein, for instance PsiD, PsiH, PsiK or PsiM.
(35) In certain embodiments, genetic modification technologies disclosed herein can be used to enhance the expression of facilitator family transporters (PsiT1 and PsiT2, or a helix-loop-helix (HLH)-domain transcriptional regulator (PsiR) by genetically editing a promoter or enhancer sequence in the gene or associated with the gene, or by introducing an additional copy of one or more said gene or homologue thereof. It may also play a role in ensuring that the synthesized psilocybin is transported and localized correctly in fungi and other organisms. In certain embodiments PsiR, PsiT1 or PsiT2 is upregulated in a cell or organism by genetically editing a promoter or enhancer sequence in the gene or associated with the gene. In certain embodiments, PsiR, PsiT1 or PsiT2 is upregulated or synthesized in a genetically modified cell or organism by introducing a PsiR, PsiT1 or PsiT2 gene, for instance the gene of Seq ID NO: 5 in said cell or organism by use of a gene editing technique described herein.
(36) A representative sequence of a gene that encodes PsiT2 is listed in Table 3. In some cases, a gene encoding PsiT2 may comprises a sequence identity from about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or up to about 100% to any one of: SEQ ID NO: 5.
(37) The above-mentioned genes can be modified by the disclosed genetic modification technologies herein to increase the production of enzymes involved in the psilocybin biosynthesis pathway, putative regulators, and putative transporters or produce such enzymes, regulators and transporters de novo in a genetically modified cell or organism described herein. For example, expression level of specific enzyme along the psilocybin biosynthesis pathway may be increased to increase production of one or more of tryptamine, 4-Hydroxytryptamine, baeocystin, norbaeocystin and psilocybin. In some cases, a genetic modification is in a promoter or enhancer region of or associated with one or more genes described herein.
(38) In certain embodiments, genes associated with pathways that also utilize tryptophan and/or 4-hydroxy-L-tryptophan are modified by a genetic modification technology described herein to down-regulate or knockout these genes, thereby reducing tryptophan consumption and/or 4-hydroxy-L-tryptophan consumption by these pathways. Downregulated or knocked-out genes can include for instance Indoleamine 2,3-dioxygenase (IDO), tryptophan 2,3-dioxygenase (TDO), and TrpM. TrpM is a methyltransferase that has Mono- and dimethylation activity on tryptophan but is not part of psilocybin biosynthesis pathway. Downregulation or knock-out of genes such as IDO, TDO, TrpM in a genetically modified organism or cell described herein results in increased availability of tryptophan and/or 4-hydroxy-L-tryptophan for psilocybin production.
(39) In certain embodiments are genetically modified cells or organisms comprising modifications that result in increased production of tryptophan and/or 4-hydroxy-L-tryptophan. These modifications include an upregulation in genes encoding phospho-2-dehydro-3-deoxyheptonate aldolase, 3-dehydroquinate synthase, 3-dehydroquinate dehydratase, shikimate dehydrogenase, 3-phosphoshikimate 1-carboxyvinyltransferase, shikimate kinase 1, shikimate kinase 2, chorismate synthase, tryptophan synthase alpha chain, tryptophan synthase beta chain, anthranilate phosphoribosyltransferase, or anthranilate synthase component. Upregulation of these genes is achieved by increase the production of the gene by modifying a promoter or enhancer in or associated with the gene, or by increasing the copy number of said gene in the organism or cell.
(40) By increasing these enzymes's expression, more substrates tryptophan and/or 4-hydroxy-L-tryptophan is produced, leading to increase psilocybin and/or psilocin production.
(41) Provided herein are methods and compositions to characterize the Psilocybin biosynthesis pathway and enzymes. In embodiments provided herein, candidate psilocybin genes are identified by sequencing three diverse Psilocybin positive (PS.sup.+) mushroom homokaryon genomes: Ps. cyanescens, Pa. (=Copelandia) cyanescens, and Gy. Dilepis. In certain embodiments, five genes were clustered, all in PS.sup.+ genomes: tryptophan decarboxylase (PsiD); psilocybin-related N-methyltransferase (PsiM); psilocybin-related hydroxylase (PsiH); psilocybin-related phosphotransferase (PsiK); psilocybin-related transporter (PsiT). In certain embodiments, PsiD, the first committed step in the reaction and the only one not producing a drug-scheduled compound, has specific decarboxylase activity on tryptophan producing tryptamine. In certain embodiments, gene duplications among the clusters relate to alternate or reticulated pathways for genetic modification.
(42) In embodiments described herein, the coding sequences of the genes within the PS.sup.+ cluster have been identified from several Mushrooms and as provided herein. In certain embodiments, information also exists on the intronic or exonic architecture of these genes (a representative list of genes is provided in Table 2).
(43) TABLE-US-00002 TABLE 2 Length and number of introns of Psilocybin biosynthetic genes in P. cubensis and P. cyanescens. If there are two values in a cell, the first value refers to the respective gene of P. cubensis, the second to P. cyanescens. Values for P. cyanescens genes and for PsiR, PsiT1, and PsiT2 of P. cubensis are predicted, using the Augustus algorithm. number Predicted or of verified function GenBank accession gene length (bp) introns cDNA length of gene product number PsiD 1426/1441 2/2 1320/1320 L-tryptophan KY984101/KY984104 decarboxylase PsiH 2155/2128 10/10 1527/1527 monooxygenase MF000993/MF000997 PsiK 1152/1147 1/1 1089/1086 kinase KY984099/KY984102 PsiM 1587/1580 11/11 930/930 N- KY984100/KY984103 methyltransferase PsiT2 2014/2047 8/8 1572/1587 transporter MF000992/MF000996 PsiT1 1696/1696 5/5 1416/1419 transporter MF000991/MF000995 PsiR 1556/1619 2/2 1077/1113 transcription MF000990/MF000994 factor
(44) TABLE-US-00003 TABLE3 Genesequencesforgeneswithenhancedexpressioningeneticallymodified cellsororganismsdescribedherein.Expressionisenhancedbymodification ofapromoterorenhancerinorassociatedwiththegene,orbyintroducing acopyofthegeneinthecellororganism. SEQ ID NO Name Sequence 1 Psilocybe atgcaggtgatacccgcgtgcaactcggcagcaataagatcactatgtcc cubensis tactcccgag strain tcttttagaaacatgggatggctctctgtcagcgatgcggtctacagcga FSU12409 gttcatagga tryptophan gagttggctacccgcgcttccaatcgaaattactccaacgagttcggcct decarboxylase catgcaacct (PsiD)mRNA, atccaggaattcaaggctttcattgaaagcgacccggtggtgcaccaaga completecds atttattgac GenBank: atgttcgagggcattcaggactctccaaggaattatcaggaactatgtaa KY984101.1 tatgttcaac gatatctttcgcaaagctcccgtctacggagaccttggccctcccgttta tatgattatg gccaaattaatgaacacccgagcgggcttctctgcattcacgagacaaag gttgaacctt cacttcaaaaaacttttcgatacctggggattgttcctgtcttcgaaaga ttctcgaaat gttcttgtggccgaccagttcgacgacagacattgcggctggttgaacga gcgggccttg tctgctatggttaaacattacaatggacgcgcatttgatgaagtcttcct ctgcgataaa aatgccccatactacggcttcaactcttacgacgacttctttaatcgcag atttcgaaac cgagatatcgaccgacctgtagtcggtggagttaacaacaccaccctcat ttctgctgct tgcgaatcactttcctacaacgtctcttatgacgtccagtctctcgacac tttagttttc aaaggagagacttattcgcttaagcatttgctgaataatgaccctttcac cccacaattc gagcatgggagtattctacaaggattcttgaacgtcaccgcttaccaccg atggcacgca cccgtcaatgggacaatcgtcaaaatcatcaacgttccaggtacctactt tgcgcaagcc ccgagcacgattggcgaccctatcccggataacgattacgacccacctcc ttaccttaag tctcttgtctacttctctaatattgccgcaaggcaaattatgtttattga agccgacaac aaggaaattggcctcattttccttgtgttcatcggcatgaccgaaatctc gacatgtgaa gccacggtgtccgaaggtcaacacgtcaatcgtggcgatgacttgggaat gttccatttc ggtggttcttcgttcgcgcttggtctgaggaaggattgcagggcagagat cgttgaaaag ttcaccgaacccggaacagtgatcagaatcaacgaagtcgtcgctgctct aaaggcttag 2 Psilocybe atgatcgctgtactattctccttcgtcattgcaggatgcatatactacat cubensis cgtttctcgt strain agagtgaggcggtcgcgcttgccaccagggccgcctggcattcctattcc FSU12409 cttcattgggaacatgtttgatatgcctgaagaatctccatggttaacat putative ttctacaatggggacgggattacagtctgtcttgccgcgttgacttctaa monooxygenase tatatgaacagctaatatattgtcagacaccgatattctctacgtggatg (PsiH)gene, ctggagggacagaaatggttattcttaacacgttggagaccattaccgat completecds ctattagaaaagcgagggtccatttattctggccggtgagctgatgttga GenBank: gttttttgcaattgaatttgtggtcacacgtttccagacttgagagtaca MF000993.1 atggtcaacgaacttatggggtgggagtttgacttagggttcatcacata cggcgacaggtggcgcgaagaaaggcgcatgttcgccaaggagttcagtg agaagggcatcaagcaatttcgccatgctcaagtgaaagctgcccatcag cttgtccaacagcttaccaaaacgccagaccgctgggcacaacatattcg ccagtaagtactacttgaggaaaatagcgtacgcttcgctgaccggtccg tacatcaaagtcagatagcggcaatgtcactggatattggttatggaatt gatcttgcagaagacgacccttggctggaagcgacccatttggctaatga aggcctcgccatagcatcagtgccgggcaaattttgggtcgattcgttcc cttctcgtgagcatccttcttctatgtaggaagggaaggagtctaacaag tgttagtaaaataccttcctgcttggttcccaggtgctgtcttcaagcgc aaagcgaaggtctggcgagaagccgccgaccatatggttgacatgcctta tgaaactatgaggaaattagcagttagtcaaatgcgttctccccgtattt tttcaatactctaacttcagctcacagcctcaaggattgactcgtccgtc gtatgcttcagctcgtctgcaagccatggatctcaacggtgaccttgagc atcaagaacacgtaatcaagaacacagccgcagaggttaatgtcggtaag tcaaaagcgtccgtcggcaattcaaaattcaggcgctaaagtgggtcttc tcaccaaggtggaggcgatactgtaaggatttctcaatcgttagagtata agtgttctaatgcagtacatactccaccaaccagactgtctctgctatgt ctgcgttcatcttggccatggtgaagtaccctgaggtccagcgaaaggtt caagcggagcttgatgctctgaccaataacggccaaattcctgactatga cgaagaagatgactccttgccatacctcaccgcatgtatcaaggagcttt tccggtggaatcaaatcgcacccctcgctataccgcacaaattaatgaag gacgacgtgtaccgcgggtatctgattcccaagaacactctagtcttcgc aaacacctggtgaggctgtccattcattcctagtacatccgttgccccac taatagcatc ttgataacagggcagtattaaacgatccagaagtctatccagatccctct gtgttccgcccagaaagatatcttggtcctgacgggaagcctgataacac tgtacgcgacccacgtaaagcggcatttggctatggacgacgaaattggt aagtgcgctttcagaacccccccttccgttgactagtgccatgcgcgcat acaatatcgctattgatctgatataacttccctgcggcatttattttggc attcctttagtcccggaattcatctagcgcagtcgacggtttggattgca ggggcaaccctcttatcagcgttcaatatcgagcgacctgtcgatcagaa tgggaagcccattgacataccggctgattttactacaggattcttcaggt agctaatttccgtctttgtgtgcataatacccctaacgacgcacgtttac ctttttgtaaagacacccagtgcctttccagtgcaggtttgttcctcgaa cagagcaagtctcacagtcggtatccggaccctga 3 Psilocybe atggcgttcgatctcaagactgaagacggcctcatcacatatctcactaa cubensis acatctttct strain ttggacgtcgacacgagcggagtgaagcgccttagcggaggctttgtcaa FSU124094- tgtaacctgg hydroxy- cgcattaagctcaatgctccttatcaaggtcatacgagcatcatcctgaa tryptamine gcatgctcag kinase ccgcacatgtctacggatgaggattttaagataggtgtagaacgttcggt (PsiK) ttacgaatac mRNA, caggctatcaagctcatgatggccaatcgggaggttctgggaggcgtgga complete tggcatagtt cds tctgtgccagaaggcctgaactacgacttagagaataatgcattgatcat GenBank: gcaagatgtc KY984099.1 gggaagatgaagacccttttagattatgtcaccgccaaaccgccacttgc gacggatata gcccgccttgttgggacagaaattggggggttcgttgccagactccataa cataggccgc gagaggcgagacgatcctgagttcaaattcttctctggaaatattgtcgg aaggacgact tcagaccagctgtatcaaaccatcatacccaacgcagcgaaatatggcgt cgatgacccc ttgctgcctactgtggttaaggaccttgtggacgatgtcatgcacagcga agagaccctt gtcatggcggacctgtggagtggaaatattcttctccagttggaggaggg aaacccatcg aagctgcagaagatatatatcctggattgggaactttgcaagtacggccc agcgtcgttg gacctgggctatttcttgggtgactgctatttgatatcccgctttcaaga cgagcaggtc ggtacgacgatgcggcaagcctacttgcaaagctatgcgcgtacgagcaa gcattcgatc aactacgccaaagtcactgcaggtattgctgctcatattgtgatgtggac cgactttatg cagtgggggagcgaggaagaaaggataaattttgtgaaaaagggggtagc tgcctttcac gacgccaggggcaacaacgacaatggggaaattacgtctaccttactgaa ggaatcatcc actgcgtaa 4 Psilocybe atgcatatcagaaatccttaccgtacaccaattgactatcaagcactttc cubensis agaggccttccctcccctcaagccatttgtgtctgtcaatgcagatggta strain ccagttctgttgacctcactatcccagaagcccagagggcgttcacggcc FSU12409 gctcttcttcatcgtgacttcgggctcaccatgaccataccagaagaccg norbaeo- tctgtgcccaacagtccccaataggttgaactacgttctgtggattgaag cystin atattttcaactacacgaacaaaaccctcggcctgtcggatgaccgtcct methyltrans- attaaaggcgttgatattggtacaggagcctccgcaatttatcctatgct ferase tgcctgtgctcggttcaaggcatggtctatggttggaacagaggtcgaga (PsiM) ggaagtgcattgacacggcccgcctcaatgtcgtcgcgaacaatctccaa mRNA, gaccgtctctcgatattagagacatccattgatggtcctattctcgtccc complete cattttcgaggcgactgaagaatacgaatacgagtttactatgtgtaacc cds ctccattctacgacggtgctgccgatatgcagacttcggatgctgccaaa GenBank: ggatttggatttggcgtgggcgctccccattctggaacagtcatcgaaat KY984100.1 gtcgactgagggaggtgaatcggctttcgtcgctcagatggtccgtgaga gcttgaagcttcgaacacgatgcagatggtacacgagtaacttgggaaag ctgaaatccttgaaagaaatagtggggctgctgaaagaacttgagataag caactatgccattaacgaatacgttcaggggtccacacgtcgttatgccg ttgcgtggtctttcactgatattcaactgcctgaggagctttctcgtccc tctaaccccgagctcagctctcttttctag 5 Psilocybe atgtctctggagcgctcaacaagtccaaatcctaccgagcgtacatctcttctatctgac cubensis actgcgtcta strain ccatttcatccagagatgacgttgaacagtcaagtctgaagcaaaggcgcacgcctat FSU12409 accaactggaca putative acttggcggtaaggtctcaatgcattcaattattataaacgctgagggtcatttatggcct transporter tatattaac (PsiT2) cagtttgtgaatgatatcggcgtctctgatgggaatccacgtaatgttgggttctacagt gene, gggttgatcg complete aaagtgtatttgcttgcggagaagtttgctctatcttcatgctgtcgaggctttcagatag cds aataggtcg GenBank: tcgaccggtgctactcccatctgcactgggtattgcagtgtttactgctctgtttggtttat MF000992.1 caagctcg tttaccatgatgttgactcttcgagtttgcgctggtctcttagccggagcgacgcctatag tacactcca ttgtcagcgaacttactgatgataccaataatgcactcgttgtaccattatatggcctcat aactcccat cggatttgccattgggcccctgatcgggggaacccttgaacacgctgcaactaagtat cccaacgtcttt ggatatgagctttttcgaaagtacccctacttcttaccatcgtttgttccatgctgcatggc tatcgtgg gcgtcacattcggctacttctttttaaaagaaacgcttcctagtttagtcaagtctaaaaa aagacttga acgtcaacggtcctcctcttctatatcatcagagaactctactctatacggtgccacaga gcatatcagg gactcaacagaagaaaccgcggcggacgaggaacccgattccaagccgaagggt attactgagttaattc gggatccttctatacgggctataatggcttctggtacatttttgatgtttctatacacgagtt ccgatgt gatattctcactctactgctttactgctgttgaggatggaggcgttggattgcctcccga gaagatcggt tatgcattctccgttgcaggcctcatagctatgctcatgcagctttgcataacgccatgg gtgctccgta cttttgacaaggctaaagtataccacttctgcatgtgctcgttccctctcgtgtttgcactc atgggatg cctgaatcccctcgctcaaactgggtacagtgaaattaacaaaacacttcatccgacca ctacgggactg ctctatgctgcaatagccatcttgctccttctagcccgtgtctgcgttatggcattccctat cagcatga tgctggttaaacaaacggccgataagcattcgcttgccactgcgaatggcctcgtgca agtggccatgac ccttgcaagagcattctgccctacaatctcaagctcggtgtttgcttattctactagccat aatatcctg ggtggacatttctgggtggtagtgatggtattcatttccctggttggggtatggcaatcta cgaaaattg ccagggtcacaaaaacaaaagagcaattgtga 6 Psilocybe atgaatcctacgaccgccaccgatgctcatgaacgaacatcgctgttgtctggaagac cubensis cgcaatctgctg strain caaattcgacggctccatatgagcgacaagttcaaccatcgcgaaaatcccaatgcttt FSU12409 actccagtgac putative cgtgatcaccataattacgctcatatatcgtctcgcgacaacgatggtaatcacgacca transporter acattcgggtt (PsiT1) ctccacacagttgcatgccagctttggtatcatgtcaacgatcccgacgtatttccagg gene, gggaaatatac complete cagaaaaatattgtgcgctacctggtgtagacaagtattatgctataatggtgtctatga cds ccactgtcat GenBank: agatggtcttggaggtatacttgggaccggcatagccagctacatgtcatctcgttttgg MF000991.1 cagaaagcct gttctcatgttcctgctttcctgtaccatgatcgatcacctcgccatcctgacagtccaaa atgtatacg gatggaagcagttggtaacatttgggttaattatgattgttgaaaccattggaaatgaga acaccacagt atttctggtgagcatgtacgtggttgatgttactgaggctgagagaaggaccgctgctc tgagttcaatt actggctggcttgttctcggaggcgccctcgcctattcaataggcggatctataacaac ttttttacact ccaactctgccgtatacattgtatcgttcagtgtcactggcatcgttctaacattcaccgc ctttgttct ccctgaatcattccctgctgaaaaaagagatctcttgcggcttgaacgactggcagaa acccgtggacac agccagtcctggacccaaaaaatcaaagctgtggcaactgtcgcattggaacctatg gaattgctaaaac cgacatttaaccccataacggggaaggcaaattggcggcttgtatactgcgccctcca ctcgtttattgt cactctagcagatgcgtatgctcttcctgccatgttgatatttttcactacccagtattcata tacaccc gctcagatgggatatgttatgacgacgtacagtgtctccagtgtgtttgttttggcgata gccttacccc tgtttattcgatggttcaagcccctgtataataatactcaaacgaagtctgtcccagatga aggggatgg actccgtgcgaccgactctggagaagcgggtgtgcacacacaagaggtcgttgtttc ggaaacctctgat cgcatggacgtccatatcactgtcatatcctggaccatagagtcattagcatacatagtt ctcggtactg tgggttcattttacgcacaacttttaggtcggccgttgcctctattggctttggatctggac gcattcca ggaattcgaagcctag 7 Psilocybe atggcacccgcaacacccgcaactcacgatcctgccttgtcccacggagcccctcct cubensis gctccaggtgctc strain cagctcctgcaaatgctcctccaaacgcctcaggagacattgctggaatgcagctcag FSU12409 cggactcgatca putative gtcccagatcatgaaccttcttcgttcattgcctggcatgttctcgggcggtaaaatacc transcrip- cgaccaaggc tional caaggcaacaaagaggatgctgctcaaacgctgtccaaccttgcccaagctcaaccg regulator tatggacaacaat (PsiR) taccccttcactaccaagctggcggcccaggaggtctgccaggaattaacgacccag gene, gcccgtccacaca complete tccccgcggccctcccaaccttggccaactgagtgctgtggcaatgcaagccgcccc cds cgctccaattcag GenBank: catccagaccagcaaacgaaccgcaacgatggcgagcaggctggcaatgcgagtg MF000990.1 caagtacctccggaa aggatggtgacaatgcagaattcgttcccccacctgctcctgctcctacaactggtcgc cgtggtggacg cagcgccaccatgggaagtgacgaatggagcagacagaggaaggataatcataaa gaggttgagcgtcga cgccgcggcaatatcaacgagggcatcaacgagcttggccgcattgtacccagtgg gtctggcgagaagg ccaaaggcgccatcctttctcgagctgtgcagtacatccatcatttgaaagagaacga agctcgcaatat cgagaagtggacccttgagaagcttctcatggaccaggccatgggtgacctgcagg cgcaactcgaagag gtcaagcgtctgtgggaagaagagcgtatggcgcgcacaagactcgaggccgagc tcgaagtgttgagaa atatgaacggcgtgaatgctggctcggccccggcctcgaaagatgagagtgctgca ggtactaagaggag gagtaccgatggagcagaggccgccaccgccgccactgaaagcagcaccgccaat gccgagggcgaacgc gacggcaagcgacaaagaaccgagtga 8 Psilocybe atgcaggtactgcccgcgtgccaatcttccgcgcttaaaacattgtgcccatcccccg cyanescens aggcctttcgaa strainFSU agctcggttggctccctactagcgacgaggtttacaacgaattcatcgatgacttgacc 12416 ggtcgcacgtg tryptophan caatgaaaagtactccagccaggttacacttttgaagcctatccaagatttcaagacatt decarboxylase catcgagaat (PsiD)mRNA, gatcccatagtgtatcaagaatttatctctatgtttgaaggaatcgagcagtctcccacc completecds aactaccacg GenBank: agctatgtaacatgttcaacgacatctttcgcaaagccccactctacggcgatcttggtc KY984104.1 ctccggttta catgatcatggccagaataatgaatacgcaggcgggtttctctgcgttcacaaaagag agcttgaacttc catttcaaaaagctcttcgacacctgggggctattcctttcctcgaaaaactctcgaaac gtgcttgttg cagaccagtttgacgataagcattacgggtggttcagcgagcgagccaagactgcca tgatgattaatta tccagggcgtacattcgagaaagtcttcatctgcgacgagcacgttccataccatggct tcacttcctat gacgatttcttcaatcgcaggttcagggacaaggatacagatcggcccgtagtcggtg gggttactgaca ccactttaatcggggctgcctgtgaatcgttgtcatataacgtctctcacaacgtccagt ctcttgacac gctagtcatcaagggagaggcctattcacttaaacatctacttcataacgaccccttcac accgcaattc gaacatgggagcatcattcaaggattcctaaatgtcaccgcttaccaccgctggcact cccccgtcaatg gcacgattgtgaagatcgtcaacgttccaggtacctacttcgctcaagctccatataca attggatctcc tatccccgataacgaccgcgacccgcctccttacctcaagtcactcgtatacttctcca acatcgctgca cggcaaattatgttcatcgaggccgacaacaaagacatcggcctcattttcttggtcttc attggaatga ctgagatctcgacttgcgaggcgacggtgtgcgaaggtcagcatgtcaaccgcggtg acgatttgggcat gttccatttcggtggttcatcttttgcccttggcttgcggaaggactcgaaggcgaagat tttggaaaag ttcgcgaaaccggggaccgttattaggatcaacgagctagttgcatctgtaaggaagt ag 9 Psilocybe atgattgttctattggtctcgctcgtccttgcaggatgcatatactacgccaacgctcgta cyanescens gagtaaggc strainFSU gctcgcgcttaccaccgggcccgcctggcataccactgcccttcattgggaatatgttt 12416 gatatgccttc putative agagtcaccgtggttaagatttcttcaatggggacgggactatcacactgatatccttta mono- cttgaatgct oxygenase ggcggaacggaaataattattctgaacacactggatgctataaccgacttgttggaaaa (PsiH)gene, gcgagggtcga partialcds tgtattcgggtcgactcgagagcaccatggtgaacgaactcatggggtgggagttcg GenBank: acttgggattcat MF000997.1 aacctatggtgaaagatggcgcgaagaaagacgcatgttcgccaaggagttcagcg aaaaaaacatcagg caattccgccacgcccaaattaaagctgccaatcagcttgttcggcagctgatcaaaa cgccagatcgtt ggtcgcagcacatccggcatcagatagcagccatgtctctagacattggttatggaatt gatctcgcaga ggatgacccctggattgcagcaacccagctagctaacgaagggctcgccgaagctt cagtaccgggcagt ttctgggtcgactcattccccgccctcaaataccttccttcatggcttcctggtgcaggat tcaagcgca aagcaaaggtatggaaggaaggtgctgaccatatggtgaacatgccgtatgaaacga tgaaaaaattgac tgttcaaggcttggcccgaccttcatatgcctcagctcgtctgcaggccatggacccc gatggcgatctc gagcatcaggaacacgtgatcagaaacacagcgactgaggtcaatgtcggcggag gtgatacgactgttt ctgctgtgtcagcctttattttggccatggtcaaatatccagaagttcaacgccaagtcc aagcagaact ggatgcactcaccagcaaaggagttgtcccaaactatgacgaagaagacgactcctt gccataccttacg gcttgcgtcaaggaaatctttcgatggaaccaaatagcaccccttgctatccctcatcg gctgatcaaag acgatgtttatcgtgggtatctcataccaaagaatgctttggtctacgccaactcatggg ctgtgttgaa tgacccagaggagtacccaaatccctctgagttccgaccagaacgatatttgagctct gacggaaagccc gacccaacggtccgtgatccccgcaaagcagcatttggctatggtcgacgcaactgt cccggaatccacc tggcacaatcgacggtatggattgctggagccactcttctctcggtattcaatatcgaac gtcctgttga tgggaatggaaaacccatcgacatcccggcgacgttcactaccggattcttcagacat cccgagcctttc cagtgcagatttgtccctcgcactcaggagattctaaaatccgtttccggt 10 Psilocybe atgactttcgatctcaagactgaagaaggcctgctctcatacctcacaaagcacctatc cyanescens gctggacgttg strainFSU ctcccaacggggtgaaacgtcttagtggaggcttcgtcaacgttacctggcgggtcg 124164- ggctcaatgcccc hydroxy- ttatcatggtcacacgagcattattctgaagcatgctcaaccgcacctgtcttcagacat tryptamine agatttcaag kinase ataggtgttgaacgatcggcgtacgagtatcaagcgctcaaaatcgtgtcagccaata (PsiK)mRNA, gctcccttctag complete gcagcagcgatattcgggtctctgtaccagaaggtcttcactacgacgtcgttaataac cds gcattgatcat GenBank: gcaagatgtcgggacaatgaagaccctgttggactatgtcactgccaaaccaccaatt KY984102.1 tctgcagagatc gccagtctcgtaggcagtcaaattggtgcatttatcgctaggctgcacaacctcggcc gcgagaataaag acaaggacgacttcaagttcttctctggaaacatcgtcgggagaacaaccgcagacc agttgtatcaaac catcatacctaatgccgctaaatacggtatcgacgatccaattctcccaattgtggtaaa ggagttggtg gaggaggtcatgaatagtgaagaaacgcttatcatggcggatttatggagtggcaata ttcttctccagt ttgatgaaaactcgacggaattgacgaggatatggctggtagactgggagttgtgcaa atatggtccacc gtctttggacatggggtacttcttaggcgactgtttcctggtcgctcgatttcaagatcag ctcgtaggg acatcaatgcgacaggcctacttgaagagctacgcaaggaatgtcaaggagccaatc aattatgcaaaag ccaccgcaggcatcggcgcgcatctcgtcatgtggactgatttcatgaagtggggga acgatgaagagag ggaagagtttgttaagaaaggcgtggaagccttccatgaagcaaatgaggacaatag aaacggggagatt acgtctatacttgtgaaggaagcatcgcgcacttag 11 Psilocybe atgcatatcaggaacccataccgcgatggtgttgactaccaagcactcgctgaagcat cyanescens ttccggctctca strainFSU aaccacatgtcacagtaaattcagacaatacgacctccatcgactttgctgtgccagaa 12416 gcccaaagact norbaeo- gtatacagctgcccttctacaccgggatttcggtcttacgatcacactcccggaagacc cystin- gtctttgtccg methyl- acagtgcctaatcggctcaactatgtcctttgggttgaagatatccttaaagtcacttctg transferase atgctctcg (PsiM) gtcttccggataatcgtcaagttaaggggatcgatatcggaactggcgcatcagcgat mRNA, atatcccatgct complete cgcatgctctcgttttaagacatggtccatggttgcaacagaggtagaccagaagtgta cds ttgacactgct GenBank: cgtctcaacgtcattgccaacaacctccaagaacgtctcgcaattatagccacctccgt KY984103.1 cgatggtccta tacttgtccccctcttgcaggcgaattctgattttgagtacgattttacgatgtgtaatccg cccttcta cgatggggcatccgacatgcagacatcggatgctgcgaaggggtttggattcggtgt gaacgctccgcat accggcacggtgctcgagatggccaccgagggaggtgaatcggccttcgtagccca aatggtccgcgaaa gtttgaatcttcaaacacgatgcaggtggttcacgagtaatttggggaaattgaagtcct tgtacgaaat tgtggggctgctgcgagaacatcagataagtaactacgcaatcaacgaatacgtcca aggagccactcgt cgatatgcgattgcatggtcgttcatcgatgttcgactgcctgatcatttgtcccgtccat ctaaccccg acctaagctctcttttctag 12 Psilocybe atgtcgccagagcgctcagcaagtcttgaaccagatgagcattcgtctctgctctccga cyanescens tacggcctcct strainFSU acatctcgagagatgacttagaagactcaaaagcgaagcaaatcccgacgcctatac 12416 caaagaaacaact putative tggagttttattttccatcagattcacagaacctataatttacagtcatttgtggccttatatc transporter aaccaa (PsiT2) ttcgttaatgatatcggggtcgccgacgggaaccctcgctatgttggattttacagtggt gene, ttgatcgaaa complete gtgtatttgcttgtggagaagtgtgttctatcttcatgttatcgaggctgtcagacagaat cds aggtcgccg GenBank: accagtgttgctcccgtctgccctcggcgtagcattatttacagctttgttcggtttatcga MF000996.1 cctcgttt actatgatgctcgttctccgggtttgtgctggtcttttggccggggctactcctatagtcc attctgttg tgagtgagctcacggacgaaacgaataatgccctcgtagtacccctttacgggttaatt acacctattgg ctttgcgattggacctctgattggtggaactcttgagcacgctgctactaaatatcccaa cgtatttggt tatgacttccttcgaaaatatccatactttctaccatcctttgttccatgctgcctagctgtc gttggcg tcaccttcggctatttcttcttgcaagagacgcttcccagtatagtacgggccaagaaaa gacttgaacg acagaaatctacttcgtctatttcgtcaagaacctccaccctatacggtgctacagatga tcacaataga gatgcatcagaatcaaccgcgttgtctccggaggaagcggaagatgaaattgactcta agcctcaaagca tcaaagctttaatcgtagacccttctatgcgggccatcatgggttctggtacctttctgat gttcctcta cacgagttccgatgttctgttctcactctactgctttactgctgtcgaggacggaggcgt cggattacct cccgacgaaatcggttacgcattctctgttgccggcgtgatagctatgcttatgcagctt tgcataacac cttgggtcctacgtacattcgataaggcaaaagtatacaagttctgcatgttctcattccc gcttgtatt tgccctcatgggatgtcttaatcccctcgctcaaaccgggtataatgaagtctctaagac tatccaccct accacaacgggacttctttacgctgctattgctgtgttgctactgttggcacgggtctgc gtcatggcgt tcccgatcagcatgatgttgattaagcagaatgccgataaaaactcactcgccactgc gaacgggcttgt gcaagtgtcgatgaccattgctagagcactctgccccacggtctctagttcgctcttcg cttattccacg agcaacaatattctgggtggtcatctctgggtccttattatggtgaccatatccctcgca ggcgtctggc agtcgatgagcatcgcccgcgttaccaaaagaaaggaagagctataa 13 Psilocybe atgaatcctacgaccgccaccgatgctcatgaacgaacatcgctgttgtctggaagac cyanescens cgcaatctgctg strainFSU caaattcgacggctccatatgagcgacaagttcaaccatcgcgaaaatcccaatgcttt 12416 actccagtgac putative cgtgatcaccataattacgctcatatatcgtctcgcgacaacgatggtaatcacgacca transporter acattcgggtt (PsiT1) ctccacacagttgcatgccagctttggtatcatgtcaacgatcccgacgtatttccagg gene, gggaaatatac complete cagaaaaatattgtgcgctacctggtgtagacaagtattatgctataatggtgtctatga cds ccactgtcat GenBank: agatggtcttggaggtatacttgggaccggcatagccagctacatgtcatctcgttttgg MF000995.1 cagaaagcct gttctcatgttcctgctttcctgtaccatgatcgatcacctcgccatcctgacagtccaaa atgtatacg gatggaagcagttggtaacatttgggttaattatgattgttgaaaccattggaaatgaga acaccacagt atttctggtgagcatgtacgtggttgatgttactgaggctgagagaaggaccgctgctc tgagttcaatt actggctggcttgttctcggaggcgccctcgcctattcaataggcggatctataacaac ttttttacact ccaactctgccgtatacattgtatcgttcagtgtcactggcatcgttctaacattcaccgc ctttgttct ccctgaatcattccctgctgaaaaaagagatctcttgcggcttgaacgactggcagaa acccgtggacac agccagtcctggacccaaaaaatcaaagctgtggcaactgtcgcattggaacctatg gaattgctaaaac cgacatttaaccccataacggggaaggcaaattggcggcttgtatactgcgccctcca ctcgtttattgt cactctagcagatgcgtatgctcttcctgccatgttgatatttttcactacccagtattcata tacaccc gctcagatgggatatgttatgacgacgtacagtgtctccagtgtgtttgttttggcgata gccttacccc tgtttattcgatggttcaagcccctgtataataatactcaaacgaagtctgtcccagatga aggggatgg actccgtgcgaccgactctggagaagcgggtgtgcacacacaagaggtcgttgtttc ggaaacctctgat cgcatggacgtccatatcactgtcatatcctggaccatagagtcattagcatacatagtt ctcggtactg tgggttcattttacgcacaacttttaggtcggccgttgcctctattggctttggatctggac gcattcca ggaattcgaagcctag 14 Psilocybe atggcacccacaacacccgcaactcacgatccagccttgtcccacggagctcctcct cyanescens actcagggctcgc strainFSU aggcaccagcaaatgcggccccaaatcttaccccagccgacatctctggcatgcaac 12416 tcaacggcctcga putative tcagtcccagatcatgaaccttctccgttcattgcccggcatgttcacaggtgctaaaat transcrip- accagatcaa tional ggacaaggcaatcccaaagaggatgctgcccaaacactgtccaacctcgcacaggc regulator ttcatcacccttcg (PsiR) gcggccaacatttgcccatccactatcaaaccggcgctgctggtggtcttccaggaat gene, caacgacccagg complete cccgtcaactcacccccgcggccctcctaacctcggccagctgagtgctgtcgcgat cds gcaagcggcccca GenBank: gcgacgatccaacaccaggaccagcaacagtctgggcgccaggaagacggcgag MF000994.1 caggccggaaatacga gcattgatagcccatctgcgaaagatggcgagaatggcactggggagtttaaccaga cgtctacgagcac tccttcgggaggccgtcggggtgggcgcagtgccaccatgggcagcgacgaatgg agcaggcagaggaag gataatcataaagaggttgagcgtcggcgccgcggaaatatcaacgaagggattaac gagctgggccgca tcgtaccgagcggatcaggcgagaaagccaaaggcgccatcctctcgcgcgccgt gcagtacatccacca tttgaaagagaatgaagctcggaacatcgagaagtggacgcttgagaagctacttatg gatcaggcgatg ggcgacctgcaggcgcaacttgaggagatcaagcggctgtgggaggaggagcgc atggctcgtacgaggc ttgaggctgagctcgaggtgttgaggaatatgaatggtgtgagtactgccggtgcgg gttcgggtgcggc gaaggatgaaagcgctgccggcacgaagcggaggagcacggatggtgctgatgct gccggcacaaatgtt gaaggtggtaataacgacaacgctgaaggagagagggacggaaaacgtcagaga actgagtga
(45) In some cases, the efficiency of genomic disruption of a fungus or any other organism, including but not limited to a cell, with any of the nucleic acid delivery platforms described herein, can result in disruption of a gene or portion thereof at about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or up to about 100% as measured by nucleic acid or protein analysis.
