COMPOSITIONS AND METHODS TO TREAT CANCER
20240052354 ยท 2024-02-15
Inventors
- Eric BILLY (Strasbourg, FR)
- Antoine De Weck (Basel, CH)
- Javad GOLJI (Grafton, MA, US)
- Gregory HOFFMAN (Chestnut Hill, MA, US)
- Francesco Hofmann (Basel, CH)
- Audrey KAUFFMANN (Mulhouse, FR)
- Konstantinos John MAVRAKIS (Boston, MA, US)
- Earl Robert MCDONALD, III (Wayland, MA, US)
- William SELLERS (Chestnut Hill, MA, US)
- Tobias SCHMELZLE (Riehen, CH)
- Frank Peter Stegmeier (Acton, MA)
- Michael Ray Schlabach, Jr. (Cambridge, MA)
Cpc classification
C12N2320/12
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N9/78
CHEMISTRY; METALLURGY
C12N2330/50
CHEMISTRY; METALLURGY
C12N2310/20
CHEMISTRY; METALLURGY
A61K47/18
HUMAN NECESSITIES
A61K31/7088
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
G01N2800/52
PHYSICS
C12N15/115
CHEMISTRY; METALLURGY
International classification
C12N15/115
CHEMISTRY; METALLURGY
A61K45/06
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The disclosure provides novel personalized therapies, kits, transmittable forms of information and methods for use in treating patients having cancer, wherein the cancer is amenable to therapeutic treatment with an inhibitor, e.g., an inhibitor of any of the targets disclosed herein. Kits, methods of screening for candidate inhibitors, and associated methods of treatment are also provided.
Claims
1-25. (canceled)
26. A method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an ADAR inhibitor wherein the cancer is selected from the group consisting of hematopoietic cancer, skin cancer, lung cancer, colorectal cancer, stomach cancer, thyroid cancer, melanoma, uveal melanoma, pancreatic cancer, endometrial cancer, Ewing's sarcoma, breast cancer, CNS cancer, kidney cancer, bladder cancer, esophageal cancer, upper aerodigestive cancer, neuroblastoma, ovarian cancer, liver cancer, and colon cancer.
27. The method of claim 26, wherein the cancer is selected from the group consisting of breast cancer, lung cancer, esophageal cancer, upper aerodigestive cancer, neuroblastoma, pancreatic cancer, and skin cancer.
28. The method of claim 26, wherein the ADAR inhibitor is selected from the group consisting of an RNAi agent, a CRISPR, a TALEN, a zinc finger nuclease, a mRNA, an antibody or derivative thereof, a chimeric antigen receptor T cell (CART), and a low molecular weight compound.
29. The method of claim 26, further comprising administering a second therapeutic agent.
30. The method of claim 26, wherein the second therapeutic agent is an anti-cancer agent, anti-allergic agent, anti-nausea agent, anti-emetic agent, pain reliever, or cytoprotective agent.
31. The method of claim 26, wherein the cancer is an interferon stimulated gene (ISG) signature positive cancer.
32. The method of claim 26, wherein the cancer is interferon stimulated gene (ISG) signature positive breast cancer, interferon stimulated gene (ISG) signature positive lung cancer, interferon stimulated gene (ISG) signature positive esophageal cancer, interferon stimulated gene (ISG) signature positive upper aerodigestive cancer, interferon stimulated gene (ISG) signature positive pancreatic cancer or interferon stimulated gene (ISG) signature positive skin cancer.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0121] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
DETAILED DESCRIPTION
[0138] The present disclosure provides novel diagnostic methods and treatments for cancer patients by targeting gene expression or function of any of the targets disclosed in Tables 1 or 2. The present invention is based, in part, on the discovery that certain types of cancer cells are sensitive to inhibition of specific targets, e.g., cancers disclosed in Table 2 are sensitive to the inhibition of respective targets disclosed in Table 2.
TABLE-US-00001 TABLE 1 List of 80 targets and associated cancer types NCBI Gene Norm No. ID Gene Symbols LRT Cosmic Potential cancer types 1 4893 NRAS 676.1693 Cosmic Across cancer types including skin, lung, and hematopoietic cancers 2 1499 CTNNB1 594.6094 Cosmic Across cancer types including colorectal cancer (CRC), stomach, and lung cancers 3 6595 SMARCA2 572.3442 NA Across cancer types including lung cancer 4 673 BRAF 531.8816 Cosmic Across cancer types including skin, CRC, and thyroid cancers 5 4286 MITF 448.6566 Cosmic Across cancer types including skin, and uveal cancers 6 4602 MYB 428.5779 Cosmic Across cancer types including hematopoietic (ALL, AML), and CRC cancers 7 3845 KRAS 422.8064 Cosmic Across cancer types including pancreatic, lung, and CRC cancers 8 200916 RPL22L1 402.6926 NA Across cancer types including CRC, endometrial, and stomach cancers 9 2313 FLI1 374.0815 Cosmic Across cancer types including hematopoietic (ALL, AML, MM, DLBCL), and Ewing's sarcoma 10 440 ASNS 364.8319 NA Across cancer types including breast, CRC, pancreatic, and skin cancers 11 7486 WRN 355.5048 Cosmic Across cancer types including CRC, endometrial, and stomach cancers 12 6663 SOX10 332.1695 NA Across cancer types including melanoma (skin and uveal), and CNS cancers 13 5832 ALDH18A1 312.2923 NA Across cancer types including breast, lung, pancreatic, and skin cancers 14 3169 FOXA1 310.3314 Cosmic Across cancer types including breast, and prostate cancers 15 6928 HNF1B 303.3582 NA Across cancer types including kidney, and lung cancers 16 1019 CDK4 299.0601 Cosmic Across cancer types including breast, lung, and skin cancers 17 861 RUNX1 250.8642 Cosmic Across cancer types including hematopoietic (ALL, AML) cancers 18 7298 TYMS 242.6004 NA Across cancer types breast, CRC, lung, and pancreatic cancers 19 6319 SCD 236.4781 NA Across cancer types including CRC, endometrium, and pancreatic cancers 20 898 CCNE1 222.976 Cosmic Across cancer types including breast, endometrial, lung, and ovarian cancers 21 1956 EGFR 215.1623 Cosmic Across cancer types including bladder, CRC, lung, stomach, and upper aerodigestive cancers 22 865 CBFB 214.1315 Cosmic Across cancer types including hematopoietic (ALL, AML) cancers 23 5604 MAP2K1 211.7167 Cosmic Across cancer types including CRC cancer 24 8626 TP63 208.5858 NA Across squamous cancer types bladder, esophageal and upper aerodigestive cancers 25 2064 ERBB2 202.7234 Cosmic Across cancer types including breast, CRC, stomach and esophageal cancers 26 5291 PIK3CB 200.9034 NA Across cancer types including breast and CRC cancers 27 4352 MPL 199.3918 Cosmic Across cancer types including AML 28 4193 MDM2 196.1677 Cosmic Across cancer types 29 2263 FGFR2 191.2429 Cosmic Across cancer types 30 2322 FLT3 181.9756 Cosmic Across cancer types including hematopoietic (ALL, AML) cancers 31 5634 PRPS2 180.3862 NA Across cancer types including breast, CRC, and lung cancers 32 5290 PIK3CA 174.7291 Cosmic Across cancer types breast, CRC and stomach cancers 33 1017 CDK2 174.3597 NA Across cancer types including breast, endometrial, lung and ovarian cancers 34 27183 VPS4A 171.5517 NA Across cancer types including breast, CRC, lung, stomach, pancreatic and upper areodigestive cancers 35 8682 PEA15 171.2006 NA Across cancer types including skin cancer 36 2099 ESR1 169.9934 Cosmic Across cancer types including breast cancer 37 10419 PRMT5 167.0136 NA Across cancer types including but not restricted to bladder, CNS, AML, lung, pancreatic and skin 38 1029 CDKN2A 165.5385 Cosmic N/A 39 22937 SCAP 162.9848 NA Across cancer types including CRC, endometrial, esophageal, pancreatic and skin cancers 40 896 CCND3 162.8703 Cosmic Across cancer types including hematopoietic (ALL, DLBCL) and lung cancers 41 6925 TCF4 162.4801 NA Across cancer types including hematopoietic cancers and neuroblastoma 42 7157 TP53 162.0464 Cosmic N/A 43 6390 SDHB 157.8968 Cosmic Across cancer types including breast, CRC, and lung cancers 44 2879 GPX4 156.6517 NA Across cancer types including CNS, kidney, AML, liver, lung, ovarian cancers and neuroblastoma 45 1050 CEBPA 153.4186 Cosmic Across cancer types including liver cancer and AML 46 468 ATF4 151.9762 NA Across cancer types including breast, CRC, endometrial, pancreatic and skin cancers 47 2625 GATA3 150.1109 Cosmic Across cancer types including breast cancer and neuroblastoma 48 10413 YAP1 149.2448 NA Across cancer types including CRC, lung, stomach and ovarian cancers 49 57492 ARID1B 144.0908 Cosmic Across cancer types 50 55884 WSB2 143.9142 NA Across cancer types 51 8575 PRKRA 141.2148 NA Across cancer types including breast, CRC, lung, pancreatic, skin and upper aerodigestive cancers 52 3480 IGF1R 140.2324 NA Across cancer types including CRC, lung cancer, multiple myeloma and neuroblastoma 53 1854 DUT 139.924 NA Across cancer types including breast cancer 54 3312 HSPA8 137.9435 NA Across cancer types including CRC and skin cancer 55 4170 MCL1 137.4848 NA Across cancer types including breast, CRC, hem, lung and skin cancers 56 4194 MDM4 137.1254 Cosmic Across cancer types including CRC, neuroblastoma and skin cancers 57 7022 TFAP2C 135.1943 NA Across cancer types including breast, and skin cancers 58 2771 GNAI2 134.2611 NA Across cancer types including hematopoietic (AML, DLBCL) cancers 59 378 ARF4 131.6471 NA Across cancer types including breast, CRC, kidney, lung, pancreatic and skin cancers 60 3662 IRF4 130.6215 Cosmic Across cancer types including multiple myeloma 61 6392 SDHD 129.2459 Cosmic Across cancer types including breast, and colon cancers 62 1072 CFL1 129.1845 NA Across cancer types including CRC, lung, esophageal, hematopoietic (AML, ALL, DLBCL) and ovarian cancers 63 4976 OPA1 127.2112 NA Across cancer types including breast, CRC, stomach and lung cancers 64 6688 SPI1 126.1878 NA Across cancer types including hematopoietic (ALL, AML) cancers 65 4522 MTHFD1 125.2011 NA Across cancer types including breast, CRC, lung, hematopoietic (AML, ALL) and pancreatic cancers 66 6391 SDHC 123.664 Cosmic Across cancer types including breast cancer and CRC 67 598 BCL2L1 121.8786 NA Across cancer types 68 8031 NCOA4 121.4796 Cosmic Across cancer types including breast, CRC, endometrial and lung cancers 69 6015 RING1 121.3331 NA Across cancer types breast cancer and CRC 70 3028 HSD17B10 120.852 NA Across cancer types including CRC, stomach and Lung cancers 71 103 ADAR 119.9291 NA Across cancer types including breast, lung, esophageal, upper aerodigestive, pancreatic and skin cancers 72 22800 RRAS2 116.2203 NA Across cancer types 73 10972, TMED10, 115.4564 NA Across cancer types 286102 TMED10P1 including CNS, CRC, kidney, liver, ovarian and lung cancers 74 156 ADRBK1 115.115 NA Across cancer types including breast, CRC, lung, upper aerodigestive cancers 75 498 ATP5A1 114.2978 NA Across cancer types including CRC and lung cancers 76 7013 TERF1 114.0913 NA Across cancer types including uveal and skin melanoma 77 9361 LONP1 114.0681 NA Across cancer types including breast, CRC, lung, esophageal, ovarian and upper aerodigestive cancers 78 4780 NFE2L2 113.9851 Cosmic Across cancer types including lung, esophageal and kidney cancers 79 10979 FERMT2 113.6685 NA Across cancer types including breast, CNS, kidney, liver, lung, esophageal, ovarian and skin cancers 80 9948 WDR1 112.5945 NA Across cancer types including CNS, CRC, lung, esophageal, neuroblastoma and ovarian cancers
TABLE-US-00002 TABLE 2 List of 25 targets, molecular stratification and associated cancer types. Molecular NCBI Stratification Gene Gene Norm based on Potential Cancer No* ID Symbols LRT COSMIC DRIVE data types 5 4286 MITF 448.6566 COSMIC Hi MITF Across cancer types expression including skin, and uveal cancers 6 4602 MYB 428.5779 COSMIC Hi MYB Across cancer types expression including hematopoietic (ALL, AML), and CRC cancers 9 2313 FLI1 374.0815 COSMIC Hi FLI1 Across cancer types expression including hematopoietic (ALL, AML, MM, DLBCL), and Ewing's sarcoma 10 440 ASNS 364.8319 NA Unclear Across cancer types including breast, CRC, pancreatic, and skin cancers 11 7486 WRN 355.5048 COSMIC Microsatellite Across cancer types instable (MSI+) including CRC, cancers endometrial, and stomach cancers 12 6663 SOX10 332.1695 NA Hi SOX10 Across cancer types expression including melanoma (skin and uveal), and CNS cancers 13 5832 ALDH18A1 312.2923 NA Unclear Across cancer types including breast, lung, pancreatic, and skin cancers 14 3169 FOXA1 310.3314 COSMIC Hi FOXA1 Across cancer types expression including breast, and prostate cancers 15 6928 HNF1B 303.3582 NA Hi HNF1B Across cancer types expression including kidney and lung cancers 17 861 RUNX1 250.8642 COSMIC Hi RUNX1 Across cancer types expression including hematopoietic (ALL, AML) cancers 22 865 CBFB 214.1315 COSMIC Hi RUNX1 Across cancer types expression or hi including IKZF1 hematopoietic expression (ALL, AML) cancers 24 8626 TP63 208.5858 NA Hi TP63 Across cancer types expression including squamous cancers, including bladder, esophageal and upper aerodigestive 33 1017 CDK2 174.3597 NA Hi CCNE1 Across cancer types expression or including breast, amplification endometrial, lung, and ovarian cancers 34 27183 VPS4A 171.5517 NA Copy number Across cancer types deletion of including breast, VPS4B CRC, lung, stomach, pancreatic and upper areodigestive cancers 41 6925 TCF4 162.4801 NA Hi TCF4 Across cancer types expression including hematopoietic cancers and neuroblastoma 45 1050 CEBPA 153.4186 COSMIC Hi CEBPA Across cancer types expression including liver cancer and AML 47 2625 GATA3 150.1109 COSMIC Hi GATA3 Across cancer types expression including breast cancer and neuroblastoma 49 57492 ARID1B 144.0908 COSMIC ARID1A Across cancer types Mutation 51 8575 PRKRA 141.2148 NA Hi EIF2AK2 Across cancer types expression including breast, CRC, lung, pancreatic, skin and upper aerodigestive cancers 54 3312 HSPA8 137.9435 NA Low HSP1A1 Across cancer types expression including CRC and skin cancer 60 3662 IRF4 130.6215 COSMIC Hi IRF4 Across cancer types Expression including multiple myeloma 64 6688 SPI1 126.1878 NA Hi SPI1 Across cancer types expression including hematopoietic (ALL, AML) cancers 65 4522 MTHFD1 125.2011 NA Unclear Across cancer types including breast, CRC, lung, hematopoietic (AML, ALL), and pancreatic cancers 71 103 ADAR 119.9291 NA Interferon Across cancer types stimulated gene including breast, (ISG) signature lung, esophageal, positive upper aerodigestive, pancreatic and skin cancers 78 4780 NFE2L2 113.9851 COSMIC KEAP1 mutation Across cancer types or NFE2L2 including lung, mutation; high esophageal and SQSTM1 kidney cancers expression; NFE2L2 gene signature positive *Numbers corresponding to entry in Table 1 CRC = Colorectal Cancer; ALL = Acute Lymphocytic Leukemia; AML = Acute Myeloid Leukemia; DLBCL = Diffuse Large B-Cell Lymphoma; CNS = Central Nervous System; MM = MultipleMyeloma
[0139] In various aspects, the present disclosure provides a method for inhibiting proliferation of cancer cells in a subject, the method comprising the step of administering an inhibitor, e.g., an inhibitor of any of the targets disclosed in Tables 1 or 2, to a subject in need thereof, in an amount that is effective to inhibit proliferation of the cancer cells. In some embodiments, the cancer is a hematological cancer, solid tumor or any of the cancers disclosed in Tables 1 or 2. In some embodiments, the cancer is associated with microsatellite instability, gene amplifications, duplications, deletions or mutations. According to the present invention, an inhibitor is a therapeutic modality, including but not limited to, a low molecular weight compound, an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART). Additionally, according to the present invention, an agonist is a therapeutic modality, including but not limited to, a low molecular weight compound, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a peptide mimetic or an analog.
[0140] The present disclosure further provides an inhibitor, e.g., an inhibitor of any of the targets disclosed in Tables 1 or 2, such as low molecular weight compound, an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART), for use in the treatment of cancer, such as colon or endometrial cancer. Also provided is a use of an inhibitor, such as low molecular weight compound, an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART), for the manufacture of a medicament for treating cancer, such as colon or endometrial cancer.
[0141] In one embodiment, the present invention provides a method of treating cancer associated with any of the targets disclosed in Tables 1 or 2, by administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition comprising a molecule that reduces, e.g., inhibits the expression of a target, e.g., any of the targets disclosed in Tables 1 or 2, wherein said molecule is a low molecular weight compound.
[0142] The present disclosure further provides a low molecular weight compound for use in the treatment of cancer, e.g., any of the cancers disclosed in Tables 1 or 2. Also provided is a use of a low molecular weight compound for the manufacture of a medicament for treating cancer, e.g., any of the cancers disclosed in Tables 1 or 2.
[0143] In another embodiment, the present invention provides a method of treating cancer, e.g., any of the cancers disclosed in Tables 1 or 2, by administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition comprising a molecule that inhibits the normal cellular function of the target protein, e.g., any of the inhibitors disclosed herein.
[0144] The present disclosure further provides a molecule that inhibits a normal cellular function of a target, e.g., a target protein for use in the treatment of cancer, such any of the cancers disclosed in Tables 1 or 2 Also provided is a use of a molecule that inhibits a normal cellular function of a target, e.g., a target protein for the manufacture of a medicament for treating cancer, such as any of the cancers disclosed in Tables 1 or 2.
[0145] In another embodiment, the present invention provides a method of treating cancer associated with microsatellite instability, gene amplifications, duplications, deletions or mutations, such any of the cancers disclosed in Tables 1 or 2, by administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition comprising a molecule which inhibits the expression of a target, e.g., any of the targets disclosed in Tables 1 or 2, including, but not limited to, a low molecular weight compound, an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART). Examples of such inhibitors are described herein.
[0146] In another embodiment, a molecule is disclosed which inhibits the expression of a target, e.g., any of the targets disclosed in Tables 1 or 2 for use in the treatment of cancer, such as any of the cancers disclosed in Tables 1 or 2. Such molecule includes, but is not limited to, a low molecular weight compound, an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART). Examples of such inhibitors are described herein.
[0147] In another embodiment, the present invention provides a method of treating cancer associated with microsatellite instability, gene amplifications, duplications, deletions or mutations, such as any of the cancers disclosed in Tables 1 or 2, by administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition comprising an inhibitor that inhibits the expression of a target, e.g., any of the target disclosed in Tables 1 or 2, wherein the inhibitor includes, but not limited to, a low molecular weight compound, an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART). Examples of such antibodies or antibody derivatives are described herein.
[0148] The present disclosure further provides an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART) for use in the treatment of cancer, such as any of the cancers disclosed in Tables 1 or 2. Also provided is a use of an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART) for the manufacture of a medicament for treating cancer, such as any of the cancers disclosed in Tables 1 or 2.
Description of Targets and Exemplary Inhibitors
MITF
[0149] The term MITF as used herein refers to the gene or protein of Microphthalmia-associated transcription factor. The term MITF includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type MITF. In one embodiment, the protein is encoded by the MITF gene (Gene ID: 4286; Ensembl ID ENSG00000187098). Exemplary MITF sequences are available at the Uniprot database under the accession number 075030. MITF is a transcription factor involved in melanocyte cell development, and neoplasia (Cronin, Julia C. et al. Pigment cell & melanoma research 22.4 (2009): 435-444. PMC. Web. 30 Jun. 2017).
[0150] In some embodiments, the MITF inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0151] In some embodiments the MITF inhibitor is ML329, e.g., as disclosed in Faloon P W et al., 2012 Dec. 13, In: Probe Reports from the NIH Molecular Libraries Program [Internet]. ML329 is a MITF inhibitor with an IC50 of 1.2 M. ML329 has the chemical name: 4-((1,4-dioxo-1,4-dihydronaphthalen-2-yl)amino)benzenesulfonamide, and has the following structure:
##STR00001##
[0152] In some embodiments, the MITF inhibitor is PIAS3 (protein inhibitor of activated STAT3) or an agonist for PIAS3 as disclosed in Levy C et al., Blood 2006 107:2839-2845. PIAS3 is an E3-type small ubiquitin-like modifier (SUMO) ligase.
MYB
[0153] The term MYB as used herein refers to the Myeloblastosis proto-oncogene gene or protein which is also known as c-Myb. The term MYB includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type MYB. In one embodiment, the protein is encoded by the MYB gene (Gene ID: 4602; Ensembl ID ENSG00000118513). Exemplary MYB sequences are available at the Uniprot database under the accession number P10242. MYB is a transcription factor involved in hematopoiesis and regulates the expression of genes involved in lineage determination, cell proliferation and differentiation. MYB has also been implicated in the development of leukemia (Uttarkar S. et al., 2016, Blood 3; 127(9):1173-82).
[0154] In some embodiments, the MYB inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0155] In one embodiment, the MYB inhibitor is Celastrol, e.g., as disclosed in Uttarkar S. et al., 2016, Blood 3; 127(9):1173-82. Celastrol is a triterpenoid and is also known as Tripterine. Celastrol has the chemical name 3-Hydroxy-98,13a-dimethyl-2-oxo-24,25,26-trinoroleana-1(10),3,5,7-tetraen-29-oic acid, and the following chemical structure:
##STR00002##
[0156] In one embodiment, the MYB inhibitor is Mexicanin-I, e.g., as disclosed in Bujnicki T. et al., (2012) Leukemia 26, 615-622. Mexicanin-I is a sesquiterpene lactone. Mexicanin-I has the chemical name: (3as,4r,4ar,7ar,8r,9as)-4-hydroxy-4a,8-dimethyl-3-methylidene-3,3a,4,4a,7a,8,9,9a-octahydroazuleno[6,5-b]furan-2,5-dione, and the following chemical structure:
##STR00003##
FLI1
[0157] The term FLI1 as used herein refers to the gene or protein of Friend leukemia integration 1 transcription factor. FLI1 is also known as ERGB. The term FLI1 includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type FLI1. In one embodiment, the protein is encoded by the FLI1 gene (Gene ID: 2313; Ensembl ID ENSG00000151702). Exemplary FLI1 sequences are available at the Uniprot database under the accession number Q01543. FLI1 is a transcription factor which is a member of the ETS transcription factor family (Truong A H L and Ben-David Y, (2000) Oncogene 19, 6482-6489).
[0158] In some embodiments, the FLI1 inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0159] In one embodiment the FLI1 inhibitor is TK-216. TK-216 is a clinical derivative of YK-4-279 with an IC50 of 449 nM. TK-216 has the chemical name: 4,7-dichloro-1,3-dihydro-3-hydroxy-3-[2-(4-methoxyphenyl)-2-oxoethyl]-(3R)-2H-indol-2-one and has the following chemical structure:
##STR00004##
[0160] In one embodiment, the FLI1 inhibitor is Mithramycin, e.g., as disclosed in Grohar P J et al., (2011) J. National Cancer Institute 102(12):962-78. Mithramycin is an RNA synthesis inhibitor and an anti-neoplastic antibiotic. Mithramycin has the chemical name: (1S)-5-deoxy-1-C-((2S,3S)-7-{[2,6-dideoxy-3--(2,6-dideoxy--D-arabino-hexopyranosyl)--D-arabino-hexopyranosyl]oxy}-3-{[2,6-dideoxy-3-C-methyl--D-ribo-hexopyranosyl-(1.fwdarw.3)-2,6-dideoxy--D-arabino-hexopyranosyl-(1.fwdarw.3)-2,6-dideoxy--D-arabino-hexopyranosyl]oxy}-5,10-dihydroxy-6-methyl-4-oxo-1,2,3,4-tetrahydroanthracen-2-yl)-1-O-methyl-D-xylulose, and the following chemical structure:
##STR00005##
[0161] In one embodiment, the FLI1 inhibitor is EC-8105, e.g., as disclosed in Osgood C L et al., (2016) Clinical Cancer Research 22(16) 4105-18. EC-8105 is a second-generation Mithramycin analogue. In one embodiment, the FLI1 inhibitor is EC-8042, e.g., as disclosed in Osgood C L et al., (2016) Clinical Cancer Research 22(16) 4105-18. EC-8042 is a second-generation Mithramycin analogue.
ASNS
[0162] The term ASNS as used herein refers to the gene or protein of Asparagine synthetase. The term ASNS includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type ASNS. In one embodiment, the protein is encoded by the ASNS gene (Gene ID: 440; Ensembl ID ENSG00000070669). Exemplary ASNS sequences are available at the Uniprot database under the accession number P08243. ASNS is an enzyme involved in the synthesis of L-asparagine from L-aspartate (Zhang Y, (1989) Genomics 4:259-265).
[0163] In some embodiments, the ASNS inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0164] In one embodiment, the ASNS inhibitor is adenylated sulfoximine 1, e.g., as disclosed in Gutierrez J A et. al., (2006) 13(12): 1339-1347. Adenylated sulfoximine 1 is a mixture of diastereoisomers, e.g., diastereoisomers 1a and 1b shown below. Adenylated sulfoximine has the following chemical structures:
##STR00006##
[0165] In some embodiments, the ASNS inhibitor adenylated sulfoximine 1 is L-methionine sulfoximine. L-methionine sulfoximine has the following chemical structure:
##STR00007##
[0166] In some embodiments, the ASNS agonist is chosen from a low molecular weight compound, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, a peptide mimetic or an analog of ASNS. Exemplary ASNS agonists are described in U.S. Pat. No. 6,040,163, which is hereby incorporated by reference in its entirety.
SOX10
[0167] The term SOX10 as used herein refers to the gene or protein of SRY Box 10. The term SOX10 includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type SOX10. In one embodiment, the protein is encoded by the SOX10 gene, e.g., as disclosed in Pusch C et al., (1998) Human Genetics 103:115-123. SOX10 gene can be identified by the following designations: Gene ID: 6663; Ensembl ID ENSG00000100146. Exemplary SOX10 sequences are available at the Uniprot database under the accession number P56693. SOX10 is a transcription factor which is a member of the SOX (SRY-related HMG-box) family of transcription factors involved in embryonic development and cell fate determination.
[0168] In some embodiments, the SOX10 inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0169] In one embodiment, the SOX10 inhibitor is an RNAi agent, e.g., as disclosed in Graf S A et al., (2014) Journal of Investigative Dermatology 134(8):2212-20. In some embodiments, the RNAi agent is an siRNA with the sequence of: CCGUAUGCAGCACAAGAAA (SEQ ID NO:1). In some embodiments, the RNAi agent is an siRNA with the sequence of: GUAUGCAGCACAAGAAAGA (SEQ ID NO:2). In another embodiment, the SOX10 inhibitor is an RNAi agent, e.g., as disclosed in Tong X et al., (2014) Oncotarget 5(21):10571-10583.
ALDH18A1
[0170] The term ALDH18A1 as used herein refers to the gene or protein of aldehyde dehydrogenase 18 family member A1. ALDH18A1 is also known as PSCS. The term ALDH18A1 includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type ALDH18A1. In one embodiment, the protein is encoded by the ALDH18A1 gene (Gene ID: 5832; Ensembl ID ENSG00000059573). Exemplary ALDH18A1sequences are available at the Uniprot database under the accession number P54886. ALDH18A1 is a bi-functional ATP- and NADPH-dependent mitochondrial enzyme (Panza E et al., (2016) Brain 139:e3).
[0171] In some embodiments, the ALDH18A1 inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0172] In one embodiment, the ALDH18A1 inhibitor is an RNAi as disclosed in Kardos G R et al., 2015, Molecular Cancer Research (10)1408-20, hereby incorporated by reference in its entirety.
[0173] In some embodiments, the ALDH18A1 agonist is chosen from a low molecular weight compound, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, a peptide mimetic, or an analog of ALDH18A1.
FOXA1
[0174] The term FOXA1 as used herein refers to the gene or protein of Forkhead box A1. FOXA1 is also known as HNF3A. The term FOXA1 includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type FOXA1. In one embodiment, the protein is encoded by the FOXA1 gene, e.g., as disclosed in Bingle and Gowan (1996) Biochim. Biophys. Acta 1307: 17-20. FOXA1 gene can be identified by the following designations: Gene ID: 3169; Ensembl ID ENSG00000129514. Exemplary FOXA1 sequences are available at the Uniprot database under the accession number P55317. FOXA1 is a transcription factor which is a member of the forkhead class of DNA binding proteins.
[0175] In some embodiments, the FOXA1 inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0176] In one embodiment, the FOXA1 inhibitor is a kinase inhibitor, e.g., as disclosed in Sunkel B et al., (2016) Nucleic Acids Research 44(9): 4105-4122. In one embodiment, the FOXA1 inhibitor is chosen from H89, MK-2206 or U0126, e.g., as disclosed in Sunkel B et al., (2016) Nucleic Acids Research 44(9): 4105-4122. In one embodiment, the FOXA1 inhibitor is H89. H89 is a Protein Kinase A inhibitor with the chemical name: N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide, and the following chemical structure:
##STR00008##
[0177] In one embodiment, the FOXA1 inhibitor is MK-2206. MK-2206 is an orally active, allosteric Akt inhibitor that is equally potent toward purified human recombinant Akt1 and Akt2 (IC50s=5 and 12 nM, respectively) and approximately 5-fold less potent against human Akt3 (IC50=65 nM). MK-2206 has the chemical name: 8-[4-(1-aminocyclobutyl)phenyl]-9-phenyl-1,2,4-triazolo[3,4-f][1,6]naphthyridin-3(2H)-one, dihydrochloride, and has the following chemical structure:
##STR00009##
[0178] In one embodiment, the FOXA1 inhibitor is U0126. U0126 is a selective non-competitive inhibitor of MAP kinase kinase, e.g., MEK-1 and MEK-2. U0126 has the chemical name: 1,4-Diamino-2,3-dicyano-1,4-bis[2-aminophenylthio]butadiene, and the following chemical structure:
##STR00010##
[0179] In one embodiment, the FOXA1 inhibitor is a kinase inhibitor, e.g., as disclosed in Johnston S J et al., In: Proceedings of the 107th Annual Meeting of the AACR; Cancer Res 2016; 76(14 Suppl):Abstract nr 2906.
HNF1B
[0180] The term HNF1B as used herein refers to the gene or protein of Hepatocyte nuclear factor 1 Homeobox B. HNF1B is also known as TCF2. The term HNF1B includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type HNF1B. In one embodiment, the protein is encoded by the HNF1B gene, e.g., as disclosed in Bach I et al., (1991) Nucleic Acids Research 19:3553-3559. HNF1B gene can be identified by the following designations: Gene ID: 6928; Ensembl ID ENSG00000275410. Exemplary HNF1B sequences are available at the Uniprot database under the accession number P35680. HNF1B is a transcription factor which is a member of the homeobox-containing superfamily of transcription factors.
[0181] In some embodiments, the HNF1B inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0182] In one embodiment, the HNF1B inhibitor is a Calcineurin inhibitor, e.g., as disclosed in Faguer S et al., (2016) Transplantation 100(9):1970-8. Calcineurin inhibitors include Tacrolimus and cyclosporine. In embodiments, the HNF1B inhibitor is Tacrolimus. Tacrolimus, also known as FK-506, has the chemical name: 3S[3R*[E(1S*,3S*,4S*)]4S*,5R*,8S*,9E,12R*,14R*,15S*,16R*,18S*,19S*,26aR*-19-dihydroxy-3-[2-(4-hydroxy-3-methoxycyclohexyl)-1-methylethenyl]-14,16-dimethoxy-4,10,12,18-tetramethyl-8-(2-propenyl)-15,19-epoxy-3H-pyrido[2,1-c][1,4] oxaazacyclotricosine-1,7,20,21(4H,23H)-tetrone, monohydrate, and the following chemical structure:
##STR00011##
[0183] In some embodiments, the HNF1B inhibitor is Cyclosporine. Cyclosporine has the chemical name: (3S,6S,9S,12R,15S,18S,21S,24S,30S,33S)-30-Ethyl-33-[(1R,2R,4E)-1-hydroxy-2-methyl-4-hexen-1-yl]-6,9,18,24-tetraisobutyl-3,21-diisopropyl-1,4,7,10,12,15,19,25,28-nonamethyl-1,4,7,10,13,16,19,22,25,28,31-undecaazacyclotritriacontane-2,5,8,11,14,17,20,23,26,29,32-undecone, and the following chemical structure:
##STR00012##
RUNX1
[0184] The term RUNX1 as used herein refers to the gene or protein of Runt related transcription factor 1. RUNX1 is also known as AML1, PEBP2 or CBFA2. The term RUNX1 includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type RUNX1. In one embodiment, the protein is encoded by the RUNX1 gene, e.g., as disclosed in Miyoshi H, et al., (1995) Nucleic Acids Research 23:2762-2769. RUNX1 gene can be identified by the following designations: Gene ID: 861; Ensembl ID ENSG00000159216. Exemplary RUNX1 sequences are available at the Uniprot database under the accession number Q01196. RUNX1 is a Runt-related transcription factor which is a member of the RUNX gene family. RUNX1 has a role in the development of hematopoietic cells. RUNX1 forms a heterodimeric complex with Core Binding Factor beta (CBFB).
[0185] In some embodiments, the RUNX1 inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0186] In one embodiment, the RUNX1 inhibitor is a CBFB inhibitor. In some embodiments, CBFB inhibitor is a small molecule that binds to CBFbeta and prevents its association with Runx1 (IC50=3.2 M). CBFB inhibitor has the chemical name: 5-ethyl-4-(4-methoxyphenyl)-2-thiazolamine, and the following chemical structure:
##STR00013##
[0187] In one embodiment, the RUNX1 inhibitor is Ro5-3335, e.g., as disclosed in Cunningham L et al., (2012) PNAS 109(36): 14592-14597. Ro5-3335 is a benzodiazepine and is a CBFB inhibitor. Ro5-3335 is a CBFB inhibitor with an IC50 of 1.1 uM. Ro5-3335 has the chemical name: 7-Chloro-1,3-dihydro-5-(1H-pyrrol-2-yl)-2H-1,4-benzodiazepin-2-one, and the following chemical structure:
##STR00014##
[0188] In one embodiment, the RUNX1 inhibitor is a CBFB inhibitor as disclosed in Illendula, Anuradha et al., EBioMedicine 8 (2016): 117-131. PMC. Web. 5 Jul. 2017. In some embodiments, the CBFB inhibitor is Al-4-57 which has an IC50 of 34.4 um. Al-4-57 has the chemical name: 5-Methoxy-2-pyridin-2-yl-1H-benzoimidazole Hydrochloride, and has the following chemical structure.
##STR00015##
[0189] In other embodiments, the CBFB inhibitor is Al-10-104 which has an IC50 of 1.25 um. Al-10-104 has the following chemical structure.
##STR00016##
CBFB
[0190] The term CBFB as used herein refers to the gene or protein of Core Binding Factor subunit Beta. CBFB is also known as PEBP2B. The term CBFB includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type CBFB. In one embodiment, the protein is encoded by the CBFB gene, e.g., as disclosed in Liu P, et al., (1993) Science 261: 1041-1044. CBFB gene can be identified by the following designations: Gene ID: 865; Ensembl ID ENSG00000067955. Exemplary CBFB sequences are available at the Uniprot database under accession numbers Q13951. CBFB protein is the beta subunit of a heterodimeric core-binding transcription factor (CBF). The CBF complex comprises a beta subunit, and an alpha subunit, e.g., RUNX1, RUNX2 or RUNX3.
[0191] In some embodiments, the CBFB inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0192] In one embodiment, the CBFB inhibitor is a small molecule that binds to CBFB and prevents its association with Runx1 (1050=3.2 M). In some embodiments, the CBFB inhibitor has the chemical name: 5-ethyl-4-(4-methoxyphenyl)-2-thiazolamine, and the following chemical structure:
##STR00017##
[0193] In one embodiment, the CBFB inhibitor is Ro5-3335, e.g., as disclosed in Cunningham L et al., (2012) PNAS 109(36): 14592-14597. Ro5-3335 is a benzodiazepine and is a CBFB inhibitor. Ro5-3335 is a CBFB inhibitor with an IC50 of 1.1 uM. Ro5-3335 has the chemical name: 7-Chloro-1,3-dihydro-5-(1H-pyrrol-2-yl)-2H-1,4-benzodiazepin-2-one, and the following chemical structure:
##STR00018##
[0194] In one embodiment, the CBFB inhibitor is a CBFB inhibitor as disclosed in Illendula, Anuradha et al., EBioMedicine 8 (2016): 117-131. PMC. Web. 5 Jul. 2017. In some embodiments, the CBFB inhibitor is Al-4-57 which has an IC50 of 34.4 um. Al-4-57 has the chemical name: 5-Methoxy-2-pyridin-2-yl-1H-benzoimidazole Hydrochloride, and has the following chemical structure.
##STR00019##
[0195] In other embodiments, the CBFB inhibitor is Al-10-104 which has an IC50 of 1.25 um. Al-10-104 has the following chemical structure.
##STR00020##
TP63
[0196] The term TP63 as used herein refers to the gene or protein of Tumor protein 63. TP63 is also known as NBP, and p63. The term TP63 includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type TP63. In one embodiment, the protein is encoded by the TP63 gene, e.g., as disclosed in Di lorio, et al., (2005) PNAS 102: 9523-9528. TP63 gene can be identified by the following designations: Gene ID: 8626; Ensembl ID ENSG00000073282. Exemplary TP63 sequences are available at the Uniprot database under accession numbers Q9H3D4. TP63 is a transcription factor which is a member of the p53 gene family based on structural similarity.
[0197] In some embodiments, the TP63 inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART). In one embodiment, the TP63 inhibitor is an RNAi agent, e.g., a shRNA or siRNA oligonucleotide, which reduces the expression of TP63. Exemplary oligonucleotides are disclosed in U.S. Pat. No. 8,962,585, the entire contents of which are hereby incorporated by reference.
CDK2
[0198] The term CDK2 as used herein refers to the gene or protein of Cyclin dependent kinase 2. CDK2 is also known as cell division kinase 2. The term CDK2 includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type CDK2. The CDK2 protein is encoded by the CDK2 gene which can be identified by the following designations: Gene ID: 1017; Ensembl ID ENSG00000123374. Exemplary CDK2 sequences are available at the Uniprot database under accession numbers P24941. CDK2 is an enzyme and is a member of the cyclin-dependent kinase family of serine threonine kinases.
[0199] In some embodiments, the CDK2 inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0200] In one embodiment, the CDK2 inhibitor is a CDK2 inhibitor disclosed in, e.g., Lapenna and Giordano (2009) Nature Reviews Drug Discovery 8, 547-566. In embodiments, the CDK2 inhibitor is chosen from AG-024322, AT7519, Flavopiridol, R547, SCH 727965, SNS-032 or ZK 304709.
[0201] In one embodiment, the CDK2 inhibitor is AG-024322. AG-024322 is a second generation CKD inhibitor and has Ki of 1-3 Nm. AG-024322 has the chemical name: N-((5-(3-(4,6-difluoro-1H-benzo[d]imidazol-2-yl)-1H-indazol-4-yl)-4-methylpyridin-3-yl)methyl)ethanamine and has the following chemical structure.
##STR00021##
[0202] In one embodiment, the CDK2 inhibitor is AT7519. AT7519 is a multi-CDK inhibitor with an IC50 of 10-210 nm. AT7519 has the chemical name: 4-[(2,6-Dichlorobenzoyhamino]-N-(4-piperidinyl)-1H-pyrazole-3-carboxamide and has the following chemical structure.
##STR00022##
[0203] In one embodiment, the CDK2 inhibitor is Flavopiridol. Flavopiridol is a multi-CDK inhibitor with an IC50 of 40 nM and is also known as HMR-1275 or Alvocidib. Flavopiridol has the chemical name: 2-(2-chlorophenyl)-5,7-dihydroxy-8-[(3S,4R)-3-hydroxy-1-methyl-4-piperidinyl]-4-chromenone and has the following chemical structure.