(46) In some cases, the genetically modified fungi and other organisms comprises about 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 125%, 150%, 175%, 200%, and up to 400% percent more of a compound of any one of Formula I-IV measured by dry weight of a fungus compared to a comparable control without genetic modification.
(47) In some cases, the genetically modified fungi and other organisms comprises about 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 125%, 150%, 175%, 200%, and up to 400% percent more dimethyltryptamine (DMT) measured by dry weight of a fungus compared to a comparable control without genetic modification.
(48) In some cases, the genetically modified fungi and other organisms comprises about 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 125%, 150%, 175%, 200%, and up to 400% percent more psilocybin measured by dry weight of a fungus compared to a comparable control without genetic modification.
(49) In some cases, the genetically modified fungi and other organisms comprises about 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 125%, 150%, 175%, 200%, and up to 400% percent more psilocin measured by dry weight of a fungus compared to a comparable control without genetic modification.
(50) Various methods may be utilized to identify potential targets for gene editing in a psilocybin and/or psilocin biosynthesis pathway. In some cases, any one of: bioinformatics, gRNA design, CRISPR reagent construction, plant transformation, plant regeneration, and/or genotyping can be utilized. Bioinformatics can comprise gene mapping, gene alignment and copy number analysis, and gene annotation. gRNA design can comprise gRNA grouping to design clusters of guides for intended function, rank and selection of guides based on target gene specificity and off-targets within the cannabis genome. CRISPR reagent construction can comprise generation of infection-ready AGRO reagents to co-deliver Cas9 that has been cannabis codon optimized and gRNA. Plant transformation and regeneration can comprise infecting plant tissue with CRISPR AGRO (for example callus), techniques to isolate cannabis protoplasts and transform RNP reagents, and/or development of techniques to obtain growing plantlets from transformed tissue. Genotyping can comprise isolating plant DNA and analyzing a target sequence. Functional analysis can comprise analyzing cannabinoid content in plant tissue and quantifying relevant cannabinoids.
(51) The above disclosed different approaches of genetic modification could be use on other organisms, such as different plants, E. coli and other suitable bacteria, or yeast to produce end products of psilocybin and/or psilocin. In the disclosed genetically engineered fungi and other organisms, the amount of psilocybin and/or psilocin is increased about by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 300%, or up to 400% more compared to a comparable control fungus or organism without such disclosed genetic modification.
Genetic Engineering
(52) Provided herein can be systems of genomic engineering. Systems of genomic engineering can include any one of clustered regularly interspaced short palindromic repeats (CRISPR) enzyme, transcription activator-like effector (TALE)-nuclease, transposon-based nuclease, Zinc finger nuclease, meganuclease, argonaute, or Mega-TAL. In some aspects, a genome editing system can utilize a guiding polynucleic acid comprising DNA, RNA, or combinations thereof. In some cases, a guide can be a guide DNA or a guide RNA.
(53) I. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)
(54) In some cases, genetic engineering can be performed using a CRISPR system or portion thereof. A CRISPR system can be a multicomponent system comprising a guide polynucleotide or a nucleic acid encoding the guide polynucleotide and a CRISPR enzyme or a nucleic acid encoding the CRISPR enzyme. A CRISPR system can also comprise any modification of the CRISPR components or any portions of any of the CRISPR components.
(55) Methods described herein can take advantage of a CRISPR system. There are at least five types of CRISPR systems which all incorporate guide RNAs and Cas proteins and encoding polynucleic acids. The general mechanism and recent advances of CRISPR system is discussed in Cong, L. et al., Multiplex genome engineering using CRISPR systems, Science, 339(6121): 819-823 (2013); Fu, Y. et al., High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells, Nature Biotechnology, 31, 822-826 (2013); Chu, V T et al. Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells, Nature Biotechnology 33, 543-548 (2015); Shmakov, S. et al., Discovery and functional characterization of diverse Class 2 CRISPR-Cas systems, Molecular Cell, 60, 1-13 (2015); Makarova, K S et al., An updated evolutionary classification of CRISPR-Cas systems,, Nature Reviews Microbiology, 13, 1-15 (2015). Site-specific cleavage of a target DNA occurs at locations determined by both 1) base-pairing complementarity between the guide RNA and the target DNA (also called a protospacer) and 2) a short motif in the target DNA referred to as the protospacer adjacent motif (PAM). A PAM can be a canonical PAM or a non-canonical PAM. For example, an engineered cell, such as a plant cell, can be generated using a CRISPR system, e.g., a type II CRISPR system. A Cas enzyme used in the methods disclosed herein can be Cas9, which catalyzes DNA cleavage. Enzymatic action by Cas9 derived from Streptococcus pyogenes or any closely related Cas9 can generate double stranded breaks at target site sequences which hybridize to about 20 nucleotides of a guide sequence and that have a protospacer-adjacent motif (PAM) following the about 20 nucleotides of the target sequence. In some aspects, less than 20 nucleotides can be hybridized. In some aspects, more than 20 nucleotides can be hybridized. Provided herein can be genomically disrupting activity of a THCA synthase comprising introducing into a cannabis and/or hemp plant or a cell thereof at least one RNA-guided endonuclease comprising at least one nuclear localization signal or nucleic acid encoding at least one RNA-guided endonuclease comprising at least one nuclear localization signal, at least one guiding nucleic acid encoding at least one guide RNA. In some aspects, a modified plant or portion thereof can be cultured.
(56) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Enzyme
(57) A CRISPR enzyme can comprise or can be a Cas enzyme. In some aspects, a nucleic acid that encodes a Cas protein or portion thereof can be utilized in embodiments provided herein. Non-limiting examples of Cas enzymes can include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cash, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Csy4, Cse1, Cse2, Cse3, Cse4, Cse5e, Csc1, Csc2, Csa5, Csn1, Csn2, Csm1, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, Csd1, Csd2, Cst1, Cst2, Csh1, Csh2, Csa1, Csa2, Csa3, Csa4, Csa5, C2c1, C2c2, C2c3, Cpf1, CARF, DinG, homologues thereof, or modified versions thereof. In some cases, a catalytically dead Cas protein can be used, for example a dCas9. An unmodified CRISPR enzyme can have DNA cleavage activity, such as Cas9. A CRISPR enzyme can direct cleavage of one or both strands at a target sequence, such as within a target sequence and/or within a complement of a target sequence. In some aspects, a target sequence is at least about 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, or at least 22 nucleotides in length. In some cases, a target sequence is at most 17 nucleotides in length. In some aspects, a target can be selected from a sequence comprising homology from about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or up to about 100% to any one of: SEQ ID NO: 1 to SEQ ID NO: 7.
(58) In some aspects, a target sequence can be found within an intron or exon of a gene. In some cases, a CRISPR system can target an exon of a gene involved in a cannabinoid biosynthesis pathway. For example, a CRISPR enzyme can direct cleavage of one or both strands within or within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence. For example, a CRISPR enzyme can direct cleavage of one or both strands within or within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from a PAM sequence. In some cases, a guide polynucleotide binds a target sequence from 3 to 10 nucleotides from a PAM. A vector that encodes a CRISPR enzyme that is mutated with respect to a corresponding wild-type enzyme such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence can be used. A Cas protein can be a high-fidelity Cas protein such as Cas9HiFi. In some cases, a Cas protein can be modified. For example, a Cas protein modification can comprise N7-Methyl-Gppp (2-O-Methyl-A).
(59) Cas9 can refer to a polypeptide with at least or at least about 50%, 60%, 70%, 80%, 90%, 100% sequence identity and/or sequence similarity to a wild type exemplary Cas9 polypeptide (e.g., Cas9 from S. pyogenes). Cas9 can refer to a polypeptide with at most or at most about 50%, 60%, 70%, 80%, 90%, 100% sequence identity and/or sequence similarity to a wild type exemplary Cas9 polypeptide (e.g., from S. pyogenes). Cas9 can refer to the wild type or a modified form of the Cas9 protein that can comprise an amino acid change such as a deletion, insertion, substitution, variant, mutation, fusion, chimera, or any combination thereof. In some cases, a CRISPR enzyme, such as Cas, can be codon optimized for expression in a plant.
(60) A polynucleotide encoding an endonuclease (e.g., a Cas protein such as Cas9) can be codon optimized for expression in particular cells, such as plant cells. This type of optimization can entail the mutation of foreign-derived (e.g., recombinant) DNA to mimic the codon preferences of the intended host organism or cell while encoding the same protein.
(61) An endonuclease can comprise an amino acid sequence having at least or at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, amino acid sequence identity to the nuclease domain of a wild type exemplary site-directed polypeptide (e.g., Cas9 from S. pyogenes).
(62) S. pyogenes Cas9 (SpCas9), can be used as a CRISPR endonuclease for genome engineering. In some cases, a different endonuclease may be used to target certain genomic targets. In some cases, synthetic SpCas9-derived variants with non-NGG PAM sequences may be used. Additionally, other Cas9 orthologues from various species have been identified and these non-SpCas9s bind a variety of PAM sequences that could also be useful for the present invention. For example, the relatively large size of SpCas9 (approximately 4 kb coding sequence) means that plasmids carrying the SpCas9 cDNA may not be efficiently expressed in a cell. Conversely, the coding sequence for Staphylococcus aureus Cas9 (SaCas9) is approximately 1 kilobase shorter than SpCas9, possibly allowing it to be efficiently expressed in a cell.
(63) Alternatives to S. pyogenes Cas9 may include RNA-guided endonucleases from the Cpf1 family. Unlike Cas9 nucleases, the result of Cpf1-mediated DNA cleavage is a double-strand break with a short 3 overhang. Cpf1's staggered cleavage pattern may open up the possibility of directional gene transfer, analogous to traditional restriction enzyme cloning, which may increase the efficiency of gene editing. Like the Cas9 variants and orthologues described above, Cpf1 may also expand the number of sites that can be targeted by CRISPR to AT-rich regions or AT-rich genomes that lack the NGG PAM sites favored by SpCas9.
(64) In some aspects Cas sequence can contain a nuclear localization sequence (NLS). A nuclear localization sequence can be from SV40. An NLS can be from at least one of: SV40, nucleoplasmin, importin alpha, C-myc, EGL-13, TUS, hnRNPA1, Mata2, or PY-NLS. An NLS can be on a C-terminus or an N-terminus of a Cas protein. In some cases, a Cas protein may contain from 1 to 5 NLS sequences. A Cas protein can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to 10 NLS sequences. A Cas protein, such as Cas9, may contain two NLS sequences. A Cas protein may contain a SV40 and nuceloplasmin NLS sequence. A Cas protein may also contain at least one untranslated region.
(65) In some aspects, a vector that encodes a CRISPR enzyme can contain a nuclear localization sequences (NLS) sequence. In some cases, a vector can comprise one or more NLSs. In some cases, a vector can contain about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 NLSs. For example, a CRISPR enzyme can comprise more than or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 NLSs at or near the ammo-terminus, more than or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, NLSs at or near the carboxyl-terminus, or any combination of these (e.g., one or more NLS at the ammo-terminus and one or more NLS at the carboxyl terminus). When more than one NLS is present, each can be selected independently of others, such that a single NLS can be present in more than one copy and/or in combination with one or more other NLSs present in one or more copies.
(66) An NLS can be monopartite or bipartite. In some cases, a bipartite NLS can have a spacer sequence as opposed to a monopartite NLS. An NLS can be from at least one of: SV40, nucleoplasmin, importin alpha, C-myc, EGL-13, TUS, hnRNPA1, Mata2, or PY-NLS. An NLS can be located anywhere within the polypeptide chain, e.g., near the N- or C-terminus. For example, the NLS can be within or within about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50 amino acids along a polypeptide chain from the N- or C-terminus. Sometimes the NLS can be within or within about 50 amino acids or more, e.g., 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 amino acids from the N- or C-terminus.
(67) Any functional concentration of Cas protein can be introduced to a cell. For example, 15 micrograms of Cas mRNA can be introduced to a cell. In other cases, a Cas mRNA can be introduced from 0.5 micrograms to 100 micrograms. A Cas mRNA can be introduced from 0.5, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 micrograms.
(68) In some cases, a dual nickase approach may be used to introduce a double stranded break or a genomic break. Cas proteins can be mutated at known amino acids within either nuclease domains, thereby deleting activity of one nuclease domain and generating a nickase Cas protein capable of generating a single strand break. A nickase along with two distinct guide RNAs targeting opposite strands may be utilized to generate a double stranded break (DSB) within a target site (often referred to as a double nick or dual nickase CRISPR system). This approach may dramatically increase target specificity, since it is unlikely that two off-target nicks will be generated within close enough proximity to cause a DSB.
(69) A nuclease, such as Cas9, can be tested for identity and potency prior to use. For example, identity and potency can be determined using at least one of spectrophotometric analysis, RNA agarose gel analysis, LC-MS, endotoxin analysis, and sterility testing. In some cases, a nuclease sequence, such as a Cas9 sequence can be sequenced to confirm its identity. In some cases, a Cas protein, such as a Cas9 protein, can be sequenced prior to clinical or therapeutic use. For example, a purified in vitro transcription product can be assessed by polyacrylamide gel electrophoresis to verify no other mRNA species exist or substantially no other mRNA species exist within a clinical product other than Cas9. Additionally, purified mRNA encoding a Cas protein, such as Cas9, can undergo validation by reverse-transcription followed by a sequencing step to verify identity at a nucleotide level. A purified in vitro transcription product can be assessed by polyacrylamide gel electrophoresis (PAGE) to verify that an mRNA is the size expected for Cas9 and substantially no other mRNA species exist within a clinical or therapeutic product.
(70) In some cases, an endotoxin level of a nuclease, such as Cas9, can be determined. A clinically/therapeutically acceptable level of an endotoxin can be less than 3 EU/mL. A clinically/therapeutically acceptable level of an endotoxin can be less than 2 EU/mL. A clinically/therapeutically acceptable level of an endotoxin can be less than 1 EU/mL. A clinically/therapeutically acceptable level of an endotoxin can be less than 0.5 EU/mL.
(71) In some cases, a nuclease, such as Cas9, can undergo sterility testing. A clinically/therapeutically acceptable level of a sterility testing can be 0 or denoted by no growth on a culture. A clinically/therapeutically acceptable level of a sterility testing can be less than 0.5%, 0.3%, 0.1%, or 0.05% growth.
(72) Guiding Polynucleic Acid
(73) A guiding polynucleic acid can be DNA or RNA. A guiding polynucleic acid can be single stranded or double stranded. In some cases, a guiding polynucleic acid can contains regions of single stranded areas and double stranded areas. A guiding polynucleic acid can also form secondary structures. As used herein, the term guide RNA (gRNA), and its grammatical equivalents can refer to an RNA which can be specific for a target DNA and can form a complex with a Cas protein. A guide RNA can comprise a guide sequence, or spacer sequence, that specifies a target site and guides an RNA/Cas complex to a specified target DNA for cleavage. For example, a guide RNA can target a CRISPR complex to a target gene or portion thereof and perform a targeted double strand break. Site-specific cleavage of a target DNA occurs at locations determined by both 1) base-pairing complementarity between a guide RNA and a target DNA (also called a protospacer) and 2) a short motif in a target DNA referred to as a protospacer adjacent motif (PAM). In some cases, gRNAs can be designed using an algorithm which can identify gRNAs located in early exons within commonly expressed transcripts.
(74) In some cases, a guide polynucleotide can be complementary to a target sequence of a gene encoding: methyltransferase, hydroxylase, monooxygenase, kinase, decarboxylase, transcriptional regulators, transporters, Indoleamine 2,3-dioxygenase (IDO), tryptophan 2,3-dioxygenase (TDO), TrpM, phospho-2-dehydro-3-deoxyheptonate aldolase, 3-dehydroquinate synthase, 3-dehydroquinate dehydratase, shikimate dehydrogenase, 3-phosphoshikimate 1-carboxyvinyltransferase, shikimate kinase 1, shikimate kinase 2, chorismate synthase, tryptophan synthase alpha chain, tryptophan synthase beta chain, anthranilate phosphoribosyltransferase, and anthranilate synthase component. In some cases, a gRNA or gDNA can bind a target sequence that is homologous or complimentary to SEQ ID NOS: 1-5 or any of the genes mentioned above.
(75) Functional gene copies, gene variants and pseudogenes are mapped and aligned to produce a sequence template for CRISPR design. In some cases, multiple guide RNAs targeting sequences conserved across aligned copies of THCA synthase are designed to disrupt the early coding sequence and introduce mutations in the coding sequence, such as frameshift mutation indels. In some cases, a guide RNAs can be selected that has a low occurrence of off-target sites elsewhere in the Cannabis and hemp genome.
(76) In an aspect, a CRISPR gRNA library may be generated and utilized to screen variant plants by DNA analysis. Multiplex CRISPR engineering can generate diverse genotypes of novel cannabinoid-producing cannabis plants. In some cases, these plants produce elevated levels of minor, rare, and/or poorly researched cannabinoids.
(77) In some cases, a gRNA can be designed to target at exon of a gene involved in a cannabinoid biosynthesis pathway. In some cases, gRNAs can be designed to disrupt an early coding sequence. In an aspect, subject guide RNAs can be clustered into two categories: those intended to disrupt the production of functional proteins by targeting coding sequences having early positions within these genes to introduce frameshift mutation indels (KO Guides); and those which target sequences spread within gene regulatory regions (Expression modulating guides). Additionally, guide RNAs can be selected that have the lowest occurrence of off-target sites elsewhere in the cannabis and hemp genome.
(78) In some cases, a gRNA can be selected based on the pattern of indels it inserts into a target gene. Candidate gRNAs can be ranked by off-target potential using a scoring system that can take into account: (a) the total number of mismatches between the gRNA sequence and any closely matching genomic sequences; (b) the mismatch position(s) relative to the PAM site which correlate with a negative effect on activity for mismatches falling close to the PAM site; (c) the distance between mismatches to account for the cumulative effect of neighboring mismatches in disrupting guide-DNA interactions; and any combination thereof. In some cases, a greater number of mismatches between a gRNA and a genomic target site can yield a lower potential for CRISPR-mediated cleavage of that site. In some cases, a mismatch position is directly adjacent to a PAM site. In other cases, a mismatch position can be from 1 nucleotide up to 100 kilobases away from a PAM site. Candidate gRNAs comprising mismatches may not be adjacent to a PAM in some cases. In other cases, at least two candidate gRNAs comprising mismatches may bind a genome from 1 nucleotide up to 100 kilobases away from each other. A mismatch can be a substitution of a nucleotide. For example, in some cases a G will be substituted for a T. Mismatches between a gRNA and a genome may allow for reduced fidelity of CRISPR gene editing. In some cases, a positive scoring gRNA can be about 110 nucleotides in length and may contain no mismatches to a complementary genome sequence. In other cases, a positive scoring gRNA can be about 110 nucleotides in length and may contain up to 3 mismatches to a complementary genome sequence. In other cases, a positive scoring gRNA can be about 110 nucleotides in length and may contain up to 20 mismatches to a complementary genome sequence. In some cases, a guiding polynucleic acid can contain internucleotide linkages that can be phosphorothioates. Any number of phosphorothioates can exist. For example from 1 to about 100 phosphorothioates can exist in a guiding polynucleic acid sequence. In some cases, from 1 to 10 phosphorothioates are present. In some cases, 8 phosphorothioates exist in a guiding polynucleic acid sequence.
(79) In some cases, top scoring gRNAs can be designed and selected and an on-target editing efficiency of each can be assessed experimentally in plant cells. In some cases, an editing efficiency as determined by TiDE analysis can exceed at least about 20%. In other cases, editing efficiency can be from about 20% to from about 50%, from about 50% to from about 80%, from about 80% to from about 100%. In some cases, a percent indel can be determined in a trial GMP run. For example, a final cellular product can be analyzed for on-target indel formation by Sanger sequencing and TIDE analysis. Genomic DNA can be extracted from about 110.sup.6 cells from both a control and experimental sample and subjected to PCR using primers flanking a gene that has been disrupted, such as a gene involved in a cannabinoid biosynthesis pathway. Sanger sequencing chromatograms can be analyzed using a TIDE software program that can quantify indel frequency and size distribution of indels by comparison of control and knockout samples.
(80) A method disclosed herein also can comprise introducing into a cell or plant embryo at least one guide RNA or nucleic acid, e.g., DNA encoding at least one guide RNA. A guide RNA can interact with a RNA-guided endonuclease to direct the endonuclease to a specific target site, at which site the 5 end of the guide RNA base pairs with a specific protospacer sequence in a chromosomal sequence.
(81) A guide RNA can comprise two RNAs, e.g., CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA). A guide RNA can sometimes comprise a single-guide RNA (sgRNA) formed by fusion of a portion (e.g., a functional portion) of crRNA and tracrRNA. A guide RNA can also be a dual RNA comprising a crRNA and a tracrRNA. A guide RNA can comprise a crRNA and lack a tracrRNA. Furthermore, a crRNA can hybridize with a target DNA or protospacer sequence.
(82) As discussed above, a guide RNA can be an expression product. For example, a DNA that encodes a guide RNA can be a vector comprising a sequence coding for the guide RNA. A guide RNA can be transferred into a cell or organism by transfecting the cell or plant embryo with an isolated guide RNA or plasmid DNA comprising a sequence coding for the guide RNA and a promoter. In some aspects, a promoter can be selected from the group consisting of a leaf-specific promoter, a flower-specific promoter, a THCA synthase promoter, a CaMV35S promoter, a FMV35S promoter, and a tCUP promoter. A guide RNA can also be transferred into a cell or plant embryo in other way, such as using particle bombardment.
(83) A guide RNA can be isolated. For example, a guide RNA can be transfected in the form of an isolated RNA into a cell or plant embryo. A guide RNA can be prepared by in vitro transcription using any in vitro transcription system. A guide RNA can be transferred to a cell in the form of isolated RNA rather than in the form of plasmid comprising encoding sequence for a guide RNA.
(84) A guide RNA can comprise a DNA-targeting segment and a protein binding segment. A DNA-targeting segment (or DNA-targeting sequence, or spacer sequence) comprises a nucleotide sequence that can be complementary to a specific sequence within a target DNA (e.g., a protospacer). A protein-binding segment (or protein-binding sequence) can interact with a site-directed modifying polypeptide, e.g. an RNA-guided endonuclease such as a Cas protein. By segment it is meant a segment/section/region of a molecule, e.g., a contiguous stretch of nucleotides in an RNA. A segment can also mean a region/section of a complex such that a segment may comprise regions of more than one molecule. For example, in some cases a protein-binding segment of a DNA-targeting RNA is one RNA molecule and the protein-binding segment therefore comprises a region of that RNA molecule. In other cases, the protein-binding segment of a DNA-targeting RNA comprises two separate molecules that are hybridized along a region of complementarity.
(85) A guide RNA can comprise two separate RNA molecules or a single RNA molecule. An exemplary single molecule guide RNA comprises both a DNA-targeting segment and a protein-binding segment.