##STR00023##
VPS4A
[0204] The term VPS4A as used herein refers to the gene or protein of vacuolar protein sorting 4 homolog A. VPS4A is also known as SKD1A, or VPS4. The term VPS4A includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type VPS4A. The VPS4A protein is encoded by the VPS4A gene, e.g., as disclosed in Bishop N et al., (2003) Gene 305: 47-59. VPS4A can be identified by the following designations: Gene ID: 27183; Ensembl ID ENSG00000132612. Exemplary VPS4A sequences are available at the Uniprot database under accession numbers Q9UN37. VPS4A associates with endosomal compartments and is involved in intracellular protein trafficking.
[0205] In some embodiments, the VPS4A inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0206] In one embodiment, the VPS4A inhibitor is a dominant negative VPS4A, e.g., as disclosed in Watanabe and Lamb (2010) Virus Research 153(1): 58-63. In some embodiments, the dominant negative VPS4A comprises a mutation in amino acid residue E228 to Q.
TCF4
[0207] The term TCF4 as used herein refers to the gene or protein of transcription factor 4. TCF4 is also known as ITF2 or bHLHb19. The term TCF4 includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type TCF4. The TCF4 protein is encoded by the TCF4 gene, e.g., as disclosed in Henthorn P et al., (1990) Science 247: 467-470. TCF4 can be identified by the following designations: Gene ID: 6925; Ensembl ID ENSG00000196628. Exemplary TCF4 sequences are available at the Uniprot database under accession numbers P15884. TCF4 is a basic helix-loop-helix transcription factor which functions as a homodimer or heterodimer and binds to E-box motifs on DNA. In some embodiments, the TCF4 inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
CEBPA
[0208] The term CEBPA as used herein refers to the gene or protein of CCAAT/enhancer binding protein alpha. CEBPA is also known as CEBP. The term CEBPA includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type CEBPA. The CEBPA protein is encoded by the CEBPA gene, e.g., as disclosed in Swart G W M et al., (1997) Biol. Chemistry 378: 373-379. CEBPA can be identified by the following designations: Gene ID: 1050; Ensembl ID ENSG00000245848. Exemplary CEBPA sequences are available at the Uniprot database under accession numbers P49715. CEBPA is a bZIP transcription factor involved in the differentiation of hematopoietic cells.
[0209] In some embodiments, the CEBPA inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
GATA3
[0210] The term GATA3 as used herein refers to the gene or protein of GATA-3. The term GATA3 includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type GATA3. The GATA3 protein is encoded by the GATA3 gene, e.g., as disclosed in Labastie M et al., (1994) Genomics 21: 1-6. GATA3 can be identified by the following designations: Gene ID: 2625; Ensembl ID ENSG00000107485. Exemplary GATA3 sequences are available at the Uniprot database under accession numbers P23771. GATA3 is a transcription factor that belongs to the GATA family of transcription factors which bind to the DNA sequence GATA.
[0211] In some embodiments, the GATA3 inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0212] In one embodiment, the GATA3 inhibitor is a glucocorticoid, e.g., dexamethasone, e.g., as disclosed in Liberman AC (2009) FASEB Journal 23(5): 1558-71. In some embodiments, the GATA3 inhibitor is dexamethasone. Dexamethasone is a steroid with an IC50 OF 10 nm. Dexamethasone has the chemical name: (8S,9R,10S,11S,13S,14S,16R,17R)-9-Fluoro-11,17-dihydroxy-17-(2-hydroxyacetyl)-10,13,16-trimethyl-6,7,8,9,10,11,12,13,14,15,16,17-dodecahydro-3H-cyclopenta[a]phenanthren-3-one and the following chemical structure:
##STR00024##
[0213] In one embodiment, the GATA3 inhibitor is an RNAi agent, e.g., a short interfering nucleic acid (siNA). Exemplary siNAs are disclosed in WO 2010/107957, hereby incorporated by reference in its entirety.
ARID1B
[0214] The term ARID1B as used herein refers to the gene or protein of AT rich interaction domain 1B. The term ARID1B includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type ARID1B. The ARID1B protein is encoded by the ARID1B gene, and can be identified by the following designations: Gene ID: 57492; Ensembl ID ENSG00000049618. Exemplary ARID1B sequences are available at the Uniprot database under accession numbers Q8NFD5. ARID1B is a component of the SWI/SNF chromatin remodeling complex.
[0215] In some embodiments, the ARID1B inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
PRKRA
[0216] The term PRKRA as used herein refers to the gene or protein of Protein kinase, interferon-inducible double stranded RNA dependent activator. PRKRA is also known as PACT or RAX. The term PRKRA includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type PRKRA. The PRKRA protein is encoded by the PRKRA gene, e.g., as disclosed in Paten and Sen (1998) EMBO 17: 4379-4390. The PRKRA gene can be identified by the following designations: Gene ID: 8575; Ensembl ID ENSG00000180228. Exemplary PRKRA sequences are available at the Uniprot database under accession number 075569. EIF2AK2 or protein kinase R (PKR) is a protein kinase which is activated by double-stranded RNA. PRKRA heterodimerizes with protein kinase R and activates it.
[0217] In some embodiments, the PRKRA inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
HSPA8
[0218] The term HSPA8 as used herein refers to the gene or protein of heat-shock 70 kD protein 8. The term HSPA8 includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type HSPA8. The HSPA9 protein is encoded by the HSPA9 gene, e.g., as disclosed in Dworniczak B et al., (1987) Nucleic Acids Research 15:5181-5197. The HSPA8 gene can be identified by the following designations: Gene ID: 3312; Ensembl ID ENSG00000109971. Exemplary HSPA8 sequences are available at the Uniprot database under accession number P11142. HSPA8 is a heat shock protein which is a member of the heat shock protein 70 family and has a role as a chaperone protein.
[0219] In some embodiments, the HSPA8 inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0220] In one embodiment, the HSPA8 inhibitor is VER 15508, e.g., as disclosed in Schlecht R et al., (2013) PlosOne 0078443. VER 15508 is an adenosine-derived inhibitor and has the chemical name: 5-O-[(4-Cyanophenyl)methyl]-8-[[(3,4-dichlorophenyhmethyl]amino]-adenosine. VER 15508 has the following chemical structure:
##STR00025##
[0221] In one embodiment, the HSPA8 inhibitor is Deoxyspergualin (DSG), e.g., as disclosed in Jose-Eneriz et al., (2008) British Journal of Hematology 142(4) 571-582. DSG is also known as Gusperimus and is an immunosuppressive agent. DSG has the chemical name: N-[2-[4-(3-Aminopropylamino)butylamino]-1-hydroxy-2-oxoethyl]-7-(diaminomethylideneamino)heptanamide and has the following chemical structure:
##STR00026##
IRF4
[0222] The term IRF4 as used herein refers to the gene or protein of Interferon regulatory factor 4. IRF4 is also known as MUM 1. The term IRF4 includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type IRF4. The IRF4 protein is encoded by the IRF4 gene, e.g., as disclosed in Grossman A et al., (1996) Genomics 37: 229-233. The IRF4 gene can be identified by the following designations: Gene ID: 3662; Ensembl ID ENSG00000137265. Exemplary IRF4 sequences are available at the Uniprot database under accession number q15306. IRF4 is a transcription factor that is associated with pigmentation.
[0223] In some embodiments, the IRF4 inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0224] In one embodiment, the IRF4 inhibitor is 10-E-09, e.g., as disclosed in Vatolin S et al., (2012) Plos One 0044690.
[0225] SPI1 The term SPI1 as used herein refers to the SPI1 gene or protein of transcription factor PU.1. The term SPI1 includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type SPI1. The PU.1 protein is encoded by the SPI1 gene, e.g., as disclosed in Ray D (1990) Oncogene 5: 663-667. The SPI1 gene can be identified by the following designations: Gene ID: 6688; Ensembl ID ENSG00000066336. Exemplary SPI1 amino acid sequences are available at the Uniprot database under accession number P17947. PU.1 is an ETS-domain transcription factor that binds to purine-rich sequences on DNA known as PU box.
[0226] In some embodiments, the SPI1 inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0227] In an embodiment, the SPI1 inhibitor is a furan-bisbenzimidazole-diamidine, e.g., as disclosed in Stephens D C et al., (2016) Nucleic Acids Research 44(9) 4005-4013. In some embodiments, the furan-bisbenzimidazole-diamidine SPI1 inhibitor is DB270. DB270 has the following chemical structure:
##STR00027##
[0228] In some embodiments, the furan-bisbenzimidazole-diamidine SPI1 inhibitor is DB1976. DB1976 has the following chemical structure:
##STR00028##
MTHFD1
[0229] The term MTHFD1 as used herein refers to the gene MTHFD1 or protein of methylenetetrahydrofolate dehydrogenase 1. The term MTHFD1 includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type MTHFD1. The MTHFD1 encodes for the C-1-tetrahydrofolate synthase, cytoplasmic protein (C1-THF synthase). The C1-THF protein is encoded by the MTHFD1 gene, e.g., as disclosed in Hum et al., (1998) JBC 263: 15946-15950. The MTHFD1 gene can be identified by the following designations: Gene ID: 4522; Ensembl ID ENSG00000100714. Exemplary MTHFD1 sequences are available at the Uniprot database under accession number P11586. MTHFD1 encodes for the tri-functional C1-THF enzyme.
[0230] In some embodiments, the MTHFD1 inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0231] In some embodiments, the MTHFD1 agonist is chosen from a low molecular weight compound, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, a peptide mimetic, or an analog of MTHFD1.
ADAR
[0232] The term ADAR as used herein refers to the gene or protein of double stranded RNA specific adenosine deaminase. ADAR is also known as ADAR1. The term ADAR includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type ADAR. The ADAR protein is encoded by the ADAR gene, e.g., as disclosed in Kim U et al., (1994) PNAS 91: 11457-11461. The ADAR gene can be identified by the following designations: Gene ID: 103; Ensembl ID ENSG00000160710. Exemplary ADAR sequences are available at the Uniprot database under accession number P55265. ADAR is an adenosine deaminase specific for RNA which binds to dsRNA and converts adenosine to inosine by deamination.
[0233] In some embodiments, the ADAR inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0234] In one embodiment, the ADAR inhibitor is O-phenanthroline, e.g., as disclosed in Kim et al., (1994) JBC 13480-13489. O-phenanthroline has the chemical name 1,10-Phenanthroline, and has the following chemical structure:
##STR00029##
[0235] In one embodiment, the ADAR inhibitor is ADAR3, e.g., as disclosed in Samuel C E (2011) Virology 411(2), 180-193.
NFE2L2
[0236] The term NFE2L2 as used herein refers to the gene or protein of nuclear factor, erythroid 2 like 2. NFE2L2 is also known as NRF2. The term NFE2L2 includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type NFE2L2. The NFE2L2 protein is encoded by the NFE2L2 gene, e.g., as disclosed in Moi et al., (1994) PNAS 91: 9926-9930. The NFE2L2 gene can be identified by the following designations: Gene ID: 4780; Ensembl ID ENSG00000116044. Exemplary NFE2L2 sequences are available at the Uniprot database under accession number Q16236. NFE2L2 is a basic leucine zipper (bZIP) transcription factor that is involved in the regulation of expression of antioxidant proteins that protect against oxidative damage.
[0237] In some embodiments, the NFE2L2 inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0238] In one embodiment, the NFE2L2 inhibitor is a NRF2 inhibitor disclosed in Tong et al., (2015) Chronic Diseases and Translational Medicine 1(13): 175-186. In some embodiments, the NFE2L2 inhibitor is chosen from Brusatol, Luteolin or Trigonelline. Brusatol has the chemical name: (118,12a,158)-13,20-Epoxy-3,11,12-trihydroxy-15-[(3-methyl-1-oxo-2-buten-1-yl)oxy]-2,16-dioxo-picras-3-en-21-oic acid methyl ester and has the following chemical structure:
##STR00030##
[0239] In one embodiment, the NFE2L2 inhibitor is Luteolin. Luteolin is a flavone, has the chemical name: 2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-4-chromenone and has the following chemical structure:
##STR00031##
[0240] In one embodiment, the NFE2L2 inhibitor is Trigenolline. Trigenolline has the chemical name: 1-Methylpyridinium-3-carboxylate and the following chemical structure:
##STR00032##
WRN
[0241] The term WRN as used herein refers to the gene or protein of Werner Syndrome RecQ DNA helicase. The term WRN includes mutants, fragments, variants, isoforms, and homologs of full-length wild-type WRN. In one embodiment, the protein is encoded by the WRN gene (Entrez gene ID 7486; Ensembl ID ENSG00000165392). Exemplary WRN sequences are available at the Uniprot database under accession number Q14191.
[0242] In some embodiments, the WRN inhibitor is chosen from: an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, a small molecule, an mRNA, a miRNA, an antibody or derivative thereof, or a chimeric antigen receptor T cell (CART).
[0243] In some embodiment, the WRN inhibitor is a Helicase Inhibitor, e.g. ML-216; Chemical Name, 1-[4-Fluoro-3-(trifluoromethyl)phenyl]-3-(5-pyridin-4-yl-1,3,4-thiadiazol-2-yl)urea; CAS 1430213-30-1.
RNAi Agents
[0244] As used herein, the term RNAi agent, RNAi agent to a target, siRNA to a target, target siRNA and the like refer to an siRNA (short inhibitory RNA), shRNA (short or small hairpin RNA), iRNA (interference RNA) agent, RNAi (RNA interference) agent, dsRNA (double-stranded RNA), microRNA, and the like, which specifically binds to the target gene, e.g., a gene of any of the targets disclosed in Tables 1 or 2, and which mediates the targeted cleavage of another RNA transcript via an RNA-induced silencing complex (RISC) pathway. In one embodiment, the RNAi agent is an oligonucleotide composition that activates the RISC complex/pathway. In another embodiment, the RNAi agent comprises an antisense strand sequence (antisense oligonucleotide). In one embodiment, the RNAi comprises a single strand. This single-stranded RNAi agent oligonucleotide or polynucleotide can comprise the sense or antisense strand, as described by Sioud 2005 J. Mol. Bioi. 348:1079-1090, and references therein. Thus the disclosure encompasses RNAi agents with a single strand comprising either the sense or antisense strand of an RNAi agent described herein. The use of the RNAi agent to a target results in a decrease of target activity, level and/or expression, e.g., a knock-down or knock-out of the target gene or target sequence.
[0245] RNA interference is a post-transcriptional, targeted gene-silencing technique that, usually, uses double-stranded RNA (dsRNA) to degrade messenger RNA (mRNA) containing the same sequence as the dsRNA. The process of RNAi occurs naturally when ribonuclease III (Dicer) cleaves longer dsRNA into shorter fragments called siRNAs. Naturally-occurring siRNAs (small interfering RNAs) are typically about 21 to 23 nucleotides long and comprise about 19 base pair duplexes. The smaller RNA segments then mediate the degradation of the target mRNA. Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control. Hutvagner et al. 2001, Science, 293, 834. The RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded mRNA complementary to the antisense strand of the siRNA. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex.
[0246] RNAi (RNA interference) has been studied in a variety of systems. Early work in Drosophila embryonic lysates (Elbashir et al. 2001 EMBO J. 20: 6877 and Tuschl et al. International PCT Publication No. WO 01/75164) revealed certain parameters for siRNA length, structure, chemical composition, and sequence that are beneficial to mediate efficient RNAi activity. These studies have shown that 21-nucleotide siRNA duplexes are most active when containing 3-terminal dinucleotide overhangs. Substitution of the 3-terminal siRNA overhang nucleotides with 2-deoxy nucleotides (2-H) was tolerated. In addition, a 5-phosphate on the target-complementary strand of an siRNA duplex is usually required for siRNA activity. Later work showed that a 3-terminal dinucleotide overhang can be replaced by a 3 end cap, provided that the 3 end cap still allows the molecule to mediate RNA interference; the 3 end cap also reduces sensitivity of the molecule to nucleases. See, for example, U.S. Pat. Nos. 8,097,716; 8,084,600; 8,404,831; 8,404,832; and 8,344,128. Additional later work on artificial RNAi agents showed that the strand length could be shortened, or a single-stranded nick could be introduced into the sense strand. In addition, mismatches can be introduced between the sense and antisense strands and a variety of modifications can be used. Any of these and various other formats for RNAi agents known in the art can be used to produce RNAi agents to any of the targets disclosed in Tables 1 or 2. In some embodiments, the RNAi agent to any of the targets disclosed in Tables 1 or 2 is ligated to one or more diagnostic compound, reporter group, cross-linking agent, nuclease-resistance conferring moiety, natural or unusual nucleobase, lipophilic molecule, cholesterol, lipid, lectin, steroid, uvaol, hecigenin, diosgenin, terpene, triterpene, sarsasapogenin, Friedelin, epifriedelanol-derivatized lithocholic acid, vitamin, carbohydrate, dextran, pullulan, chitin, chitosan, synthetic carbohydrate, oligo lactate 15-mer, natural polymer, low- or medium-molecular weight polymer, inulin, cyclodextrin, hyaluronic acid, protein, protein-binding agent, integrin-targeting molecule, polycationic, peptide, polyamine, peptide mimic, and/or transferrin.
[0247] Kits for RNAi synthesis are commercially available, e.g., from New England Biolabs and Ambion.
[0248] A suitable RNAi agent can be selected by any process known in the art or conceivable by one of ordinary skill in the art. For example, the selection criteria can include one or more of the following steps: initial analysis of the target gene sequence and design of RNAi agents; this design can take into consideration sequence similarity across species (human, cynomolgus, mouse, etc.) and dissimilarity to other (non-target) genes; screening of RNAi agents in vitro (e.g., at 10 nM in cells); determination of EC50 in HeLa cells; determination of viability of various cells treated with RNAi agents, wherein it is desired that the RNAi agent to a target not inhibit the viability of these cells; testing with human PBMC (peripheral blood mononuclear cells), e.g., to test levels of TNF-alpha to estimate immunogenicity, wherein immunostimulatory sequences are less desired; testing in human whole blood assay, wherein fresh human blood is treated with an RNAi agent and cytokine/chemokine levels are determined [e.g., TNF-alpha (tumor necrosis factor-alpha) and/or MCPI (monocyte chemotactic protein 1)], wherein immunostimulatory sequences are less desired; determination of gene knockdown in vivo using subcutaneous tumors in test animals; target gene modulation analysis, e.g., using a pharmacodynamic (PD) marker, and optimization of specific modifications of the RNAi agents.
[0249] In some embodiments, the present invention provides an RNAi agent to a target, e.g., a target disclosed in Tables 1 or 2, and methods of using an RNAi agent to a target, e.g., a target disclosed in Tables 1 or 2. RNAi agents disclosed herein include those compositions capable of mediating RNA interference, including, inter alia, shRNAs and siRNAs. In some embodiments, the RNAi agent comprises an antisense strand and a sense strand.
[0250] An embodiment of the invention provides a composition comprising an RNAi agent comprising a first (sense) or second (antisense) strand, wherein the sense and/or antisense strand comprises at least 15 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from the antisense strand of an RNAi agent to a target, e.g., a target disclosed in Tables 1 or 2. In another embodiment, the present invention provides a composition comprising an RNAi agent comprising a sense strand and an antisense strand, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from the antisense strand of an RNAi agent.
[0251] In another embodiment, the present invention provides a composition comprising an RNAi agent comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from the sense strand and the antisense strand comprises at least 15 contiguous nucleotides differing by 1, 2, or 3 nucleotides from the antisense strand of an RNAi agent to a target, e.g., a target disclosed in Tables 1 or 2.
[0252] In one embodiment, the present invention provides particular compositions comprising an RNAi agent comprising an antisense strand, wherein the antisense strand comprises at least contiguous nucleotides from the antisense strand of an RNAi agent to a target, e.g., a target disclosed in Tables 1 or 2. In another embodiment, the present invention provides a composition comprising an RNAi agent comprising a sense strand and an antisense strand, wherein the sequence of the antisense strand is the sequence of the antisense strand of an RNAi agent to a target, e.g., a target disclosed in Tables 1 or 2. In another embodiment, the present invention provides a composition comprising an RNAi agent comprising a sense strand and an antisense strand, wherein the sequence of the antisense strand comprises the sequence of the antisense strand of an RNAi agent to a target, e.g., a target disclosed in Tables 1 or 2.
[0253] In some embodiments, the antisense and sense strand can be two physically separated strands, or can be components of a single strand or molecule, e.g., they are linked a loop of nucleotides or other linker. A non-limiting example of the former is a siRNA; a non-limiting example of the latter is a shRNA. The can also, optionally, exist single-stranded nicks in the sense strand, or one or more mismatches between the antisense and sense strands.
[0254] Additional modified sequences (e.g., sequences comprising one or more modified base) of each of the compositions above are also contemplated as part of the disclosure.
[0255] In one embodiment, the antisense strand is about 30 or fewer nucleotides in length. In one embodiment, the antisense strand forms a duplex region with a sense strand, wherein the duplex region is about 15 to 30 nucleotide pairs in length.
[0256] In one embodiment, the antisense strand is about 15 to about 30 nucleotides in length, including about 19 to about 23 nucleotides in length. In one embodiment, the antisense strand has at least the length selected from about 15 nucleotides, about 16 nucleotides, about 17 nucleotides, about 18 nucleotides, about 19 nucleotides, about 20 nucleotides, about 21 nucleotides, about 22 nucleotides, about 23 nucleotides, about 24 nucleotides, about 25 nucleotides, about 26 nucleotides, about 27 nucleotides, about 28 nucleotides, about 29 nucleotides and 30 nucleotides.
[0257] In one embodiment, the RNAi agent comprises a modification that causes the RNAi agent to have increased stability in a biological sample or environment.
[0258] In one embodiment, the RNAi agent comprises at least one sugar backbone modification (e.g., phosphorothioate linkage) or at least one 2-modified nucleotide.
[0259] In one embodiment, the RNAi agent comprises: at least one 5-uridine-adenine-3 (5-ua-3) dinucleotide, wherein the uridine is a 2-modified nucleotide; at least one 5-uridine-5 guanine-3 (5-ug-3) dinucleotide, wherein the 5-uridine is a 2-modified nucleotide; at least one 5-cytidine-adenine-3 (5-ca-3) dinucleotide, wherein the 5-cytidine is a 2-modified nucleotide; or at least one 5-uridine-uridine-3 (5-uu-3 ) dinucleotide, wherein the 5-uridine is a 2-modified nucleotide. These dinucleotide motifs are particularly prone to serum nuclease degradation (e.g. RNase A). Chemical modification at the 2-position of the first pyrimidine nucleotide in the motif prevents or slows down such cleavage. This modification recipe is also known under the term endo light.
[0260] In one embodiment, the RNAi agent comprises a 2-modification selected from the group consisting of: 2-deoxy, 2-deoxy-2-fluoro, 2-O-methyl, 2-O-methoxyethyl (2-O-MOE), 2-O-aminopropyl (2-O-AP), 2-O-dimethylaminoethyl (2-O-DMAOE), 2-O-dimethylaminopropyl (2-O-DMAP), 2-O-dimethylaminoethyloxyethyl (2-O-DMAEOE), and 2-ON-methylacetamido (2-O-NMA). In one embodiment, all pyrimidines (uridine and cytidine) are 2-O-methyl-modified nucleosides. In some embodiments, one or more nucleotides can be modified, or substituted with DNA, a peptide nucleic acid (PNA), locked nucleic acid (LNA), morpholino nucleotide, threose nucleic acid (TNA), glycol nucleic acid (GNA), arabinose nucleic acid (ANA), 2-fluoroarabinose nucleic acid (FANA), cyclohexene nucleic acid (CeNA), anhydrohexitol nucleic acid (HNA), unlocked nucleic acid (UNA).
[0261] In some embodiments, the sense and/or antisense strand can terminate at the 3 end with a phosphate or modified internucleoside linker, and further comprise, in 5 to 3 order: a spacer, a second phosphate or modified internucleoside linker, and a 3 end cap. In some embodiments, modified internucleoside linker is selected from phosphorothioate, phosphorodithioate, phosphoramidate, boranophosphonoate, an amide linker, and a compound of formula (I):
##STR00033##
where R3 is selected from O, S, NH2, BH3, CH3, C1-6 alkyl, C6-10 aryl, C1-6 alkoxy and C6-10 aryl-oxy, wherein C1-6 alkyl and C6-10 aryl are unsubstituted or optionally independently substituted with 1 to 3 groups independently selected from halo, hydroxyl and NH2; and R4 is selected from O, S, NH, and CH2. In some embodiments, the spacer can be a sugar, alkyl, cycloakyl, ribitol or other type of a basic nucleotide, 2-deoxy-ribitol, diribitol, 2-methoxyethoxy-ribitol (ribitol with 2-MOE), C3-6 alkyl, or 4-methoxybutane-1,3-diol (5300). In some embodiments, the 3 end cap can be selected from any of various 3 end caps described herein or known in the art. In some embodiments, one or more phosphates can be replaced by a modified internucleoside linker.
[0262] In one embodiment, the RNAi agent comprises at least one blunt end.
[0263] In one embodiment, the RNAi agent comprises an overhang having 1 nt to 4 nt.
[0264] In one embodiment, the RNAi agent comprises an overhang at the 3-end of the antisense strand of the RNAi agent.
[0265] In one embodiment, the RNAi agent is ligated to one or more diagnostic compound, reporter group, cross-linking agent, nuclease-resistance conferring moiety, natural or unusual nucleobase, lipophilic molecule, cholesterol, lipid, lectin, steroid, uvaol, hecigenin, diosgenin, terpene, triterpene, sarsasapogenin, Friedelin, epifriedelanol-derivatized lithocholic acid, vitamin, carbohydrate, dextran, pullulan, chitin, chitosan, synthetic carbohydrate, oligo lactate natural polymer, low- or medium-molecular weight polymer, inulin, cyclodextrin, hyaluronic acid, protein, protein-binding agent, integrin-targeting molecule, polycationic, peptide, polyamine, peptide mimic, and/or transferrin.
[0266] In one embodiment, the composition further comprises a second RNAi agent to a target, e.g., a target disclosed in Tables 1 or 2. RNAi agents of the present invention can be delivered or introduced (e.g., to a cell in vitro or to a patient) by any means known in the art. Introducing into a cell, when referring to an iRNA, means facilitating or effecting uptake or absorption into the cell, as is understood by those skilled in the art. Absorption or uptake of an iRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. The meaning of this term is not limited to cells in vitro; an iRNA may also be introduced into a cell, wherein the cell is part of a living organism. In such an instance, introduction into the cell will include the delivery to the organism. For example, for in vivo delivery, iRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be by a beta-glucan delivery system, such as those described in U.S. Pat. Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005/0281781 which are hereby incorporated by reference in their entirety. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described below or known in the art.
[0267] Delivery of RNAi agent to tissue is a problem both because the material must reach the target organ and must also enter the cytoplasm of target cells. RNA cannot penetrate cellular membranes, so systemic delivery of naked RNAi agent is unlikely to be successful. RNA is quickly degraded by RNAse activity in serum. For these reasons, other mechanisms to deliver RNAi agent to target cells has been devised. Methods known in the art include but are not limited to: viral delivery (retrovirus, adenovirus, lentivirus, baculovirus, AAV); liposomes (Lipofectamine, cationic DOTAP, neutral DOPC) or nanoparticles (cationic polymer, PEI), bacterial delivery (tkRNAi), and also chemical modification (LNA) of siRNA to improve stability. Xia et al. 2002 Nat. Biotechnol. 20 and Devroe et al. 2002. BMC Biotechnol. 21: 15, disclose incorporation of siRNA into a viral vector. Other systems for delivery of RNAi agents are contemplated, and the RNAi agents of the present invention can be delivered by various methods yet to be found and/or approved by the FDA or other regulatory authorities.
[0268] Liposomes have been used previously for drug delivery (e.g., delivery of a chemotherapeutic). Liposomes (e.g., cationic liposomes) are described in PCT publications WO02/100435A1, WO03/015757A1, and WO04029213A2; U.S. Pat. Nos. 5,962,016; 5,030,453; and 6,680,068; and U.S. Patent Application 2004/0208921. A process of making liposomes is also described in WO04/002453A1. Furthermore, neutral lipids have been incorporated into cationic liposomes (e.g., Farhood et al. 1995). Cationic liposomes have been used to deliver RNAi agent to various cell types (Sioud and Sorensen 2003; U.S. Patent Application 2004/0204377; Duxbury et al., 2004; Donze and Picard, 2002). Use of neutral liposomes disclosed in Miller et al. 1998, and U.S. Publ. 2003/0012812.
[0269] As used herein, the term SNALP refers to a stable nucleic acid-lipid particle. A SNALP represents a vesicle of lipids coating a reduced aqueous interior comprising a nucleic acid such as an iRNA or a plasmid from which an iRNA is transcribed. SNALPs are described, e.g., in U.S. Patent Application Publication Nos. 20060240093, 20070135372, and in International Application No. WO 2009082817. These applications are incorporated herein by reference in their entirety.
[0270] Chemical transfection using lipid-based, amine-based and polymer-based techniques, is disclosed in products from Ambion Inc., Austin, Tex.; and Novagen, EMD Biosciences, Inc, an Affiliate of Merck KGaA, Darmstadt, Germany); Ovcharenko D (2003) Efficient delivery of siRNAs to human primary cells. Ambion TechNotes 10 (5): 15-16). Additionally, Song et al. (Nat Med. published online (Fete I 0, 2003) doi: 10.1038/nm828) and others [Caplen et al. 2001 Proc. Natl. Acad. Sci. (USA), 98: 9742-9747; and McCaffrey et al. Nature 414: 34-39] disclose that liver cells can be efficiently transfected by injection of the siRNA into a mammal's circulatory system.
[0271] A variety of molecules have been used for cell-specific RNAi agent delivery. For example, the nucleic acid-condensing property of protamine has been combined with specific antibodies to deliver siRNAs. Song et al. 2005 Nat Biotech. 23: 709-717. The self-assembly PEGylated polycation polyethylenimine has also been used to condense and protect siRNAs. Schiffelers et al. 2004 Nucl. Acids Res. 32: 49, 141-110.
[0272] The siRNA-containing nanoparticles were then successfully delivered to integrin overexpressing tumor neovasculature. Hu-Lieskovan et al. 2005 Cancer Res. 65: 8984-8992. The RNAi agents of the present invention can be delivered via, for example, Lipid nanoparticles (LNP); neutral liposomes (NL); polymer nanoparticles; double-stranded RNA binding motifs (dsRBMs); or via modification of the RNAi agent (e.g., covalent attachment to the dsRNA). Lipid nanoparticles (LNP) are self-assembling cationic lipid based systems. These can comprise, for example, a neutral lipid (the liposome base); a cationic lipid (for siRNA loading); cholesterol (for stabilizing the liposomes); and PEG-lipid (for stabilizing the formulation, charge shielding and extended circulation in the bloodstream). The cationic lipid can comprise, for example, a headgroup, a linker, a tail and a cholesterol tail. The LNP can have, for example, good tumor delivery, extended circulation in the blood, small particles (e.g., less than 100 nm), and stability in the tumor microenvironment (which has low pH and is hypoxic).
[0273] Neutral liposomes (NL) are non-cationic lipid based particles. Polymer nanoparticles are self-assembling polymer-based particles. Double-stranded RNA binding motifs (dsRBMs) are self-assembling RNA binding proteins, which will need modifications.
[0274] The present disclosure further provides use of an RNAi agent for the treatment of cancer, such as colon or endometrial cancer. Also provided is a use of an RNAi agent protein for the manufacture of a medicament for treating cancer, such as a cancer disclosed in Tables 1 or 2.
In another embodiment, the present invention provides a method of treating cancer associated with microsatellite instability, gene amplifications, duplications, deletions or mutations, such as a cancer disclosed in Tables 1 or 2, by administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition comprising an RNAi agent described herein.
[0275] In another embodiment, an RNAi agent which inhibits the expression of a target, e.g., any of the targets disclosed in Tables 1 or 2, for use in the treatment of cancer is provided. The cancer is chosen from any of the cancers disclosed in Tables 1 or 2.
[0276] Several other molecules may be suitable to inhibit a target disclosed herein, such as low molecular weight compounds, cyclic peptides, RNAi agents, Aptamers, CRISPRs, TALENs, ZFNs, and antibodies.
Low Molecular Weight Compounds and Therapies
[0277] In one embodiment, the disclosure comprises a low molecular weight compound inhibiting gene expression that inhibits the expression of a target, e.g., any of the targets disclosed in Tables 1 or 2.
[0278] In another embodiment, the present invention provides a molecule that inhibits the normal cellular function of the target protein. Exemplary small molecules that inhibit targets described herein are provided in this disclosure.
[0279] The present disclosure thus provides use of a low molecular weight inhibitor for a target, e.g., a target disclosed in Tables 1 or 2 for the treatment of cancer, such as a cancer disclosed herein. Also provided is a use of a low molecular weight inhibitor of a target, e.g., a target disclosed in Tables 1 or 2 for the manufacture of a medicament for treating cancer, such as a cancer disclosed in Tables 1 or 2.
[0280] In another embodiment, the present invention provides a method of treating cancer associated with microsatellite instability, gene amplifications, duplications, deletions or mutations, such as a cancer disclosed in Tables 1 or 2, by administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition comprising an RNAi agent described herein.
[0281] In another embodiment, a low molecular weight inhibitor for use in the treatment of cancer is provided. The cancer may be a cancer disclosed in Tables 1 or 2.
[0282] The inhibitor of the present disclosure can also be, inter alia, derived from a CRISPR/Cas system, TALEN, or ZFN.
CRISPR
[0283] By CRISPR or CRISPR to a target or CRISPR to inhibit a target and the like is meant a set of clustered regularly interspaced short palindromic repeats, or a system comprising such a set of repeats. By Cas is meant a CRISPR-associated protein. By CRISPR/Cas system is meant a system derived from CRISPR and Cas which can be used to silence, enhance or mutate the target gene, e.g., a target gene of any of the targets disclosed in Tables 1 or 2.
[0284] Naturally-occurring CRISPR/Cas systems are found in approximately 40% of sequenced eubacteria genomes and 90% of sequenced archaea. Grissa et al. 2007. BMC Bioinformatics 8: 172. This system is a type of prokaryotic immune system that confers resistance to foreign genetic elements such as plasmids and phages and provides a form of acquired immunity. Barrangou et al. 2007. Science 315: 1709-1712; Marragini et al. 2008 Science 322: 1843-1845. The CRISPR/Cas system has been modified for use in gene editing (silencing, enhancing or changing specific genes) in eukaryotes such as mice or primates. Wiedenheft et al. 2012. Nature 482: 331-8. This is accomplished by introducing into the eukaryotic cell a plasmid containing a specifically designed CRISPR and one or more appropriate Cas.
[0285] The CRISPR sequence, sometimes called a CRISPR locus, comprises alternating repeats and spacers. In a naturally-occurring CRISPR, the spacers usually comprise sequences foreign to the bacterium such as a plasmid or phage sequence; in the target CRISPR/Cas system, the spacers are derived from the target gene sequence. The repeats generally show some dyad symmetry, implying the formation of a secondary structure such as a hairpin, but they are not truly palindromic.
[0286] RNA from the CRISPR locus is constitutively expressed and processed by Cas proteins into small RNAs. These comprise a spacer flanked by a repeat sequence. The RNAs guide other Cas proteins to silence exogenous genetic elements at the RNA or DNA level. Horvath et al. 2010. Science 327: 167-170; Makarova et al. 2006 Biology Direct 1: 7. The spacers thus serve as templates for RNA molecules, analogously to siRNAs. Pennisi 2013. Science 341: 833-836.
As these naturally occur in many different types of bacteria, the exact arrangements of the CRISPR and structure, function and number of Cas genes and their product differ somewhat from species to species. Haft et al. 2005 PLoS Comput. Biol. 1: e60; Kunin et al. 2007. Genome Biol. 8: R61; Mojica et al. 2005. J. Mol. Evol. 60: 174-182; Bolotin et al. 2005. Microbiol. 151: 2551-2561; Pourcel et al. 2005. Microbiol. 151: 653-663; and Stern et al. 2010. Trends. Genet. 28: 335-340. For example, the Cse (Cas subtype, E. coli) proteins (e.g., CasA) form a functional complex, Cascade, that processes CRISPR RNA transcripts into spacer-repeat units that Cascade retains. Brouns et al. 2008. Science 321: 960-964. In other prokaryotes, Cas6 processes the CRISPR transcript. The CRISPR-based phage inactivation in E. coli requires Cascade and Cas3, but not Cas1 or Cas2. The Cmr (Cas RAMP module) proteins in Pyrococcus furiosus and other prokaryotes form a functional complex with small CRISPR RNAs that recognizes and cleaves complementary target RNAs. A simpler CRISPR system relies on the protein Cas9, which is a nuclease with two active cutting sites, one for each strand of the double helix. Combining Cas9 and modified CRISPR locus RNA can be used in a system for gene editing. Pennisi 2013. Science 341: 833-836.
[0287] The CRISPR/Cas system can thus be used to edit a target gene, e.g., a target gene disclosed in Tables 1 or 2 (adding or deleting a basepair), e.g., repairing a damaged target gene, or introducing a premature stop which thus decreases expression of an over-expressed target. The CRISPR/Cas system can alternatively be used like RNA interference, turning off the target gene in a reversible fashion. In a mammalian cell, for example, the RNA can guide the Cas protein to the target promoter, sterically blocking RNA polymerases.
[0288] Artificial CRISPR/Cas systems can be generated which inhibit a target, e.g., a target disclosed in Tables 1 or 2, using technology known in the art, e.g., that described in U.S. patent application Ser. No. 13/842,859. The present disclosure thus provides a CRISPR/Cas system suitable for editing a target, e.g., any of the targets disclosed in Tables 1 or 2, for use in the treatment of cancer, such as a cancer disclosed in Tables 1 or 2. Also provided is a use of a CRISPR/Cas system suitable for editing a target gene, e.g., any of the target genes disclosed Tables 1 or 2 for the manufacture of a medicament for treating cancer, such as a cancer disclosed in Tables 1 or 2.
In another embodiment, the present invention provides a method of treating cancer associated with microsatellite instability, gene amplifications, duplications, deletions or mutations, such as a cancer disclosed in Tables 1 or 2, by administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition comprising a CRISPR/Cas system suitable for editing a target, e.g., any of the targets disclosed in Tables 1 or 2.
[0289] In another embodiment, a CRISPR/Cas system suitable for editing a target, e.g., any of the targets disclosed in Tables 1 or 2, for use in the treatment of cancer is provided. The cancer may be a cancer disclosed in Tables 1 or 2.
[0290] An inhibitory CRISPR system can include a guide RNA (gRNA) comprising a targeting domain, i.e., a nucleotide sequence that is complementary to a target DNA strand, and a second domain that interacts with an RNA-directed nuclease, e.g., cpf1 or Cas molecule, e.g., Cas9 molecule.
[0291] In some embodiments, the ability of an RNA-directed nuclease, e.g., cpf1 or Cas molecule, e.g., Cas9 molecule, to interact with and cleave a target nucleic acid is Protospacer Adjacent Motif (PAM) sequence dependent. A PAM sequence is a sequence in the target nucleic acid. In some embodiments, cleavage of the target nucleic acid occurs upstream from the PAM sequence. RNA-directed nuclease molecules, e.g., cpf1 or Cas molecules, e.g., Cas9 molecules, from different bacterial species can recognize different sequence motifs (e.g., PAM sequences). In addition to recognizing different PAM sequences, RNA-directed nucleases, e.g., cpf1 or Cas molecules, e.g., Cas9 molecules, from different species may be directed to different target sequences (e.g., target sequences adjacent, e.g., immediately upstream, to the PAM sequence) by gRNA molecules comprising targeting domains capable of hybridizing to said target sequences and a tracr sequence that binds to said RNA-directed nuclease, e.g., cpf1 or Cas molecule, e.g., Cas9 molecule.
[0292] In some embodiments, the CRISPR system comprises a gRNA molecule and a Cas9 molecule from S. pyogenes. A Cas9 molecule of S. pyogenes recognizes the sequence motif NGG and directs cleavage of a target nucleic acid sequence 1 to 10, e.g., 3 to 5, base pairs upstream from that sequence.
[0293] In some embodiments, the CRISPR system comprises a gRNA molecule and a Cas9 molecule from S. thermophilus. A Cas9 molecule of S. thermophilus recognizes the sequence motif NGGNG and NNAGAAW (W=A or T) and directs cleavage of a core target nucleic acid sequence 1 to 10, e.g., 3 to 5, base pairs upstream from these sequences. A gRNA molecule useful with S. thermophilus-based CRISPR systems may include a tracr sequence known to interact with S. thermophilus. See, e.g., Horvath et al., SCIENCE 2010; 327(5962): 167-170, and Deveau et al., J BACTERIOL 2008; 190(4): 1390-1400.
[0294] In some embodiments, the CRISPR system comprises a gRNA molecule and a Cas9 molecule from S. aureus. A Cas9 molecule of S. aureus recognizes the sequence motif NNGRR (R=A or G) and directs cleavage of a target nucleic acid sequence 1 to 10, e.g., 3 to base pairs upstream from that sequence.