(86) An exemplary two-molecule DNA-targeting RNA can comprise a crRNA-like (CRISPR RNA or targeter-RNA or crRNA or crRNA repeat) molecule and a corresponding tracrRNA-like (trans-acting CRISPR RNA or activator-RNA or tracrRNA) molecule. A first RNA molecule can be a crRNA-like molecule (targeter-RNA), that can comprise a DNA-targeting segment (e.g., spacer) and a stretch of nucleotides that can form one half of a double-stranded RNA (dsRNA) duplex comprising the protein-binding segment of a guide RNA. A second RNA molecule can be a corresponding tracrRNA-like molecule (activator-RNA) that can comprise a stretch of nucleotides that can form the other half of a dsRNA duplex of a protein-binding segment of a guide RNA. In other words, a stretch of nucleotides of a crRNA-like molecule can be complementary to and can hybridize with a stretch of nucleotides of a tracrRNA-like molecule to form a dsRNA duplex of a protein-binding domain of a guide RNA. As such, each crRNA-like molecule can be said to have a corresponding tracrRNA-like molecule. A crRNA-like molecule additionally can provide a single stranded DNA-targeting segment, or spacer sequence. Thus, a crRNA-like and a tracrRNA-like molecule (as a corresponding pair) can hybridize to form a guide RNA. A subject two-molecule guide RNA can comprise any corresponding crRNA and tracrRNA pair.
(87) A DNA-targeting segment or spacer sequence of a guide RNA can be complementary to sequence at a target site in a chromosomal sequence, e.g., protospacer sequence such that the DNA-targeting segment of the guide RNA can base pair with the target site or protospacer. In some cases, a DNA-targeting segment of a guide RNA can comprise from or from about 10 nucleotides to from or from about 25 nucleotides or more. For example, a region of base pairing between a first region of a guide RNA and a target site in a chromosomal sequence can be or can be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, 25, or more than 25 nucleotides in length. Sometimes, a first region of a guide RNA can be or can be about 19, 20, or 21 nucleotides in length.
(88) A guide RNA can target a nucleic acid sequence of or of about 20 nucleotides. A target nucleic acid can be less than or less than about 20 nucleotides. A target nucleic acid can be at least or at least about 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. A target nucleic acid can be at most or at most about 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. A target nucleic acid sequence can be or can be about 20 bases immediately 5 of the first nucleotide of the PAM. A guide RNA can target a nucleic acid sequence of a gene that encodes a protein involved in the cannabinoid biosynthesis pathway. In some cases, a guiding polynucleic acid, such as a guide RNA, can bind a genomic region from about 1 base pair to about 20 base pairs away from a PAM. A guide can bind a genomic region from about 1, 2, 3, 4, 5 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or up to about 20 base pairs away from a PAM.
(89) A guide nucleic acid, for example, a guide RNA, can refer to a nucleic acid that can hybridize to another nucleic acid, for example, the target nucleic acid or protospacer in a genome of a cell. A guide nucleic acid can be RNA. A guide nucleic acid can be DNA. The guide nucleic acid can be programmed or designed to bind to a sequence of nucleic acid site-specifically. A guide nucleic acid can comprise a polynucleotide chain and can be called a single guide nucleic acid. A guide nucleic acid can comprise two polynucleotide chains and can be called a double guide nucleic acid.
(90) A guide nucleic acid can comprise one or more modifications to provide a nucleic acid with a new or enhanced feature. A guide nucleic acid can comprise a nucleic acid affinity tag. A guide nucleic acid can comprise synthetic nucleotide, synthetic nucleotide analog, nucleotide derivatives, and/or modified nucleotides. A guide nucleic acid can comprise a nucleotide sequence (e.g., a spacer), for example, at or near the 5 end or 3 end, that can hybridize to a sequence in a target nucleic acid (e.g., a protospacer). A spacer of a guide nucleic acid can interact with a target nucleic acid in a sequence-specific manner via hybridization (i.e., base pairing). A spacer sequence can hybridize to a target nucleic acid that is located 5 or 3 of a protospacer adjacent motif (PAM). The length of a spacer sequence can be at least or at least about 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The length of a spacer sequence can be at most or at most about 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides.
(91) A guide RNA can also comprise a dsRNA duplex region that forms a secondary structure. For example, a secondary structure formed by a guide RNA can comprise a stem (or hairpin) and a loop. A length of a loop and a stem can vary. For example, a loop can range from about 3 to about 10 nucleotides in length, and a stem can range from about 6 to about 20 base pairs in length. A stem can comprise one or more bulges of 1 to about 10 nucleotides. The overall length of a second region can range from about 16 to about 60 nucleotides in length. For example, a loop can be or can be about 4 nucleotides in length and a stem can be or can be about 12 base pairs. A dsRNA duplex region can comprise a protein-binding segment that can form a complex with an RNA-binding protein, such as an RNA-guided endonuclease, e.g. Cas protein.
(92) A guide RNA can also comprise a tail region at the 5 or 3 end that can be essentially single-stranded. For example, a tail region is sometimes not complementarity to any chromosomal sequence in a cell of interest and is sometimes not complementarity to the rest of a guide RNA. Further, the length of a tail region can vary. A tail region can be more than or more than about 4 nucleotides in length. For example, the length of a tail region can range from or from about 5 to from or from about 60 nucleotides in length.
(93) A guide RNA can be introduced into a cell or embryo as an RNA molecule. For example, an RNA molecule can be transcribed in vitro and/or can be chemically synthesized. A guide RNA can then be introduced into a cell or embryo as an RNA molecule. A guide RNA can also be introduced into a cell or embryo in the form of a non-RNA nucleic acid molecule, e.g., DNA molecule. For example, a DNA encoding a guide RNA can be operably linked to promoter control sequence for expression of the guide RNA in a cell or embryo of interest. A RNA coding sequence can be operably linked to a promoter sequence that is recognized by RNA polymerase III (Pol III).
(94) A DNA molecule encoding a guide RNA can also be linear. A DNA molecule encoding a guide RNA can also be circular. A DNA sequence encoding a guide RNA can also be part of a vector. Some examples of vectors can include plasmid vectors, phagemids, cosmids, artificial/mini-chromosomes, transposons, and viral vectors. For example, a DNA encoding a RNA-guided endonuclease is present in a plasmid vector. Other non-limiting examples of suitable plasmid vectors include pUC, pBR322, pET, pBluescript, and variants thereof. Further, a vector can comprise additional expression control sequences (e.g., enhancer sequences, Kozak sequences, polyadenylation sequences, transcriptional termination sequences, etc.), selectable marker sequences (e.g., antibiotic resistance genes), origins of replication, and the like.
(95) When both a RNA-guided endonuclease and a guide RNA are introduced into a cell as DNA molecules, each can be part of a separate molecule (e.g., one vector containing fusion protein coding sequence and a second vector containing guide RNA coding sequence) or both can be part of a same molecule (e.g., one vector containing coding (and regulatory) sequence for both a fusion protein and a guide RNA).
(96) A Cas protein, such as a Cas9 protein or any derivative thereof, can be pre-complexed with a guide RNA to form a ribonucleoprotein (RNP) complex. The RNP complex can be introduced into plant cells. Introduction of the RNP complex can be timed. The cell can be synchronized with other cells at G1, S, and/or M phases of the cell cycle. The RNP complex can be delivered at a cell phase such that HDR is enhanced. The RNP complex can facilitate homology directed repair.
(97) A guide RNA can also be modified. The modifications can comprise chemical alterations, synthetic modifications, nucleotide additions, and/or nucleotide subtractions. The modifications can also enhance CRISPR genome engineering. A modification can alter chirality of a gRNA. In some cases, chirality may be uniform or stereopure after a modification. A guide RNA can be synthesized. The synthesized guide RNA can enhance CRISPR genome engineering. A guide RNA can also be truncated. Truncation can be used to reduce undesired off-target mutagenesis. The truncation can comprise any number of nucleotide deletions. For example, the truncation can comprise 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50 or more nucleotides. A guide RNA can comprise a region of target complementarity of any length. For example, a region of target complementarity can be less than 20 nucleotides in length. A region of target complementarity can be more than 20 nucleotides in length. A region of target complementarity can target from about 5 bp to about 20 bp directly adjacent to a PAM sequence. A region of target complementarity can target about 13 bp directly adjacent to a PAM sequence. The polynucleic acids as described herein can be modified. A modification can be made at any location of a polynucleic acid. More than one modification can be made to a single polynucleic acid. A polynucleic acid can undergo quality control after a modification. In some cases, quality control may include PAGE, HPLC, MS, or any combination thereof. A modification can be a substitution, insertion, deletion, chemical modification, physical modification, stabilization, purification, or any combination thereof. A polynucleic acid can also be modified by 5adenylate, 5 guanosine-triphosphate cap, 5N.sup.7-Methylguanosine-triphosphate cap, 5triphosphate cap, 3phosphate, 3thiophosphate, 5phosphate, 5thiophosphate, Cis-Syn thymidine dimer, trimers, C12 spacer, C3 spacer, C6 spacer, dSpacer, PC spacer, rSpacer, Spacer 18, Spacer 9,3-3 modifications, 5-5 modifications, abasic, acridine, azobenzene, biotin, biotin BB, biotin TEG, cholesteryl TEG, desthiobiotin TEG, DNP TEG, DNP-X, DOTA, dT-Biotin, dual biotin, PC biotin, psoralen C2, psoralen C6, TINA, 3DABCYL, black hole quencher 1, black hole quencher 2, DABCYL SE, dT-DABCYL, IRDye QC-1, QSY-21, QSY-35, QSY-7, QSY-9, carboxyl linker, thiol linkers, 2deoxyribonucleoside analog purine, 2deoxyribonucleoside analog pyrimidine, ribonucleoside analog, 2-O-methyl ribonucleoside analog, sugar modified analogs, wobble/universal bases, fluorescent dye label, 2fluoro RNA, 2O-methyl RNA, methylphosphonate, phosphodiester DNA, phosphodiester RNA, phosphothioate DNA, phosphorothioate RNA, UNA, pseudouridine-5-triphosphate, 5-methylcytidine-5-triphosphate, or any combination thereof. In some cases, a modification can be permanent. In other cases, a modification can be transient. In some cases, multiple modifications are made to a polynucleic acid. A polynucleic acid modification may alter physio-chemical properties of a nucleotide, such as their conformation, polarity, hydrophobicity, chemical reactivity, base-pairing interactions, or any combination thereof. In some aspects a gRNA can be modified. In some cases, a modification is on a 5 end, a 3 end, from a 5 end to a 3 end, a single base modification, a 2-ribose modification, or any combination thereof. A modification can be selected from a group consisting of base substitutions, insertions, deletions, chemical modifications, physical modifications, stabilization, purification, and any combination thereof. In some cases, a modification is a chemical modification.
(98) In some cases, a modification is a 2-O-methyl 3 phosphorothioate addition denoted as m. A phosphothioate backbone can be denoted as (ps). A 2-O-methyl 3 phosphorothioate addition can be performed from 1 base to 150 bases. A 2-O-methyl 3 phosphorothioate addition can be performed from 1 base to 4 bases. A 2-O-methyl 3 phosphorothioate addition can be performed on 2 bases. A 2-O-methyl 3 phosphorothioate addition can be performed on 4 bases. A modification can also be a truncation. A truncation can be a 5-base truncation. In some cases, a modification may be at C terminus and N terminus nucleotides.
(99) A modification can also be a phosphorothioate substitute. In some cases, a natural phosphodiester bond may be susceptible to rapid degradation by cellular nucleases and; a modification of internucleotide linkage using phosphorothioate (PS) bond substitutes can be more stable towards hydrolysis by cellular degradation. A modification can increase stability in a polynucleic acid. A modification can also enhance biological activity. In some cases, a phosphorothioate enhanced RNA polynucleic acid can inhibit RNase A, RNase Ti, calf serum nucleases, or any combinations thereof. These properties can allow the use of PS-RNA polynucleic acids to be used in applications where exposure to nucleases is of high probability in vivo or in vitro. For example, phosphorothioate (PS) bonds can be introduced between the last 3-5 nucleotides at the 5- or 3-end of a polynucleic acid which can inhibit exonuclease degradation. In some cases, phosphorothioate bonds can be added throughout an entire polynucleic acid to reduce attack by endonucleases.
(100) In another embodiment, genetically modifying fungi comprises introducing into a fungus to increase tryptamine derived substance, such as dimethyltryptamine, psilocybin, or psilocin, or a cell thereof (i) at least one RNA-guided endonuclease comprising at least one nuclear localization signal or nucleic acid encoding at least one RNA-guided endonuclease comprising at least one nuclear localization signal, (ii) at least one guide RNA or DNA encoding at least one guide RNA, and, optionally, (iii) at least one donor polynucleotide such as a barcode; and culturing the fungus or cell thereof such that each guide RNA directs an RNA-guided endonuclease to a targeted site in the chromosomal sequence where the RNA-guided endonuclease introduces a double-stranded break in the targeted site, and the double-stranded break is repaired by a DNA repair process such that the chromosomal sequence is modified, wherein the targeted site is located in any of the genes that encode methyltransferase, hydroxylase, monooxygenase, kinase, decarboxylase, putative transcriptional regulators, and putative transporters and the chromosomal modification interrupts or interferes with transcription and/or translation of said gene.
(101) In some cases, a GUIDE-Seq analysis can be performed to determine the specificity of engineered guide RNAs. The general mechanism and protocol of GUIDE-Seq profiling of off-target cleavage by CRISPR system nucleases is discussed in Tsai, S. et al., GUIDE-Seq enables genome-wide profiling of off-target cleavage by CRISPR system nucleases, Nature, 33: 187-197 (2015). To assess off-target frequencies by next generation sequencing cells can be transfected with Cas9 mRNA and a guiding RNA. Genomic DNA can be isolated from transfected cells from about 72 hours post transfection and PCR amplified at potential off-target sites. A potential off-target site can be predicted using the Wellcome Trust Sanger Institute Genome Editing database (WGE) algorithm. Candidate off-target sites can be chosen based on sequence homology to an on-target site. In some cases, sites with about 4 or less mismatches between a gRNA and a genomic target site can be utilized. For each candidate off-target site, two primer pairs can be designed. PCR amplicons can be obtained from both untreated (control) and Cas9/gRNA-treated cells. PCR amplicons can be pooled. NGS libraries can be prepared using TruSeq Nano DNA library preparation kit (Illumina). Samples can be analyzed on an Illumina HiSeq machine using a 250 bp paired-end workflow. In some cases, from about 40 million mappable NGS reads per gRNA library can be acquired. This can equate to an average number of about 450,000 reads for each candidate off-target site of a gRNA. In some cases, detection of CRISPR-mediated disruption can be at a frequency as low as 0.1% at any genomic locus.
(102) Computational predictions can be used to select candidate gRNAs likely to be the safest choice for a targeted gene. Candidate gRNAs can then tested empirically using a focused approach steered by computational predictions of potential off-target sites. In some cases, an assessment of gRNA off-target safety can employ a next-generation deep sequencing approach to analyze the potential off-target sites predicted by the CRISPR design tool for each gRNA. In some cases, gRNAs can be selected with fewer than 3 mismatches to any sequence in the genome (other than the perfect matching intended target). In some cases, a gRNA can be selected with fewer than 50, 40, 30, 20, 10, 5, 4, 3, 2, or 1 mismatch(es) to any sequence in a genome. In some cases, a computer system or software can be utilized to provide recommendations of candidate gRNAs with predictions of low off-target potential.
(103) In some cases, potential off-target sites can be identified with at least one of: GUIDE-Seq and targeted PCR amplification, and next generation sequencing. In addition, modified cells, such as Cas9/gRNA-treated cells can be subjected to karyotyping to identify any chromosomal re-arrangements or translocations.
(104) A gRNA can be introduced at any functional concentration. For example, a gRNA can be introduced to a cell at 10 micrograms. In other cases, a gRNA can be introduced from 0.5 micrograms to 100 micrograms. A gRNA can be introduced from 0.5, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 micrograms.
(105) A guiding polynucleic acid can have any frequency of bases. For example, a guiding polynucleic acid can have 29 As, 17 Cs, 23 Gs, 23 Us, 3 mGs, 1 mCs, and 4 mUs. A guiding polynucleic acid can have from about 1 to about 100 nucleotides. A guiding polynucleic acid can have from about 1 to 30 of a single polynucleotide. A guiding polynucleic acid can have from about 1 to 10, 10 to 20, or from 20 to 30 of a single nucleotide.
(106) A guiding polynucleic acid can be tested for identity and potency prior to use. For example, identity and potency can be determined using at least one of spectrophotometric analysis, RNA agarose gel analysis, LC-MS, endotoxin analysis, and sterility testing. In some cases, identity testing can determine an acceptable level for clinical/therapeutic use. For example, an acceptable spectrophotometric analysis result can be 142 L/vial at 5.00.5 mg/mL. an acceptable spectrophotometric analysis result can also be from about 10-202 L/vial at 5.00.5 mg/mL or from about 10-202 L/vial at about 3.0 to 7.00.5 mg/mL. An acceptable clinical/therapeutic size of a guiding polynucleic acid can be about 100 bases. A clinical/therapeutic size of a guiding polynucleic acid can be from about 5 bases to about 150 bases. A clinical/therapeutic size of a guiding polynucleic acid can be from about 20 bases to about 150 bases. A clinical/therapeutic size of a guiding polynucleic acid can be from about 40 bases to about 150 bases. A clinical/therapeutic size of a guiding polynucleic acid can be from about 60 bases to about 150 bases. A clinical/therapeutic size of a guiding polynucleic acid can be from about 80 bases to about 150 bases. A clinical/therapeutic size of a guiding polynucleic acid can be from about 100 bases to about 150 bases. A clinical/therapeutic size of a guiding polynucleic acid can be from about 110 bases to about 150 bases. A clinical/therapeutic size of a guiding polynucleic acid can be from about 120 bases to about 150 bases.
(107) In some cases, a mass of a guiding polynucleic acid can be determined. A mass can be determined by LC-MS assay. A mass can be about 32,461.0 amu. A guiding polynucleic acid can have a mass from about 30,000 amu to about 50,000 amu. A guiding polynucleic acid can have a mass from about 30,000 amu to 40,000 amu, from about 40,000 amu to about 50,000 amu. A mass can be of a sodium salt of a guiding polynucleic acid.
(108) In some cases, an endotoxin level of a guiding polynucleic acid can be determined. A clinically/therapeutically acceptable level of an endotoxin can be less than 3 EU/mL. A clinically/therapeutically acceptable level of an endotoxin can be less than 2 EU/mL. A clinically/therapeutically acceptable level of an endotoxin can be less than 1 EU/mL. A clinically/therapeutically acceptable level of an endotoxin can be less than 0.5 EU/mL.
(109) In some cases, a guiding polynucleic acid can go sterility testing. A clinically/therapeutically acceptable level of a sterility testing can be 0 or denoted by no growth on a culture. A clinically/therapeutically acceptable level of a sterility testing can be less than 0.5% growth.
(110) Guiding polynucleic acids can be assembled by a variety of methods, e.g., by automated solid-phase synthesis. A polynucleic acid can be constructed using standard solid-phase DNA/RNA synthesis. A polynucleic acid can also be constructed using a synthetic procedure. A polynucleic acid can also be synthesized either manually or in a fully automated fashion. In some cases, a synthetic procedure may comprise 5-hydroxyl oligonucleotides can be initially transformed into corresponding 5-H-phosphonate mono esters, subsequently oxidized in the presence of imidazole to activated 5-phosphorimidazolidates, and finally reacted with pyrophosphate on a solid support. This procedure may include a purification step after the synthesis such as PAGE, HPLC, MS, or any combination thereof.
(111) Donor Sequences
(112) In some cases, a donor sequence may be introduced to a genome of a fungus, yeast, plant or portion thereof. In some cases, a donor is inserted into a genomic break. In some aspects, a donor comprises homology to sequencing flanking a target sequence. Methods of introducing a donor sequence are known to the skilled artisan but may include the use of homology arms. For example, a donor sequence can comprise homology arms to at least a portion of a genome that comprises a genomic break. In some cases, a donor sequence is randomly inserted into a genome of a cannabis or hemp plant cell genome.
(113) In some cases, a donor sequence can be introduced in a site directed fashion using homologous recombination. Homologous recombination permits site specific modifications in endogenous genes and thus inherited or acquired mutations may be corrected, and/or novel alterations may be engineered into the genome. Homologous recombination and site-directed integration in plants are discussed in, for example, U.S. Pat. Nos. 5,451,513, 5,501,967 and 5,527,695.
(114) In some aspects, a donor sequence comprises a promoter sequence. Increasing expression of designed gene products may be achieved by synthetically increasing expression by modulating promoter regions or inserting stronger promoters upstream of desired gene sequences. In some aspects, a promoter such as 35s and Ubi10 that are highly functional in Arabidopsis and other plants may be introduced. In some cases, a promoter that is highly functional in cannabis and/or hemp is introduced.
(115) In some cases, a barcode can comprise a non-natural sequence. In some aspects, a barcode contains natural sequences. In some aspects, a barcode can be utilized to allow for identification of transgenic organism via genotyping. In some aspects, a donor sequence can be a marker. Selectable marker genes can include, for example, photosynthesis (atpB, tscA, psaA/B, petB, petA, ycf3, rpoA, rbcL), antibiotic resistance (rrnS, rrnL, aadA, nptII, aphA-6), herbicide resistance (psbA, bar, AHAS (ALS), EPSPS, HPPD, sul) and metabolism (BADH, codA, ARG8, ASA2) genes. The sul gene from bacteria has herbicidal sulfonamide-insensitive dihydropteroate synthase activity and can be used as a selectable marker when the protein product is targeted to plant mitochondria (U.S. Pat. No. 6,121,513). In some embodiments, the sequence encoding the marker can be incorporated into the genetically modified cell or organism, for instance fungus, yeast or plant described herein. In some embodiments, the incorporated sequence encoding the marker may by subsequently removed from the transformed genome. Removal of a sequence encoding a marker may be facilitated by the presence of direct repeats before and after the region encoding the marker. Removal of the sequence encoding the marker can occur via the endogenous homologous recombination system of the organelle or by use of a site-specific recombinase system such as cre-lox or FLP/FRT.
(116) In some cases, a marker can refer to a label capable of detection, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator, or enzyme. Examples of detectable markers include, but are not limited to, the following: fluorescent labels (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic labels (e.g., horseradish peroxidase, -galactosidase, luciferase, alkaline phosphatase), chemiluminescent, biotinyl groups, predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags).
(117) Selectable or detectable markers normally comprise DNA segments that allow a cell, or a molecule marked with a tag inside a cell of interest, to be identified, often under specific conditions. Such markers can encode an activity, selected from, but not limited to, the production of RNA, peptides, or proteins, or the marker can provide a bonding site for RNA, peptides, proteins, inorganic and organic compounds or composites, etc. By way of example, selectable markers comprise, without being limited thereto, DNA segments that comprise restriction enzyme cleavage points, DNA segments comprising a fluorescent probe, DNA segments that encode products that provide resistance to otherwise toxic compounds, comprising antibiotics, e.g. spectinomycin, ampicillin, kanamycin, tetracycline, BASTA, neomycin-phosphotransferase II (NEO) and hygromycin-phosphotransferase (HPT), DNA segments that encode products that a plant target cell of interest would not have under natural conditions, e.g. tRNA genes, auxotrophic markers and the like, DNA segments that encode products that can be readily identified, in particular optically observable markers, e.g. phenotype markers such as -galactosidases, GUS, fluorescent proteins, e.g. green fluorescent protein (GFP) and other fluorescent proteins, e.g. blue (CFP), yellow (YFP) or red (RFP) fluorescent proteins, and surface proteins, wherein those fluorescent proteins that exhibit a high fluorescence intensity are of particular interest, because these proteins can also be identified in deeper tissue layers if, instead of a single cell, a complex plant target structure or a plant material or a plant comprising numerous types of tissues or cells can be to be analyzed, new primer sites for PCR, the recording of DNA sequences that cannot be modified in accordance with the present disclosure by restriction endonucleases or other DNA modified enzymes or effector domains, DNA sequences that are used for specific modifications, e.g. epigenetic modifications, e.g. methylations, and DNA sequences that carry a PAM motif, which can be identified by a suitable CRISPR system in accordance with the present disclosure, and also DNA sequences that do not have a PAM motif, such as can be naturally present in an endogenous plant genome sequence.
(118) In one embodiment, a donor comprises a selectable, screenable, or scoreable marker gene or portion thereof. In some cases, a marker serves as a selection or screening device may function in a regenerable genetically modified organism to produce a compound that would confer upon a tissue in said organism resistance to an otherwise toxic compound. Genes of interest for use as a selectable, screenable, or scoreable marker would include but are not limited to gus, green fluorescent protein (gfp), luciferase (lux), genes conferring tolerance to antibiotics like kanamycin (Dekeyser et al., 1989) or spectinomycin (e.g. spectinomycin aminoglycoside adenyltransferase (aadA), genes that encode enzymes that give tolerance to herbicides like glyphosate (e.g. 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS); glyphosate oxidoreductase (GOX); glyphosate decarboxylase; or glyphosate N-acetyltransferase (GAT), dalapon (e.g. dehI encoding 2,2-dichloropropionic acid dehalogenase conferring tolerance to 2,2-dichloropropionic acid, bromoxynil (haloarylnitrilase (Bxn) for conferring tolerance to bromoxynil, sulfonyl herbicides (e.g. acetohydroxyacid synthase or acetolactate synthase conferring tolerance to acetolactate synthase inhibitors such as sulfonylurea, imidazolinone, triazolopyrimidine, pyrimidyloxybenzoates and phthalide; encoding ALS, GST-II), bialaphos or phosphinothricin or derivatives (e.g. phosphinothricin acetyltransferase (bar) conferring tolerance to phosphinothricin or glufosinate, atrazine (encoding GST-III), dicamba (dicamba monooxygenase), or sethoxydim (modified acetyl-coenzyme A carboxylase for conferring tolerance to cyclohexanedione (sethoxydim) and aryloxyphenoxypropionate (haloxyfop), among others. Other selection procedures can also be implemented including positive selection mechanisms (e.g. use of the manA gene of E. coli, allowing growth in the presence of mannose), and dual selection (e.g. simultaneously using 75-100 ppm spectinomycin and 3-10 ppm glufosinate, or 75 ppm spectinomycin and 0.2-0.25 ppm dicamba). Use of spectinomycin at a concentration of about 25-1000 ppm, such as at about 150 ppm, can be also contemplated. In an embodiment, a detectable marker can be attached by spacer arms of various lengths to reduce potential steric hindrance.
(119) In some cases, a donor polynucleotide comprises homology to sequences flanking a target sequence. In some cases, a donor polynucleotide introduces a stop codon into a gene provided herein for example to block synthesis of a non-psilocybin tryptamine. In some cases, a donor polynucleotide comprises a barcode, a reporter, or a selection marker.
(120) Transformation
(121) Appropriate transformation techniques can include but are not limited to: electroporation of fungi protoplasts; liposome-mediated transformation; polyethylene glycol (PEG) mediated transformation; transformation using viruses; micro-injection of cells; micro-projectile bombardment of cells; vacuum infiltration; and Agrobacterium tumeficiens mediated transformation. Transformation means introducing a nucleotide sequence into a cell in a manner to cause stable or transient expression of the sequence.
(122) Following transformation, fungi or other organisms may be selected using a dominant selectable marker incorporated into the transformation vector. In certain embodiments, such marker confers antibiotic or herbicide resistance on the transformed fungi or other organisms, and selection of transformants can be accomplished by exposing the fungi and other organisms to appropriate concentrations of the antibiotic or herbicide. After transformed fungi or other organisms are selected and grown to maturity, those fungi and other organisms showing a modified trait are identified. The modified trait can be any of those traits described above. Additionally, expression levels or activity of the polypeptide or polynucleotide of the invention can be determined by analyzing mRNA expression using Northern blots, RT-PCR, RNA seq or microarrays, or protein expression using immunoblots or Western blots or gel shift assays.
(123) Suitable methods for transformation of fungal or other cells for use with the current invention are believed to include virtually any method by which DNA can be introduced into a cell, such as by direct delivery of DNA such as by PEG-mediated transformation of protoplasts, by desiccation/inhibition-mediated DNA uptake, by electroporation, by agitation with silicon carbide fibers, by Agrobacterium-mediated transformation and by acceleration of DNA coated particles. Through the application of techniques such as these, the cells of virtually any fungus species may be stably transformed, and these cells developed into transgenic fungi.
(124) Agrobacterium Mediated Transformation
(125) Agrobacterium-mediated transfer is a widely applicable system for introducing genes into fungal cells because the DNA can be introduced into whole fungal tissues, thereby bypassing the need for regeneration of an intact fungus from a protoplast. The use of Agrobacterium-mediated fungal integrating vectors to introduce DNA, for example comprising CRISPR systems or donors sequences, into fungal cells is well known in the art.
(126) Further, agrobacterium-mediated transformation can be efficient in other organisms, such as dicotyledonous plants and can be used for the transformation of dicots, including Arabidopsis, tobacco, tomato, alfalfa and potato. Indeed, while Agrobacterium-mediated transformation has been routinely used with dicotyledonous plants for a number of years. In some cases, agrobacterium-mediated transformation can be used in monocotyledonous plants. For example, Agrobacterium-mediated transformation techniques have now been applied to rice, wheat, barley, alfalfa and maize.
(127) Modern Agrobacterium transformation vectors are capable of replication in E. coli as well as Agrobacterium, allowing for convenient manipulations as described. Moreover, recent technological advances in vectors for Agrobacterium-mediated gene transfer have improved the arrangement of genes and restriction sites in the vectors to facilitate the construction of vectors capable of expressing various polypeptide coding genes. In some aspects, a vector can have convenient multi-linker regions flanked by a promoter and a polyadenylation site for direct expression of inserted polypeptide coding genes and are suitable for purposes described herein. In addition, Agrobacterium containing both armed and disarmed Ti genes can be used for the transformations.
(128) Electroporation
(129) In some aspects, a fungus, yeast, plant or a cell thereof may be modified using electroporation. To effect transformation by electroporation, one may employ either friable tissues, such as a suspension culture of cells or embryogenic callus or alternatively one may transform immature embryos or other organized tissue directly. In this technique, one would partially degrade the cell walls of the chosen cells, by exposing them to pectin-degrading enzymes (pectolyases) or mechanically wounding in a controlled manner.