[0295] In some embodiments, the CRISPR system comprises a gRNA molecule and an RNA-directed nuclease, e.g., cpf1 molecule, e.g., a cpf1 molecule from L. bacterium or a cpf1 molecule from A. sp. A cpf1 molecule, e.g., a cpf1 molecule from L. bacterium or a cpf1 molecule from A. sp., recognizes the sequence motive of TTN (where N=A, T, G or C) or preferably TTTN (where N=A, T, G or C), and directs cleavage of a target nucleic acid sequence 1-25 base pairs upstream of the PAM sequence, e.g., 18-19 base pairs upstream from the PAM sequence on the same strand as the PAM and 23 base pairs upstream of the PAM sequence on the opposite strand as the PAM, creating a sticky end break.
TALEN
[0296] By TALEN or TALEN to target or TALEN to inhibit target and the like is meant a transcription activator-like effector nuclease, an artificial nuclease which can be used to edit a target gene, e.g., any of the targets disclosed in Tables 1 or 2.
[0297] TALENs are produced artificially by fusing a TAL effector DNA binding domain to a DNA cleavage domain. Transcription activator-like effects (TALEs) can be engineered to bind any desired DNA sequence, including a portion of the target gene. By combining an engineered TALE with a DNA cleavage domain, a restriction enzyme can be produced which is specific to any desired DNA sequence, including a target sequence, e.g., a target disclosed in Tables 1 or 2. These can then be introduced into a cell, wherein they can be used for genome editing. Boch 2011 Nature Biotech. 29: 135-6; and Boch et al. 2009 Science 326: 1509-12; Moscou et al. 2009 Science 326: 3501.
[0298] TALEs are proteins secreted by Xanthomonas bacteria. The DNA binding domain contains a repeated, highly conserved 33-34 amino acid sequence, with the exception of the 12th and 13th amino acids. These two positions are highly variable, showing a strong correlation with specific nucleotide recognition. They can thus be engineered to bind to a desired DNA sequence.
[0299] To produce a TALEN, a TALE protein is fused to a nuclease (N), which is a wild-type or mutated FokI endonuclease. Several mutations to FokI have been made for its use in TALENs; these, for example, improve cleavage specificity or activity. Cermak et al. 2011 Nucl. Acids Res. 39: e82; Miller et al. 2011 Nature Biotech. 29: 143-8; Hockemeyer et al. 2011 Nature Biotech. 29: 731-734; Wood et al. 2011 Science 333: 307; Doyon et al. 2010 Nature Methods 8: 74-79; Szczepek et al. 2007 Nature Biotech. 25: 786-793; and Guo et al. 2010 J. Mol. Biol. 200: 96.
[0300] The FokI domain functions as a dimer, requiring two constructs with unique DNA binding domains for sites in the target genome with proper orientation and spacing. Both the number of amino acid residues between the TALE DNA binding domain and the FokI cleavage domain and the number of bases between the two individual TALEN binding sites appear to be important parameters for achieving high levels of activity. Miller et al. 2011 Nature Biotech. 29: 143-8.
[0301] A TALEN to a target can be used inside a cell to produce a double-stranded break (DSB). A mutation can be introduced at the break site if the repair mechanisms improperly repair the break via non-homologous end joining. For example, improper repair may introduce a frame shift mutation. Alternatively, foreign DNA can be introduced into the cell along with the TALEN; depending on the sequences of the foreign DNA and chromosomal sequence, this process can be used to correct a defect in the target gene or introduce such a defect into a wt target gene, thus decreasing expression of target gene.
[0302] TALENs specific to sequences in a target gene, e.g., a target gene disclosed in Tables 1 or 2, can be constructed using any method known in the art, including various schemes using modular components. Zhang et al. 2011 Nature Biotech. 29: 149-53; Geibler et al. 2011 PLoS ONE 6: e19509.
[0303] The present disclosure thus provides use of a TALEN for a target gene, e.g., a target gene disclosed in Tables 1 or 2, for the treatment of cancer, such as a cancer disclosed in Tables 1 or 2. Also provided is a use of a TALEN for the manufacture of a medicament for treating cancer, such as a cancer disclosed in Tables 1 or 2.
[0304] In another embodiment, the present invention provides a method of treating cancer associated with microsatellite instability gene amplifications, duplications, deletions or mutations, such as a cancer disclosed in Tables 1 or 2, by administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition comprising a TALEN of a target described herein. In another embodiment, a TALEN of a target, e.g., a target gene disclosed in Tables 1 or 2 for use in the treatment of cancer is provided. The cancer may be a cancer disclosed in Tables 1 or 2.
Zinc Finger Nuclease to Inhibit Target Genes
[0305] By ZFN, or Zinc Finger Nuclease or ZFN to a target gene or ZFN to inhibit target gene and the like is meant a zinc finger nuclease, an artificial nuclease which can be used to edit a target gene, e.g., a target disclosed in Tables 1 or 2.
[0306] Like a TALEN, a ZFN comprises a FokI nuclease domain (or derivative thereof) fused to a DNA-binding domain. In the case of a ZFN, the DNA-binding domain comprises one or more zinc fingers. Carroll et al. 2011. Genetics Society of America 188: 773-782; and Kim et al. Proc. Natl. Acad. Sci. USA 93: 1156-1160.
[0307] A zinc finger is a small protein structural motif stabilized by one or more zinc ions. A zinc finger can comprise, for example, Cys2His2, and can recognize an approximately 3-bp sequence. Various zinc fingers of known specificity can be combined to produce multi-finger polypeptides which recognize about 6, 9, 12, 15 or 18-bp sequences. Various selection and modular assembly techniques are available to generate zinc fingers (and combinations thereof) recognizing specific sequences, including phage display, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems, and mammalian cells.
[0308] Like a TALEN, a ZFN must dimerize to cleave DNA. Thus, a pair of ZFNs is required to target non-palindromic DNA sites. The two individual ZFNs must bind opposite strands of the DNA with their nucleases properly spaced apart. Bitinaite et al. 1998 Proc. Natl. Acad. Sci. USA 95: 10570-5.
[0309] Also like a TALEN, a ZFN can create a double-stranded break in the DNA, which can create a frame-shift mutation if improperly repaired, leading to a decrease in the expression and amount of a target in a cell. ZFNs can also be used with homologous recombination to mutate, or repair defects, in the target gene.
[0310] ZFNs specific to sequences in a target gene, e.g., a target disclosed in Tables 1 or 2, can be constructed using any method known in the art. Cathomen et al. Mol. Ther. 16: 1200-7; and Guo et al. 2010. J. Mol. Biol. 400: 96.
[0311] The present disclosure thus provides use of a ZFN specific to sequences in a target gene, e.g., a target disclosed in Tables 1 or 2 for the treatment of cancer, such as colon or endometrial cancer. Also provided is a use of a ZFN specific to sequences in a target gene, e.g., a target disclosed in Tables 1 or 2 for the manufacture of a medicament for treating cancer, such a cancer disclosed in Tables 1 or 2.
[0312] In another embodiment, the present invention provides a method of treating cancer associated with microsatellite instability, gene amplifications, duplications, deletions or mutations, such as a cancer disclosed in Tables 1 or 2, by administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition comprising a ZFN specific to sequences in a target gene, e.g., a target disclosed in Tables 1 or 2. In another embodiment, a ZFN specific to sequences in a target gene, e.g., a target disclosed in Tables 1 or 2 for use in the treatment of cancer is provided. The cancer may be a cancer disclosed in Tables 1 or 2.
Antibodies to Target Genes
[0313] In some embodiments, the present invention provides an inhibitor, e.g., an inhibitor to any of the targets disclosed in Tables 1 or 2, which is an antibody or epitope-binding fragment or derivative thereof, and methods of using the same. Various types of antibodies and epitope-binding fragments and derivatives thereof are known in the art, as are methods of producing these. Any of these, including but not limited to those described herein, can be used to produce an inhibitor, e.g., an inhibitor to any of the targets disclosed in Tables 1 or 2, which can be used in various methods of inhibiting a target and treating a target-related disease, such as cancer, e.g., a cancer disclosed in Tables 1 or 2.
[0314] In certain embodiments of the invention, the antibody to a target, e.g., a target disclosed in Tables 1 or 2 is an intrabody. Single chain antibodies expressed within the cell (e.g. cytoplasm or nucleus) are called intrabodies. Due to the reducing environment within the cell, disulfide bridges, believed to be critical for antibody stability, are not formed. Thus, it was initially believed that applications of intrabodies are not suitable. But several cases are described showing the feasibility of intrabodies (Beerli et al., 1994 J Biol Chem, 269, 23931-6; Biocca et al., 1994 Bio/Technology, 12, 396-9; Duan et al., 1994 Proceedings of the National Academy of Sciences of the United States of America, 91, 5075-9; Gargano and Cattaneo, 1997 FEBS Lett, 414, 537-40; Greenman et al., 1996 J Immunol Methods, 194, 169-80; Martineau et al., 1998 Journal of Molecular Biology, 280, 117-27; Mhashilkar et al., 1995 EMBO Journal, 14, 1542-51; Tavladoraki et al., 1993 Nature, 366, 469-72). In these cases, intrabodies work by, e.g., blocking the cytoplasmic antigen and therefore inhibiting its biological activity.
[0315] Such intracellular antibodies are also referred to as intrabodies and may comprise a Fab fragment, or preferably comprise a scFv fragment (see, e.g., Lecerf et al., Proc. Natl. Acad. Sci. USA 98:4764-49 (2001). The framework regions flanking the CDR regions can be modified to improve expression levels and solubility of an intrabody in an intracellular reducing environment (see, e.g., Worn et al., J. Biol. Chem. 275:2795-803 (2000). An intrabody may be directed to a particular cellular location or organelle, for example by constructing a vector that comprises a polynucleotide sequence encoding the variable regions of an intrabody that may be operatively fused to a polynucleotide sequence that encodes a particular target antigen within the cell (see, e.g., Graus-Porta et al., Mol. Cell Biol. 15:1182-91 (1995); Lener et al., Eur. J. Biochem. 267:1196-205 (2000)). An intrabody may be introduced into a cell by a variety of techniques available to the skilled artisan including via a gene therapy vector, or a lipid mixture (e.g., Provectin manufactured by Imgenex Corporation, San Diego, Calif.), or according to photochemical internalization methods.
[0316] Intrabodies can be derived from monoclonal antibodies which were first selected with classical techniques (e.g., phage display) and subsequently tested for their biological activity as intrabodies within the cell (Visintin et al., 1999 Proceedings of the National Academy of Sciences of the United States of America, 96, 11723-11728). For additional information, see: Cattaneo, 1998 Bratisl Lek Listy, 99, 413-8; Cattaneo and Biocca, 1999 Trends In Biotechnology, 17, 115-21. The solubility of an intrabody can be modified by either changes in the framework (Knappik and Pluckthun, 1995 Protein Engineering, 8, 81-9) or the CDRs (Kipriyanov et al., 1997; Ulrich et al., 1995 Protein Engineering, 10, 445-53). Additional methods for producing intrabodies are described in the art, e.g., U.S. Pat. Nos. 7,258,985 and 7,258,986.
[0317] In one embodiment, antigen-binding proteins, such as antibodies, that are able to target cytosolic/intracellular proteins, for example, a target protein, e.g., a target disclosed in Tables 1 or 2. The disclosed antibodies target a peptide/MHC complex as it would typically appear on the surface of a cell following antigen processing of the target protein and presentation by the cell. HLA class I binds to peptides approximately 9 amino acids in length and presents them on the surface of the cell to cytotoxic T lymphocytes. The presentation of these peptides is the product of cytoplasmic cleavage by enzymes and active transport by transporter proteins. Further, the binding of particular peptides after processing and localization is heavily influenced by the amino acid sequence of the particular HLA protein. Most of these steps are amenable to in vitro characterization, allowing one to predict the likelihood that a particular amino acid sequence, derived from a larger peptide or protein of interest, will be successfully processed, transported, bound by MHC class I, and presented to cytotoxic T lymphocytes. In that regard, the antibodies mimic T-cell receptors in that the antibodies have the ability to specifically recognize and bind to a peptide in an MHC-restricted fashion, that is, when the peptide is bound to an MHC antigen. The peptide/MHC complex recapitulates the antigen as it would typically appear on the surface of a cell following antigen processing and presentation of the target protein to a T-cell.
[0318] The accurate prediction for a particular step in this process is dependent upon models informed by experimental data. The cleavage specificity of the proteasome, producing peptides often <amino acids in length, can be determined by in vitro assays. The affinity for the transporter complex can similarly be determined by relatively straight-forward in vitro binding assays. The MHC class I protein's affinity is highly variable, depending on the MHC allele, and generally must be determined on an allele-by-allele basis. One approach is to elute the peptides presented by the MHC protein on the cell surface to generate a consensus motif. An alternative approach entails generating cells deficient in a peptide processing step such that most or all of the MHC proteins on the cell surface are not loaded with a peptide. Many different peptides can be washed over the cells in parallel and monitored for binding. The set of peptides that do and do not bind can be used to train a classifier (such as an artificial neural network or support vector machine) to discriminate between the two peptide sets. This trained classifier can then be applied to novel peptides to predict their binding to the MHC allele. Alternatively, the affinity for each peptide can be used to train a regression model, which can then be used to make quantitative predictions regarding the MHC protein's affinity for an untested peptide. The collection of such datasets is laborious, so methods exist to combine data collected for one HLA allele with the knowledge of the amino acid differences between that particular allele and another unstudied MHC allele to predict its peptide binding specificity.
[0319] Additional methods for constructing antibodies to cytosolic peptides such as a target gene disclosed in Tables 1 or 2 are described in, for example, WO 2012/135854, which is hereby incorporated by reference in its entirety. This document describes production of antibodies which recognize and bind to epitopes of a peptide/MHC complex, such as a peptide/HLA-A2 or peptide/HLA-A0201 complex. In some embodiments of the invention, the peptide is portion of a target gene disclosed in Tables 1 or 2.
[0320] HLA class I binds to peptides approximately 9 amino acids in length and presents them on the surface of the cell to cytotoxic T lymphocytes. The presentation of these peptides is the product of cytoplasmic cleavage by enzymes and active transport by transporter proteins. Further, the binding of particular peptides after processing and localization is heavily influenced by the amino acid sequence of the particular HLA protein. Most of these steps are amenable to in vitro characterization, allowing one to predict the likelihood that a particular amino acid sequence, derived from a larger peptide or protein of interest, will be successfully processed, transported, bound by MHC class I, and presented to cytotoxic T lymphocytes. The accurate prediction for a particular step in this process is dependent upon models informed by experimental data. The cleavage specificity of the proteasome, producing peptides often <amino acids in length, can be determined by in vitro assays. The affinity for the transporter complex can similarly be determined by relatively straight-forward in vitro binding assays. The MHC class I protein's affinity is highly variable, depending on the MHC allele, and generally must be determined on an allele-by-allele basis. One approach is to elute the peptides presented by the MHC protein on the cell surface to generate a consensus motif. An alternative approach entails generating cells deficient in a peptide processing step such that most or all of the MHC proteins on the cell surface are not loaded with a peptide. Many different peptides can be washed over the cells in parallel and monitored for binding. The set of peptides that do and do not bind can be used to train a classifier (such as an artificial neural network or support vector machine) to discriminate between the two peptide sets. This trained classifier can then be applied to novel peptides to predict their binding to the MHC allele. Alternatively, the affinity for each peptide can be used to train a regression model, which can then be used to make quantitative predictions regarding the MHC protein's affinity for an untested peptide. The collection of such datasets is laborious, so methods exist to combine data collected for one HLA allele with the knowledge of the amino acid differences between that particular allele and another unstudied MHC allele to predict its peptide binding specificity.
[0321] One such machine learning approach that combines prediction of likely proteasomal cleavage, transporter affinity, and MHC affinity is SMM (Stabilized Matrix Method, Tenzer S et al, 2005. PMID 15868101). This approach can be extended to mutations specific to an indication: a mutation leading to an amino acid change alters the peptide sequence and can lead to a peptide that produces a different score than the wildtype sequence. By focusing on such mutations and selecting those mutant peptide sequences that score highly, one can generate peptides that are presented solely in a diseased state because the sequence simply does not exist in a non-diseased individual. Cross-reactivity can be further minimized by also evaluating the wildtype sequence and selecting for downstream analyses only those peptides whose non-mutant sequence is not predicted to be processed and presented by MHC efficiently.
[0322] Once appropriate peptides have been identified, peptide synthesis may be done in accordance with protocols well known to those of skill in the art. Peptides may be directly synthesized in solution or on a solid support in accordance with conventional techniques (See for example, Solid Phase Peptide Synthesis by John Morrow Stewart and Martin et al. Application of Almez-mediated Amidation Reactions to Solution Phase Peptide Synthesis, Tetrahedron Letters Vol. 39, pages 1517-1520 1998.). Peptides may then be purified by high-pressure liquid chromatography and the quality assessed by high-performance liquid chromatography analysis. Purified peptides may be dissolved in DMSO diluted in PBS (pH7.4) or saline and stored at 80 C. The expected molecular weight may be confirmed using matrix-assisted laser desorption mass spectrometry.
[0323] Subsequent to peptide selection, binding of the peptide to HLA-A may be tested. In one method, binding activity is tested using the antigen-processing deficient T2 cell line, which stabilizes expression of HLA-A on its cell surface when a peptide is loaded exogenously in the antigen-presenting groove by incubating the cells with peptide for a sufficient amount of time. This stabilized expression is read out as an increase in HLA-A expression by flow cytometry using HLA-A2 specific monoclonal antibodies (for example, BB7.2) compared to control treated cells. In another method, presence of the peptide in the HLA-A2 antigen-presenting groove of T2 cells may be detected using targeted mass spectrometry. The peptides are enriched using a MHC-specific monoclonal Ab (W6/32) and then specific MRM assays monitor the peptides predicted to be presented (See for example, Kasuga, Kie. (2013) Comprehensive Analysis of MHC Ligands in Clinical material by Immunoaffinity-Mass Spectrometry, Helena Backvall and Janne Lethio, The Low Molecular Weight Proteome: Methods and Protocols (203-218), New York, New York: Springer Sciences+Business Media and Kowalewski D and Stevanovic S. (2013) Biochemical Large-Scale Identification of MHC Class I Ligands, Peter van Endert, Antigen Processing: Methods and Protocols, Methods in Molecular Biology, Vol 960 (145-158), New York, New York: Springer Sciences+Business Media). This strategy differs slightly than the normally applied tandem mass spectrometry based peptide sequencing. Heavy labeled internal standards are used for identification which results in a more sensitive and quantitative approach.
[0324] Once a suitable peptide has been identified the next step would be identification of specific antibodies to the peptide/HLA-A complex, the target antigen, utilizing conventional antibody generation techniques such as phage display or hybridoma technology in accordance with protocols well known to those skilled in the art. The target antigen (for example, the peptide/HLA-A02-01 complex) is prepared by bringing the peptide and the HLA-A molecule together in solution to form the complex. Next, selection of Fab or scFv presenting phage that bind to the target antigen are selected by iterative binding of the phage to the target antigen, which is either in solution or bound to a solid support (for example, beads or mammalian cells), followed by removal of non-bound phage by washing and elution of specifically bound phage. The targeted antigen may be first biotinylated for immobilization, for example, to streptavidin-conjugated (for example, Dynabeads M-280).
[0325] Positive Fab or scFv clones may be then tested for binding to peptide/HLA-A2 complexes on peptide-pulsed T2 cells by flow cytometry. T2 cells pulsed with the specific peptide or a control irrelevant peptide may be incubated with phage clones. The cells are washed and bound phage are detected by binding an antibody specific for the coat protein (for example, M13 coat protein antibody) followed by a fluorescent labelled secondary antibody to detect the coat protein antibody (for example, anti-mouse Ig). Binding of the antibody clones to human tumor cells expressing both HLA-A2 and the target can also be assessed by incubating the tumor cells with phage as described or purified Fab or scFv flow cytometry and appropriate secondary antibody detection.
[0326] An alternative method to isolating antibodies specific to the peptide/HLA-A2 complex may be achieved through conventional hybridoma approaches in accordance with protocols well known to those of skill in the art. In this method, the target antigen is injected into mice or rabbits to elicit an immune response and monoclonal antibody producing clones are generated. In one embodiment, the host mouse may be one of the available human HLA-A2 transgenic animals which may serve to reduce the abundance of non-specific antibodies generated to HLA-A2 alone. Clones may then be screened for specific binding to the target antigen using standard ELISA methods (for example, incubating supernatant from the clonal antibody producing cells with biotinylated peptide/MHC complex captured on streptavidin coated ELISA plates and detected with anti-mouse antibodies). The positive clones can also be identified by incubating supernatant from the antibody producing clones with peptide pulsed T2 cells by flow cytometry and detection with specific secondary antibodies (for example, fluorescent labelled anti-mouse IgG antibodies). Binding of the antibody clones to human tumor cells expressing both HLA-A2 and the target can also be assessed by incubating the tumor cells with supernatant or purified antibody from the hybridoma clones by flow cytometry and appropriate secondary antibody detection.
Immunotherapy (CART)
[0327] Adoptive cell transfer has been shown to be a promising treatment for various types of cancer. Adoptive cell transfer in cancer therapy involves the transfer of autologous or allogeneic immune effector cells (such as T cells) to enhance immune response against the tumor in a patient having cancer. Recent methods of adoptive cell transfer that have shown promise in cancer therapy include the genetic modification of cells prior to delivery to the patient to express molecules that target antigens expressed on cancer cells and improve the anti-cancer immune response. Examples of such molecules include T cell receptors (TCRs) and chimeric antigen receptors (CARs), which are described in further detail below.
[0328] TCR is a disulfide-linked membrane-anchored heterodimer present on T cell lymphocytes, and normally consisting of an alpha chain and a beta chain. Each chain comprises a variable (V) and a constant (C) domain, wherein the variable domain recognizes an antigen, or an MHC-presented peptide. Signaling is mediated through interaction between the antigen-bound alpha beta heterodimer to CD3 chain molecules, e.g., CD3zeta. Upon binding of a TCR to its antigen, a signal transduction cascade is initiated that can result in T cell activation, T cell expansion, and antitumor effect, e.g., increased cytolytic activity against tumor cells.
[0329] In TCR gene therapy, naturally occurring or modified TCRalpha and TCR alpha beta chains with a known specificity and avidity for tumor antigens are introduced and expressed in a T cell. Briefly, a tumor antigen-specific T cell clone, e.g., with high affinity to the target antigen, is isolated from a donor or patient sample, e.g., a blood or PBMC sample. The tumor antigen-specific TCR alpha and beta chains are isolated using standard molecular cloning techniques known in the art, and a recombinant expression vector for delivery into a host PBMC or T cell population, or subpopulation thereof, is generated. The host cell population is transduced, and the TCR-engineered cells are expanded and/or activated ex vivo prior to administration to the patient. T cells redirected with TCRs that target tumor antigens, such as glycoprotein-100 (gp100) and MART-1, have shown success in recent studies. TCR-redirected T cells recognizing any antigens that are uniquely or preferentially expressed on tumor cells can be used in the present invention.
[0330] The TCR chains can be modified to improve various TCR characteristics for enhancing therapeutic efficacy. Modifications can be made to the TCR to improve TCR surface expression by any of the following: utilizing promoters that drive high level of gene expression in T cells, e.g., retroviral long terminal repeats (LTRs), CMV, MSCV, SV40 promoters (Cooper et al., J. Virol., 2004; Jones et al., Hum. Gene Ther., 2009); introducing other regulatory elements that can enhance transgene expression, e.g., woodchuck hepatitis virus posttranscriptional regulatory element which increases RNA stability (Zufferey et al., J. Virol., 1999); codon optimization (Gustafsson et al., Trends Biotechnol., 2004); or eliminating mRNA instability motifs or cryptic splice sites (Scholten et al., Clin. Immunol., 2006); or a combination thereof. To reduce TCR chain mispairing between the introduced and endogenous TCR chains, and promote the preferential pairings of the introduced TCR chains with each other, any one of the following: introducing foreign constant domains, e.g., from another organism, to the TCRalpha and TCRbeta chains, e.g., murine constant domains for human TCR chains; increasing interchain affinity by engineering a second disulfide bond in the introduced TCR, e.g., introducing additional cysteine residues in the constant domains (Kuball et al., Blood, 2007); or introducing mutations, e.g., point mutations, that increase the knob in hole interface between the TCRalpha and TCRbeta chain (Voss et al., J. Immunol., 2008); or fusing signaling domains, e.g., CD3z domains, directly to the variable domains of the TCRalpha and TCRbeta (Sebestyen et al., 2008); or any combination thereof. The different TCR modifications described above merely represent exemplary modifications, and do not represent an exhaustive or comprehensive list of modifications. Other modifications that increase specificity, avidity, or function of the TCRs or the engineered T cells expressing the TCRs can be readily envisioned by the ordinarily skilled artisan. Methods for introducing the TCRs into host cells and administration of the TCR-engineered cells are further described below.
[0331] Single-chain TCRs has been described in, e.g., Willemsen R A et al, Gene Therapy 2000; 7: 1369-1377; Zhang T et al, Cancer Gene Ther 2004; 11: 487-496; Aggen et al, Gene Ther. 2012 April; 19(4):365-74.
[0332] Chimeric antigen receptors (CARs) are based upon TCRs, and generally comprise 1) an extracellular antigen binding domain; 2) a transmembrane domain; and 3) an intracellular domain comprising one or more intracellular signaling domains. Similar to TCR gene therapy, CAR gene therapy generally comprises isolating a host cell population from a donor or patient, e.g., PBMCs, T cells, or a subpopulation thereof, and introducing the CAR molecule to the host cells such that the host cells express the CAR. The CAR-redirected T cells are then expanded and activated ex vivo using methods known in the art, such as stimulation by anti-CD3 and anti-CD28 antibodies prior to delivery to the patient.
[0333] The antigen binding domain of a CAR refers to a molecule that has affinity for an antigen that is expressed on a target cell, e.g., a cancer cell. The antigen binding domain can be a ligand, a counterligand, or an antibody or antigen-binding fragment thereof, e.g., an Fab, Fab, F(ab)2, or Fv fragment, an scFv antibody fragment, a linear antibody, single domain antibody such as an sdAb (either VL or VH), a camelid VHH domain, a nanobody, and multi-specific antibodies formed from antibody fragments. The antibody or fragment thereof can be humanized. Any antibodies or fragments thereof that recognize and bind to tumor antigens known in the art can be utilized in a CAR.
[0334] The transmembrane domain of a CAR refers to a polypeptide that spans the plasma membrane, linking the extracellular antigen binding domain to the intracellular domain. A transmembrane domain can include one or more additional amino acids adjacent to the transmembrane region, e.g., one or more amino acid associated with the extracellular or intracellular region of the protein from which the transmembrane was derived (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 up to 15 amino acids of the extracellular or intracellular region). Examples of transmembrane domains can be derived from any one or more of the following: the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, KIRDS2, OX40, CD2, CD27, LFA-1 (CD11a, CD18), ICOS (CD278), 4-1BB (CD137), GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD160, CD19, IL2R beta, IL2R gamma, IL7R a, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11 b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, PAG/Cbp. Additional sequences, e.g., hinge or spacer sequence, can be disposed between a transmembrane domain and another sequence or domain to which it is fused.
[0335] The intracellular domain of a CAR includes at least one primary signaling domain and, optionally, one or more co-stimulatory signaling domains, which are responsible for activation of at least one of the normal effector functions of the immune cell in which the CAR has been introduced. Examples of primary signaling domains include TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD32, CD79a, CD79b, CD66d, DAP10, and DAP12. Examples of costimulatory signaling domains include CD27, CD28, 4-166 (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds with CD83, CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD160, CD19, CD4, CD8alpha, CD8beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11 a, LFA-1, ITGAM, CD11 b, ITGAX, CD11 c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, TRANCE/RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT, GADS, SLP-76, and PAG/Cbp. The intracellular signaling sequences may be linked to each other in random or specified order, and may be separated by a short oligo or polypeptide linker.
[0336] Introduction of the TCR and CAR molecules described above to a host cell can be accomplished using any methods known in the art. The host cells are isolated from a patient, or optionally, a donor, and can be immune effector cells, preferably T cells. In some embodiments, specific subpopulations of the immune effector cells may be preferred, for example, tumor infiltrating lymphocytes (TIL), CD4+ T cells, CD8+ T cells, helper T cells (Th cells), or NK cells. Subpopulations of immune effector cells can be identified or isolated from a patient or a donor by the expression of surface markers, e.g., CD4, CD8. The host cells can be modified by transduction or transfection of an expression vector, e.g., a lentiviral vector, a retroviral vector, or a gamma-retroviral vector, encoding the TCR or CAR molecule for sustained or stable expression of the TCR or CAR molecule. With regard to TCR, the alpha and beta chain may be in different expression vectors, or in a single expression vector. In other embodiments, the host cells are modified by in vitro transcribed RNA encoding the TCR or CAR molecule, to transiently express the TCR or CAR. The RNA encoding the TCR or CAR molecule can be introduced to the host cell by transfection, lipofection, or electroporation. The TCR or CAR-modified host cells are cultured under conditions sufficient for expression of the TCR or CAR molecules. In some aspects, the engineered cells are expanded and/or activated using methods known in the art, such as culturing in the presence of specific cytokines or factors that stimulate proliferation and activation known in the art. Examples include culturing in the presence of IL-2, and/or anti-CD3/CD28 antibodies.
[0337] The patient can receive one or more doses of a therapeutic amount of TCR or CAR-engineered cells. The therapeutic amount of TCR or CAR-engineered cells in each dosage can be determined by a physician with consideration of individual differences in age, weight, tumor size, extent of infection or metastasis, and condition of the patient. It can generally be stated that a pharmaceutical composition comprising the immune TCR or CAR-engineered cells described herein may be administered at a dosage of 10 4 to 10 9 cells/kg body weight, in some instances 10 5 to 10 6 cells/kg body weight, including all integer values within those ranges. The pharmaceutical compositions may also be administered multiple times at these dosages. The cells can be administered by using infusion techniques that are commonly known in immunotherapy (see, e.g., Rosenberg et al., New Eng. J. of Med. 319:1676, 1988), e.g., intravenous injection, or direct delivery to the site of the tumor.
[0338] Cancer vaccines generally involve inoculating a patient with a reagent designed to induce an antigen specific immune response. Preventative cancer vaccines are typically administered prior to diagnosis or development of a cancer to reduce the incidence of cancer. Preventative cancer vaccines are designed to target infectious agents, e.g., oncogenic viruses, by stimulating the immune system to recognize the infectious agents for protecting the body against future exposure. Therapeutic cancer vaccines aim to treat cancer after diagnosis by delaying or inhibiting cancer cell growth, causing tumor regression, preventing cancer relapse, or eliminating cancer cells that are not killed by other forms of treatment.
[0339] Cancer vaccines may comprise peptides or proteins, antibodies, glycoproteins, recombinant vectors or other recombinant microorganisms, killed tumor cells, protein- or peptide-activated dendritic cells. The composition of the cancer vaccine depends upon multiple factors, such as the particular tumor antigen that is targeted, the disease and disease stage, and whether the vaccine is administered in combination with another mode of cancer therapy. Adjuvants known in the art that modify or boost the immune response can be added to the cancer vaccine composition.
[0340] Antibody cancer vaccines have been developed, including anti-idiotype vaccines which comprise antibodies that recognize the antigenic determinants of tumor antigen-specific antibodies, called idiotopes. Thus, these anti-idiotype antibodies mimic distinct tumor antigens and act as surrogate antigens for triggering humoral and/or cellular immune response in the patient against the tumor cells. The anti-idiotype antibodies can also be fragments thereof that recognize idiotopes, e.g., single chain antibodies, scFv fragments, and sdAbs. Anti-idiotype cancer vaccines have had some success in clinical trials for treating melanoma, lung cancer, colorectal carcinoma, breast cancer, and ovarian carcinomas (Ladjemi et al., Front Oncol., 2012).
[0341] Other therapies that can be used in the context of the present invention include passive immunotherapy through delivery of antibodies that target a tumor antigen to a patient. The most common form of passive immunotherapy is monoclonal antibody therapy, in which monoclonal antibodies target the tumor cell resulting in tumor cell death through antibody-dependent cell-mediated cytotoxicity (ADCC) or complement-dependent cytotoxicity.
Antibody Drug Conjugate
[0342] The present invention further provides uses of antibodies or fragments thereof against a target, e.g., a target disclosed in Tables 1 or 2, linked to a therapeutic moiety. An antibody or fragment thereof can be conjugated to a label, such as a drug moiety, e.g., an anti-cancer agent, an autoimmune treatment agent, an anti-inflammatory agent, an antifungal agent, an antibacterial agent, an anti-parasitic agent, an anti-viral agent, or an anesthetic agent.
[0343] In certain embodiments, the drug moiety of the antibody drug conjugates of the present invention is selected from a V-ATPase inhibitor, a HSP90 inhibitor, an IAP inhibitor, an mTor inhibitor, a microtubule stabilizer, a microtubule destabilizers, an auristatin, a dolastatin, a maytansinoid, a MetAP (methionine aminopeptidase), an inhibitor of nuclear export of proteins CRM1, a DPPIV inhibitor, proteasome inhibitors, an inhibitors of phosphoryl transfer reactions in mitochondria, a protein synthesis inhibitor, a kinase inhibitor, a CDK2 inhibitor, a CDK9 inhibitor, an EG5 inhibitor, an HDAC inhibitor, a DNA damaging agent, a DNA alkylating agent, a DNA intercalator, a DNA minor groove binder and a DHFR inhibitor.
[0344] Further, an anti-target antibody or antibody fragment may be conjugated to a drug moiety that modifies a given biological response. Drug moieties are not to be construed as limited to classical chemical therapeutic agents. For example, the drug moiety may be a protein, peptide, or polypeptide possessing a desired biological activity. Such proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, cholera toxin, or diphtheria toxin, a protein such as tumor necrosis factor, a-interferon, 8-interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, a cytokine, an apoptotic agent, an anti-angiogenic agent, or, a biological response modifier such as, for example, a lymphokine.
[0345] In one embodiment, an anti-target antibody or antibody fragment is conjugated to a drug moiety, such as a cytotoxin, a drug (e.g., an immunosuppressant) or a radiotoxin. Examples of cytotoxin include but are not limited to, taxanes (see, e.g., International (PCT) Patent Application Nos. WO 01/38318 and PCT/US03/02675), DNA-alkylating agents (e.g., CC-1065 analogs), anthracyclines, tubulysin analogs, duocarmycin analogs, auristatin E, auristatin F, maytansinoids, and cytotoxic agents comprising a reactive polyethylene glycol moiety (see, e.g., Sasse et al., J. Antibiot. (Tokyo), 53, 879-85 (2000), Suzawa et al., Bioorg. Med. Chem., 8, 2175-84 (2000), Ichimura et al., J. Antibiot. (Tokyo), 44, 1045-53 (1991), Francisco et al., Blood (2003) (electronic publication prior to print publication), U.S. Pat. Nos. 5,475,092, 6,340,701, 6,372,738, and 6,436,931, U.S. Patent Application Publication No. 2001/0036923 A1, Pending U.S. patent application Ser. Nos. 10/024,290 and 10/116,053, and International (PCT) Patent Application No. WO 01/49698), taxon, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, t. colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof. Therapeutic agents also include, for example, anti-metabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), ablating agents (e.g., mechlorethamine, thioepa chloraxnbucil, meiphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin, anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g., vincristine and vinblastine). (See e.g., Seattle Genetics US20090304721).
[0346] Other examples of therapeutic cytotoxins that can be conjugated to an anti-target antibody or antibody fragment include duocarmycins, calicheamicins, maytansines and auristatins, and derivatives thereof. An example of a calicheamicin antibody conjugate is commercially available (Mylotarg; Wyeth-Ayerst).
[0347] For further discussion of types of cytotoxins, linkers and methods for conjugating therapeutic agents to antibodies, see also Saito et al., (2003) Adv. Drug Deliv. Rev. 55:199-215; Trail et al., (2003) Cancer Immunol. Immunother. 52:328-337; Payne, (2003) Cancer Cell 3:207-212; Allen, (2002) Nat. Rev. Cancer 2:750-763; Pastan and Kreitman, (2002) Curr. Opin. Investig. Drugs 3:1089-1091; Senter and Springer, (2001) Adv. Drug Deliv. Rev. 53:247-264. According to the present invention, an anti-target antibody or antibody fragment can also be conjugated to a radioactive isotope to generate cytotoxic radiopharmaceuticals, referred to as radioimmunoconjugates. Examples of radioactive isotopes that can be conjugated to antibodies for use diagnostically or therapeutically include, but are not limited to, iodineI31, indium111, yttrium90, and lutetium177. Methods for preparing radioimmunoconjugates are established in the art. Examples of radioimmunoconjugates are commercially available, including Zevalin (DEC Pharmaceuticals) and Bexxar (Corixa Pharmaceuticals), and similar methods can be used to prepare radioimmunoconjugates using the antibodies of the invention. In certain embodiments, the macrocyclic chelator is 1,4,7,10-tetraazacyclododecane-N,N,N,N-tetraacetic acid (DOTA) which can be attached to the antibody via a linker molecule. Such linker molecules are commonly known in the art and described in Denardo et al., (1998) Clin Cancer Res. 4(10):2483-90; Peterson et al., (1999) Bioconjug. Chem. 10(4):553-7; and Zimmerman et al., (1999) Nucl. Med. Biol. 26(8):943-50, each incorporated by reference in their entireties.
[0348] The present invention further encompasses an anti-target antibody or antibody fragment conjugated to a heterologous protein or polypeptide (or fragment thereof, preferably to a polypeptide of at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 amino acids) to generate fusion proteins. In particular, the invention provides fusion proteins comprising an antibody fragment described herein (e.g., a Fab fragment, Fd fragment, Fv fragment, F(ab)2 fragment, a VH domain, a VH CDR, a VL domain or a VL CDR) and a heterologous protein, polypeptide, or peptide.
[0349] Additional fusion proteins may be generated through the techniques of gene-shuffling, motif-shuffling, exon-shuffling, and/or codon-shuffling (collectively referred to as DNA shuffling). DNA shuffling may be employed to alter the activities of antibodies of the invention or fragments thereof (e.g., antibodies or fragments thereof with higher affinities and lower dissociation rates). See, generally, U.S. Pat. Nos. 5,605,793, 5,811,238, 5,830,721, and 5,837,458; Patten et al., (1997) Curr. Opinion Biotechnol. 8:724-33; Harayama, (1998) Trends Biotechnol. 16(2):76-82; Hansson et al., (1999) J. Mol. Biol. 287:265-76; and Lorenzo and Blasco, (1998) Biotechniques 24(2):308-313 (each of these patents and publications are hereby incorporated by reference in its entirety). Antibodies or fragments thereof, or the encoded antibodies or fragments thereof, may be altered by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination. A polynucleotide encoding an antibody or fragment thereof that specifically binds to an antigen may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.
[0350] Moreover, an anti-target antibody or antibody fragment can be conjugated to marker sequences, such as a peptide to facilitate purification. In preferred embodiments, the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available. As described in Gentz et al., (1989) Proc. Natl. Acad. Sci. USA 86:821-824, for instance, hexa-histidine provides for convenient purification of the fusion protein. Other peptide tags useful for purification include, but are not limited to, the hemagglutinin (HA) tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., (1984) Cell 37:767), and the FLAG tag (A. Einhauer et al., J. Biochem. Biophys. Methods 49: 455-465, 2001). According to the present invention, antibodies or antigen binding fragments can also be conjugated to tumor-penetrating peptides in order to enhance their efficacy.
[0351] In other embodiments, an anti-target antibody or antibody fragment is conjugated to a diagnostic or detectable agent. Such immunoconjugates can be useful for monitoring or prognosing the onset, development, progression and/or severity of a disease or disorder as part of a clinical testing procedure, such as determining the efficacy of a particular therapy. Such diagnosis and detection can accomplished by coupling the antibody to detectable substances including, but not limited to, various enzymes, such as, but not limited to, horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; prosthetic groups, such as, but not limited to, streptavidin/biotin and avidin/biotin; fluorescent materials, such as, but not limited to, Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500, Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, Alexa Fluor 750, umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; luminescent materials, such as, but not limited to, luminol; bioluminescent materials, such as but not limited to, luciferase, luciferin, and aequorin; radioactive materials, such as, but not limited to, iodine (1311, 1251, 1231, and 1211,), carbon (14C), sulfur (35S), tritium (3H), indium (1151n, 1131n, 1121n, and 111In,), technetium (99Tc), thallium (201Ti), gallium (68Ga, 67Ga), palladium (103Pd), molybdenum (99Mo), xenon (133Xe), fluorine (18F), 153Sm, 177Lu, 159Gd, 149Pm, 140La, 175Yb, 166Ho, 90Y, 47Sc, 186Re, 188Re, 142 Pr, 105Rh, 97Ru, 68Ge, 57Co, 85Sr, 32P, 153Gd, 169Yb, 51Cr, 54Mn, 75Se, 64Cu, 113Sn, and 117Sn; and positron emitting metals using various positron emission tomographies, and non-radioactive paramagnetic metal ions.