(130) Any transfection system can be utilized. In some cases, a Neon transfection system may be utilized. A Neon system can be a three-component electroporation apparatus comprising a central control module, an electroporation chamber that can be connected to a central control module by a 3-foot-long electrical cord, and a specialized pipette. In some cases, a specialized pipette can be fitted with exchangeable and/or disposable sterile tips. In some cases, an electroporation chamber can be fitted with exchangeable/disposable sterile electroporation cuvettes. In some cases, standard electroporation buffers supplied by a manufacturer of a system, such as a Neon system, can be replaced with GMP qualified solutions and buffers. In some cases, a standard electroporation buffer can be replaced with GMP grade phosphate buffered saline (PBS). A self-diagnostic system check can be performed on a control module prior to initiation of sample electroporation to ensure the Neon system is properly functioning. In some cases, a transfection can be performed in a class 1,000 biosafety cabinet within a class 10,000 clean room in a cGMP facility. In some cases, electroporation pulse voltage may be varied to optimize transfection efficiency and/or cell viability. In some cases, electroporation pulse width may be varied to optimize transfection efficiency and/or cell viability. In some cases, the number of electroporation pulses may be varied to optimize transfection efficiency and/or cell viability. In some cases, electroporation may comprise a single pulse. In some cases, electroporation may comprise more than one pulse. In some cases, electroporation may comprise 2 pulses, 3 pulses, 4 pulses, 5 pulses 6 pulses, 7 pulses, 8 pulses, 9 pulses, or 10 or more pulses.
(131) In some aspects, protoplasts of fungi and/or plants may be used for electroporation transformation.
(132) Microprojectile Bombardment
(133) Another method for delivering transforming DNA segments to fungal cells and cells derived from other organisms in accordance with the invention is microprojectile bombardment. In this method, particles may be coated with nucleic acids and delivered into cells by a propelling force. Exemplary particles include those comprised of tungsten, platinum, and preferably, gold. It is contemplated that in some instances DNA precipitation onto metal particles would not be necessary for DNA delivery to a recipient cell using microprojectile bombardment. However, it is contemplated that particles may contain DNA rather than be coated with DNA. In some aspects, DNA-coated particles may increase the level of DNA delivery via particle bombardment. For the bombardment, cells in suspension are concentrated on filters or solid culture medium. Alternatively, immature embryos or other target cells may be arranged on solid culture medium. The cells to be bombarded are positioned at an appropriate distance below the macroprojectile stopping plate.
(134) An illustrative embodiment of a method for delivering DNA into fungal cells by acceleration is the Biolistics Particle Delivery System, which can be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with monocot plant cells cultured in suspension. The screen disperses the particles so that they are not delivered to the recipient cells in large aggregates.
(135) Other Transformation Methods
(136) Additional transformation methods include but are not limited to calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments.
(137) To transform fungi that cannot be successfully regenerated from protoplasts, other ways to introduce DNA into intact cells or tissues can be utilized. For example, regeneration of plants from immature embryos or explants can be affected as described. Also, silicon carbide fiber-mediated transformation may be used with or without protoplasting. Transformation with this technique can be accomplished by agitating silicon carbide fibers together with cells in a DNA solution. DNA passively enters as the cells are punctured.
(138) In some cases, a starting cell density for genomic editing may be varied to optimize editing efficiency and/or cell viability. In some cases, the starting cell density for genomic editing may be less than about 110.sup.5 cells. In some cases, the starting cell density for electroporation may be at least about 110.sup.5 cells, at least about 210.sup.5 cells, at least about 310.sup.5 cells, at least about 410.sup.5 cells, at least about 510.sup.5 cells, at least about 610.sup.5 cells, at least about 710.sup.5 cells, at least about 810.sup.5 cells, at least about 910.sup.5 cells, at least about 110.sup.6 cells, at least about 1.510.sup.6 cells, at least about 210.sup.6 cells, at least about 2.510.sup.6 cells, at least about 310.sup.6 cells, at least about 3.510.sup.6 cells, at least about 410.sup.6 cells, at least about 4.510.sup.6 cells, at least about 510.sup.6 cells, at least about 5.510.sup.6 cells, at least about 610.sup.6 cells, at least about 6.510.sup.6 cells, at least about 710.sup.6 cells, at least about 7.510.sup.6 cells, at least about 810.sup.6 cells, at least about 8.510.sup.6 cells, at least about 910.sup.6 cells, at least about 9.510.sup.6 cells, at least about 110.sup.7 cells, at least about 1.210.sup.7 cells, at least about 1.410.sup.7 cells, at least about 1.610.sup.7 cells, at least about 1.810.sup.7 cells, at least about 210.sup.7 cells, at least about 2.210.sup.7 cells, at least about 2.410.sup.7 cells, at least about 2.610.sup.7 cells, at least about 2.810.sup.7 cells, at least about 310.sup.7 cells, at least about 3.210.sup.7 cells, at least about 3.410.sup.7 cells, at least about 3.610.sup.7 cells, at least about 3.810.sup.7 cells, at least about 410.sup.7 cells, at least about 4.210.sup.7 cells, at least about 4.410.sup.7 cells, at least about 4.610.sup.7 cells, at least about 4.810.sup.7 cells, or at least about 510.sup.7 cells.
(139) The efficiency of genomic disruption of plants or any part thereof, including but not limited to a cell, with any of the nucleic acid delivery platforms described herein, can result in disruption of a gene or portion thereof at about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or up to about 100% as measured by nucleic acid or protein analysis.
(140) Organism Breeding
(141) In some embodiments, fungi, yeast or plants of the present disclosure can be used to produce new plant varieties. In some embodiments, the plants are used to develop new, unique and superior varieties or hybrids with desired phenotypes. In some embodiments, selection methods, e.g., molecular marker assisted selection, can be combined with breeding methods to accelerate the process. In some embodiments, a method comprises (i) crossing any organism provided herein comprising the expression cassette as a donor to a recipient organism line to create a FI population; (ii) selecting offspring that have expression cassette. Optionally, the offspring can be further selected by testing the expression of the gene of interest. In some embodiments, complete chromosomes of a donor organism are transferred. For example, the transgenic organism with an expression cassette can serve as a male or female parent in a cross pollination to produce offsprings by receiving a transgene from a donor thereby generating offsprings having an expression cassette. In a method for producing organisms having the expression cassette, protoplast fusion can also be used for the transfer of the transgene from a donor to a recipient. Protoplast fusion is an induced or spontaneous union, such as a somatic hybridization, between two or more protoplasts (cells in which the cell walls are removed by enzymatic treatment) to produce a single bi- or multi-nucleate cell. The fused cell that may even be obtained with species that cannot be interbred in nature is tissue cultured into a hybrid organism exhibiting the desirable combination of traits. More specifically, a first protoplast can be obtained from an organism having the expression cassette. A second protoplast can be obtained from a second organism, optionally from another species or variety, or from the same species or variety, that comprises commercially desirable characteristics, such as, but not limited to disease resistance, insect resistance etc. The protoplasts are then fused using traditional protoplast fusion procedures, which are known in the art to produce the cross. Alternatively, embryo rescue may be employed in the transfer of the expression cassette from a donor to a recipient. Embryo rescue can be used as a procedure to isolate embryos and tissue culture the same.
(142) In some cases, population improvement methods may be utilized. Population improvement methods fall naturally into two groups, those based on purely phenotypic selection, normally called mass selection, and those based on selection with progeny testing. Interpopulation improvement utilizes the concept of open breeding populations; allowing genes to flow from one population to another. Selection can be applied to improve one (or sometimes both) population(s) by isolating plants comprising desirable traits from both sources.
(143) In another aspect, mass selection can be utilized. In mass selection, desirable individual plants are chosen, harvested, and the seed composited without progeny testing to produce the following generation. Since selection is based on the maternal parent only, and there is no control over pollination, mass selection amounts to a form of random mating with selection. As stated herein, the purpose of mass selection is to increase the proportion of superior genotypes m the population. While mass selection is sometimes used, progeny testing is generally preferred for poly crosses, because of their operational simplicity and obvious relevance to the objective, namely exploitation of general combining ability in a synthetic.
(144) In some embodiments, breeding may utilize molecular markers. Molecular markers are designed and made, based on the genome of the plants of the present application. In some embodiments, the molecular markers are selected from Isozyme Electrophoresis, Restriction Fragment Length Polymorphisms (RFLPs), Randomly-Amplified Polymorphic DNAs (RAPDs), Arbitrarily Primed Polymerase Chain Reaction (AP-PCR), DNA Amplification Fingerprinting (DAF), Sequence Characterized Amplified Regions (SCARs). Amplified Fragment Length Polymorphisms (AFLPs), and Simple Sequence Repeats (SSRs) which are also referred to as Microsatellites, etc. Methods of developing molecular markers and their applications are described by Avise (Molecular markers, natural history, and evolution, Publisher: Sinauer Associates, 2004, ISBN 0878930418, 9780878930418), Snvastava et al. (Plant biotechnology and molecular markers, Publisher: Springer, 2004, ISBN1402019114, 9781402019111), and Vienne (Molecular markers in plant genetics and biotechnology, Publisher: Science Publishers, 2003), each of winch is incorporated by reference in its entirety for all purposes. The molecular markers can be used in molecular marker assisted breeding. Provided herein can also be methods for generating transgenic fungi. In some aspects, methods provided herein can comprise (a) contacting a fungus cell with an endonuclease or a polypeptide encoding an endonuclease. In some cases, an endonuclease introduces a genetic modification in a genome of a fungal cell resulting in an increased amount of one of Formula I-IV, derivatives or analogs thereof, as compared to an amount of the same compound in a comparable control without a genetic modification. In some aspects, a method can further comprise culturing a fungal cell that has been genetically modified as previously described to generate a transgenic fungus. Methods of making transgenic fungi can include electroporation, agrobacterium mediated transformation, biolistic particle bombardment, or protoplast transformation. In some aspects, a method can further comprise culturing a fungal cell to generate a fungus.
(145) In some aspects, provided herein can also be a method for generating transgenic plants comprising contacting a plant cell with an endonuclease or a polypeptide encoding an endonuclease. An endonuclease can introduce a genetic modification resulting in an increased amount of a psilocybin, psilocin, or dimethyltryptamine (DMT), a derivative, or analogue thereof as compared to an amount of the same compound in a comparable control absent a genetic modification.
(146) In some aspects, provided herein can also be a method for generating transgenic animals comprising contacting an animal cell with an endonuclease or a polypeptide encoding an endonuclease. An endonuclease can introduce a genetic modification resulting in an increased amount of a psilocybin, psilocin, or dimethyltryptamine (DMT), a derivative, or analogue thereof as compared to an amount of the same compound in a comparable control absent a genetic modification.
(147) In some aspects, provided herein can also be a method for generating transgenic insects comprising contacting an insect cell with an endonuclease or a polypeptide encoding an endonuclease. An endonuclease can introduce a genetic modification resulting in an increased amount of a psilocybin, psilocin, or dimethyltryptamine (DMT), a derivative, or analogue thereof as compared to an amount of the same compound in a comparable control absent a genetic modification.
(148) In some aspects, provided herein can also be a method for generating transgenic yeast comprising contacting a yeast cell with an endonuclease or a polypeptide encoding an endonuclease. An endonuclease can introduce a genetic modification resulting in an increased amount of a psilocybin, psilocin, or dimethyltryptamine (DMT), a derivative, or analogue thereof as compared to an amount of the same compound in a comparable control absent a genetic modification.
(149) In some aspects, provided herein can also be a method for generating transgenic E. coli comprising contacting an E. coli cell with an endonuclease or a polypeptide encoding an endonuclease. An endonuclease can introduce a genetic modification resulting in an increased amount of a psilocybin, psilocin, or dimethyltryptamine (DMT), a derivative, or analogue thereof as compared to an amount of the same compound in a comparable control absent a genetic modification.
(150) Methods comprising modifications of fungal cell genomes can result in: 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or up to about 80% more
(151) ##STR00006##
as measured by dry weight in a transgenic fungus as compared to a comparable control without a genomic modification. Further, methods comprising modifications can also result in from about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 100%, or up to about 200% more
(152) ##STR00007##
as measured by dry weight in a transgenic as compared to a comparable control without a modification. Moreover, methods comprising modifications can also result in from about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 100%, or up to about 200% more psilocybin or psilocin as measured by dry weight in a transgenic as compared to a comparable control without a modification.
(153) Provided herein can also be genetically modified cells comprising a disruption in a gene that results in an increased amount of a compound
(154) ##STR00008##
derivatives or analogs thereof, compared to an amount of the same compound in a comparable control cell without said genetic modification. Further, provided herein can also be genetically modified cells comprising a disruption in a gene that results in an increased amount of a compound
(155) ##STR00009##
derivatives or analogs thereof, compared to an amount of the same compound in a comparable control cell without said genetic modification. In addition, provided herein can also be genetically modified cells comprising a disruption in a gene that results in an increased amount of psilocybin and/or psilocin, derivatives or analogs thereof, compared to an amount of the same compound in a comparable control cell without said genetic modification. Alternatively, the genetically modified cells are plant cells, fungal cells, bacterial cells, animal cells, or insect cells.
(156) Additionally, provided herein can also be compositions comprising an endonuclease or polynucleotide encoding said endonuclease capable of introducing a genetic modification, wherein said genetic modification results in an increased amount of psilocybin or psilocin, their derivatives or analogs compared to a comparable control cell without said genetic modification.
Psilocybin Synthesis Genes Transgene Methods and Compositions
(157) Provided herein can be methods of transforming mushrooms with Psilocybin synthesis genes. In some embodiments, the coding sequences of the 4 major Psilocybin Synthesis genes are synthesized and cloned into an overexpression vector system pGWB5 under the control of the 35S promoter. In some embodiments, additional vectors with different promoters driving expression of these genes are also produced (including Gpd, EF1a and Actin).
(158) In some cases, Basidiomycete fungi are transformed using pGWB5 to test transformation efficiency and develop protocols. In some cases, transformations including the different Psi genes individually and in combination to observe potential for increase in psilocybin production. In some cases, an all-in-one expression vector of the four Psi genes in tandem within a polycistronic vector is generated and tested.
(159) In some embodiments, propagation and growth of Psilocybe cubensis is enabled on different substrates to generate both mature fruiting mushrooms and mycelia. In some embodiments, tissue is extracted from the mushroom gills and is transformed of the Psi genes by agrobacterium-mediated transformation. In some embodiments, protoplasts are generated from Mycelia and PEG-mediated transformation of the Psi genes, along with agrobacterium-mediated transformation of the mycelia. In some embodiments, Psilocybe cubensis is grown in PDA agar or in a barley-perlite compost at room temperature for 7 days. In some cases, Mycelia and fruiting bodies are harvested for tissue extraction and cell isolation prior to transformation.
(160) In some embodiments, Psi gene overexpression is under the control of two distinct promoter types, the 35S promoter, a widely used plant over-expression promoter, and two fungal specific over-expression promoters, GPD and CcDED1 (Table 4,
(161) TABLE-US-00004 TABLE 4 Gene Expression Vectors Gene Promoter Vector Promoter Gene Inserted characteristics pGWB5 35S PsiH|PsiD|PsiK|PsiH Cauliflower mosaic virus 35S promoter pGHGWY GPD PsiH|PsiD|PsiK|PsiH Fungal specific promoters pGHGWY CcDED1 PsiH|PsiD|PsiK|PsiH Fungal specific promoters
(162) In some embodiments, PsiD gene over-expression comprises a vector expressing PsiD gene under the control of a 35S promoter (Table 5: SEQ ID NO: 18, 17,647 bp;
(163) In some embodiments, Psi genes over-expression comprises a vector expressing Psi genes under the control of a GcDED1 promoter (Table 5: SEQ ID NO: 19, 9,462 bp;
Pharmaceutical and Nutraceutical Compositions and Methods
(164) Provided herein can be pharmaceutical or nutraceutical compositions comprising genetically modified cells, organisms, fungi or plants described herein or an extract, derivative or product thereof. Provided herein can also be pharmaceutical or nutraceutical reagents, methods of using the same, and method of making pharmaceutical or nutraceutical compositions comprising genetically modified cells, organisms, fungi or plants described herein or an extract or product thereof. Provided herein are also pharmaceutically and nutraceutical-suitable cells, organisms, or plants described herein or an extract, derivative or product thereof.
(165) In some cases, a genetically modified cells, organisms, fungi or plants described herein or an extract or product thereof can be used as a pharmaceutical or nutraceutical agent. In some cases, a composition comprising such a pharmaceutical or nutraceutical agents can be used for treating or stabilizing conditions or symptoms associated with conditions such as depression, anxiety, post-traumatic stress, addiction or cessation related side-effects such as smoking cessation, and psychological distress including cancer-related psychological distress. Specifically genetically modified cells, organisms, fungi or plants described herein or an extract, derivative or product thereof can be used to alleviate various symptoms associated with mental disorders and conditions.
(166) In some aspects, cells, organisms, or plants described herein or an extract or product thereof can be used to treat particular symptoms. For example, pain, nausea, weight loss, wasting, multiple sclerosis, allergies, infection, vasoconstrictor, depression, migraine, hypertension, post-stroke neuroprotection, as well as inhibition of tumor growth, inhibition of angiogenesis, and inhibition of metastasis, antioxidant, and neuroprotectant. In some aspects, cells, organisms, or plants described herein or an extract or product thereof can be used to treat additional symptoms. For instance, persistent muscle spasms, including those that are characteristic of multiple sclerosis, severe arthritis, peripheral neuropathy, intractable pain, migraines, terminal illness requiring end of life care, Hydrocephalus with intractable headaches, Intractable headache syndromes, neuropathic facial pain, shingles, chronic nonmalignant pain, causalgia, chronic inflammatory demyelinating polyneuropathy, bladder pain, myoclonus, post-concussion syndrome, residual limb pain, obstructive sleep apnea, traumatic brain injury (TBI), elevated intraocular pressure, opioids or opiates withdrawal, and/or appetite loss.
(167) In some cases, cells, organisms, or plants described herein or an extract or product thereof may also comprise other pharmaceutically or nutraceutically relevant compounds and extracts, including flavonoids, monoamine oxidase inhibitors and phytosterols (e.g., apigenin, quercetin, cannflavin A, beta.-sitosterol and the like).
(168) In some an extract or product thereof can be subject to methods comprising extractions that preserve the psilocybene, dimethyltryptamine or psilocene. The extracts of the present disclosure are designed to produce products for human or animal consumption via inhalation (via combustion, vaporization and nebulization), buccal absorption within the mouth, oral administration, and topical application delivery methods. The present disclosure teaches an optimized method at which we extract compounds of interest, by extracting at the point when the drying harvested plant or fungus has reached 5, 10, or 15% water weight. Stems are typically still cool and rubbery from evaporation taking place. This timeframe (or if frozen at this point in process) allow extractor to minimize active agent loss to evaporation. There is a direct correlation between cool/slow, -dry and preservation of essential oils. Thus, there is a direct correlation to EO loss in flowers that dry too fast, or too hot conditions or simply dry out too much (<10% H20). The chemical extraction of cells, organisms, or plants described herein or an extract or product thereof can be accomplished employing polar and non-polar solvents in various phases at varying pressures and temperatures to selectively or comprehensively extract other compounds of flavor, fragrance or pharmacological value for use individually or combination in the formulation of products. The extractions can be shaped and formed into single or multiple dose packages, e.g., dabs, pellets and loads. The solvents employed for selective extraction of our cultivars may include water, carbon dioxide, 1,1,1,2-tetrafluoroethane, butane, propane, ethanol, isopropyl alcohol, hexane, and limonene, in combination or series. The extracts of the present disclosure may also be combined with pure compounds of interest to the extractions, e.g. cannabinoids or terpenes to further enhance or modify the resulting formulation's fragrance, flavor or pharmacology. In some embodiments, the extractions are supplemented with terpenes or cannabinoids to adjust for any loss of those compounds during extraction processes.
(169) In some aspects, genetically modified organism, derivative or extracts of the present disclosure can be used for vaporization, production of e-juice or tincture for e-cigarettes, or for the production of other consumable products such as edibles, balms, or topical spreads. In an aspect, a modified composition provided herein can be used as a supplement, for example a food supplement. In some embodiments, the cells, organisms, or plants described herein or an extract or product thereof can be used to make edibles. Edible recipes can begin with the extraction of cannabinoids and terpenes, which are then used as an ingredient in various edible recipes. Extraction methods for edibles include extraction into cooking oil, milk, cream, balms, flour and butter. Lipid rich extraction mediums/edibles are believed to facilitate absorption into the blood stream. Lipids may be utilized as excipients in combination with the various compositions provided herein In other aspects, compositions provided herein can comprise: oral forms, a transdermal forms, an oil formulation, an edible food, or a food substrate, an aqueous dispersion, an emulsion, a solution, a suspension, an elixir, a gel, a syrup, an aerosol, a mist, a powder, a tablet, a lozenge, a gel, a lotion, a paste, a formulated stick, a balm, a cream, or an ointment.
(170) Provided herein are also kits comprising compositions provided herein. Kits can include packaging, instructions, and various compositions provided herein. In some aspects, kits can also contain additional compositions used to generate the various plants and portions of plants provided herein such as pots, soil, fertilizers, water, and culturing tools.
(171) While preferred embodiments of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure. It should be understood that various alternatives to the embodiments of the disclosure described herein may be employed in practicing the disclosure. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.
EXAMPLES
Example 1: Strategy of Overexpressing Psi Genes in Psliocybe Cubensis
(172) Step 1. Build Psilocybin Pathway Expression Vectors.
(173) Panel of expression vectors with different promoters of varying strengths are being constructed. Some promoters are mushroom specific while other promoters are from high expression plant systems etc. (
(174) Step 2. Prepare Mushroom Material for Transformation.
(175) Protoplast, conidia, gill tissue and mycelium were isolated for transformation as illustrated in Examples 3-7. The selection of the appropriate protocol depends on the mushroom to be transformed. Here, protoplasts and extract gill tissue were isolated, as exemplified in Examples 3-5 and
(176) Step 3. Transformation.
(177) Cultured protoplasts from Step 2 was transfected with plasmid DNA from Step 1 using various protocols. See Examples 3-5. Additionally, gill tissue from Step 2 was transformed with agrobacterium from Step 1 using various protocols. See Examples 6-7. Transformants with the plasmid DNA or agrobacterium incorporation will be selected, as illustrated in
(178) Step 4. Regeneration.
(179) Adult mushrooms from transformants of Step 3 will be regenerated, as illustrated in
(180) Step 5. Psilocybin Analysis.
(181) The psilocybin content of the genetically modified mushrooms will be analyzed by gas chromatography/mass spectrometry, as illustrated in
Example 2: Vector Constructs Overexpressing Psi Genes
(182) The coding sequences of the 4 major psilocybin synthesis genes (psiD/psiH/psiK/psiM) have been synthesized and cloned into an overexpression vector system (pGWB5) under the control of a 35S promoter. The 35S promoter is a widely used plant over-expression promoter. See Table 4. For example, PsiD gene was cloned into a vector expressing PsiD gene under the control of a 35S promoter (Table 5: SEQ ID NO: 18, 17,647 bp;
(183) In addition, an all-in-one expression vector of the four Psi genes in tandem within a polycistronic vector has also been generated and is now being tested.
(184) Other vectors with different promoters (including GPD, EF1a and Actin) were produced, and the 4 major psilocybin synthesis genes (psiD/psiH/psiK/psiM) will be cloned into these vectors. For example, GPD and CcDED1 promoters are two fungi specific over-expression promoters. See Table 4. Psi genes will be be cloned into a vector expressing Psi genes under the control of a GcDED1 promoter (vector backbone Table 5: SEQ ID NO: 19, 9,462 bp;
Example 3: Vector Mediated Transfection of Protoplasts: Protocol A
(185) Material
(186) Pleurotus nebrodensis strain was grown at 25 C. on PDSA medium (20% potato, 2% dextrose, 0.3% KH2PO4, 0.15% MgSO4,0.0005% vitamin B1, 2% agar) and kept at 4 C.
(187) Vegetative cultures of mycelia were conducted in PDSB medium (PDSA medium without agar) at 25 C. for 1 week.
(188) Protoplast Extraction.
(189) Collected 1 gr mycelum growing in PDSB medium for 7 days by infiltration through nylon mesh.
(190) Washed in 0.6 M of MgSO4 for two times.
(191) Resuspended in 3 ml of lysis buffer containing 1.5% lywallzyme (Guangdong Institute of Micro-biology) and 0.6 M MgSO4, then incubated at 32 C. for 2.5 h with gently shaking for protoplast release.
(192) Protoplasts were purified by filtration through a glass injector with a layer of 1 mm of loose absorbent cotton and collected by centrifugation at 2000 gf or 20 min at 4 C.
(193) Washed twice with 3 ml MM buffer containing 0.5 M mannitol and 50 mM maleic acid buffer (pH 5.5).
(194) Resuspended in 2-3 ml of MMC buffer (0.5 M mannitol, 50 mM maleic acid buffer with pH 5.5, 5 mM CaCl2) to a concentration of 10.sup.8-10.sup.9 protoplasts ml.sup.1.
(195) Protoplast Transformation
(196) 3 ug of desired plasmid, 12.5 ul of PTC buffer (25% PEG4000, 10 mM Tris-HCl at pH 7.5, 25 mM CaCl.sub.2) were added to 50 ul of chilled protoplast suspension and mixed well.
(197) Mixture was kept on ice for 20 min.
(198) 0.5 ml of PTC buffer was added to the mixture and mixed gently, followed by incubation for 5 min at room temperature.
(199) Protoplast mixture was ready for plating on the regeneration and screening medium.
(200) Protoplast Regeneration
(201) The protoplast mixture was diluted with 1 ml STC buffer (18.2% sorbitol, 10 mM Tris-HCl at pH 7.5, 25 mM CaCl2) and plated on the regeneration medium (PDSA plus 1.0 M sorbitol) for 24 h at 25 C.
(202) After regeneration culture for 24 h at 25 C., each plate was added with 20 ml screening medium (PDSA plus 0.8 M sorbitol, 80 ug/ml hygromycin B, 0.8% agar) and incubated at 25 C. in dark for 2 weeks.
(203) Putative transformants appeared on the screening medium were subjected to a further five-round subculture on PDSA medium containing 80 ug/ml hygromycin B for screening of stable transformants. Some regenerating protoplast stops growing at 1-2 mm diameter. Only those that pass the 1-2 mm diameter size were transferred to further selection rounds.
(204) The average transformation efficiency is about 3 transformants per microgram of plasmid pAN7-1 DNA.
(205) DNA Extract and Analysis
(206) Genomic DNA was isolated from mycelia of the putative stable transformants and non-transformed control of P. nebrodensis by the fungal DNA extraction (FDE) method. One gram of mycelium was crushed in liquid nitrogen to powder and digested in 10 ml TESN buffer (50 mM Tris-HCl at pH 7.5, 100 mM EDTA at pH 8.0,0.5% SDS, 300 mM NaOAc at pH 5.2) at 68 C. for 1 h. After the addition of 3.5 ml 3 M NaOAc (pH 5.2) and incubation on ice for 20 min, the digestion mixture was centrifuged at 8000 g for 20 min at 4 C. The DNA in supernatant was extracted by phenol/chloroform extraction method.
Example 4: Vector Mediated Transfection of Protoplasts: Protocol B
(207) Protoplast Extraction and Collection:
(208) Step 1: Small blocks of monokaryon mycelium were inoculated into CYM medium (1% maltose, 2% glucose, 0.2% yeast extract, 0.2% tryptone, 0.05% MgSO47H2O, 0.46% KH2PO4) and allowed to grow for 5 days at 25 C. with shaking at 230 rpm.
(209) Step 2: Mycelia were harvested by centrifugation, washed twice with 0.7 M NaCl, and treated with enzyme solution (50 mg/ml lysing enzymes from Trichoderma harzianum [Sigma-Aldrich] in 1 M MgSO4 and 0.6 M phosphate buffer, pH 6.0) at 25 C. for 2.0 to 2.5 h.
(210) Step 3: After incubation, protoplasts were separated from hyphal debris by filtration through a sterile Miracloth and collected by centrifugation at 3,000g for 10 min.
(211) Step 4: Protoplasts were washed twice with 1 M sorbitol, and the protoplast density was adjusted to 108/ml with the same.
(212) PEG-Mediated Transformation:
(213) Step 1: Fifty microliters of protoplasts (108/ml) was mixed with 10 g of each plasmid DNA and 12.5 l of PEG solution (40% PEG 4000, 10 mM Tris-HCl, pH 8.0, 25 mM CaCl.sub.2; filter sterilized).
(214) Step 2: Protoplasts were incubated on ice for 20 min.
(215) Step 3: Five hundred microliters of PEG solution was added, gently mixed, and incubated for 5 min at room temperature.
(216) Step 4: One millilitre of ice-cold STC buffer (1 M sorbitol, 10 mM Tris-HCl, pH 8.0, 25 mM CaCl.sub.2) was added, and the mixture was then spread on plates containing 20 ml PDAS regeneration agar medium (PDA plus 0.6 M sucrose, pH 6.5).
(217) Step 5: Plates were incubated at 25 C. for 48 h, and then 5 ml of PDAS medium containing 600 g/ml hygromycin B (Duchefa, The Netherlands), 600 g/ml phleomycin (Invitrogen), or 60 g/ml carboxin (Duchefa, The Netherlands) was added as an overlay, and plates were further incubated at 25 C. until the transformants appeared (5 to 7 days).
(218) Protoplast Regeneration:
(219) Step 1: Transformants were individually subcultured onto fresh PDA plates containing 50 g/ml hygromycin, 50 g/ml phleomycin, or 5 g/ml carboxin.
(220) Step 2: Mature fruiting bodies of Psilocybe cubensis were obtained following cultivation on MMP medium (1% malt extract, 0.5% mycological peptone, 1.5% agar) at 25 C. for 20 to 22 days with the respective selection agent.
Example 5: Agrobacterium Mediated Transformation of Protoplast
(221) Material: Gill Tissue
(222) The veil was cut from the fruiting body of P. eryngii and the exposed gill tissue was aseptically excised and sectioned into 1.00.5 cm pieces.