[0352] An anti-target antibody or antibody fragment may also be attached to solid supports, which are particularly useful for immunoassays or purification of the target antigen. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.
Combination Therapies
[0353] Many potential combination partners exist for treatment with inhibition of a target, e.g., inhibition of targets disclosed in Tables 1 or 2. The treatment could be partnered with current standards of care in the cancer types to be treated, as well as potential future drugs that might be approved.
[0354] The term combination refers to either a fixed combination in one dosage unit form, or a combined administration where a compound of the present invention and a combination partner (e.g. another drug as explained below, also referred to as therapeutic agent or co-agent) may be administered independently at the same time or separately within time intervals, especially where these time intervals allow that the combination partners show a cooperative, e.g. synergistic effect. The single components may be packaged in a kit or separately. One or both of the components (e.g., powders or liquids) may be reconstituted or diluted to a desired dose prior to administration. The terms co-administration or combined administration or the like as utilized herein are meant to encompass administration of the selected combination partner to a single subject in need thereof (e.g. a patient), and are intended to include treatment regimens in which the agents are not necessarily administered by the same route of administration or at the same time. The term pharmaceutical combination as used herein means a product that results from the mixing or combining of more than one therapeutic agent and includes both fixed and non-fixed combinations of the therapeutic agents. The term fixed combination means that the therapeutic agents, e.g. a compound of the present invention and a combination partner, are both administered to a patient simultaneously in the form of a single entity or dosage. The term non-fixed combination means that the therapeutic agents, e.g. a compound of the present invention and a combination partner, are both administered to a patient as separate entities either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the two compounds in the body of the patient. The latter also applies to cocktail therapy, e.g. the administration of three or more therapeutic agent.
[0355] By combination, there is meant either a fixed combination in one dosage unit form, or a combined administration where a compound of the present invention and a combination partner may be administered independently at the same time or separately within time intervals that especially allow that the combination partners show a cooperative, e.g. synergistic effect. The single components may be packaged together in a kit or separately. One or both of the components (e.g., powders or liquids) may be reconstituted or diluted to a desired dose prior to administration.
[0356] The term pharmaceutical combination as used herein refers to either a fixed combination in one dosage unit form, or non-fixed combination or a kit of parts for the combined administration where two or more therapeutic agents may be administered independently at the same time or separately within time intervals, especially where these time intervals allow that the combination partners show a cooperative, e.g. synergistic effect.
[0357] The term combination therapy refers to the administration of two or more therapeutic agents to treat a therapeutic condition or disorder described in the present disclosure. Such administration encompasses co-administration of these therapeutic agents in a substantially simultaneous manner, such as in a single capsule having a fixed ratio of active ingredients. Alternatively, such administration encompasses co-administration in multiple, or in separate containers (e.g., tablets, capsules, powders, and liquids) for each active ingredient. Powders and/or liquids may be reconstituted or diluted to a desired dose prior to administration. In addition, such administration also encompasses use of each type of therapeutic agent in a sequential manner, either at approximately the same time or at different times. In either case, the treatment regimen will provide beneficial effects of the drug combination in treating the conditions or disorders described herein.
[0358] In certain instances, compounds of the present invention are combined with other therapeutic agents, such as other anti-cancer agents, anti-allergic agents, anti-nausea agents (or anti-emetics), pain relievers, cytoprotective agents, and combinations thereof.
[0359] General Chemotherapeutic agents considered for use in combination therapies include anastrozole (Arimidex), bicalutamide (Casodex), bleomycin sulfate (Blenoxane), busulfan (Myleran), busulfan injection (Busulfex), capecitabine (Xeloda), N4-pentoxycarbonyl-5-deoxy-5-fluorocytidine, carboplatin (Paraplatin), carmustine (BiCNU), chlorambucil (Leukeran), cisplatin (Platinol), cladribine (Leustatin), cyclophosphamide (Cytoxan or Neosar), cytarabine, cytosine arabinoside (Cytosar-U), cytarabine liposome injection (DepoCyt), dacarbazine (DTIC-Dome), dactinomycin (Actinomycin D, Cosmegan), daunorubicin hydrochloride (Cerubidine), daunorubicin citrate liposome injection (DaunoXome), dexamethasone, docetaxel (Taxotere), doxorubicin hydrochloride (Adriamycin, Rubex), etoposide (Vepesid), fludarabine phosphate (Fludara), 5-fluorouracil (Adrucil, Efudex), flutamide (Eulexin), tezacitibine, Gemcitabine (difluorodeoxycitidine), hydroxyurea (Hydrea), Idarubicin (Idamycin), ifosfamide (IFEX), irinotecan (Camptosar), L-asparaginase (ELSPAR), leucovorin calcium, melphalan (Alkeran), 6-mercaptopurine (Purinethol), methotrexate (Folex), mitoxantrone (Novantrone), mylotarg, paclitaxel (Taxol), phoenix (Yttrium90/MX-DTPA), pentostatin, polifeprosan 20 with carmustine implant (Gliadel), tamoxifen citrate (Nolvadex), teniposide (Vumon), 6-thioguanine, thiotepa, tirapazamine (Tirazone), topotecan hydrochloride for injection (Hycamptin), vinblastine (Velban), vincristine (Oncovin), and vinorelbine (Navelbine).
[0360] Anti-cancer agents of particular interest for combinations with the compounds of the present invention include fluorouracil (5-FU) and irinotecan.
[0361] Further compounds of particular interest for combinations with the compounds of the present invention include: EGFR-inhibitors, such as cetuximab, panitumimab, erlotinib, gefitinib and EGFRi NOS; MAPK-pathway inhibitors, such as BRAFi, panRAFi, MEKi, ERKi; PI3K-mTOR pathway inhibitors, such as alpha-specific PI3Ki, pan-class I PI3Ki, mTOR/PI3Ki, and particularly also evirolimus and analogues thereof.
[0362] Some patients may experience allergic reactions to the compounds of the present invention and/or other anti-cancer agent(s) during or after administration; therefore, anti-allergic agents are often administered to minimize the risk of an allergic reaction. Suitable anti-allergic agents include corticosteroids, such as dexamethasone (e.g., Decadron), beclomethasone (e.g., Beclovent), hydrocortisone (also known as cortisone, hydrocortisone sodium succinate, hydrocortisone sodium phosphate, and sold under the tradenames Ala-Corte, hydrocortisone phosphate, Solu-Cortef, Hydrocort Acetate and Lanacort), prednisolone (sold under the tradenames Delta-Cortel, Orapred, Pediapred and Prelone), prednisone (sold under the tradenames Deltasone, Liquid Red, Meticorten and Orasone), methylprednisolone (also known as 6-methylprednisolone, methylprednisolone acetate, methylprednisolone sodium succinate, sold under the tradenames Duralone, Medralone, Medrol, M-Prednisol and Solu-Medrol); antihistamines, such as diphenhydramine (e.g., Benadryl), hydroxyzine, and cyproheptadine; and bronchodilators, such as the beta-adrenergic receptor agonists, albuterol (e.g., Proventil), and terbutaline (Brethine).
[0363] Some patients may experience nausea during and after administration of the compound of the present invention and/or other anti-cancer agent(s); therefore, anti-emetics are used in preventing nausea (upper stomach) and vomiting. Suitable anti-emetics include aprepitant (Emend), ondansetron (Zofran), granisetron HCl (Kytril), lorazepam (Ativan. dexamethasone (Decadron), prochlorperazine (Compazine), casopitant (Rezonic and Zunrisa), and combinations thereof.
[0364] Medication to alleviate the pain experienced during the treatment period is often prescribed to make the patient more comfortable. Common over-the-counter analgesics, such Tylenol, are often used. However, opioid analgesic drugs such as hydrocodone/paracetamol or hydrocodone/acetaminophen (e.g., Vicodin), morphine (e.g., Astramorph or Avinza), oxycodone (e.g., OxyContin or Percocet), oxymorphone hydrochloride (Opana), and fentanyl (e.g., Duragesic) are also useful for moderate or severe pain.
[0365] In an effort to protect normal cells from treatment toxicity and to limit organ toxicities, cytoprotective agents (such as neuroprotectants, free-radical scavengers, cardioprotectors, anthracycline extravasation neutralizers, nutrients and the like) may be used as an adjunct therapy. Suitable cytoprotective agents include Amifostine (Ethyol), glutamine, dimesna (Tavocept), mesna (Mesnex), dexrazoxane (Zinecard or Totect), xaliproden (Xaprila), and leucovorin (also known as calcium leucovorin, citrovorum factor and folinic acid).
[0366] The structure of the active compounds identified by code numbers, generic or trade names may be taken from the actual edition of the standard compendium The Merck Index or from databases, e.g. Patents International (e.g. IMS World Publications).
[0367] The above-mentioned compounds, which can be used in combination with a compound of the present invention, can be prepared and administered as described in the art, such as in the documents cited above.
[0368] In one embodiment, the present invention provides pharmaceutical compositions comprising at least one compound of the present invention (e.g., a compound of the present invention) or a pharmaceutically acceptable salt thereof together with a pharmaceutically acceptable carrier suitable for administration to a human or animal subject, either alone or together with other anti-cancer agents.
[0369] In one embodiment, the present invention provides methods of treating human or animal subjects suffering from a cellular proliferative disease, such as cancer. The present invention provides methods of treating a human or animal subject in need of such treatment, comprising administering to the subject a therapeutically effective amount of a compound of the present invention (e.g., a compound of the present invention) or a pharmaceutically acceptable salt thereof, either alone or in combination with other anti-cancer agents.
[0370] In particular, compositions will either be formulated together as a combination therapeutic or administered separately.
[0371] In combination therapy, the compound of the present invention and other anti-cancer agent(s) may be administered either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the two compounds in the body of the patient.
[0372] In a preferred embodiment, the compound of the present invention and the other anti-cancer agent(s) is generally administered sequentially in any order by infusion or orally. The dosing regimen may vary depending upon the stage of the disease, physical fitness of the patient, safety profiles of the individual drugs, and tolerance of the individual drugs, as well as other criteria well-known to the attending physician and medical practitioner(s) administering the combination. The compound of the present invention and other anti-cancer agent(s) may be administered within minutes of each other, hours, days, or even weeks apart depending upon the particular cycle being used for treatment. In addition, the cycle could include administration of one drug more often than the other during the treatment cycle and at different doses per administration of the drug.
[0373] In another aspect of the present invention, kits that include one or more compound of the present invention and a combination partner as disclosed herein are provided. Representative kits include (a) a compound of the present invention or a pharmaceutically acceptable salt thereof, (b) at least one combination partner, e.g., as indicated above, whereby such kit may comprise a package insert or other labeling including directions for administration.
[0374] A compound of the present invention may also be used to advantage in combination with known therapeutic processes, for example, the administration of hormones or especially radiation. A compound of the present invention may in particular be used as a radiosensitizer, especially for the treatment of tumors which exhibit poor sensitivity to radiotherapy.
Assaying for Biomarkers and Inhibitor Treatment
[0375] The invention provides, among other things, an assay for the detection of the identity of the nucleic acid sequence and amino acid sequence for a target, e.g., any of the targets disclosed in Tables 1 or 2. The method can include detecting the mutation in a body fluid such as blood (e.g., serum or plasma) bone marrow, cerebral spinal fluid, peritoneal/pleural fluid, lymph fluid, ascite, serous fluid, sputum, lacrimal fluid, stool, and urine, or in a tissue such as a tumor tissue. The tumor tissue can be fresh tissue or paraffin-embedded tissue.
[0376] A number of patient stratification strategies could be employed to find patients likely to be sensitive to a target, e.g., any of the targets disclosed in Tables 1 or 2, depletion, including but not limited to: testing for microsatellite instability, screening for mutations, amplifications, duplications or deletions of target genes, and testing for target or target-associated molecule expression (e.g., mRNA or protein) or activity (e.g., enzyme activity).
[0377] Once a patient has been assayed for target status and predicted to be sensitive to treatment with a target specific inhibitor, administration of an inhibitor to the target, e.g., an inhibitor disclosed herein, to a patient can be affected in one dose, continuously or intermittently throughout the course of treatment. Methods of determining the most effective means and dosage of administration are well known to those of skill in the art and will vary with the composition used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician. Suitable dosage formulations and methods of administering the agents may be empirically adjusted.
[0378] Different inhibitors can be administered and followed by determining the status of the target. In this embodiment, more than one inhibitor of a target, e.g., any of the targets disclosed in Tables 1 or 2, is chosen and administered to the patient. Target expression, e.g., RNA or protein, or activity can then be assayed for after administration of each different inhibitor. This assay can also be done at multiple timepoints after administration of the different inhibitor. For example, a first inhibitor could be administered to the patient and target expression, e.g., RNA or protein, or activity assayed for at 1 hour, 2 hours, 3 hours, 4 hours, 8 hours, 16 hours, 24 hours, 48 hours, 3 days, 1 week or 1 month or several months after administration. A second inhibitor could then be administered and target expression, e.g., RNA or protein, or activity can be assayed for again at 1 hour, 2 hours, 3 hours, 4 hours, 8 hours, 16 hours, 24 hours, 48 hours, 3 days, 1 week or 1 month or several months after administration of the second inhibitor.
[0379] It is well known in the art that cancers can become resistant to chemotherapeutic treatment, especially when that treatment is prolonged. Determining the presence of target expression, e.g., RNA or protein, or activity can be done after prolonged treatment with any chemotherapeutic to determine if the cancer would be sensitive to the inhibitor. If the patient has been previously treated with another chemotherapeutic or another inhibitor, it is useful to assay for a target expression, e.g., RNA or protein, or activity to determine if the tumor is sensitive to the inhibitor of the target. This assay can be especially beneficial to the patient if the cancer goes into remission and then re-grows or has metastasized to a different site.
Sample Preparation
[0380] Body fluid samples can be obtained from a subject using any of the methods known in the art. Methods for extracting cellular DNA from body fluid samples are well known in the art. Typically, cells are lysed with detergents. After cell lysis, proteins are removed from DNA using various proteases. DNA is then extracted with phenol, precipitated in alcohol, and dissolved in an aqueous solution. Methods for extracting acellular DNA from body fluid samples are also known in the art. Commonly, a cellular DNA in a body fluid sample is separated from cells, precipitated in alcohol, and dissolved in an aqueous solution.
[0381] Generally, a solid tumor sample can be a test sample of cells or tissue that are obtained from a subject with cancer by biopsy or surgical resection. A sample of cells or tissue can be removed by needle aspiration biopsy. For this, a fine needle attached to a syringe is inserted through the skin and into the tissue of interest. The needle is typically guided to the region of interest using ultrasound or computed tomography (CT) imaging. Once the needle is inserted into the tissue, a vacuum is created with the syringe such that cells or fluid may be sucked through the needle and collected in the syringe. A sample of cells or tissue can also be removed by incisional or core biopsy. For this, a cone, a cylinder, or a tiny bit of tissue is removed from the region of interest. CT imaging, ultrasound, or an endoscope is generally used to guide this type of biopsy. More particularly, the entire cancerous lesion may be removed by excisional biopsy or surgical resection. In the present invention, the test sample is typically a sample of cells removed as part of surgical resection.
[0382] The test sample of, for example tissue, may also be stored in, e.g., RNAlater (Ambion; Austin Tex.) or flash frozen and stored at 80 C. for later use. The biopsied tissue sample may also be fixed with a fixative, such as formaldehyde, paraformaldehyde, or acetic acid/ethanol. The fixed tissue sample may be embedded in wax (paraffin) or a plastic resin. The embedded tissue sample (or frozen tissue sample) may be cut into thin sections. RNA or protein may also be extracted from a fixed or wax-embedded tissue sample.
[0383] Cancers amenable for treatment according to the present invention include any of the cancers disclosed in Tables 1 or 2, as well as other possible cancer types with microsatellite instability, gene amplifications, duplications, deletions or mutations.
Measurement of Gene Expression
[0384] Detection of gene expression can be by any appropriate method, including for example, detecting the quantity of mRNA transcribed from the gene or the quantity of cDNA produced from the reverse transcription of the mRNA transcribed from the gene or the quantity of the polypeptide or protein encoded by the gene. These methods can be performed on a sample by sample basis or modified for high throughput analysis. For example, using Affymetrix U133 microarray chips.
[0385] In one aspect, gene expression is detected and quantitated by hybridization to a probe that specifically hybridizes to the appropriate probe for that biomarker. The probes also can be attached to a solid support for use in high throughput screening assays using methods known in the art. WO 97/10365 and U.S. Pat. Nos. 5,405,783; 5,412,087 and 5,445,934, for example, disclose the construction of high density oligonucleotide chips which can contain one or more of the sequences disclosed herein. Using the methods disclosed in U.S. Pat. Nos. 5,405,783; 5,412,087 and 5,445,934, the probes of this invention are synthesized on a derivatized glass surface. Photoprotected nucleoside phosphoramidites are coupled to the glass surface, selectively deprotected by photolysis through a photolithographic mask, and reacted with a second protected nucleoside phosphoramidite. The coupling/deprotection process is repeated until the desired probe is complete.
[0386] In one aspect, the expression level of a gene is determined through exposure of a nucleic acid sample to the probe-modified chip. Extracted nucleic acid is labeled, for example, with a fluorescent tag, preferably during an amplification step. Hybridization of the labeled sample is performed at an appropriate stringency level. The degree of probe-nucleic acid hybridization is quantitatively measured using a detection device. See U.S. Pat. Nos. 5,578,832 and 5,631,734.
Alternatively any one of gene copy number, transcription, or translation can be determined using known techniques. For example, an amplification method such as PCR may be useful. General procedures for PCR are taught in MacPherson et al., PCR: A Practical Approach, (IRL Press at Oxford University Press (1991)). However, PCR conditions used for each application reaction are empirically determined. A number of parameters influence the success of a reaction. Among them are annealing temperature and time, extension time, Mg.sup.2+ and/or ATP concentration, pH, and the relative concentration of primers, templates, and deoxyribonucleotides. After amplification, the resulting DNA fragments can be detected by agarose gel electrophoresis followed by visualization with ethidium bromide staining and ultraviolet illumination.
In one embodiment, the hybridized nucleic acids are detected by detecting one or more labels attached to the sample nucleic acids. The labels can be incorporated by any of a number of means well known to those of skill in the art. However, in one aspect, the label is simultaneously incorporated during the amplification step in the preparation of the sample nucleic acid. Thus, for example, polymerase chain reaction (PCR) with labeled primers or labeled nucleotides will provide a labeled amplification product. In a separate embodiment, transcription amplification, as described above, using a labeled nucleotide (e.g. fluorescein-labeled UTP and/or CTP) incorporates a label in to the transcribed nucleic acids.
[0387] Alternatively, a label may be added directly to the original nucleic acid sample (e.g., mRNA, polyA, mRNA, cDNA, etc.) or to the amplification product after the amplification is completed. Means of attaching labels to nucleic acids are well known to those of skill in the art and include, for example nick translation or end-labeling (e.g. with a labeled RNA) by kinasing of the nucleic acid and subsequent attachment (ligation) of a nucleic acid linker joining the sample nucleic acid to a label (e.g., a fluorophore).
[0388] Detectable labels suitable for use in the present invention include any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means. Useful labels in the present invention include biotin for staining with labeled streptavidin conjugate, magnetic beads (e.g., Dynabeads), fluorescent dyes (e.g., fluorescein, Texas red, rhodamine, green fluorescent protein, and the like), radiolabels (e.g., 3H, 1251, 35S, 14C, or 32P) enzymes (e.g., horse radish peroxidase, alkaline phosphatase and others commonly used in an ELISA), and calorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads. Patents teaching the use of such labels include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241.
[0389] Detection of labels is well known to those of skill in the art. Thus, for example, radiolabels may be detected using photographic film or scintillation counters, fluorescent markers may be detected using a photodetector to detect emitted light. Enzymatic labels are typically detected by providing the enzyme with a substrate and detecting the reaction product produced by the action of the enzyme on the substrate, and calorimetric labels are detected by simply visualizing the coloured label.
[0390] The detectable label may be added to the target (sample) nucleic acid(s) prior to, or after the hybridization, such as described in WO 97/10365. These detectable labels are directly attached to or incorporated into the target (sample) nucleic acid prior to hybridization. In contrast, indirect labels are joined to the hybrid duplex after hybridization. Generally, the indirect label is attached to a binding moiety that has been attached to the target nucleic acid prior to the hybridization. For example, the target nucleic acid may be biotinylated before the hybridization. After hybridization, an avidin-conjugated fluorophore will bind the biotin bearing hybrid duplexes providing a label that is easily detected. For a detailed review of methods of labeling nucleic acids and detecting labeled hybridized nucleic acids see Laboratory Techniques in Biochemistry and Molecular Biology, Vol. 24: Hybridization with Nucleic Acid Probes, P. Tijssen, ed. Elsevier, N.Y. (1993).