(223) Agrobacterium Preparation
(224) GV3101 carrying plasmid vector of interest was grown in 50 ml LB medium supplemented with kanamycin (50 g/ml) at 28 C. for 2 days to an optical density at 600 nm of 1.6. Bacteria was collected by centrifugation for 30 min at 4,000 g and then washed once with 50 ml washing solution containing 100 mM MgCl2 and 100 M acetosyringone. After centrifugation at 4,000 g for another 30 min, the pellet of bacteria was resuspended in washing solution to an optical density at 600 nm of 1.0.
(225) Transformation (This dark culture method is highly effective for growing mycelium and eliminating Agrobacterium).
(226) These pieces (from ##) were vacuum infiltrated in the Agrobacterium suspension culture two times for 10 min.
(227) The evacuated tissues were washed with triple distilled water and dried on sterile Whatman filter paper under aseptic condition for 10 min.
(228) The tissues were then transferred to a sterile Petri dish without medium and incubated for 7-14 days in the dark at 25 C.
(229) For selection, the dark-cultured active tissues were transferred to PDA (Potato dextrose agar) medium (20% potato extract, 2% dextrose, and 1.5% Agar) containing 50 g/ml hygromycin and 100 g/ml cefotaxime and cultured for 2-3 weeks in the dark at 25 C.
(230) Putative transformants will then be sub-cultured onto PDA medium at 25 C. for 1 week in the dark. Finally, the mycelia will be cultured on liquid medium containing PDB (PDA without agar) for 2 weeks in a shaking incubator at 25 C. and 130 g.
(231) Mycelia will then be separated by filtration through Whatman filter paper and used for further processing.
(232) DNA extraction: Mycelia will be collected from putative transgenic and untransformed mushrooms and grounded in liquid nitrogen using a pre-chilled mortar and pestle. DNA will be isolated from mycelia following the cetyl-trimethyl-ammonium bro-mide (CTAB).
Example 6: Agrobacterium Mediated Transformation of Mycelium
(233) Psilocybe cubensis mycelia was routinely maintained on potato dextrose agar (PDA) at 25 C. Mature fruiting bodies of Psilocybe cubensis were obtained following cultivation on MMP medium (1% malt extract, 0.5% mycological peptone, 1.5% agar) at 25 C. for 20 to 22 days.
(234) A. tumefaciens strains AGL1 containing the desired expression vector were grown for 24 h in LB medium supplemented with appropriate antibiotics.
(235) Bacterial cultures were subsequently diluted to an optical density at 660 nm of 0.15 with Agrobacterium induction medium (AIM) (Induction medium (IM) [MM containing 0.5% (w/v) glycerol, 0.2 mM acetosyringone (AS), 40 mM 2-(N-morpholino)ethanesulfonicacid (MES), pH 5.3]) in the presence of 200 M acetosyringone and grown for an additional 5 to 6 h.
(236) 5-day-old Psilocybe cubensis mycelia obtained from general-purpose growth medium were homogenized using an Ultra-Turrax homogenizer, and hyphal fragments were transferred to fresh general-purpose growth medium and grown for 24 h to give a uniform mycelial slurry.
(237) A 100-l mycelial suspension was mixed with 100 l of bacterial culture and then spread on cellophane discs, overlaid on AIM agar plates, and incubated at 25 C. for 48 h.
(238) After cocultivation, cellophane discs were transferred to PDA medium containing 200 g/ml Timentine to kill residual Agrobacterium cells and 100 g/ml hygromycin to select fungal transformants.
(239) These were incubated at 25 C. until the hygromycin-resistant colonies appeared. Individual colonies were subsequently transferred to PDA medium containing 50 g/ml hygromycin.
(240) Mature fruiting bodies of Psilocybe cubensis were obtained following cultivation on MMP medium (1% malt extract, 0.5% mycological peptone, 1.5% agar) at 25 C. for 20 to 22 days with the respective selection agent.
Example 7: Agrobacterium Mediated Transformation of Fruiting Body
(241) P. cubensis was routinely maintained on potato dextrose agar (PDA) at 25 C. Mature fruiting bodies of P. cubensis were obtained following cultivation on MMP medium (1% malt extract, 0.5% mycological peptone, 1.5% agar) at 25 C. for 20 to 22 days.
(242) A. tumefaciens strains AGL-1 containing desired expression vector were grown for 24 h in LB medium supplemented with appropriate antibiotics
(243) Bacterial cultures were subsequently diluted to an optical density at 660 nm of 0.15 with Agrobacterium induction medium (AIM) in the presence of 200 M acetosyringone and grown for an additional 5 to 6 h.
(244) Mature fruiting bodies (mature but before gill exposure) were excised from MMP plates using a scalpel and diced into small sections.
(245) Fruiting body gill tissue pieces were mixed with induced A. tumefaciens culture and vacuum infiltrated until no more air bubbles emerged.
(246) The infiltrated gill pieces were transferred to cellulose discs overlaid on AIM agar plates. Cocultivation and selection of transformants were carried out as described in Example 6.
(247) After cocultivation, cellophane discs were transferred to PDA medium containing 200 g/ml Timentine to kill residual Agrobacterium cells and 100 g/ml hygromycin to select fungal transformants.
(248) These were incubated at 25 C. until the hygromycin-resistant colonies appeared. Individual colonies were subsequently transferred to PDA medium containing 50 g/ml hygromycin.
(249) Mature fruiting bodies of P. cubensis were obtained following cultivation on MMP medium (1% malt extract, 0.5% mycological peptone, 1.5% agar) at 25 C. for 20 to 22 days with the respective selection agent.
Example 8: Transformation, Transfection, and Regeneration
(250) Psilocybe cubensis was propagated and grown on different substrates to generate both mature fruiting mushrooms and mycelia, as shown in
(251) Basidiomycete fungi are transformed using pGWB5 vectors described in Example 2, with transformation or transfection protocol described through Example 3-7. Transformations include the different Psi genes individually and in combination (using multiple different vectors, or a vector with multiple Psi genes).
(252) For example, tissue was extracted from the mushroom gills and was transformed of the Psi genes by agrobacterium-mediated transformation described in Example 3-7.
(253) Protoplasts were generated from mycelia and transformed of the Psi genes with PEG-mediated transfection. Mycelia were transformed with agrobacterium-mediated transformation.
(254) After regeneration of multiple transformed fungi, polynucleotide analysis will be performed to confirm gene integration and to determine RNA expression levels. In addition, mRNA and protein levels of the disrupted gene will be determined. The content of one or more bioactive metabolites, such as terpenes or cannabinoids in plant tissues will also be determined. For example, the content of one or more of psilocybin and/or psilocin will be determined with procedures known to a person with an ordinary skill in the art.
(255) TABLE-US-00005 TABLE5 PsilocybinExpressionVectorSequences. SEQ ID NO Name Sequence 15 pGWB5:35S: tgagcgtcgcaaaggcgctcggtcttgccttgctcgtcggtgatgtacttcaccagctccgcgaa PsiMcds: gtcgctcttcttgatggagcgcatggggacgtgcttggcaatcacgcgcaccccccggccgtttt stop agcggctaaaaaagtcatggctctgccctcgggcggaccacgcccatcatgaccttgccaagctc gtcctgcttctcttcgatcttcgccagcagggcgaggatcgtggcatcaccgaaccgcgccgtgc gcgggtcgtcggtgagccagagtttcagcaggccgcccaggcggcccaggtcgccattgatgcgg gccagctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggcca gcaggtaggccgacaggctcatgccggccgccgccgccttttcctcaatcgctcttcgttcgtct ggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcatcagccatccg cttgccctcatctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagca ccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacct atcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcc tgtatatcgtgcgaaaaaggatggatataccgaaaaaatcgctataatgaccccgaagcagggtt atgcagcggaaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggc agggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtc ctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagc ctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctca catgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctg ataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgc cagaaggccgccagagaggccgagcgcggccgtgaggcttggacgctagggcagggcatgaaaaa gcccgtagcgggctgctacgggcgtctgacgcggtggaaagggggaggggatgttgtctacatg gctctgctgtagtgagtgggttgcgctccggcagcggtcctgatcaatcgtcaccctttctcggt ccttcaacgttcctgacaacgagcctccttttcgccaatccatcgacaatcaccgcgagtccctg ctcgaacgctgcgtccggaccggcttcgtcgaaggcgtctatcgcggcccgcaacagcggcgaga gcggagcctgttcaacggtgccgccgcgctcgccggcatcgctgtcgccggcctgctcctcaagc acggccccaacagtgaagtagctgattgtcatcagcgcattgacggcgtccccggccgaaaaacc cgcctcgcagaggaagcgaagctgcgcgtcggccgtttccatctgcggtgcgcccggtcgcgtg ccggcatggatgcgcgcgccatcgcggtaggcgagcagcgcctgcctgaagctgcgggcattc ccgatcagaaatgagcgccagtcgtcgtcggctctcggcaccgaatgcgtatgattctccgccag catggcttcggccagtgcgtcgagcagcgcccgcttgttcctgaagtgccagtaaagcgccggct gctgaacccccaaccgttccgccagtttgcgtgtcgtcagaccgtctacgccgacctcgttcaac aggtccagggcggcacggatcactgtattcggctgcaactttgtcatgcttgacactttatcact gataaacataatatgtccaccaacttatcagtgataaagaatccgcgcgttcaatcggaccagcg gaggctggtccggaggccagacgtgaaacccaacatacccctgatcgtaattctgagcactgtcg cgctcgacgctgtcggcatcggcctgattatgccggtgctgccgggcctcctgcgcgatctggtt cactcgaacgacgtcaccgcccactatggcattctgctggcgctgtatgcgttggtgcaatttgc ctgcgcacctgtgctgggcgcgctgtcggatcgtttcgggcggcggccaatcttgctcgtctcgc tggccggcgccagatctggggaaccctgtggttggcatgcacatacaaatggacgaacggataaa ccttttcacgcccttttaaatatccgattattctaataaacgctcttttctcttaggtttacccg ccaatatatcctgtcaaacactgatagtttaaactgaaggcgggaaacgacaatctgatcatgag cggagaattaagggagtcacgttatgacccccgccgatgacgcgggacaagccgttttacgtttg gaactgacagaaccgcaacgttgaaggagccactcagccgcgggtttctggagtttaatgagcta agcacatacgtcagaaaccattattgcgcgttcaaaagtcgcctaaggtcactatcagctagcaa atatttcttgtcaaaaatgctccactgacgttccataaattcccctcggtatccaattagagtct catattcactctcaatccaaataatctgcaccggatctggatcgtttcgcatgattgaacaagat ggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaaca gacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttg tcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctg gccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggct gctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtat ccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccac caagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatga tctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgc ccgacggcgatgatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaat ggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagc gttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgcttt acggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctga gcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgat tccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgat cctccagcgcggggatctcatgctggagttcttcgcccacgggatctctgcggaacaggcggtcg aaggtgccgatatcattacgacagcaacggccgacaagcacaacgccacgatcctgagcgacaat atgatcgggcccggcgtccacatcaacggcgtcggcggcgactgcccaggcaagaccgagatgca ccgcgatatcttgctgcgttcggatattttcgtggagttcccgccacagacccggatgatccccg atcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgatt atcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatt tatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaa tatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgggcctcc tgtcaatgctggcggcggctctggtggtggttctggtggcggctctgagggtggtggctctgagg gtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctctggttccggtgat tttgattatgaaaagatggcaaacgctaataagggggctatgaccgaaaatgccgatgaaaacgc gctacagtctgacgctaaaggcaaacttgattctgtcgctactgattacggtgctgctatcgatg gtttcattggtgacgtttccggccttgctaatggtaatggtgctactggtgattttgctggctct aattcccaaatggctcaagtcggtgacggtgataattcacctttaatgaataatttccgtcaat atttaccttccctccctcaatcggttgaatgtcgcccttttgtctttggcccaatacgcaaacc gcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaag cgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacac tttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacag ctatgaccatgattacgccaagcttgcatgcctgcaggtccccagattagccttttcaatttcag aaagaatgctaacccacagatggttagagaggcttacgcagcaggtctcatcaagacgatctacc cgagcaataatctccaggaaatcaaataccttcccaagaaggttaaagatgcagtcaaaagattc aggactaactgcatcaagaacacagagaaagatatatttctcaagatcagaagtactattccagt atggacgattcaaggcttgcttcacaaaccaaggcaagtaatagagattggagtctctaaaaagg tagttcccactgaatcaaaggccatggagtcaaagattcaaatagaggacctaacagaactcgcc gtaaagactggcgaacagttcatacagagtctcttacgactcaatgacaagaagaaaatcttcgt caacatggtggagcacgacacacttgtctactccaaaaatatcaaagatacagtctcagaagacc aaagggcaattgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgccca gctatctgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattg cgataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccac ccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgt gatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctat ataaggaagttcatttcatttggagagaacacgggggactctaatcaaacaagtttgtacaaaaa agctgaacgagaaacgtaaaatgatataaatatcaaatgcatatcagaaatccttaccgtacacc aattgactatcaagcactttcagaggccttccctcccctcaagccatttgtgtctgtcaatgcag atggtaccagttctgttgacctcactatcccagaagcccagagggcgttcacggccgctcttctt catcgtgacttcgggctcaccatgaccataccagaagaccgtctgtgcccaacagtccccaatag gttgaactacgttctgtggattgaagatattttcaactacacgaacaaaaccctcggcctgtcgg atgaccgtcctattaaaggcgttgatattggtacaggagcctccgcaatttatcctatgcttgcc tgtgctcggttcaaggcatggtctatggttggaacagaggtcgagaggaagtgcattgacacggc ccgcctcaatgtcgtcgcgaacaatctccaagaccgtctctcgatattagagacatccattgatg gtcctattctcgtccccattttcgaggcgactgaagaatacgaatacgagtttactatgtgtaac cctccattctacgacggtgctgccgatatgcagacttcggatgctgccaaaggatttggatttgg cgtgggcgctccccattctggaacagtcatcgaaatgtcgactgagggaggtgaatcggctttcg tcgctcagatggtccgtgagagcttgaagcttcgaacacgatgcagatggtacacgagtaacttg ggaaagctgaaatccttgaaagaaatagtggggctgctgaaagaacttgagataagcaactatgc cattaacgaatacgttcaggggtccacacgtcgttatgccgttgcgtggtctttcactgatattc aactgcctgaggagctttctcgtccctctaaccccgagctcagctctcttttctagcatt ttacgtttctcgttcagctttcttgtacaaagtggttcgatctagaggatccatggtgag caagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtgaa cggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccct gaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcacct acggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgcc atgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagaccc gcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgact tcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtct atatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcga ggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccg tgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaa gcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactcacggcatggacgag ctgtacaagtaaagcggcccgagctcgaatttccccgatcgttcaaacatttggcaataaagttt cttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgtta agcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtc ccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatc gcgcgcggtgtcatctatgttactagatcgggaattagcttcatcaacgcaagacatgcgcacga ccgtctgacaggagaggaatttccgacgagcacagaaaggacttgctcttggacgtaggcctatt tctcaggcacatgtatcaagtgttcggacgtgggttttcgatggtgtatcagccgccgccaactg ggagatgaggaggctttcttggggggcagtcagcagttcatttcacaagacagaggaacttgtaa ggagatgcactgatttatcttggcgcaaaccagcaggacgaattagtgggaatagcccgcgaata tctaagttatgcctgtcggcatgagcagaaacttccaattcgaaacagtttggagaggttgtttt tgggcataccttttgttagtcagcctctcgattgctcatcgtcattacacagtaccgaagtttga tcgatctagtaacatagatgacaccgcgcgcgataatttatcctagtttgcgcgctatattttgt tttctatcgcgtattaaatgtataattgcgggactctaatcataaaaacccatctcataaataac gtcatgcattacatgttaattattacatgcttaacgtaattcaacagaaattatatgataatcat cgcaagaccggcaacaggattcaatcttaagaaactttattgccaaatgtttgaacgatctgctt cgacgcactccttctttactccaccatctcgtccttattgaaaacgtgggtagcaccaaaacgaa tcaagtcgctggaactgaagttaccaatcacgctggatgatttgccagttggattaatcttgcct ttccccgcatgaataatattgatgaatgcatgcgtgaggggtatttcgattttggcaatagctgc aattgccgcgacatcctccaacgagcataattcttcagaaaaatagcgatgttccatgttgtcag ggcatgcatgatgcacgttatgaggtgacggtgctaggcagtattccctcaaagtttcatagtca gtatcatattcatcattgcattcctgcaagagagaattgagacgcaatccacacgctgcggcaac cttccggcgttcgtggtctatttgctcttggacgttgcaaacgtaagtgttggatcccggtcggc atctactctattcctttgccctcggacgagtgctggggcgtcggtttccactatcggcgagtact atctcacagccatcggtccagacggccgcgcttctgcgggcgatttgtgtacgcccgacagtccc ggctccggatcggacgattgcgtcgcatcgaccctgcgcccaagctgcatcatcgaaattgccgt caaccaagctctgatagagttggtcaagaccaatgcggagcatatacgcccggagccgcggcgat cctgcaagctccggatgcctccgctcgaagtagcgcgtctgctgctccatacaagccaaccacgg cctccagaagaagatgttggcgacctcgtattgggaatccccgaacatcgcctcgctccagtcaa tgaccgctgttatgcggccattgtccgtcaggacattgttggagccgaaatccgcgtgcacgagg tgccggacttcggggcagtcctcggcccaaagcatcagctcatcgagagcctgcgcgacggacgc actgacggtgtcgtccatcacagtttgccagtgatacacatggggatcagcaatcgcgcatatga aatcacgccatgtagtgtattgaccgattccttgcggtccgaatgggccgaacccgctcgtctgg ctaagatcggccgcagcgatcgcatccatggcctccgcgaccggctgcagaacagcgggcagttc ggtttcaggcaggtcttgcaacgtgacaccctgtgcacggcgggagatgcaataggtcaggctct cgctgaattccccaatgtcaagcacttccggaatcgggagcgcggccgatgcaaagtgccgataa acataacgatctttgtagaaaccatcggcgcagctatttacccgcaggacatatccacgccctcc tacatcgaagctgaaagcacgagattcttcgccctccgagagctgcatcaggtcggagacgctgt cgaacttttcgatcagaaacttctcgacagacgtcgcggtgagttcaggctttttcatatcgggg tcgtcctctccaaatgaaatgaacttccttatatagaggaagggtcttgcgaaggatagtgggat tgtgcgtcatcccttacgtcagtggagatatcacatcaatccacttgctttgaagacgtggttgg aacgtcttctttttccacgatgctcctcgtgggtgggggtccatctttgggaccactgtcggcag aggcatcttgaacgatagcctttcctttatcgcaatgatggcatttgtaggtgccaccttccttt tctactgtccttttgatgaagtgacagatagctgggcaatggaatccgaggaggtttcccgatat taccctttgttgaaaagtctcaatagccctttggtcttctgagactgtatctttgatattcttgg agtagacgagagtgtcgtgctccaccatgttgacggatctctaggacgcgtcctagaagctaatt cactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgcctt gcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttccca acagttgcgcagcctgaatggcgcccgctcctttcgctttcttcccttcctttctcgccacgttc gccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacg gcacctcgaccccaaaaaacttgatttgggtgatggttcacgtagtgggccatcgccctgataga cggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactgga acaacactcaaccctatctcgggctattcttttgatttataagggattttgccgatttcggaacc accatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctca gggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccccag tacattaaaaacgtccgcaatgtgttattaagttgtctaagcgtcaatttgtttacaccacaata tatcctgccaccagccagccaacagctccccgaccggcagctcggcacaaaatcaccactcgata caggcagcccatcagtccgggacggcgtcagcgggagagccgttgtaaggcggcagactttgctc atgttaccgatgctattcggaagaacggcaactaagctgccgggtttgaaacacggatgatctcg cggagggtagcatgttgattgtaacgatgacagagcgttgctgcctgtgatcaaatatcatctcc ctcgcagagatccgaattatcagccttcttattcatttctcgcttaaccgtgacaggctgtcgat cttgagaactatgccgacataataggaaatcgctggataaagccgctgaggaagctgagtggcgc tatttctttagaagtgaacgttgacgatatcaactcccctatccattgctcaccgaatggtacag gtcggggacccgaagttccgactgtcggcctgatgcatccccggctgatcgaccccagatctggg gctgagaaagcccagtaaggaaacaactgtaggttcgagtcgcgagatcccccggaaccaaagga agtaggttaaacccgctccgatcaggccgagccacgccaggccgagaacattggttcctgtaggc atcgggattggcggatcaaacactaaagctactggaacgagcagaagtcctccggccgccagttg ccaggcggtaaaggtgagcagaggcacgggaggttgccacttgcgggtcagcacggttccgaacg ccatggaaaccgcccccgccaggcccgctgcgacgccgacaggatctagcgctgcgtttggtgtc aacaccaacagcgccacgcccgcagttccgcaaatagcccccaggaccgccatcaatcgtatcgg gctacctagcagagcggcagagatgaacacgaccatcagcggctgcacagcgcctaccgtcgccg cgaccccgcccggcaggcggtagaccgaaataaacaacaagctccagaatagcgaaatattaagt gcgccgaggatgaagatgcgcatccaccagattcccgttggaatctgtcggacgatcatcacgag caataaacccgccggcaacgcccgcagcagcataccggcgacccctcggcctcgctgttcgggct ccacgaaaacgccggacagatgcgccttgtgagcgtccttggggccgtcctcctgtttgaagacc gacagcccaatgatctcgccgtcgatgtaggcgccgaatgccacggcatctcgcaaccgttcagc gaacgcctccatgggctttttctcctcgtgctcgtaaacggacccgaacatctctggagctttct tcagggccgacaatcggatctcgcggaaatcctgcacgtcggccgctccaagccgtcgaatctga gccttaatcacaattgtcaattttaatcctctgtttatcggcagttcgtagagcgcgccgtgcgt cccgagcgatactgagcgaagcaagtgcgtcgagcagtgcccgcttgttcctgaaatgccagtaa agcgctggctgctgaacccccagccggaactgaccccacaaggccctagcgtttgcaatgcacca ggtcatcattgacccaggcgtgttccaccaggccgctgcctcgcaactcttcgcaggcttcgccg acctgctcgcgccacttcttcacgcgggtggaatccgatccgcacatgaggcggaaggtttccag cttgagcgggtacggctcccggtgcgagctgaaatagtcgaacatccgtcgggccgtcggcgaca gcttgcggtacttctcccatatgaatttcgtgtagtggtcgccagcaaacagcacgacgatttcc tcgtcgatcaggacctggcaacgggacgttttcttgccacggtccaggacgcggaagcggtgcag cagcgacaccgattccaggtgcccaacgcggtcggacgtgaagcccatcgccgtcgcctgtaggc gcgacaggcattcctcggccttcgtgtaataccggccattgatcgaccagcccaggtcctggcaa agctcgtagaacgtgaaggtgatcggctcgccgataggggtgcgcttcgcgtactccaacacctg ctgccacaccagttcgtcatcgtcggcccgcagctcgacgccggtgtaggtgatcttcacgtcct tgttgacgtggaaaatgaccttgttttgcagcgcctcgcgcgggattttcttgttgcgcgtggtg aacagggcagagcgggccgtgtcgtttggcatcgctcgcatcgtgtccggccacggcgcaatatc gaacaaggaaagctgcatttccttgatctgctgcttcgtgtgtttcagcaacgcggcctgcttgg cctcgctgacctgttttgccaggtcctcgccggcggtttttcgcttcttggtcgtcatagttcct cgcgtgtcgatggtcatcgacttcgccaaacctgccgcctcctgttcgagacgacgcgaacgctc cacggcggccgatggcgcgggcagggcagggggagccagttgcacgctgtcgcgctcgatcttgg ccgtagcttgctggaccatcgagccgacggactggaaggtttcgcggggcgcacgcatgacggtg cggcttgcgatggtttcggcatcctcggcggaaaaccccgcgtcgatcagttcttgcctgtatgc cttccggtcaaacgtccgattcattcaccctccttgcgggattgccccgactcacgccggggcaa tgtgcccttattcctgatttgacccgcctggtgccttggtgtccagataatccaccttatcggca atgaagtcggtcccgtagaccgtctggccgtccttctcgtacttggtattccgaatcttgccctg cacgaataccagcgaccccttgcccaaatacttgccgtgggcctcggcctgagagccaaaacact tgatgcggaagaagtcggtgcgctcctgcttgtcgccggcatcgttgcgccacatctaggtacta aaacaattcatccagtaaaatataatattttattttctcccaatcaggcttgatccccagtaagt caaaaaatagctcgacatactgttcttccccgatatcctccctgatcgaccggacgcagaaggca atgtcataccacttgtccgccctgccgcttctcccaagatcaataaagccacttactttgccatc tttcacaaagatgttgctgtctcccaggtcgccgtgggaaaagacaagttcctcttcgggctttt ccgtctttaaaaaatcatacagctcgcgcggatctttaaatggagtgtcttcttcccagttttcg caatccacatcggccagatcgttattcagtaagtaatccaattcggctaagcggctgtctaagct attcgtatagggacaatccgatatgtcgatggagtgaaagagcctgatgcactccgcatacagct cgataatcttttcagggctttgttcatcttcatactcttccgagcaaaggacgccatcggcctca ctcatgagcagattgctccagccatcatgccgttcaaagtgcaggacctttggaacaggcagctt tccttccagccatagcatcatgtccttttcccgttccacatcataggtggtccctttataccggc tgtccgtcatttttaaatataggttttcattttctcccaccagcttatataccttagcaggagac attccttccgtatcttttacgcagcggtatttttcgatcagttttttcaattccggtgatattct cattttagccatttattatttccttcctcttttctacagtatttaaagataccccaagaagctaa ttataacaagacgaactccaattcactgttccttgcattctaaaaccttaaataccagaaaacag ctttttcaaagttgttttcaaagttggcgtataacatagtatcgacggagccgattttgaaacca caattatgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagt ggcttctgtgtctatcagctgtccctcctgttcagctactgacggggtggtgcgtaacggcaaaa gcaccgccggacatcagcgctatctctgctctcactgccgtaaaacatggcaactgcagttcact tacaccgcttctcaacccggtacgcaccagaaaatcattgatatggccatgaatggcgttggatg ccgggcaacagcccgcattatgggcgttggcctcaacacgattttacgtcacttaaaaaactcag gccgcagtcggtaacctcgcgcatacagccgggcagtgacgtcatcgtctgcgcggaaatggacg aacagtggggctatgtcggggctaaatcgcgccagcgctggctgttttacgcgtatgacagtctc cggaagacggttgttgcgcacgtattcggtgaacgcactatggcgacgctggggcgtcttatgag cctgctgtcaccctttgacgtggtgatatggatgacggatggctggccgctgtatgaatcccgcc tgaagggaaagctgcacgtaatcagcaagcgatatacgcagcgaattgagcggcataacctgaat ctgaggcagcacctggcacggctgggacggaagtcgctgtcgttctcaaaatcggtggagctgca tgacaaagtcatcgggcattatctgaacataaaacactatcaataagttggagtcattacccaat tatgatagaatttacaagctataaggttattgtcctgggtttcaagcattagtccatgcaagttt ttatgctttgcccattctatagatatattgataagcgcgctgcctatgccttgccccctgaaatc cttacatacggcgatatcttctatataaaagatatattatcttatcagtattgtcaatatattca aggcaatctgcctcctcatcctcttcatcctcttcgtcttggtagctttttaaatatggcgcttc atagagtaattctgtaaaggtccaattctcgttttcatacctcggtataatcttacctatcacct caaatggttcgctgggtttatcgcacccccgaacacgagcacggcacccgcgaccactatgccaa gaatgcccaaggtaaaaattgccggccccgccatgaagtccgtgaatgccccgacggccgaagtg aagggcaggccgccacccaggccgccgccctcactgcccggcacctggtcgctgaatgtcgatgc cagcacctgcggcacgtcaatgcttccgggcgtcgcgctcgggctgatcgcccatcccgttactg ccccgatcccggcaatggcaaggactgccagcgctgccatttttggggtgaggccgttcgcggcc gaggggcgcagcccctggggggatgggaggcccgcgttagcgggccgggagggttcgagaagggg gggcaccccccttcggcgtgcgcggtcacgcgcacagggcgcagccctggttaaaaacaaggttt ataaatattggtttaaaagcaggttaaaagacaggttagcggtggccgaaaaacgggcggaaacc cttgcaaatgctggattttctgcctgtggacagcccctcaaatgtcaataggtgcgcccctcatc tgtcagcactctgcccctcaagtgtcaaggatcgcgcccctcatctgtcagtagtcgcgcccctc aagtgtcaataccgcagggcacttatccccaggcttgtccacatcatctgtgggaaactcgcgta aaatcaggcgttttcgccgatttgcgaggctggccagctccacgtcgccggccgaaatcgagcct gcccctcatctgtcaacgccgcgccgggtgagtcggcccctcaagtgtcaacgtccgcccctcat ctgtcagtgagggccaagttttccgcgaggtatccacaacgccggcggccgcggtgtctcgcaca cggcttcgacggcgtttctggcgcgtttgcagggccatagacggccgccagcccagcggcgaggg caaccagcccgg 16 PGWB5:35S: tgagcgtcgcaaaggcgctcggtcttgccttgctcgtcggtgatgtacttcaccagctccgcgaa PsiKcds: gtcgctcttcttgatggagcgcatggggacgtgcttggcaatcacgcgcaccccccggccgtttt stop agcggctaaaaaagtcatggctctgccctcgggcggaccacgcccatcatgaccttgccaagctc gtcctgcttctcttcgatcttcgccagcagggcgaggatcgtggcatcaccgaaccgcgccgtgc gcgggtcgtcggtgagccagagtttcagcaggccgcccaggcggcccaggtcgccattgatgcgg gccagctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggccag caggtaggccgacaggctcatgccggccgccgccgccttttcctcaatcgctcttcgttcgtctg gaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcatcagccatccgc ttgccctcatctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagcac cgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacct atcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcc tgtatatcgtgcgaaaaaggatggatataccgaaaaaatcgctataatgaccccgaagcagggtt atgcagcggaaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggc agggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtc ctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagc ctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctca ccatgtttttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctg ataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgc cagaaggccgccagagaggccgagcgcggccgtgaggcttggacgctagggcagggcatgaaaaa gcccgtagcgggctgctacgggcgtctgacgcggtggaaagggggaggggatgttgtctacatgg ctctgctgtagtgagtgggttgcgctccggcagcggtcctgatcaatcgtcaccctttctcggtc cttcaacgttcctgacaacgagcctccttttcgccaatccatcgacaatcaccgcgagtccctgc tcgaacgctgcgtccggaccggcttcgtcgaaggcgtctatcgcggcccgcaacagcggcgagag cggagcctgttcaacggtgccgccgcgctcgccggcatcgctgtcgccggcctgctcctcaagca cggccccaacagtgaagtagctgattgtcatcagcgcattgacggcgtccccggccgaaaaacc cgcctcgcagaggaagcgaagctgcgcgtcggccgtttccatctgcggtgcgcccggtcgcgtg ccggcatggatgcgcgcgccatcgcggtaggcgagcagcgcctgcctgaagctgcgggcattc ccgatcagaaatgagcgccagtcgtcgtcggctctcggcaccgaatgcgtatgattctccgccag catggcttcggccagtgcgtcgagcagcgcccgcttgttcctgaagtgccagtaaagcgccggct gctgaacccccaaccgttccgccagtttgcgtgtcgtcagaccgtctacgccgacctcgttcaac aggtccagggcggcacggatcactgtattcggctgcaactttgtcatgcttgacactttatcact gataaacataatatgtccaccaacttatcagtgataaagaatccgcgcgttcaatcggaccagcg gaggctggtccggaggccagacgtgaaacccaacatacccctgatcgtaattctgagcactgtcg cgctcgacgctgtcggcatcggcctgattatgccggtgctgccgggcctcctgcgcgatctggtt cactcgaacgacgtcaccgcccactatggcattctgctggcgctgtatgcgttggtgcaatttgc ctgcgcacctgtgctgggcgcgctgtcggatcgtttcgggcggcggccaatcttgctcgtctcgc tggccggcgccagatctggggaaccctgtggttggcatgcacatacaaatggacgaacggataaa ccttttcacgcccttttaaatatccgattattctaataaacgctcttttctcttaggtttacccg ccaatatatcctgtcaaacactgatagtttaaactgaaggcgggaaacgacaatctgatcatgag cggagaattaagggagtcacgttatgacccccgccgatgacgcgggacaagccgttttacgtttg gaactgacagaaccgcaacgttgaaggagccactcagccgcgggtttctggagtttaatgagcta agcacatacgtcagaaaccattattgcgcgttcaaaagtcgcctaaggtcactatcagctagcaa atatttcttgtcaaaaatgctccactgacgttccataaattcccctcggtatccaattagagtct catattcactctcaatccaaataatctgcaccggatctggatcgtttcgcatgattgaacaagat ggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaaca gacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttg tcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctg gccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggct gctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtat ccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccac caagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatga tctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgc ccgacggcgatgatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaat ggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagc gttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgcttt acggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctga gcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgat tccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgat cctccagcgcggggatctcatgctggagttcttcgcccacgggatctctgcggaacaggcggtcg aaggtgccgatatcattacgacagcaacggccgacaagcacaacgccacgatcctgagcgacaat atgatcgggcccggcgtccacatcaacggcgtcggcggcgactgcccaggcaagaccgagatgca ccgcgatatcttgctgcgttcggatattttcgtggagttcccgccacagacccggatgatccccg atcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgatt atcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatt tatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaa tatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgggcctcc tgtcaatgctggcggcggctctggtggtggttctggtggcggctctgagggtggtggctctgagg gtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctctggttccggtgat tttgattatgaaaagatggcaaacgctaataagggggctatgaccgaaaatgccgatgaaaacgc gctacagtctgacgctaaaggcaaacttgattctgtcgctactgattacggtgctgctatcgatg gtttcattggtgacgtttccggccttgctaatggtaatggtgctactggtgattttgctggctct aattcccaaatggctcaagtcggtgacggtgataattcacctttaatgaataatttccgtcaata tttaccttccctccctcaatcggttgaatgtcgcccttttgtctttggcccaatacgcaaaccgc ctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcg ggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactt tatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagct atgaccatgattacgccaagcttgcatgcctgcaggtccccagattagccttttcaatttcagaa agaatgctaacccacagatggttagagaggcttacgcagcaggtctcatcaagacgatctacccg agcaataatctccaggaaatcaaataccttcccaagaaggttaaagatgcagtcaaaagattcag gactaactgcatcaagaacacagagaaagatatatttctcaagatcagaagtactattccagtat ggacgattcaaggcttgcttcacaaaccaaggcaagtaatagagattggagtctctaaaaaggta gttcccactgaatcaaaggccatggagtcaaagattcaaatagaggacctaacagaactcgccgt aaagactggcgaacagttcatacagagtctcttacgactcaatgacaagaagaaaatcttcgtca acatggtggagcacgacacacttgtctactccaaaaatatcaaagatacagtctcagaagaccaa agggcaattgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagc tatctgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcg ataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccaccc acgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtga tatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatat aaggaagttcatttcatttggagagaacacgggggactctaatcaaacaagtttgtacaaaaaag ctgaacgagaaacgtaaaatgatataatggcgttcgatctcaagactgaagacggcctcatcaca tatctcactaaacatctttctttggacgtcgacacgagcggagtgaagcgccttagcggaggctt tgtcaatgtaacctggcgcattaagctcaatgctccttatcaaggtcatacgagcatcatcctga agcatgctcagccgcacatgtctacggatgaggattttaagataggtgtagaacgttcggtttac gaataccaggctatcaagctcatgatggccaatcgggaggttctgggaggcgtggatggcatagt ttctgtgccagaaggcctgaactacgacttagagaataatgcattgatcatgcaagatgtcggga agatgaagacccttttagattatgtcaccgccaaaccgccacttgcgacggatatagcccgcctt gttgggacagaaattggggggttcgttgccagactccataacataggccgcgagaggcgagacga tcctgagttcaaattcttctctggaaatattgtcggaaggacgacttcagaccagctgtatcaaa ccatcatacccaacgcagcgaaatatggcgtcgatgaccccttgctgcctactgtggttaaggac cttgtggacgatgtcatgcacagcgaagagacccttgtcatggcggacctgtggagtggaaatat tcttctccagttggaggagggaaacccatcgaagctgcagaagatatatatcctggattgggaac tttgcaagtacggcccagcgtcgttggacctgggctatttcttgggtgactgctatttgatatcc cgctttcaagacgagcaggtcggtacgacgatgcggcaagcctacttgcaaagctatgcgcgtac gagcaagcattcgatcaactacgccaaagtcactgcaggtattgctgctcatattgtgatgtgga ccgactttatgcagtgggggagcgaggaagaaaggataaattttgtgaaaaagggggtagctgcc tttcacgacgccaggggcaacaacgacaatggggaaattacgtctaccttactgaaggaatcatc cactgcgtaaatcattttacgtttctcgttcagctttcttgtacaaagtggttcgatctagagga tccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacgg cgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagc tgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccacc ttcacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaa gtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactaca agacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatc gacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgt ctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcg aggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtg ctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcg cgatcacatggtcctgctggagttcgtgaccgccgccgggatcactcacggcatggacgagctgt acaagtaaagcggcccgagctcgaatttccccgatcgttcaaacatttggcaataaagtttctta agattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagca tgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgc aattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgc gcggtgtcatctatgttactagatcgggaattagcttcatcaacgcaagacatgcgcacgaccgt ctgacaggagaggaatttccgacgagcacagaaaggacttgctcttggacgtaggcctatttctc aggcacatgtatcaagtgttcggacgtgggttttcgatggtgtatcagccgccgccaactgggag atgaggaggctttcttggggggcagtcagcagttcatttcacaagacagaggaacttgtaaggag atgcactgatttatcttggcgcaaaccagcaggacgaattagtgggaatagcccgcgaatatcta agttatgcctgtcggcatgagcagaaacttccaattcgaaacagtttggagaggttgtttttggg cataccttttgttagtcagcctctcgattgctcatcgtcattacacagtaccgaagtttgatcga tctagtaacatagatgacaccgcgcgcgataatttatcctagtttgcgcgctatattttgttttc tatcgcgtattaaatgtataattgcgggactctaatcataaaaacccatctcataaataacgtca tgcattacatgttaattattacatgcttaacgtaattcaacagaaattatatgataatcatcgca agaccggcaacaggattcaatcttaagaaactttattgccaaatgtttgaacgatctgcttcgac gcactccttctttactccaccatctcgtccttattgaaaacgtgggtagcaccaaaacgaatcaa gtcgctggaactgaagttaccaatcacgctggatgatttgccagttggattaatcttgcctttcc ccgcatgaataatattgatgaatgcatgcgtgaggggtatttcgattttggcaatagctgcaatt gccgcgacatcctccaacgagcataattcttcagaaaaatagcgatgttccatgttgtcagggca tgcatgatgcacgttatgaggtgacggtgctaggcagtattccctcaaagtttcatagtcagtat catattcatcattgcattcctgcaagagagaattgagacgcaatccacacgctgcggcaaccttc cggcgttcgtggtctatttgctcttggacgttgcaaacgtaagtgttggatcccggtcggcatct actctattcctttgccctcggacgagtgctggggcgtcggtttccactatcggcgagtacttcta cacagccatcggtccagacggccgcgcttctgcgggcgatttgtgtacgcccgacagtcccggct ccggatcggacgattgcgtcgcatcgaccctgcgcccaagctgcatcatcgaaattgccgtcaac caagctctgatagagttggtcaagaccaatgcggagcatatacgcccggagccgcggcgatcctg caagctccggatgcctccgctcgaagtagcgcgtctgctgctccatacaagccaaccacggcctc cagaagaagatgttggcgacctcgtattgggaatccccgaacatcgcctcgctccagtcaatgac cgctgttatgcggccattgtccgtcaggacattgttggagccgaaatccgcgtgcacgaggtgcc ggacttcggggcagtcctcggcccaaagcatcagctcatcgagagcctgcgcgacggacgcactg acggtgtcgtccatcacagtttgccagtgatacacatggggatcagcaatcgcgcatatgaaatc acgccatgtagtgtattgaccgattccttgcggtccgaatgggccgaacccgctcgtctggctaa gatcggccgcagcgatcgcatccatggcctccgcgaccggctgcagaacagcgggcagttcggtt tcaggcaggtcttgcaacgtgacaccctgtgcacggcgggagatgcaataggtcaggctctcgct gaattccccaatgtcaagcacttccggaatcgggagcgcggccgatgcaaagtgccgataaacat aacgatctttgtagaaaccatcggcgcagctatttacccgcaggacatatccacgccctcctaca tcgaagctgaaagcacgagattcttcgccctccgagagctgcatcaggtcggagacgctgtcgaa cttttcgatcagaaacttctcgacagacgtcgcggtgagttcaggctttttcatatcggggtcgt cctctccaaatgaaatgaacttccttatatagaggaagggtcttgcgaaggatagtgggattgtg cgtcatcccttacgtcagtggagatatcacatcaatccacttgctttgaagacgtggttggaacg tcttctttttccacgatgctcctcgtgggtgggggtccatctttgggaccactgtcggcagaggc atcttgaacgatagcctttcctttatcgcaatgatggcatttgtaggtgccaccttccttttcta ctgtccttttgatgaagtgacagatagctgggcaatggaatccgaggaggtttcccgatattacc ctttgttgaaaagtctcaatagccctttggtcttctgagactgtatctttgatattcttggagta gacgagagtgtcgtgctccaccatgttgacggatctctaggacgcgtcctagaagctaattcact ggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcag cacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacag ttgcgcagcctgaatggcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccg gctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcac ctcgaccccaaaaaacttgatttgggtgatggttcacgtagtgggccatcgccctgatagacggt ttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaa cactcaaccctatctcgggctattcttttgatttataagggattttgccgatttcggaaccacca tcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggc caggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccccagtaca ttaaaaacgtccgcaatgtgttattaagttgtctaagcgtcaatttgtttacaccacaatatatc ctgccaccagccagccaacagctccccgaccggcagctcggcacaaaatcaccactcgatacagg cagcccatcagtccgggacggcgtcagcgggagagccgttgtaaggcggcagactttgctcatgt taccgatgctattcggaagaacggcaactaagctgccgggtttgaaacacggatgatctcgcgga gggtagcatgttgattgtaacgatgacagagcgttgctgcctgtgatcaaatatcatctccctcg cagagatccgaattatcagccttcttattcatttctcgcttaaccgtgacaggctgtcgatcttg agaactatgccgacataataggaaatcgctggataaagccgctgaggaagctgagtggcgctatt tctttagaagtgaacgttgacgatatcaactcccctatccattgctcaccgaatggtacaggtcg gggacccgaagttccgactgtcggcctgatgcatccccggctgatcgaccccagatctggggctg agaaagcccagtaaggaaacaactgtaggttcgagtcgcgagatcccccggaaccaaaggaagta ggttaaacccgctccgatcaggccgagccacgccaggccgagaacattggttcctgtaggcatcg ggattggcggatcaaacactaaagctactggaacgagcagaagtcctccggccgccagttgccag gcggtaaaggtgagcagaggcacgggaggttgccacttgcgggtcagcacggttccgaacgccat ggaaaccgcccccgccaggcccgctgcgacgccgacaggatctagcgctgcgtttggtgtcaaca ccaacagcgccacgcccgcagttccgcaaatagcccccaggaccgccatcaatcgtatcgggcta cctagcagagcggcagagatgaacacgaccatcagcggctgcacagcgcctaccgtcgccgcgac cccgcccggcaggcggtagaccgaaataaacaacaagctccagaatagcgaaatattaagtgcgc cgaggatgaagatgcgcatccaccagattcccgttggaatctgtcggacgatcatcacgagcaat aaacccgccggcaacgcccgcagcagcataccggcgacccctcggcctcgctgttcgggctccac gaaaacgccggacagatgcgccttgtgagcgtccttggggccgtcctcctgtttgaagaccgaca gcccaatgatctcgccgtcgatgtaggcgccgaatgccacggcatctcgcaaccgttcagcgaac gcctccatgggctttttctcctcgtgctcgtaaacggacccgaacatctctggagctttcttcag ggccgacaatcggatctcgcggaaatcctgcacgtcggccgctccaagccgtcgaatctgagcct taatcacaattgtcaattttaatcctctgtttatcggcagttcgtagagcgcgccgtgcgtcccg agcgatactgagcgaagcaagtgcgtcgagcagtgcccgcttgttcctgaaatgccagtaaagcg ctggctgctgaacccccagccggaactgaccccacaaggccctagcgtttgcaatgcaccaggtc atcattgacccaggcgtgttccaccaggccgctgcctcgcaactcttcgcaggcttcgccgacct gctcgcgccacttcttcacgcgggtggaatccgatccgcacatgaggcggaaggtttccagcttg agcgggtacggctcccggtgcgagctgaaatagtcgaacatccgtcgggccgtcggcgacagctt gcggtacttctcccatatgaatttcgtgtagtggtcgccagcaaacagcacgacgatttcctcgt cgatcaggacctggcaacgggacgttttcttgccacggtccaggacgcggaagcggtgcagcagc gacaccgattccaggtgcccaacgcggtcggacgtgaagcccatcgccgtcgcctgtaggcgcga caggcattcctcggccttcgtgtaataccggccattgatcgaccagcccaggtcctggcaaagct cgtagaacgtgaaggtgatcggctcgccgataggggtgcgcttcgcgtactccaacacctgctgc cacaccagttcgtcatcgtcggcccgcagctcgacgccggtgtaggtgatcttcacgtccttgtt gacgtggaaaatgaccttgttttgcagcgcctcgcgcgggattttcttgttgcgcgtggtgaaca gggcagagcgggccgtgtcgtttggcatcgctcgcatcgtgtccggccacggcgcaatatcgaac aaggaaagctgcatttccttgatctgctgcttcgtgtgtttcagcaacgcggcctgcttggcctc gctgacctgttttgccaggtcctcgccggcggtttttcgcttcttggtcgtcatagttcctcgcg tgtcgatggtcatcgacttcgccaaacctgccgcctcctgttcgagacgacgcgaacgctccacg gcggccgatggcgcgggcagggcagggggagccagttgcacgctgtcgcgctcgatcttggccgt agcttgctggaccatcgagccgacggactggaaggtttcgcggggcgcacgcatgacggtgcggc ttgcgatggtttcggcatcctcggcggaaaaccccgcgtcgatcagttcttgcctgtatgccttc cggtcaaacgtccgattcattcaccctccttgcgggattgccccgactcacgccggggcaatgtg cccttattcctgatttgacccgcctggtgccttggtgtccagataatccaccttatcggcaatga agtcggtcccgtagaccgtctggccgtccttctcgtacttggtattccgaatcttgccctgcacg aataccagcgaccccttgcccaaatacttgccgtgggcctcggcctgagagccaaaacacttgat gcggaagaagtcggtgcgctcctgcttgtcgccggcatcgttgcgccacatctaggtactaaaac aattcatccagtaaaatataatattttattttctcccaatcaggcttgatccccagtaagtcaaa aaatagctcgacatactgttcttccccgatatcctccctgatcgaccggacgcagaaggcaatgt cataccacttgtccgccctgccgcttctcccaagatcaataaagccacttactttgccatctttc acaaagatgttgctgtctcccaggtcgccgtgggaaaagacaagttcctcttcgggcttttccgt ctttaaaaaatcatacagctcgcgcggatctttaaatggagtgtcttcttcccagttttcgcaat ccacatcggccagatcgttattcagtaagtaatccaattcggctaagcggctgtctaagctattc gtatagggacaatccgatatgtcgatggagtgaaagagcctgatgcactccgcatacagctcgat aatcttttcagggctttgttcatcttcatactcttccgagcaaaggacgccatcggcctcactca tgagcagattgctccagccatcatgccgttcaaagtgcaggacctttggaacaggcagctttcct tccagccatagcatcatgtccttttcccgttccacatcataggtggtccctttataccggctgtc cgtcatttttaaatataggttttcattttctcccaccagcttatataccttagcaggagacattc cttccgtatcttttacgcagcggtatttttcgatcagttttttcaattccggtgatattctcatt ttagccatttattatttccttcctcttttctacagtatttaaagataccccaagaagctaattat aacaagacgaactccaattcactgttccttgcattctaaaaccttaaataccagaaaacagcttt ttcaaagttgttttcaaagttggcgtataacatagtatcgacggagccgattttgaaaccacaat tatgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggct tctgtgtctatcagctgtccctcctgttcagctactgacggggtggtgcgtaacggcaaaagcac cgccggacatcagcgctatctctgctctcactgccgtaaaacatggcaactgcagttcacttaca ccgcttctcaacccggtacgcaccagaaaatcattgatatggccatgaatggcgttggatgccgg gcaacagcccgcattatgggcgttggcctcaacacgattttacgtcacttaaaaaactcaggccg cagtcggtaacctcgcgcatacagccgggcagtgacgtcatcgtctgcgcggaaatggacgaaca gtggggctatgtcggggctaaatcgcgccagcgctggctgttttacgcgtatgacagtctccgga agacggttgttgcgcacgtattcggtgaacgcactatggcgacgctggggcgtcttatgagcctg ctgtcaccctttgacgtggtgatatggatgacggatggctggccgctgtatgaatcccgcctgaa gggaaagctgcacgtaatcagcaagcgatatacgcagcgaattgagcggcataacctgaatctga ggcagcacctggcacggctgggacggaagtcgctgtcgttctcaaaatcggtggagctgcatgac aaagtcatcgggcattatctgaacataaaacactatcaataagttggagtcattacccaattatg atagaatttacaagctataaggttattgtcctgggtttcaagcattagtccatgcaagtttttat gctttgcccattctatagatatattgataagcgcgctgcctatgccttgccccctgaaatcctta catacggcgatatcttctatataaaagatatattatcttatcagtattgtcaatatattcaaggc aatctgcctcctcatcctcttcatcctcttcgtcttggtagctttttaaatatggcgcttcatag agtaattctgtaaaggtccaattctcgttttcatacctcggtataatcttacctatcacctcaaa tggttcgctgggtttatcgcacccccgaacacgagcacggcacccgcgaccactatgccaagaat gcccaaggtaaaaattgccggccccgccatgaagtccgtgaatgccccgacggccgaagtgaagg gcaggccgccacccaggccgccgccctcactgcccggcacctggtcgctgaatgtcgatgccagc acctgcggcacgtcaatgcttccgggcgtcgcgctcgggctgatcgcccatcccgttactgcccc gatcccggcaatggcaaggactgccagcgctgccatttttggggtgaggccgttcgcggccgagg ggcgcagcccctggggggatgggaggcccgcgttagcgggccgggagggttcgagaagggggggc accccccttcggcgtgcgcggtcacgcgcacagggcgcagccctggttaaaaacaaggtttataa atattggtttaaaagcaggttaaaagacaggttagcggtggccgaaaaacgggcggaaacccttg caaatgctggattttctgcctgtggacagcccctcaaatgtcaataggtgcgcccctcatctgtc agcactctgcccctcaagtgtcaaggatcgcgcccctcatctgtcagtagtcgcgcccctcaagt gtcaataccgcagggcacttatccccaggcttgtccacatcatctgtgggaaactcgcgtaaaat caggcgttttcgccgatttgcgaggctggccagctccacgtcgccggccgaaatcgagcctgccc ctcatctgtcaacgccgcgccgggtgagtcggcccctcaagtgtcaacgtccgcccctcatctgt cagtgagggccaagttttccgcgaggtatccacaacgccggcggccgcggtgtctcgcacacggc ttcgacggcgtttctggcgcgtttgcagggccatagacggccgccagcccagcggcgagggcaac cagcccgg 17 pGWB5:35S: tgagcgtcgcaaaggcgctcggtcttgccttgctcgtcggtgatgtacttcaccagctccgcgaa PsiHcds: gtcgctcttcttgatggagcgcatggggacgtgcttggcaatcacgcgcaccccccggccgtttt stop agcggctaaaaaagtcatggctctgccctcgggcggaccacgcccatcatgaccttgccaagctc gtcctgcttctcttcgatcttcgccagcagggcgaggatcgtggcatcaccgaaccgcgccgtgc gcgggtcgtcggtgagccagagtttcagcaggccgcccaggcggcccaggtcgccattgatgcgg gccagctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggcca gcaggtaggccgacaggctcatgccggccgccgccgccttttcctcaatcgctcttcgttcgtct ggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcatcagccatccg cttgccctcatctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagca ccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacct atcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcc tgtatatcgtgcgaaaaaggatggatataccgaaaaaatcgctataatgaccccgaagcagggtt atgcagcggaaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggc agggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtc ctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagc ctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctca catgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctg ataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgc cagaaggccgccagagaggccgagcgcggccgtgaggcttggacgctagggcagggcatgaaaaa gcccgtagcgggctgctacgggcgtctgacgcggtggaaagggggaggggatgttgtctacatg gctctgctgtagtgagtgggttgcgctccggcagcggtcctgatcaatcgtcaccctttctcggt ccttcaacgttcctgacaacgagcctccttttcgccaatccatcgacaatcaccgcgagtccctg ctcgaacgctgcgtccggaccggcttcgtcgaaggcgtctatcgcggcccgcaacagcggcgaga gcggagcctgttcaacggtgccgccgcgctcgccggcatcgctgtcgccggcctgctcctcaagc acggccccaacagtgaagtagctgattgtcatcagcgcattgacggcgtccccggccgaaaaacc cgcctcgcagaggaagcgaagctgcgcgtcggccgtttccatctgcggtgcgcccggtcgcgtg ccggcatggatgcgcgcgccatcgcggtaggcgagcagcgcctgcctgaagctgcgggcattc ccgatcagaaatgagcgccagtcgtcgtcggctctcggcaccgaatgcgtatgattctccgccag catggcttcggccagtgcgtcgagcagcgcccgcttgttcctgaagtgccagtaaagcgccggct gctgaacccccaaccgttccgccagtttgcgtgtcgtcagaccgtctacgccgacctcgttcaac aggtccagggcggcacggatcactgtattcggctgcaactttgtcatgcttgacactttatcact gataaacataatatgtccaccaacttatcagtgataaagaatccgcgcgttcaatcggaccagcg gaggctggtccggaggccagacgtgaaacccaacatacccctgatcgtaattctgagcactgtcg cgctcgacgctgtcggcatcggcctgattatgccggtgctgccgggcctcctgcgcgatctggtt cactcgaacgacgtcaccgcccactatggcattctgctggcgctgtatgcgttggtgcaatttgc ctgcgcacctgtgctgggcgcgctgtcggatcgtttcgggcggcggccaatcttgctcgtctcgc tggccggcgccagatctggggaaccctgtggttggcatgcacatacaaatggacgaacggataaa ccttttcacgcccttttaaatatccgattattctaataaacgctcttttctcttaggtttacccg ccaatatatcctgtcaaacactgatagtttaaactgaaggcgggaaacgacaatctgatcatgag cggagaattaagggagtcacgttatgacccccgccgatgacgcgggacaagccgttttacgtttg gaactgacagaaccgcaacgttgaaggagccactcagccgcgggtttctggagtttaatgagcta agcacatacgtcagaaaccattattgcgcgttcaaaagtcgcctaaggtcactatcagctagcaa atatttcttgtcaaaaatgctccactgacgttccataaattcccctcggtatccaattagagtct catattcactctcaatccaaataatctgcaccggatctggatcgtttcgcatgattgaacaagat ggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaaca gacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttg tcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctg gccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggct gctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtat ccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccac caagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatga tctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgc ccgacggcgatgatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaat ggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagc gttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgcttt acggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctga gcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgat tccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgat cctccagcgcggggatctcatgctggagttcttcgcccacgggatctctgcggaacaggcggtcg aaggtgccgatatcattacgacagcaacggccgacaagcacaacgccacgatcctgagcgacaat atgatcgggcccggcgtccacatcaacggcgtcggcggcgactgcccaggcaagaccgagatgca ccgcgatatcttgctgcgttcggatattttcgtggagttcccgccacagacccggatgatccccg atcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgatt atcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatt tatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaa tatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgggcctcc tgtcaatgctggcggcggctctggtggtggttctggtggcggctctgagggtggtggctctgagg gtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctctggttccggtgat tttgattatgaaaagatggcaaacgctaataagggggctatgaccgaaaatgccgatgaaaacgc gctacagtctgacgctaaaggcaaacttgattctgtcgctactgattacggtgctgctatcgatg gtttcattggtgacgtttccggccttgctaatggtaatggtgctactggtgattttgctggctct aattcccaaatggctcaagtcggtgacggtgataattcacctttaatgaataatttccgtcaata tttaccttccctccctcaatcggttgaatgtcgcccttttgtctttggcccaatacgcaaaccgc ctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcg ggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactt tatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagct atgaccatgattacgccaagcttgcatgcctgcaggtccccagattagccttttcaatttcagaa agaatgctaacccacagatggttagagaggcttacgcagcaggtctcatcaagacgatctacccg agcaataatctccaggaaatcaaataccttcccaagaaggttaaagatgcagtcaaaagattcag gactaactgcatcaagaacacagagaaagatatatttctcaagatcagaagtactattccagtat ggacgattcaaggcttgcttcacaaaccaaggcaagtaatagagattggagtctctaaaaaggta gttcccactgaatcaaaggccatggagtcaaagattcaaatagaggacctaacagaactcgccgt aaagactggcgaacagttcatacagagtctcttacgactcaatgacaagaagaaaatcttcgtca acatggtggagcacgacacacttgtctactccaaaaatatcaaagatacagtctcagaagaccaa agggcaattgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagc tatctgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcg ataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccaccc acgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtga tatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatat aaggaagttcatttcatttggagagaacacgggggactctaatcaaacaagtttgtacaaaaaag ctgaacgagaaacgtaaaatgatataaatatcatgatcgctgtactattctccttcgtcattgca ggatgcatatactacatcgtttctcgtagagtgaggcggtcgcgcttgccaccagggccgcctgg cattcctattcccttcattgggaacatgtttgatatgcctgaagaatctccatggttaacatttc tacaatggggacgggattacagtctgtcttgccgcgttgacttctaatatatgaacagctaatat attgtcagacaccgatattctctacgtggatgctggagggacagaaatggttattcttaacacgt tggagaccattaccgatctattagaaaagcgagggtccatttattctggccggtgagctgatgtt gagttttttgcaattgaatttgtggtcacacgtttccagacttgagagtacaatggtcaacgaac ttatggggtgggagtttgacttagggttcatcacatacggcgacaggtggcgcgaagaaaggcgc atgttcgccaaggagttcagtgagaagggcatcaagcaatttcgccatgctcaagtgaaagctgc ccatcagcttgtccaacagcttaccaaaacgccagaccgctgggcacaacatattcgccagtaag tactacttgaggaaaatagcgtacgcttcgctgaccggtccgtacatcaaagtcagatagcggca atgtcactggatattggttatggaattgatcttgcagaagacgacccttggctggaagcgaccca tttggctaatgaaggcctcgccatagcatcagtgccgggcaaattttgggtcgattcgttccctt ctcgtgagcatccttcttctatgtaggaagggaaggagtctaacaagtgttagtaaaataccttc ctgcttggttcccaggtgctgtcttcaagcgcaaagcgaaggtctggcgagaagccgccgaccat atggttgacatgccttatgaaactatgaggaaattagcagttagtcaaatgcgttctccccgtat tttttcaatactctaacttcagctcacagcctcaaggattgactcgtccgtcgtatgcttcagct cgtctgcaagccatggatctcaacggtgaccttgagcatcaagaacacgtaatcaagaacacagc cgcagaggttaatgtcggtaagtcaaaagcgtccgtcggcaattcaaaattcaggcgctaaagtg ggtcttctcaccaaggtggaggcgatactgtaaggatttctcaatcgttagagtataagtgttct aatgcagtacatactccaccaaccagactgtctctgctatgtctgcgttcatcttggccatggtg aagtaccctgaggtccagcgaaaggttcaagcggagcttgatgctctgaccaataacggccaaat tcctgactatgacgaagaagatgactccttgccatacctcaccgcatgtatcaaggagcttttcc ggtggaatcaaatcgcacccctcgctataccgcacaaattaatgaaggacgacgtgtaccgcggg tatctgattcccaagaacactctagtcttcgcaaacacctggtgaggctgtccattcattcctag tacatccgttgccccactaatagcatcttgataacagggcagtattaaacgatccagaagtctat ccagatccctctgtgttccgcccagaaagatatcttggtcctgacgggaagcctgataacactgt acgcgacccacgtaaagcggcatttggctatggacgacgaaattggtaagtgcgctttcagaacc cccccttccgttgactagtgccatgcgcgcatacaatatcgctattgatctgatataacttccct gcggcatttattttggcattcctttagtcccggaattcatctagcgcagtcgacggtttggattg caggggcaaccctcttatcagcgttcaatatcgagcgacctgtcgatcagaatgggaagcccatt gacataccggctgattttactacaggattcttcaggtagctaatttccgtctttgtgtgcataat acccctaacgacgcacgtttacctttttgtaaagacacccagtgcctttccagtgcaggtttgtt cctcgaacagagcaagtctcacagtcggtatccggaccctgaatatcattttacgtttctcgttc agctttcttgtacaaagtggttcgatctagaggatccatggtgagcaagggcgaggagctgttca ccggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtcc ggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaa gctgcccgtgccctggcccaccctcgtgaccaccttcacctacggcgtgcagtgcttcagccgct accccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggag cgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcga caccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggc acaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggc atcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccacta ccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcaccc agtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgacc gccgccgggatcactcacggcatggacgagctgtacaagtaaagcggcccgagctcgaatttccc cgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatga ttatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgtta tttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaa aatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgggaat tagcttcatcaacgcaagacatgcgcacgaccgtctgacaggagaggaatttccgacgagcacag aaaggacttgctcttggacgtaggcctatttctcaggcacatgtatcaagtgttcggacgtgggt tttcgatggtgtatcagccgccgccaactgggagatgaggaggctttcttggggggcagtcagca gttcatttcacaagacagaggaacttgtaaggagatgcactgatttatcttggcgcaaaccagca ggacgaattagtgggaatagcccgcgaatatctaagttatgcctgtcggcatgagcagaaacttc caattcgaaacagtttggagaggttgtttttgggcataccttttgttagtcagcctctcgattgc tcatcgtcattacacagtaccgaagtttgatcgatctagtaacatagatgacaccgcgcgcgata atttatcctagtttgcgcgctatattttgttttctatcgcgtattaaatgtataattgcgggact ctaatcataaaaacccatctcataaataacgtcatgcattacatgttaattattacatgcttaac gtaattcaacagaaattatatgataatcatcgcaagaccggcaacaggattcaatcttaagaaac tttattgccaaatgtttgaacgatctgcttcgacgcactccttctttactccaccatctcgtcct tattgaaaacgtgggtagcaccaaaacgaatcaagtcgctggaactgaagttaccaatcacgctg gatgatttgccagttggattaatcttgcctttccccgcatgaataatattgatgaatgcatgcgt gaggggtatttcgattttggcaatagctgcaattgccgcgacatcctccaacgagcataattctt cagaaaaatagcgatgttccatgttgtcagggcatgcatgatgcacgttatgaggtgacggtgct aggcagtattccctcaaagtttcatagtcagtatcatattcatcattgcattcctgcaagagaga attgagacgcaatccacacgctgcggcaaccttccggcgttcgtggtctatttgctcttggacgt tgcaaacgtaagtgttggatcccggtcggcatctactctattcctttgccctcggacgagtgctg gggcgtcggtttccactatcggcgagtacttctacacagccatcggtccagacggccgcgcttct gcgggcgatttgtgtacgcccgacagtcccggctccggatcggacgattgcgtcgcatcgaccct gcgcccaagctgcatcatcgaaattgccgtcaaccaagctctgatagagttggtcaagaccaatg cggagcatatacgcccggagccgcggcgatcctgcaagctccggatgcctccgctcgaagtagcg cgtctgctgctccatacaagccaaccacggcctccagaagaagatgttggcgacctcgtattggg aatccccgaacatcgcctcgctccagtcaatgaccgctgttatgcggccattgtccgtcaggaca ttgttggagccgaaatccgcgtgcacgaggtgccggacttcggggcagtcctcggcccaaagcat cagctcatcgagagcctgcgcgacggacgcactgacggtgtcgtccatcacagtttgccagtgat acacatggggatcagcaatcgcgcatatgaaatcacgccatgtagtgtattgaccgattccttgc ggtccgaatgggccgaacccgctcgtctggctaagatcggccgcagcgatcgcatccatggcctc cgcgaccggctgcagaacagcgggcagttcggtttcaggcaggtcttgcaacgtgacaccctgtg cacggcgggagatgcaataggtcaggctctcgctgaattccccaatgtcaagcacttccggaatc gggagcgcggccgatgcaaagtgccgataaacataacgatctttgtagaaaccatcggcgcagct atttacccgcaggacatatccacgccctcctacatcgaagctgaaagcacgagattcttcgccct ccgagagctgcatcaggtcggagacgctgtcgaacttttcgatcagaaacttctcgacagacgtc gcggtgagttcaggctttttcatatcggggtcgtcctctccaaatgaaatgaacttccttatata gaggaagggtcttgcgaaggatagtgggattgtgcgtcatcccttacgtcagtggagatatcaca tcaatccacttgctttgaagacgtggttggaacgtcttctttttccacgatgctcctcgtgggtg ggggtccatctttgggaccactgtcggcagaggcatcttgaacgatagcctttcctttatcgcaa tgatggcatttgtaggtgccaccttccttttctactgtccttttgatgaagtgacagatagctgg gcaatggaatccgaggaggtttcccgatattaccctttgttgaaaagtctcaatagccctttggt cttctgagactgtatctttgatattcttggagtagacgagagtgtcgtgctccaccatgttgacg gatctctaggacgcgtcctagaagctaattcactggccgtcgttttacaacgtcgtgactgggaa aaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatag cgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgcccgctcctttc gctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggct ccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgatttgggtgatg gttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttc tttaatagtggactcttgttccaaactggaacaacactcaaccctatctcgggctattcttttga tttataagggattttgccgatttcggaaccaccatcaaacaggattttcgcctgctggggcaaac cagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccg tctcactggtgaaaagaaaaaccaccccagtacattaaaaacgtccgcaatgtgttattaagttg tctaagcgtcaatttgtttacaccacaatatatcctgccaccagccagccaacagctccccgacc ggcagctcggcacaaaatcaccactcgatacaggcagcccatcagtccgggacggcgtcagcggg agagccgttgtaaggcggcagactttgctcatgttaccgatgctattcggaagaacggcaactaa gctgccgggtttgaaacacggatgatctcgcggagggtagcatgttgattgtaacgatgacagag cgttgctgcctgtgatcaaatatcatctccctcgcagagatccgaattatcagccttcttattca tttctcgcttaaccgtgacaggctgtcgatcttgagaactatgccgacataataggaaatcgctg gataaagccgctgaggaagctgagtggcgctatttctttagaagtgaacgttgacgatatcaact cccctatccattgctcaccgaatggtacaggtcggggacccgaagttccgactgtcggcctgat gcatccccggctgatcgaccccagatctggggctgagaaagcccagtaaggaaacaactgtag gttcgagtcgcgagatcccccggaaccaaaggaagtaggttaaacccgctccgatcaggccga gccacgccaggccgagaacattggttcctgtaggcatcgggattggcggatcaaacactaaagct actggaacgagcagaagtcctccggccgccagttgccaggcggtaaaggtgagcagaggcac gggaggttgccacttgcgggtcagcacggttccgaacgccatggaaaccgcccccgccaggcc cgctgcgacgccgacaggatctagcgctgcgtttggtgtcaacaccaacagcgccacgcccgca gttccgcaaatagcccccaggaccgccatcaatcgtatcgggctacctagcagagcggcagaga tgaacacgaccatcagcggctgcacagcgcctaccgtcgccgcgaccccgcccggcaggcgg tagaccgaaataaacaacaagctccagaatagcgaaatattaagtgcgccgaggatgaagatgc gcatccaccagattcccgttggaatctgtcggacgatcatcacgagcaataaacccgccggcaac gcccgcagcagcataccggcgacccctcggcctcgctgttcgggctccacgaaaacgccggac agatgcgccttgtgagcgtccttggggccgtcctcctgtttgaagaccgacagcccaatgatctc gccgtcgatgtaggcgccgaatgccacggcatctcgcaaccgttcagcgaacgcctccatgggct ttttctcctcgtgctcgtaaacggacccgaacatctctggagctttcttcagggccgacaatcgg atctcgcggaaatcctgcacgtcggccgctccaagccgtcgaatctgagccttaatcacaattgt caattttaatcctctgtttatcggcagttcgtagagcgcgccgtgcgtcccgagcgatactgagc gaagcaagtgcgtcgagcagtgcccgcttgttcctgaaatgccagtaaagcgctggctgctgaac ccccagccggaactgaccccacaaggccctagcgtttgcaatgcaccaggtcatcattgacccag gcgtgttccaccaggccgctgcctcgcaactcttcgcaggcttcgccgacctgctcgcgccactt cttcacgcgggtggaatccgatccgcacatgaggcggaaggtttccagcttgagcgggtacggct cccggtgcgagctgaaatagtcgaacatccgtcgggccgtcggcgacagcttgcggtacttctcc catatgaatttcgtgtagtggtcgccagcaaacagcacgacgatttcctcgtcgatcaggacctg gcaacgggacgttttcttgccacggtccaggacgcggaagcggtgcagcagcgacaccgattcca ggtgcccaacgcggtcggacgtgaagcccatcgccgtcgcctgtaggcgcgacaggcattcctcg gccttcgtgtaataccggccattgatcgaccagcccaggtcctggcaaagctcgtagaacgtgaa ggtgatcggctcgccgataggggtgcgcttcgcgtactccaacacctgctgccacaccagttcgt catcgtcggcccgcagctcgacgccggtgtaggtgatcttcacgtccttgttgacgtggaaaatg accttgttttgcagcgcctcgcgcgggattttcttgttgcgcgtggtgaacagggcagagcgggc cgtgtcgtttggcatcgctcgcatcgtgtccggccacggcgcaatatcgaacaaggaaagctgca tttccttgatctgctgcttcgtgtgtttcagcaacgcggcctgcttggcctcgctgacctgtttt gccaggtcctcgccggcggtttttcgcttcttggtcgtcatagttcctcgcgtgtcgatggtcat cgacttcgccaaacctgccgcctcctgttcgagacgacgcgaacgctccacggcggccgatggcg cgggcagggcagggggagccagttgcacgctgtcgcgctcgatcttggccgtagcttgctggacc atcgagccgacggactggaaggtttcgcggggcgcacgcatgacggtgcggcttgcgatggtttc ggcatcctcggcggaaaaccccgcgtcgatcagttcttgcctgtatgccttccggtcaaacgtcc gattcattcaccctccttgcgggattgccccgactcacgccggggcaatgtgcccttattcctga tttgacccgcctggtgccttggtgtccagataatccaccttatcggcaatgaagtcggtcccgta gaccgtctggccgtccttctcgtacttggtattccgaatcttgccctgcacgaataccagcgacc ccttgcccaaatacttgccgtgggcctcggcctgagagccaaaacacttgatgcggaagaagtcg gtgcgctcctgcttgtcgccggcatcgttgcgccacatctaggtactaaaacaattcatccagta aaatataatattttattttctcccaatcaggcttgatccccagtaagtcaaaaaatagctcgaca tactgttcttccccgatatcctccctgatcgaccggacgcagaaggcaatgtcataccacttgtc cgccctgccgcttctcccaagatcaataaagccacttactttgccatctttcacaaagatgttgc tgtctcccaggtcgccgtgggaaaagacaagttcctcttcgggcttttccgtctttaaaaaatca tacagctcgcgcggatctttaaatggagtgtcttcttcccagttttcgcaatccacatcggccag atcgttattcagtaagtaatccaattcggctaagcggctgtctaagctattcgtatagggacaat ccgatatgtcgatggagtgaaagagcctgatgcactccgcatacagctcgataatcttttcaggg ctttgttcatcttcatactcttccgagcaaaggacgccatcggcctcactcatgagcagattgct ccagccatcatgccgttcaaagtgcaggacctttggaacaggcagctttccttccagccatagca tcatgtccttttcccgttccacatcataggtggtccctttataccggctgtccgtcatttttaaa tataggttttcattttctcccaccagcttatataccttagcaggagacattccttccgtatcttt tacgcagcggtatttttcgatcagttttttcaattccggtgatattctcattttagccatttatt atttccttcctcttttctacagtatttaaagataccccaagaagctaattataacaagacgaact ccaattcactgttccttgcattctaaaaccttaaataccagaaaacagctttttcaaagttgttt tcaaagttggcgtataacatagtatcgacggagccgattttgaaaccacaattatgggtgatgct gccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggcttctgtgtctatca gctgtccctcctgttcagctactgacggggtggtgcgtaacggcaaaagcaccgccggacatcag cgctatctctgctctcactgccgtaaaacatggcaactgcagttcacttacaccgcttctcaacc cggtacgcaccagaaaatcattgatatggccatgaatggcgttggatgccgggcaacagcccgca ttatgggcgttggcctcaacacgattttacgtcacttaaaaaactcaggccgcagtcggtaacct cgcgcatacagccgggcagtgacgtcatcgtctgcgcggaaatggacgaacagtggggctatgtc ggggctaaatcgcgccagcgctggctgttttacgcgtatgacagtctccggaagacggttgttgc gcacgtattcggtgaacgcactatggcgacgctggggcgtcttatgagcctgctgtcaccctttg acgtggtgatatggatgacggatggctggccgctgtatgaatcccgcctgaagggaaagctgcac gtaatcagcaagcgatatacgcagcgaattgagcggcataacctgaatctgaggcagcacctggc acggctgggacggaagtcgctgtcgttctcaaaatcggtggagctgcatgacaaagtcatcgggc attatctgaacataaaacactatcaataagttggagtcattacccaattatgatagaatttacaa gctataaggttattgtcctgggtttcaagcattagtccatgcaagtttttatgctttgcccattc tatagatatattgataagcgcgctgcctatgccttgccccctgaaatccttacatacggcgatat cttctatataaaagatatattatcttatcagtattgtcaatatattcaaggcaatctgcctcctc atcctcttcatcctcttcgtcttggtagctttttaaatatggcgcttcatagagtaattctgtaa aggtccaattctcgttttcatacctcggtataatcttacctatcacctcaaatggttcgctgggt ttatcgcacccccgaacacgagcacggcacccgcgaccactatgccaagaatgcccaaggtaaaa attgccggccccgccatgaagtccgtgaatgccccgacggccgaagtgaagggcaggccgccacc caggccgccgccctcactgcccggcacctggtcgctgaatgtcgatgccagcacctgcggcacgt caatgcttccgggcgtcgcgctcgggctgatcgcccatcccgttactgccccgatcccggcaatg gcaaggactgccagcgctgccatttttggggtgaggccgttcgcggccgaggggcgcagcccctg gggggatgggaggcccgcgttagcgggccgggagggttcgagaagggggggcaccccccttcggc gtgcgcggtcacgcgcacagggcgcagccctggttaaaaacaaggtttataaatattggtttaaa agcaggttaaaagacaggttagcggtggccgaaaaacgggcggaaacccttgcaaatgctggatt ttctgcctgtggacagcccctcaaatgtcaataggtgcgcccctcatctgtcagcactctgcccc tcaagtgtcaaggatcgcgcccctcatctgtcagtagtcgcgcccctcaagtgtcaataccgcag ggcacttatccccaggcttgtccacatcatctgtgggaaactcgcgtaaaatcaggcgttttcgc cgatttgcgaggctggccagctccacgtcgccggccgaaatcgagcctgcccctcatctgtcaac gccgcgccgggtgagtcggcccctcaagtgtcaacgtccgcccctcatctgtcagtgagggccaa gttttccgcgaggtatccacaacgccggcggccgcggtgtctcgcacacggcttcgacggcgttt ctggcgcgtttgcagggccatagacggccgccagcccagcggcgagggcaaccagcccgg 18 pGWB5:35S: tgagcgtcgcaaaggcgctcggtcttgccttgctcgtcggtgatgtacttcaccagctccgcgaa PsiDcds: gtcgctcttcttgatggagcgcatggggacgtgcttggcaatcacgcgcaccccccggccgtttt stop agcggctaaaaaagtcatggctctgccctcgggcggaccacgcccatcatgaccttgccaagctc gtcctgcttctcttcgatcttcgccagcagggcgaggatcgtggcatcaccgaaccgcgccgtgc gcgggtcgtcggtgagccagagtttcagcaggccgcccaggcggcccaggtcgccattgatgcgg gccagctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggcca gcaggtaggccgacaggctcatgccggccgccgccgccttttcctcaatcgctcttcgttcgtct ggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcatcagccatccg cttgccctcatctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagca ccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacct atcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcc tgtatatcgtgcgaaaaaggatggatataccgaaaaaatcgctataatgaccccgaagcagggtt atgcagcggaaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcag ggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctg tcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagccta tggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacat gttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgata ccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgccag aaggccgccagagaggccgagcgcggccgtgaggcttggacgctagggcagggcatgaaaaagcc cgtagcgggctgctacgggcgtctgacgcggtggaaagggggaggggatgttgtctacatggctc tgctgtagtgagtgggttgcgctccggcagcggtcctgatcaatcgtcaccctttctcggtcctt caacgttcctgacaacgagcctccttttcgccaatccatcgacaatcaccgcgagtccctgctcg aacgctgcgtccggaccggcttcgtcgaaggcgtctatcgcggcccgcaacagcggcgagagc ggagcctgttcaacggtgccgccgcgctcgccggcatcgctgtcgccggcctgctcctcaagca cggccccaacagtgaagtagctgattgtcatcagcgcattgacggcgtccccggccgaaaaacc cgcctcgcagaggaagcgaagctgcgcgtcggccgtttccatctgcggtgcgcccggtcgcgtg ccggcatggatgcgcgcgccatcgcggtaggcgagcagcgcctgcctgaagctgcgggcattc ccgatcagaaatgagcgccagtcgtcgtcggctctcggcaccgaatgcgtatgattctccgccag catggcttcggccagtgcgtcgagcagcgcccgcttgttcctgaagtgccagtaaagcgccggct gctgaacccccaaccgttccgccagtttgcgtgtcgtcagaccgtctacgccgacctcgttcaac aggtccagggcggcacggatcactgtattcggctgcaactttgtcatgcttgacactttatcact gataaacataatatgtccaccaacttatcagtgataaagaatccgcgcgttcaatcggaccagcg gaggctggtccggaggccagacgtgaaacccaacatacccctgatcgtaattctgagcactgtcg cgctcgacgctgtcggcatcggcctgattatgccggtgctgccgggcctcctgcgcgatctggtt cactcgaacgacgtcaccgcccactatggcattctgctggcgctgtatgcgttggtgcaatttgc ctgcgcacctgtgctgggcgcgctgtcggatcgtttcgggcggcggccaatcttgctcgtctcgc tggccggcgccagatctggggaaccctgtggttggcatgcacatacaaatggacgaacggataaa ccttttcacgcccttttaaatatccgattattctaataaacgctcttttctcttaggtttacccg ccaatatatcctgtcaaacactgatagtttaaactgaaggcgggaaacgacaatctgatcatgag cggagaattaagggagtcacgttatgacccccgccgatgacgcgggacaagccgttttacgtttg gaactgacagaaccgcaacgttgaaggagccactcagccgcgggtttctggagtttaatgagcta agcacatacgtcagaaaccattattgcgcgttcaaaagtcgcctaaggtcactatcagctagcaa atatttcttgtcaaaaatgctccactgacgttccataaattcccctcggtatccaattagagtct catattcactctcaatccaaataatctgcaccggatctggatcgtttcgcatgattgaacaagat ggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaaca gacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttg tcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctg gccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggct gctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtat ccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccac caagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatga tctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgc ccgacggcgatgatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaat ggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagc gttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgcttt acggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctga gcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgat tccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgat cctccagcgcggggatctcatgctggagttcttcgcccacgggatctctgcggaacaggcggtcg aaggtgccgatatcattacgacagcaacggccgacaagcacaacgccacgatcctgagcgacaat atgatcgggcccggcgtccacatcaacggcgtcggcggcgactgcccaggcaagaccgagatgca ccgcgatatcttgctgcgttcggatattttcgtggagttcccgccacagacccggatgatccccg atcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgatt atcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatt tatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaa tatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgggcctcc tgtcaatgctggcggcggctctggtggtggttctggtggcggctctgagggtggtggctctgagg gtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctctggttccggtgat tttgattatgaaaagatggcaaacgctaataagggggctatgaccgaaaatgccgatgaaaacgc gctacagtctgacgctaaaggcaaacttgattctgtcgctactgattacggtgctgctatcgatg gtttcattggtgacgtttccggccttgctaatggtaatggtgctactggtgattttgctggctct aattcccaaatggctcaagtcggtgacggtgataattcacctttaatgaataatttccgtcaata tttaccttccctccctcaatcggttgaatgtcgcccttttgtctttggcccaatacgcaaaccgc ctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcg ggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactt tatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagct atgaccatgattacgccaagcttgcatgcctgcaggtccccagattagccttttcaatttcagaa agaatgctaacccacagatggttagagaggcttacgcagcaggtctcatcaagacgatctacccg agcaataatctccaggaaatcaaataccttcccaagaaggttaaagatgcagtcaaaagattcag gactaactgcatcaagaacacagagaaagatatatttctcaagatcagaagtactattccagtat ggacgattcaaggcttgcttcacaaaccaaggcaagtaatagagattggagtctctaaaaaggta gttcccactgaatcaaaggccatggagtcaaagattcaaatagaggacctaacagaactcgccgt aaagactggcgaacagttcatacagagtctcttacgactcaatgacaagaagaaaatcttcgtca acatggtggagcacgacacacttgtctactccaaaaatatcaaagatacagtctcagaagaccaa agggcaattgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagc tatctgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcg ataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccaccc acgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtga attctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatat aaggaagttcatttcatttggagagaacacgggggactctaatcaaacaagtttgtacaaaaaag ctgaacgagaaacgtaaaatgatataaatatgcaggtgatacccgcgtgcaactcggcagcaata agatcactatgtcctactcccgagtcttttagaaacatgggatggctctctgtcagcgatgcggt ctacagcgagttcataggagagttggctacccgcgcttccaatcgaaattactccaacgagttcg gcctcatgcaacctatccaggaattcaaggctttcattgaaagcgacccggtggtgcaccaagaa tttattgacatgttcgagggcattcaggactctccaaggaattatcaggaactatgtaatatgtt caacgatatctttcgcaaagctcccgtctacggagaccttggccctcccgtttatatgattatgg ccaaattaatgaacacccgagcgggcttctctgcattcacgagacaaaggttgaaccttcacttc aaaaaacttttcgatacctggggattgttcctgtcttcgaaagattctcgaaatgttcttgtggc cgaccagttcgacgacagacattgcggctggttgaacgagcgggccttgtctgctatggttaaac attacaatggacgcgcatttgatgaagtcttcctctgcgataaaaatgccccatactacggcttc aactcttacgacgacttctttaatcgcagatttcgaaaccgagatatcgaccgacctgtagtcgg tggagttaacaacaccaccctcatttctgctgcttgcgaatcactttcctacaacgtctcttatg acgtccagtctctcgacactttagttttcaaaggagagacttattcgcttaagcatttgctgaat aatgaccctttcaccccacaattcgagcatgggagtattctacaaggattcttgaacgtcaccgc ttaccaccgatggcacgcacccgtcaatgggacaatcgtcaaaatcatcaacgttccaggtacct actttgcgcaagccccgagcacgattggcgaccctatcccggataacgattacgacccacctcct taccttaagtctcttgtctacttctctaatattgccgcaaggcaaattatgtttattgaagccga caacaaggaaattggcctcattttccttgtgttcatcggcatgaccgaaatctcgacatgtgaag ccacggtgtccgaaggtcaacacgtcaatcgtggcgatgacttgggaatgttccatttcggtggt tcttcgttcgcgcttggtctgaggaaggattgcagggcagagatcgttgaaaagttcaccgaacc cggaacagtgatcagaatcaacgaagtcgtcgctgctctaaaggcttagtacgtttctcgttcag ctttcttgtacaaagtggttcgatctagaggatccatggtgagcaagggcgaggagctgttcacc ggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccg gcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggca agctgcccgtgccctggcccaccctcgtgaccaccttcacctacggcgtgcagtgcttcagccgc taccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccagg agcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagg gcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcc tggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaa gaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgc cgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccacta cctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgct ggagttcgtgaccgccgccgggatcactcacggcatggacgagctgtacaagtaaagcggccc gagctcgaatttccccgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttg ccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatg taatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaata cgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgt tactagatcgggaattagcttcatcaacgcaagacatgcgcacgaccgtctgacaggagaggaat ttccgacgagcacagaaaggacttgctcttggacgtaggcctatttctcaggcacatgtatcaag tgttcggacgtgggttttcgatggtgtatcagccgccgccaactgggagatgaggaggctttctt ggggggcagtcagcagttcatttcacaagacagaggaacttgtaaggagatgcactgatttatct tggcgcaaaccagcaggacgaattagtgggaatagcccgcgaatatctaagttatgcctgtcggc atgagcagaaacttccaattcgaaacagtttggagaggttgtttttgggcataccttttgttagt cagcctctcgattgctcatcgtcattacacagtaccgaagtttgatcgatctagtaacatagatg acaccgcgcgcgataatttatcctagtttgcgcgctatattttgttttctatcgcgtattaaatg tataattgcgggactctaatcataaaaacccatctcataaataacgtcatgcattacatgttaat tattacatgcttaacgtaattcaacagaaattatatgataatcatcgcaagaccggcaacaggat tcaatcttaagaaactttattgccaaatgtttgaacgatctgcttcgacgcactccttctttact ccaccatctcgtccttattgaaaacgtgggtagcaccaaaacgaatcaagtcgctggaactgaag ttaccaatcacgctggatgatttgccagttggattaatcttgcctttccccgcatgaataatatt gatgaatgcatgcgtgaggggtatttcgattttggcaatagctgcaattgccgcgacatcctcca acgagcataattcttcagaaaaatagcgatgttccatgttgtcagggcatgcatgatgcacgtta tgaggtgacggtgctaggcagtattccctcaaagtttcatagtcagtatcatattcatcattgca ttcctgcaagagagaattgagacgcaatccacacgctgcggcaaccttccggcgttcgtggtcta tttgctcttggacgttgcaaacgtaagtgttggatcccggtcggcatctactctattcctttgcc ctcggacgagtgctggggcgtcggtttccactatcggcgagtacttctacacagccatcggtcca gacggccgcgcttctgcgggcgatttgtgtacgcccgacagtcccggctccggatcggacgattg cgtcgcatcgaccctgcgcccaagctgcatcatcgaaattgccgtcaaccaagctctgatagagt tggtcaagaccaatgcggagcatatacgcccggagccgcggcgatcctgcaagctccggatgcct ccgctcgaagtagcgcgtctgctgctccatacaagccaaccacggcctccagaagaagatgttgg cgacctcgtattgggaatccccgaacatcgcctcgctccagtcaatgaccgctgttatgcggcca ttgtccgtcaggacattgttggagccgaaatccgcgtgcacgaggtgccggacttcggggcagtc ctcggcccaaagcatcagctcatcgagagcctgcgcgacggacgcactgacggtgtcgtccatca cagtttgccagtgatacacatggggatcagcaatcgcgcatatgaaatcacgccatgtagtgtat tgaccgattccttgcggtccgaatgggccgaacccgctcgtctggctaagatcggccgcagcgat cgcatccatggcctccgcgaccggctgcagaacagcgggcagttcggtttcaggcaggtcttgc aacgtgacaccctgtgcacggcgggagatgcaataggtcaggctctcgctgaattccccaatgtc aagcacttccggaatcgggagcgcggccgatgcaaagtgccgataaacataacgatctttgtaga aaccatcggcgcagctatttacccgcaggacatatccacgccctcctacatcgaagctgaaagca cgagattcttcgccctccgagagctgcatcaggtcggagacgctgtcgaacttttcgatcagaaa cttctcgacagacgtcgcggtgagttcaggctttttcatatcggggtcgtcctctccaaatgaaa tgaacttccttatatagaggaagggtcttgcgaaggatagtgggattgtgcgtcatcccttacgt cagtggagatatcacatcaatccacttgctttgaagacgtggttggaacgtcttctttttccacg atgctcctcgtgggtgggggtccatctttgggaccactgtcggcagaggcatcttgaacgatagc ctttcctttatcgcaatgatggcatttgtaggtgccaccttccttttctactgtccttttgatga agtgacagatagctgggcaatggaatccgaggaggtttcccgatattaccctttgttgaaaagtc tcaatagccctttggtcttctgagactgtatctttgatattcttggagtagacgagagtgtcgtg ctccaccatgttgacggatctctaggacgcgtcctagaagctaattcactggccgtcgttttaca acgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcg ccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaat ggcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaag ctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaa cttgatttgggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgac gttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatct cgggctattcttttgatttataagggattttgccgatttcggaaccaccatcaaacaggattttc gcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggc aatcagctgttgcccgtctcactggtgaaaagaaaaaccaccccagtacattaaaaacgtccgca atgtgttattaagttgtctaagcgtcaatttgtttacaccacaatatatcctgccaccagccagc caacagctccccgaccggcagctcggcacaaaatcaccactcgatacaggcagcccatcagtccg ggacggcgtcagcgggagagccgttgtaaggcggcagactttgctcatgttaccgatgctattcg gaagaacggcaactaagctgccgggtttgaaacacggatgatctcgcggagggtagcatgttgat tgtaacgatgacagagcgttgctgcctgtgatcaaatatcatctccctcgcagagatccgaatta tcagccttcttattcatttctcgcttaaccgtgacaggctgtcgatcttgagaactatgccgaca taataggaaatcgctggataaagccgctgaggaagctgagtggcgctatttctttagaagtgaac gttgacgatatcaactcccctatccattgctcaccgaatggtacaggtcggggacccgaagttcc gactgtcggcctgatgcatccccggctgatcgaccccagatctggggctgagaa agcccagtaaggaaacaactgtaggttcgagtcgcgagatcccccggaaccaaaggaagtagg ttaaacccgctccgatcaggccgagccacgccaggccgagaacattggttcctgtaggcatcgg gattggcggatcaaacactaaagctactggaacgagcagaagtcctccggccgccagttgccag gcggtaaaggtgagcagaggcacgggaggttgccacttgcgggtcagcacggttccgaacgcc atggaaaccgcccccgccaggcccgctgcgacgccgacaggatctagcgctgcgtttggtgtca acaccaacagcgccacgcccgcagttccgcaaatagcccccaggaccgccatcaatcgtatcgg gctacctagcagagcggcagagatgaacacgaccatcagcggctgcacagcgcctaccgtcgc cgcgaccccgcccggcaggcggtagaccgaaataaacaacaagctccagaatagcgaaatatt aagtgcgccgaggatgaagatgcgcatccaccagattcccgttggaatctgtcggacgatcatca cgagcaataaacccgccggcaacgcccgcagcagcataccggcgacccctcggcctcgctgtt cgggctccacgaaaacgccggacagatgcgccttgtgagcgtccttggggccgtcctcctgtttg aagaccgacagcccaatgatctcgccgtcgatgtaggcgccgaatgccacggcatctcgcaacc gttcagcgaacgcctccatgggctttttctcctcgtgctcgtaaacggacccgaacatctctgga gctttcttcagggccgacaatcggatctcgcggaaatcctgcacgtcggccgctccaagccgtcg aatctgagccttaatcacaattgtcaattttaatcctctgtttatcggcagttcgtagagcgcgc cgtgcgtcccgagcgatactgagcgaagcaagtgcgtcgagcagtgcccgcttgttcctgaaatg ccagtaaagcgctggctgctgaacccccagccggaactgaccccacaaggccctagcgtttgcaa tgcaccaggtcatcattgacccaggcgtgttccaccaggccgctgcctcgcaactcttcgcaggc ttcgccgacctgctcgcgccacttcttcacgcgggtggaatccgatccgcacatgaggcggaagg tttccagcttgagcgggtacggctcccggtgcgagctgaaatagtcgaacatccgtcgggccgtc ggcgacagcttgcggtacttctcccatatgaatttcgtgtagtggtcgccagcaaacagcacgac gatttcctcgtcgatcaggacctggcaacgggacgttttcttgccacggtccaggacgcggaagc ggtgcagcagcgacaccgattccaggtgcccaacgcggtcggacgtgaagcccatcgccgtcgcc tgtaggcgcgacaggcattcctcggccttcgtgtaataccggccattgatcgaccagcccaggtc ctggcaaagctcgtagaacgtgaaggtgatcggctcgccgataggggtgcgcttcgcgtactcca acacctgctgccacaccagttcgtcatcgtcggcccgcagctcgacgccggtgtaggtgatcttc acgtccttgttgacgtggaaaatgaccttgttttgcagcgcctcgcgcgggattttcttgttgcg cgtggtgaacagggcagagcgggccgtgtcgtttggcatcgctcgcatcgtgtccggccacggcg caatatcgaacaaggaaagctgcatttccttgatctgctgcttcgtgtgtttcagcaacgcggcc tgcttggcctcgctgacctgttttgccaggtcctcgccggcggtttttcgcttcttggtcgtcat agttcctcgcgtgtcgatggtcatcgacttcgccaaacctgccgcctcctgttcgagacgacgcg aacgctccacggcggccgatggcgcgggcagggcagggggagccagttgcacgctgtcgcgctcg atcttggccgtagcttgctggaccatcgagccgacggactggaaggtttcgcggggcgcacgcat gacggtgcggcttgcgatggtttcggcatcctcggcggaaaaccccgcgtcgatcagttcttgcc tgtatgccttccggtcaaacgtccgattcattcaccctccttgcgggattgccccgactcacgcc ggggcaatgtgcccttattcctgatttgacccgcctggtgccttggtgtccagataatccacctt atcggcaatgaagtcggtcccgtagaccgtctggccgtccttctcgtacttggtattccgaatct tgccctgcacgaataccagcgaccccttgcccaaatacttgccgtgggcctcggcctgagagcca aaacacttgatgcggaagaagtcggtgcgctcctgcttgtcgccggcatcgttgcgccacatcta ggtactaaaacaattcatccagtaaaatataatattttattttctcccaatcaggcttgatcccc agtaagtcaaaaaatagctcgacatactgttcttccccgatatcctccctgatcgaccggacgca gaaggcaatgtcataccacttgtccgccctgccgcttctcccaagatcaataaagccacttactt tgccatctttcacaaagatgttgctgtctcccaggtcgccgtgggaaaagacaagttcctcttcg ggcttttccgtctttaaaaaatcatacagctcgcgcggatctttaaatggagtgtcttcttccca gttttcgcaatccacatcggccagatcgttattcagtaagtaatccaattcggctaagcggctgt ctaagctattcgtatagggacaatccgatatgtcgatggagtgaaagagcctgatgcactccgca tacagctcgataatcttttcagggctttgttcatcttcatactcttccgagcaaaggacgccatc ggcctcactcatgagcagattgctccagccatcatgccgttcaaagtgcaggacctttggaacag gcagctttccttccagccatagcatcatgtccttttcccgttccacatcataggtggtcccttta taccggctgtccgtcatttttaaatataggttttcattttctcccaccagcttatataccttagc aggagacattccttccgtatcttttacgcagcggtatttttcgatcagttttttcaattccggtg atattctcattttagccatttattatttccttcctcttttctacagtatttaaagataccccaag aagctaattataacaagacgaactccaattcactgttccttgcattctaaaaccttaaataccag aaaacagctttttcaaagttgttttcaaagttggcgtataacatagtatcgacggagccgatttt gaaaccacaattatgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtg ctccagtggcttctgtgtctatcagctgtccctcctgttcagctactgacggggtggtgcgtaac ggcaaaagcaccgccggacatcagcgctatctctgctctcactgccgtaaaacatggcaactgca gttcacttacaccgcttctcaacccggtacgcaccagaaaatcattgatatggccatgaatggcg ttggatgccgggcaacagcccgcattatgggcgttggcctcaacacgattttacgtcacttaaaa aactcaggccgcagtcggtaacctcgcgcatacagccgggcagtgacgtcatcgtctgcgcggaa atggacgaacagtggggctatgtcggggctaaatcgcgccagcgctggctgttttacgcgtatga cagtctccggaagacggttgttgcgcacgtattcggtgaacgcactatggcgacgctggggcgtc ttatgagcctgctgtcaccctttgacgtggtgatatggatgacggatggctggccgctgtatgaa tcccgcctgaagggaaagctgcacgtaatcagcaagcgatatacgcagcgaattgagcggcataa cctgaatctgaggcagcacctggcacggctgggacggaagtcgctgtcgttctcaaaatcggtgg agctgcatgacaaagtcatcgggcattatctgaacataaaacactatcaataagttggagtcatt acccaattatgatagaatttacaagctataaggttattgtcctgggtttcaagcattagtccatg caagtttttatgctttgcccattctatagatatattgataagcgcgctgcctatgccttgccccc tgaaatccttacatacggcgatatcttctatataaaagatatattatcttatcagtattgtcaat atattcaaggcaatctgcctcctcatcctcttcatcctcttcgtcttggtagctttttaaatatg gcgcttcatagagtaattctgtaaaggtccaattctcgttttcatacctcggtataatcttacct atcacctcaaatggttcgctgggtttatcgcacccccgaacacgagcacggcacccgcgaccact atgccaagaatgcccaaggtaaaaattgccggccccgccatgaagtccgtgaatgccccgacggc cgaagtgaagggcaggccgccacccaggccgccgccctcactgcccggcacctggtcgctgaatg tcgatgccagcacctgcggcacgtcaatgcttccgggcgtcgcgctcgggctgatcgcccatccc gttactgccccgatcccggcaatggcaaggactgccagcgctgccatttttggggtgaggccgtt cgcggccgaggggcgcagcccctggggggatgggaggcccgcgttagcgggccgggagggttcga gaagggggggcaccccccttcggcgtgcgcggtcacgcgcacagggcgcagccctggttaaaaac aaggtttataaatattggtttaaaagcaggttaaaagacaggttagcggtggccgaaaaacgggc ggaaacccttgcaaatgctggattttctgcctgtggacagcccctcaaatgtcaataggtgcgcc cctcatctgtcagcactctgcccctcaagtgtcaaggatcgcgcccctcatctgtcagtagtcgc gcccctcaagtgtcaataccgcagggcacttatccccaggcttgtccacatcatctgtgggaaac tcgcgtaaaatcaggcgttttcgccgatttgcgaggctggccagctccacgtcgccggccgaaat cgagcctgcccctcatctgtcaacgccgcgccgggtgagtcggcccctcaagtgtcaacgtccgc ccctcatctgtcagtgagggccaagttttccgcgaggtatccacaacgccggcggccgcggtgtc tcgcacacggcttcgacggcgtttctggcgcgtttgcagggccatagacggccgccagcccagcg gcgagggcaaccagcccgg 19 pGHGWY:Cc AGATCTCTAATTCCGGGGATCGGAAATCCAGAAGCCCGAG DED1pro- AGGTTGCCGCCTTTCGGGCTTTTTCTTTTTCAAAAAAAAAA moter_ ATTTATAAAACGATCTGTTGCGGCCGGCCGCCGGGTTGTGG intron:GW GCAAAGGCGCTGGCGCTCGACGGTGGGCAACCGCTTGCGG cassette_ TTGTCCACGGGCGGAGCCGGTGCGCGTAGCGCATTGTCCA YFP CAAGCCAAGGGCGACCAATAATTGATATATATATTCATAA TTGAAAAGCTAATTGAACATACTACTTGCTGTAACTACTTG CCGGAGCGAGGGGTGTTTGCAAGCTGTTGATCTGAAAGGG CTATTAGCGTTCTCACGTGCCTTTTTGATTAGCGATTTCACG TGACCTTATTAGCGATTTCACGTACTCCGATTAGCGATTTC ACGTACCCTGATTAGCGATTTCACGTGGATAGTTTTTGGAG CGGGCCGGAAAGCCCCGTGAATCAAGGCTTTGCGGGGCAT TAGCGGTTTCACGTGGATAACTACCCTCTATCCACAGGCTT CCGGGGATAAAAAAGCCCGCTCGACGGCGGGCTGTTGGAT GGGGATCGCCTGAATCGCCCCATCATCCAGCCAGAAAGTG AGGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACC AGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCT GCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAGC AAAAGTTCGATTTATTCAACAAAGCCACGTTGTGTCTCAAA ATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCA TGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAA GGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCA AGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGG GTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCG ACAATCTACCGATTGTATGGGAAGCCCGATGCGCCAGAGT TGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGTTGTT ACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTA TGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGAT GATGCATGGTTACTCACCACTGCGATCCCAGGGAAAACAG CATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAAT ATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTC GATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATT TCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGG TTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCT GTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATT CTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTG ATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATT GATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATC TTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCAT TACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCT GATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTT TTTCTAATCACTAGACCAATGTTACACATATATACTTTAGA TTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTG AAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACG TGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGA TCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCT GCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGT TTGTTTGCCGGATCAAGAGCTACCAACTCTTCTTCCGAAGG TAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTT CTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGT AGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAG TGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTG GACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGG GCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCG AACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTA TGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGAC AGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGC ACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATA GTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTT TTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACG CCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGG CCTTTTGCTCACATGAGATCTCAAACAAACACATACAGCGA CTTAGTTTACCCGCCAATATATCCTGTCAAGGATCGTACCC CTACTCCAAAAATGTCAAAGATACAGTCTCAGAAGACCAA AGGGCTATTGAGACTTTTCAACAAAGGGTAATTTCGGGAA ACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATC GAAAGGACAGTAGAAAAGGAAGGTGGCTCCTACAAATGCC ATCATTGCGATAAAGGAAAGGCTATCATTCAAGATGCCTCT GCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGA GCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAA GCAAGTGGATTGATGTGACATCTCCACTGACGTAAGGGAT GACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTAT ATAAGGAAGTTCATTTCATTTGGAGAGGACAGCCCAAGCT GATCCCTATGAAAAAGCCTGAACTCACCGCGACGTCTGTC GAGAAGTTTCTGATCGAAAAGTTCGACAGCGTCTCCGACCT GATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCT TCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAG CTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGC ACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTGAC ATTGGGGAGTTCAGCGAGAGCCTGACCTATTGCATCTCCCG CCGTGCACAGGGTGTCACGTTGCAAGACCTGCCTGAAACC GAACTGCCCGCTGTTCTTCAGCCGGTCGCGGAGGCTATGGA TGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTC GGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACAT GGCGTGATTTCATATGCGCGATTGCTGATCCCCATGTGTAT CACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCG TCGCGCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGGA CTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATTTCGGCT CCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGT CATTGACTGGAGCGAGGCGATGTTCGGGGATTCCCAATAC GAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGTTGGCTTG TATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCG GAGCTTGCAGGATCGCCACGCCTCCGGGCGTATATGCTCCG CATTGGTCTTGACCAACTCTATCAGAGCTTGGTTGACGGCA ATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGC AATCGTCCGATCCGGAGCCGGGACTGTCGGGCGTACACAA ATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGCTGTG TAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCAC TCGTCCGAGGGCAAAGGAATAGAGTAGATGCCGACCGAAC AAGAGCTGATTTCGAGAACGCCTCAGCCAGCAACTCGCGC GAGCCTAGCAAGGCAAATGCGAGAGAACGGCCTTACGCTT GGTGGCACAGTTCTCGTCCACAGTTCGCTAAGCTCGCTCGG CTGGTCGCGGGAGAATTAATTCGGTACGCTGAAATCACCA GTCTCTCTCTACAAATCTATCTCTCTCTATTTTCTCCATAAA TAATGTGTGAGTAGTTTCCCGATAAGGGAAATTAGGGTTCT TATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTT AGTATGTATTTGTATTTGTAAAATACTTCTATCAATAAAAT TTCTAATTCCTAAAACCAAAATCCAGTACTAAAATCCAGAT CGATCCTTCATGTTCTTTCCTGCGTTATCCCCTGATTCTGTG GATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCG CCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAG GAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCG CGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTT CCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATG TGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTT ATGACTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGAT AACAATTTCACACAGGAAACAGCTATGACCATGATTACGC CAAGCTCGGAATTAACCCTCACTAAAGGGAACAAAAGCTG GAGCTCTGGTCCCGCAGGGGCGGCGGCTGAAACATCTGCA CAAGCTACTGCCACGGCGCAGAGTAGTGGACGGGCGACGC CGCAGGCGACTGCGAACCCCTCTAGTGCAGCTTCGCAACA ATCTGTCGCTGCTGCGGCAGCGACGCCATCTTCTGCGAGGG CGAGTCCGATGCCTGCTATGCACGCCCAACAGAATCCCACT CAGTCGCAACAAGCCCAGCAAGCGAATGCGGCCATACTTC AAGCTGCGATTCAACAACAACAACTACAGCGACAACAGCA ACAATACCAGCGCACGTTGACCCCCATTCAGCCACAGAAG ACGAACTCTCAAGGAGGGCAGGTGCAGATGCAGGTTCAGC CGCAATTGGCCGCAAATGGACAATATACGTTCACGACGCC GTTCAATGCTGCCGCATTGCGAGCCGCAACGCCCTTGACCG CTAGTCAGCAAGCTGCTGCTCAACGGATGGCTGCTGCCCA AGCAAATGCAGCTAAAATGAGCGCGGGGACCCCTGCACAG AATGCAGGCAGTAACATTCACGTACAGCCGTCACCGCAAC AAGCCCAGGCTCAAATCCAGGTACAGCAGCAGCAGACGCT TCAGGTCCCGCAACAGCAACAGGCGAGGACACCACAAATG CAAACGCAGCAGCTACGGACGCCTCAAATTCAGGCTCAGC AATTACGGACGCCACAGATGCAAACGCAACAGCTTCAGCG AACGCCTCAGATGCAGACGCAACAACTTCAACCGACGCCG CAGATGCAGCCTCAGCAGCTCCAGTCTCAAATGGGGCAGA TGCAACGCCAGCCGACTCCTCAGCAACATACGCCTCAGCA ACAACATGCTCAACTTCAGCCTGTGCAGGCTCAGCAGTTAG CGATGGCCCAGCAGCAACAGCAACAGCAGCAAATGCAGGC TCAAATTCAGCAGCAACAACCACAACAAGCGCATCTGACT CCGCAACAGTATCAGCAGTATCAGATGTATAGCAATTATTA TCAAGCTGCGGCGGCAATGCAACAACACGGGGGACAGAG ACTGACTCCGCAACAACAACAGGCAATTTGGAACGCGCAG TTCCAGCGTGCTGCTGCTGCTGCTGGTATGCAGGGGCAGCA TGGCGGGGTACCTATGAACCAGGTACAACAGGCTGCGCTG GCCGCACACATAGCGAAACAGCAGCAACAACAGCAACAG CATCAAGGTCAAGGTCCACGGTGAATGGGTTTAGCTTCGTA GATAGTGTATTAGTATTTTGTAATGGACATTGGGATTGGGT GAAGACAAACCCGAGAACGTCATCTTTGTGGAGTGTTTGTT CGGATTTGGTGTGAGGCCGTGCAAGCTTAGTCAGCAGTTA GTGGAAAAGGTGGAGGTAGAAAGAGGGCAAGGGAAGTTT TCGTCTCCTTTCTGATCTGGTACCACCATCATCACCCCAGC AAAACTCTCTACTCTCTTAGACCTTCACTTTATCCTTCACTT TTATTCTTTTTCAACTCTTTTCGTTTCTCAAGTTCTACTCCCA AAGTCGCTCGTTTCTTTCGAATTTCACGAAAGACTGCACAA AAAGACGTATCTTTGCTAGCCCTGCAAGCATCGACCACCG ATATCCACAGCGATTCAAGAACGATTCGAGTTCAACAAAT CTTCAACTAATgtaattctctttcttttgggataagttgaaacccgaacgaggaactaatct ttcactcggtgtagAAGCTTATCGATACCGTCGACCTCGAGGGGGG GCCCGGTACCCACCGGATCCACAAGTTTGTACAAAAAAGC TGAACGAGAAACGTAAAATGATATAAATATCAATATATTA AATTAGATTTTGCATAAAAAACAGACTACATAATACTGTA AAACACAACATATCCAGTCACTATGGCGGCCGCATTAGGC ACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGT GTGGATTTTGAGTTAGGATCCGGCGAGATTTTCAGGAGCTA AGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCAC CGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGG CATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTT CAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAA ATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCC CGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAA AGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTT ACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTC TGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACAT ATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCT ATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCA GCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGT GGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGG GCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCT GGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATG TCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGA GTGGCAGGGCGGGGCGTAAACGCGTGGATCCGGCTTACTA AAAGCCAGATAACAGTATGCGTATTTGCGCGCTGATTTTTG CGGTATAAGAATATATACTGATATGTATACCCGAAGTATGT CAAAAAGAGGTGTGCTATGAAGCAGCGTATTACAGTGACA GTTGACAGCGACAGCTATCAGTTGCTCAAGGCATATATGAT GTCAATATCTCCGGTCTGGTAAGCACAACCATGCAGAATG AAGCCCGTCGTCTGCGTGCCGAACGCTGGAAAGCGGAAAA TCAGGAAGGGATGGCTGAGGTCGCCCGGTTTATTGAAATG AACGGCTCTTTTGCTGACGAGAACAGGGACTGGTGAAATG CAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATC GTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCC GGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGC TGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCAT ATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGG CCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGA TCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAAC CTGATGTTCTGGGGAATATAAATGTCAGGCTCCCTTATACA CAGCCAGTCTGCAGGTCGACCATAGTGACTGGATATGTTGT GTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCTAA TTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTCA GCTTTCTTGTACAAAGTGGTGCTCGAGATGGTGAGCAAGG GCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGA GCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCC GGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCC TGAAGCTGATCTGCACCACCGGCAAGCTGCCCGTGCCCTG GCCCACCCTCGTGACCACCCTGGGCTACGGCCTGCAGTGCT TCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTC AAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCA TCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGA GGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAG CTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGG GGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTA TATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCAAC TTCAAGATCCGCCACAACATCGAGGACGGCGGCGTGCAGC TCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGG CCCCGTGCTGCTGCCCGACAACCACTACCTGAGCTACCAGT CCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACAT GGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCG GCATGGACGAGCTGTACAAGTAAGTCGACCTGCAGGCATG CGCTGAAATCACCAGTCTCTCTCTACAAATCTATCTCTCTCT ATAATAATGTGTGAGTAGTTCCCAGATAAGGGAATTAGGG TTCTTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAAC CCTTAGTATGTATTTGTATTTGTAAAATACTTCTATCAATAA AATTTCTAATTCCTAAAACCAAAATCCAGTGGGTACCCAAT TCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGT TTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAAC TTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGT AATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGT TGCGCAGCCTGAATGGCGAATGGCGCGAAATTGTAAACGT TAATGTTAACGTTACACCACAATATATCCTGCCA 20 pGHGWY:G AGATCTCTAATTCCGGGGATCGGAAATCCAGAAGCCCGAG PDpromoter_ AGGTTGCCGCCTTTCGGGCTTTTTCTTTTTCAAAAAAAAAA intron:GW ATTTATAAAACGATCTGTTGCGGCCGGCCGCCGGGTTGTGG cassette: GCAAAGGCGCTGGCGCTCGACGGTGGGCAACCGCTTGCGG YFP TTGTCCACGGGCGGAGCCGGTGCGCGTAGCGCATTGTCCA CAAGCCAAGGGCGACCAATAATTGATATATATATTCATAA TTGAAAAGCTAATTGAACATACTACTTGCTGTAACTACTTG CCGGAGCGAGGGGTGTTTGCAAGCTGTTGATCTGAAAGGG CTATTAGCGTTCTCACGTGCCTTTTTGATTAGCGATTTCACG TGACCTTATTAGCGATTTCACGTACTCCGATTAGCGATTTC ACGTACCCTGATTAGCGATTTCACGTGGATAGTTTTTGGAG CGGGCCGGAAAGCCCCGTGAATCAAGGCTTTGCGGGGCAT TAGCGGTTTCACGTGGATAACTACCCTCTATCCACAGGCTT CCGGGGATAAAAAAGCCCGCTCGACGGCGGGCTGTTGGAT GGGGATCGCCTGAATCGCCCCATCATCCAGCCAGAAAGTG AGGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACC AGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCT GCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAGC AAAAGTTCGATTTATTCAACAAAGCCACGTTGTGTCTCAAA ATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCA TGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAA GGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCA AGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGG GTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCG ACAATCTACCGATTGTATGGGAAGCCCGATGCGCCAGAGT TGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGTTGTT ACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTA TGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGAT GATGCATGGTTACTCACCACTGCGATCCCAGGGAAAACAG CATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAAT ATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTC GATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATT TCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGG TTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCT GTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATT CTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTG ATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATT GATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATC TTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCAT TACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCT GATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTT TTTCTAATCACTAGACCAATGTTACACATATATACTTTAGA TTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTG AAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACG TGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGA TCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCT GCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGT TTGTTTGCCGGATCAAGAGCTACCAACTCTTCTTCCGAAGG TAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTT CTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGT AGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAG TGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTG GACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGG GCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCG AACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTA TGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGAC AGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGC ACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATA GTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTT TTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACG CCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGG CCTTTTGCTCACATGAGATCTCAAACAAACACATACAGCGA CTTAGTTTACCCGCCAATATATCCTGTCAAGGATCGTACCC CTACTCCAAAAATGTCAAAGATACAGTCTCAGAAGACCAA AGGGCTATTGAGACTTTTCAACAAAGGGTAATTTCGGGAA ACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATC GAAAGGACAGTAGAAAAGGAAGGTGGCTCCTACAAATGCC ATCATTGCGATAAAGGAAAGGCTATCATTCAAGATGCCTCT GCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGA GCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAA GCAAGTGGATTGATGTGACATCTCCACTGACGTAAGGGAT GACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTAT ATAAGGAAGTTCATTTCATTTGGAGAGGACAGCCCAAGCT GATCCCTATGAAAAAGCCTGAACTCACCGCGACGTCTGTC GAGAAGTTTCTGATCGAAAAGTTCGACAGCGTCTCCGACCT GATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCT TCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAG CTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGC ACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTGAC ATTGGGGAGTTCAGCGAGAGCCTGACCTATTGCATCTCCCG CCGTGCACAGGGTGTCACGTTGCAAGACCTGCCTGAAACC GAACTGCCCGCTGTTCTTCAGCCGGTCGCGGAGGCTATGGA TGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTC GGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACAT GGCGTGATTTCATATGCGCGATTGCTGATCCCCATGTGTAT CACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCG TCGCGCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGGA CTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATTTCGGCT CCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGT CATTGACTGGAGCGAGGCGATGTTCGGGGATTCCCAATAC GAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGTTGGCTTG TATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCG GAGCTTGCAGGATCGCCACGCCTCCGGGCGTATATGCTCCG CATTGGTCTTGACCAACTCTATCAGAGCTTGGTTGACGGCA ATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGC AATCGTCCGATCCGGAGCCGGGACTGTCGGGCGTACACAA ATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGCTGTG TAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCAC TCGTCCGAGGGCAAAGGAATAGAGTAGATGCCGACCGAAC AAGAGCTGATTTCGAGAACGCCTCAGCCAGCAACTCGCGC GAGCCTAGCAAGGCAAATGCGAGAGAACGGCCTTACGCTT GGTGGCACAGTTCTCGTCCACAGTTCGCTAAGCTCGCTCGG CTGGTCGCGGGAGAATTAATTCGGTACGCTGAAATCACCA GTCTCTCTCTACAAATCTATCTCTCTCTATTTTCTCCATAAA TAATGTGTGAGTAGTTTCCCGATAAGGGAAATTAGGGTTCT TATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTT AGTATGTATTTGTATTTGTAAAATACTTCTATCAATAAAAT TTCTAATTCCTAAAACCAAAATCCAGTACTAAAATCCAGAT CGATCCTTCATGTTCTTTCCTGCGTTATCCCCTGATTCTGTG GATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCG CCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAG GAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCG CGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTT CCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATG TGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTT ATGACTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGAT AACAATTTCACACAGGAAACAGCTATGACCATGATTACGC CAAGCTCGGAATTAACCCTCACTAAAGGGAACAAAAGCTG GAGCTCgaggtccgcaagtagattgaaagttcagtacgtttttaacaatagagcattctcgag gcttgcgtcattctgtgtcaggctagcagtttataagcgttgaggatctagagctgctgtttccg cgtctcgaatgttctcggtgtttaggggttagcaatctgatatgataataatttgtgatgacatc gatagtacaaaaaccccaattccggtcacatccacctctccgttttctcccatctacacacaaca agcttatcgccgtaattctctttcttttgggataagttgaaacccgaacgaggaactaatctttc actcggtgtagAAG CTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCC ACCGGATCCACAAGTTTGTACAAAAAAGCTGAACGAGAAA CGTAAAATGATATAAATATCAATATATTAAATTAGATTTTG CATAAAAAACAGACTACATAATACTGTAAAACACAACATA TCCAGTCACTATGGCGGCCGCATTAGGCACCCCAGGCTTTA CACTTTATGCTTCCGGCTCGTATAATGTGTGGATTTTGAGTT AGGATCCGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAAT GGAGAAAAAAATCACTGGATATACCACCGTTGATATATCC CAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGT TGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTA CGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTT TTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGC TCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTG GTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCA TGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACC ACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGAT GTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGG GTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGG TGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGAC AACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATAC GCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTT CATCATGCCGTCTGTGATGGCTTCCATGTCGGCAGAATGCT TAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGG GCGTAAACGCGTGGATCCGGCTTACTAAAAGCCAGATAAC AGTATGCGTATTTGCGCGCTGATTTTTGCGGTATAAGAATA TATACTGATATGTATACCCGAAGTATGTCAAAAAGAGGTG TGCTATGAAGCAGCGTATTACAGTGACAGTTGACAGCGAC AGCTATCAGTTGCTCAAGGCATATATGATGTCAATATCTCC GGTCTGGTAAGCACAACCATGCAGAATGAAGCCCGTCGTC TGCGTGCCGAACGCTGGAAAGCGGAAAATCAGGAAGGGAT GGCTGAGGTCGCCCGGTTTATTGAAATGAACGGCTCTTTTG CTGACGAGAACAGGGACTGGTGAAATGCAGTTTAAGGTTT ACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGAT GTACAGAGTGATATTATTGACACGCCCGGGCGACGGATGG TGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTC TCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAA GCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGT CTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGC GAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGG GAATATAAATGTCAGGCTCCCTTATACACAGCCAGTCTGCA GGTCGACCATAGTGACTGGATATGTTGTGTTTTACAGTATT ATGTAGTCTGTTTTTTATGCAAAATCTAATTTAATATATTGA TATTTATATCATTTTACGTTTCTCGTTCAGCTTTCTTGTACA AAGTGGTGCTCGAGATGGTGAGCAAGGGCGAGGAGCTGTT CACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGAC GTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGG GCGATGCCACCTACGGCAAGCTGACCCTGAAGCTGATCTG CACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGA CCACCCTGGGCTACGGCCTGCAGTGCTTCGCCCGCTACCCC GACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGC CCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGA CGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAG GGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCG ACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGA GTACAACTACAACAGCCACAACGTCTATATCACCGCCGAC AAGCAGAAGAACGGCATCAAGGCCAACTTCAAGATCCGCC ACAACATCGAGGACGGCGGCGTGCAGCTCGCCGACCACTA CCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTG CCCGACAACCACTACCTGAGCTACCAGTCCGCCCTGAGCA AAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGA GTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAG CTGTACAAGTAAGTCGACCTGCAGGCATGCGCTGAAATCA CCAGTCTCTCTCTACAAATCTATCTCTCTCTATAATAATGTG TGAGTAGTTCCCAGATAAGGGAATTAGGGTTCTTATAGGGT TTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTA TTTGTATTTGTAAAATACTTCTATCAATAAAATTTCTAATTC CTAAAACCAAAATCCAGTGGGTACCCAATTCGCCCTATAGT GAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCG TGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTG CAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGA GGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGA ATGGCGAATGGCGCGAAATTGTAAACGTTAATGTTAACGT TACACCACAATATATCCTGCCA