Detection of Polypeptides
[0391] Expression level of a target, e.g., any of the targets disclosed in Tables 1 or 2, can be determined by examining protein expression or the protein product. Determining the protein level involves measuring the amount of any immunospecific binding that occurs between an antibody that selectively recognizes and binds to the polypeptide of the biomarker in a sample obtained from a patient and comparing this to the amount of immunospecific binding of at least one biomarker in a control sample. The amount of protein expression of the target can be increased or reduced when compared with control expression.
[0392] A variety of techniques are available in the art for protein analysis. They include but are not limited to radioimmunoassays, ELISA (enzyme linked immunosorbent assays), sandwich immunoassays, immunoradiometric assays, in situ immunoassays (using e.g., colloidal gold, enzyme or radioisotope labels), Western blot analysis, immunoprecipitation assays, immunofluorescent assays, flow cytometry, immunohistochemistry, HPLC, mass spectrometry, confocal microscopy, enzymatic assays, surface plasmon resonance and PAGE-SDS. In one embodiment, a method of determining if a subject afflicted with a cancer will respond to therapeutic treatment with an inhibitor, e.g., an inhibitor of any of the targets disclosed in Tables 1 or 2, is provided.
[0393] The inhibitor may be selected from the group consisting of an RNA inhibitor (e.g., an RNAi agent), a CRISPR, a TALEN, a zinc finger nuclease, an mRNA, a miRNA, an antibody or derivative thereof, a chimeric antigen receptor T cell (CART) or a low molecular weight compound.
The inhibitor is a short hairpin RNA (shRNA) or a short inhibitory RNA (siRNAs).
[0394] In one embodiment, a method of determining the sensitivity of a cancer cell associated with the loss of target function through an inhibitor is provided.
[0395] In one embodiment, a method of screening for inhibitors of target is provided. The method comprises contacting a sample containing one or more cells harboring one or more mutations, amplification, deletions or microsatellite instability with an inhibitor of the target; measuring the reduction in viability of said cells in said sample; contacting a similar sample containing one or more cells harboring one or more mutations, amplifications, deletions or microsatellite instability with a known inhibitor of the target; measuring the reduction in viability of said cells in said similar sample; comparing the reduction in viability of said cells harboring one or more mutations, amplifications, deletions, or microsatellite instability from said sample with viability of said similar sample, wherein a similar reduction in viability indicates said candidate sample is an inhibitor of the target.
[0396] In one embodiment, a therapeutic method of treating a subject afflicted with a cancer associated with a genetic alteration disclosed in Table 2 is provided, comprising the steps of: contacting a sample obtained from said subject with a reagent capable of detecting human cancer cells harboring one or more mutations, amplifications, deletions, or microsatellite instabilities; comparing the sample obtained from said afflicted subject with a similar sample taken from a non-cancerous or normal control subject, wherein the presence of one or mutations, amplifications, deletions or microsatellite instability in said sample obtained from said afflicted subject indicates said afflicted subject will respond to therapeutic treatment with an inhibitor of the target, e.g., an inhibitor disclosed herein; and administering a therapeutically effective amount of the inhibitor to those subjects.
[0397] In one embodiment, a therapeutic method of treating a subject afflicted with a cancer associated with a genetic alteration disclosed in Table 2 comprising the steps of: contacting a sample obtained from said subject with a reagent capable of detecting human cancer cells harboring one or more mutations, amplifications, deletions or microsatellite instability; comparing the sample obtained from said afflicted subject with a similar sample taken from a non-cancerous or normal control subject, wherein the presence of one or more mutations, amplifications, deletions or microsatellite instability in said sample obtained from said afflicted subject indicates said afflicted subject will respond to therapeutic treatment with an inhibitor of the target, e.g., an inhibitor disclosed herein; and administering a therapeutically effective amount of the composition according to an aspect of the invention.
[0398] In one embodiment, a method of determining if a subject afflicted with a cancer associated with a genetic alteration disclosed in Table 2 will respond to therapeutic treatment with an inhibitor, e.g., an inhibitor of any of the target disclosed in Tables 1 or 2 is provided, comprising: contacting a sample obtained from said subject with a reagent capable of detecting human cancer cells exhibiting target protein loss of function; and comparing the sample obtained from said afflicted subject with a similar sample taken from a non-cancerous or normal control subject, wherein the detection of target protein loss of function in said sample obtained from said afflicted subject indicates said afflicted subject will respond to therapeutic treatment with an inhibitor of the target.
[0399] In one embodiment, a method of determining if a subject afflicted with a cancer associated with a genetic alteration disclosed in Table 2 will respond to therapeutic treatment with an inhibitor of the target, e.g., a target associated with the genetic alteration disclosed in Table 2 is provided, comprising: contacting a sample obtained from said subject with a reagent capable of detecting human cancer cells exhibiting lack of expression of the target; and comparing the sample obtained from said afflicted subject with a similar sample taken from a non-cancerous or normal control subject, wherein the detection of lack of expression of target in said sample obtained from said afflicted subject indicates said afflicted subject will not respond to therapeutic treatment with an inhibitor of the target.
[0400] In one embodiment, a method of determining if a subject afflicted with a cancer associated with a genetic alteration disclosed in Table 2 will respond to therapeutic treatment with an inhibitor of the target, e.g., a target associated with the genetic alteration disclosed in Table 2 is provided, comprising: contacting a sample obtained from said subject with a reagent capable of detecting human cancer cells exhibiting expression of the target; and comparing the sample obtained from said afflicted subject with a similar sample taken from a non-cancerous or normal control subject, wherein the detection of expression of target in said sample obtained from said afflicted subject indicates said afflicted subject will respond to therapeutic treatment with an inhibitor of the target.
Kits
[0401] Kits for assessing the activity of any inhibitor, e.g., an inhibitor to any of the targets disclosed in Tables 1 or 2, can be made. For example, a kit comprising nucleic acid primers for PCR or for microarray hybridization for a mutation, amplification, deletion, duplication or microsatellite instability can be used for assessing target inhibitor sensitivity.
[0402] In some embodiments kits related to methods of the invention are provided. In one embodiment, the kit comprises a solid support, and a DNA comprising a nucleotide sequence capable of detecting mutations, amplifications, deletions, duplications or instability, wherein the DNA is coupled to the support.
[0403] In one embodiment, a kit for predicting the sensitivity of a subject afflicted with a cancer associated with microsatellite instability, mutations, amplifications, deletions, target or target-associated molecule expression (e.g., high or low mRNA or protein expression) or activity, such as a cancer associated with mutations, amplifications, deletions, duplications, microsatellite instability, or target or target-associated molecule expression for treatment with an inhibitor is provided. The kit comprises: i) reagents capable of: a) detecting human cancer cells harboring one or more mutations, amplifications, deletions, duplications or microsatellite instability; or b) detecting expression level (e.g., mRNA or protein), or activity (e.g., enzyme activity), of a target (e.g., a target of the inhibitor administered) or a target-associated molecule (e.g., a downstream effector disclosed in Table 2) in human cancer cells from a subject; and ii) instructions for how to use said kit.
EXAMPLES
Example 1: DRIVE (Deep RNAi Interrogation of Viability Effects in Cancer) Screen to Map Cancer Dependencies and Identify Genes Important for Cell Viability
[0404] To map cancer dependencies and identify genes important for cell viability in specific genetic and lineage subtypes of cancer, a large-scale RNAi screen was conducted. This screen is referred to as project DRIVE (Deep RNAi Interrogation of Viability Effects in cancer). In DRIVE, a lentiviral library was produced targeting 7837 human genes with a median of 20 shRNAs per gene and used to screen 398 cancer cell lines in a pooled format to ascertain the effect on cell viability.
Library Construction and Virus Production
[0405] The DRIVE library was synthesized by Cellecta as independent pools and were ordered from Cellecta using the following library ID numbers: 55K_PoolA-MS-NOVA; 55K_PooIB-MS-NOVA; 27KBGP2-MS-NOVA; 13K-hTF-GH-NOVA; 13K-hYAP-GH-NOVA; 13K-hEPl2-GHNOVA. Pool A, Pool B and a combination of the other libraries (BGP2, TF, YAP, EP12 combination is referred to as BGPD pool) were cloned in the pRSI16cb-U6-sh-13kCB18-HTS6-UbiC-TagRFP-2A-Puro vector. The DRIVE viral packaging was scaled up to 5-layer Cellstack (Corning, Cat No, 22250-152). 2.110{circumflex over ()}8 293T cells were plated on one 5-layer Cellstack 24 hours prior to transfection. Cells were transfected according to the manufacturer's recommended protocol (Cellecta). For each 5-layer Cellstack, cells were transfected using 510.3 L of TransIT reagent diluted into 18.4 ml of OPTI-MEM that was combined with 75.6 g of the plasmid pool and 94.5 g of the Cellecta packaging mix (containing the psPAX2 and pMD2 plasmids that encode Gag/Pol and VSV-G respectively). Virus was harvested at 72 hours post transfection, aliquoted, and frozen at 80C for later use. Viral titers were measured and benchmarked against a reference virus that was used to assess infectability of each screened cell line.
Screening Approach
[0406] 383 of the cell lines are part of the original Cancer Cell Line Encyclopedia (CCLE) and were handled accordingly while the remaining 15 lines were kindly provided by investigators. All models are regularly tested for being free of mycoplasma and their identity verified, both for the banked stocks (e.g., starting material for screen) as well as upon completion of screen (extracted gDNA for NGS). A 79 SNP identification panel has been uploaded to the CCLE website by the CCLE team to allow investigators to readily identify CCLE cell lines. For each cell line the optimal puromycin dose required to achieve >95% cell killing in 72 hours was determined by measuring cell viability with a Cell Titer Glo or a Methylene blue staining assay for a 6-point dose response ranging from 0 to 8 g of puromycin. The volume of virus required to give an MOI of 0.5 (for delivery of only one shRNA per cell) was determined using a point dose response ranging from 0 to 400 L of viral supernatant in the presence of 8 g/ml polybrene. Infectivity was determined using titered virus from the library backbone vector expressing RFP and measuring the % RFP-positive cells by FACS 4 days post-infection after three days of puromycin selection. Cell lines that could not pass these screening characterization criteria (puromycin sensitivity, reasonable infectivity and RFP positivity) did not enter the final screening queue.
[0407] The three DRIVE libraries were screened as independent pools across 398 cell lines. The cells were infected to maintain 1000 library representation during the duration of the 2 week viability screen. For large-scale infections, 90 million cells (per library) were plated 24 hrs prior to infection in 5-layer CelISTACK culture chambers (Corning) in 500 ml of medium (one CelISTACK per library). On the day of infection, the culture media was replaced with 500 ml of fresh media containing 8 g/ml polybrene and required volume of virus for MOI of 0.5 was added. 24 hrs after infection the culture media was replaced with 500 ml fresh media containing puromycin at the cell line-specific concentration. 72 hrs following puromycin addition, cells were trypsinized, and 70-90 million cells were re-plated in 5-layer CelISTACK culture chambers. An aliquot of cells was used to measure transduction efficiency determined by measuring the RFP positive cells and was typically >90-95%. Cells were maintained in culture and passaged as needed to ensure they did not exceed 90% confluence during the course of the screen. At each split, 70-90 million cells were passaged into new flasks, ensuring a representation of >1000 cells/shRNA in the library and the % RFP positive cells was measured to ensure stability of the transduced population over time. 14 days after infection, cells were trypsinized and samples of 70-90 million cells were harvested by centrifugation and stored at 80 C. prior to gDNA extraction.
Purification of Genomic DNA & PCR for Library production and Next Generation Sequencing
[0408] Cell pellets were processed according to the QIAamp DNA Blood Maxi Spin Protocol (Cat #51192), and the resulting genomic DNA resuspended in 2mls Qiagen buffer AE. Genomic DNA concentrations were measured using a Picogreen dye-binding assay giving a typical yield of 1 g gDNA per million cells. For Next Generation Sequencing (NGS) library generation, the barcodes are PCR amplified in 24 independent 100 L PCR reactions using 4 g of input gDNA per reaction with Titanium Taq, a single forward primer and one of 24 indexing oligos (as listed below) for 30 cycles. Library input DNA was also sequenced and referred to as plasmid counts in the provided raw data. 24 independent PCR reactions were pooled and purified using the Agencourt AMPure XP PCR cleanup kit (Beckman Coulter). The resulting products were analyzed by agarose e-gel to confirm the expected 190 bp product and the amount of purified product quantified using the Advanced Analytical Fragment Analyzer. Barcode representation was measured on the Illumine 2500 platform. For good representation of each shRNA in the NGS data, 40-60 million raw Illumine sequence reads were required per sample averaging approximately 1000 reads per shRNA. Note that the individual plasmid pools for each shRNA library were spiked into each NGS flowcell at 15% of the total loading volume as normalization controls.
From Raw Counts to shRNA Level Scores to Gene Level Scores
[0409] The drop-out value for each shRNA was calculated using the Bioconductor R package EdgeR (Robinson et al., 2010). The plasmid and sample raw counts per shRNAs were normalized in pairs using the Timed Mean of M-values (TMM) normalization. In the rare event that the plasmid spike-in failed to generate sufficient counts (<20 million total reads per plasmid) to be used as a normalization control then a virtual library was used in place of plasmid counts. This virtual library is obtained by equalizing the library size of the available plasmid libraries counts using the equalizeLibSizes function in edgeR and rounding the mean pseudo count of the resulting output to the nearest integer. The edgeR negative binomial model is fitted to obtain the log fold change (logFC) of counts between the sample and plasmid (the parameters used are common dispersion=0.2 and prior count=12). This is performed for each sample-plasmid pair to obtain a logFC per shRNA per cell line. Additionally this procedure is performed on each pool individually. The logFC are then normalized per sample using a quantile normalization to obtain a shRNA level sensitivity score. The shRNA level scores are further aggregated to gene level sensitivity scores using either the ATARiS algorithm (Shao et al., 2013) or the RSA algorithm (Konig et al., 2007). RSA uses all the shRNAs per gene to give a measure of the statistical significance of the drop-out of those 20 shRNAs compared to the background of the rest of the shNRAs logFC. The method is directional and only captures shRNA drop-out, not growth enhancing shRNAs. Additionally every gene incorporated in the screen is aggregated into a RSA score. ATARiS only uses the shRNAs which display consistent profiles across the 398 samples, thus mitigating the potential issue of off-targets. Additionally, inert genes will not generate ATARiS scores since the shRNAs are unlikely to correlate. The ATARiS algorithm can serially produce multiple solutions depending on the number of clusters of shRNA showing consistent phenotype across the cell lines. In those cases only the first solution is reported which generally represents the solution with the most shRNA (i.e. 84% of cases). Finally, the procedure from raw counts to gene level scores is performed on each pool independently from each other.
Quality Control
[0410] Several QC metrics were considered when running the analysis pipeline. Those metrics were recorded and analysed in aggregate to identify potential outlier samples. In particular at the read count level the total number of read counts in each sample, the frequency of the most abundant shRNA, and the third quartile of the read counts after library size scaling were considered and recorded. After logFC estimation of the individual shRNA the proportion of pan-lethal genes represented in the lowest quartile within each sample was also considered. The proportion of shRNAs with logFC below the quantile with p=0.05 across samples was kept in order to identify potential hyper-sensitive lines. Finally some shRNAs are present in all three pools and the correlation of those shRNA logFC levels across the pools was assessed. Those metrics were then considered in aggregate to identify outliers which were removed.
Identifying Outlier Sensitivity Profiles
[0411] The distribution of the sensitivity scores can be used to identify potential genes of interest. In particular one hopes to prioritize genes which are neither inert nor essential, but display differential sensitivity across samples, i.e. a subset of samples is strongly sensitive to the knock down, while the rest is unaffected. To identify these profiles a Likelihood Ratio Test-based method was used (i.e. Normality LRT) which identifies profiles whose distribution diverge the most from the normal distribution. For each gene both a normal distribution and a skew Student t distribution are fitted to the distribution of sensitivity scores across all cell lines. The Normality LRT score is twice the log of the likelihood ratio of the fitted skewed distribution over the likelihood of the fitted normal distribution, i.e. the difference between the deviance of the two models.
TABLE-US-00003 TABLE3 Primersusedforsequencing SEQID NO Index Name Sequenceinthe5to3direction 3 1 DRIVEPCR CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 4 2 DRIVEPCR CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 5 3 DRIVEPCR CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 6 4 DRIVEPCR CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 7 5 DRIVEPCR CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 8 6 DRIVEPCR CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 9 7 DRIVEPCR CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGA RevPrimer GTTCAGACGTGTGCTCTTCCGATCTgaggttcagagttct acagtccGAA 10 8 DRIVEPCR CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 11 9 DRIVEPCR CAAGCAGAAGACGGCATACGAGATTTGACTGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 12 10 DRIVEPCR CAAGCAGAAGACGGCATACGAGATGGAACTGTGACTGGA RevPrimer GTTCAGACGTGTGCTCTTCCGATCTgaggttcagagttct acagtccGAA 13 11 DRIVEPCR CAAGCAGAAGACGGCATACGAGATTGACATGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 14 12 DRIVEPCR CAAGCAGAAGACGGCATACGAGATGGACGGGTGACTGGA RevPrimer GTTCAGACGTGTGCTCTTCCGATCTgaggttcagagttct acagtccGAA 15 13 DRIVEPCR CAAGCAGAAGACGGCATACGAGATCTCTACGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 16 14 DRIVEPCR CAAGCAGAAGACGGCATACGAGATGCGGACGTGACTGGA RevPrimer GTTCAGACGTGTGCTCTTCCGATCTgaggttcagagttct acagtccGAA 17 15 DRIVEPCR CAAGCAGAAGACGGCATACGAGATTTTCACGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 18 16 DRIVEPCR CAAGCAGAAGACGGCATACGAGATGGCCACGTGACTGGA RevPrimer GTTCAGACGTGTGCTCTTCCGATCTgaggttcagagttct acagtccGAA 19 17 DRIVEPCR CAAGCAGAAGACGGCATACGAGATCGAAACGTGACTGGA RevPrimer GTTCAGACGTGTGCTCTTCCGATCTgaggttcagagttct acagtccGAA 20 18 DRIVEPCR CAAGCAGAAGACGGCATACGAGATCGTACGGTGACTGGA RevPrimer GTTCAGACGTGTGCTCTTCCGATCTgaggttcagagttct acagtccGAA 21 19 DRIVEPCR CAAGCAGAAGACGGCATACGAGATCCACTCGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 22 20 DRIVEPCR CAAGCAGAAGACGGCATACGAGATATCAGTGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 23 21 DRIVEPCR CAAGCAGAAGACGGCATACGAGATAGGAATGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 24 22 DRIVEPCR CAAGCAGAAGACGGCATACGAGATCTTTTGGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 25 23 DRIVEPCR CAAGCAGAAGACGGCATACGAGATTAGTTGGTGACTGGAG RevPrimer TTCAGACGTGTGCTCTTCCGATCTgaggttcagagttcta cagtccGAA 26 24 DRIVEPCR CAAGCAGAAGACGGCATACGAGATCCGGTGGTGACTGGA RevPrimer GTTCAGACGTGTGCTCTTCCGATCTgaggttcagagttct acagtccGAA 27 25 DRIVEPCR AATGATACGGCGACCACCGAGATCTACACATTCGCACCAG FWD CACGCTACGCA Universal Primer
Feature Association
[0412] To find potential hypotheses explaining the observed sensitivity profiles an automated separation of the samples population into sensitive and insensitive lines was performed for each gene using a k-means clustering method with k=3. The two extreme populations were designated as sensitive and insensitive, while the intermediate cluster was not used further. A differential representation of the known CCLE features across the two remaining populations was systematically undertaken to identify potential explanatory features (mutation, CNA, gene expression). The type of test performed was dependent on the feature type: Fisher Exact test for mutation, Wilcoxon test for CNA and Bioconductor Limma (Ritchie et al., 2015) for expression. The resulting p-values were adjusted for multiple testing within each feature type using the Benjamini Hochberg correction.
GO Term Enrichment
[0413] The enrichment of GO terms within the essential genes of the screen compared to the remaining genes of the screen was calculated. For this purpose essential genes were defined as genes with 50% or more cell lines displaying an RSA score below 3 upon knock down. For this analysis only the GO terms with 50 or more genes were considered (not restricted to the genes in the screen). For each remaining biological process GO term a contingency table was built using the number of essential genes within the term, the number of essential genes outside the term, the number of non-essential genes within the term and the number of non-essential genes outside the term in each of the entry of the 22 matrix. A Chi-square test was then performed on the resulting contingency table and the top 5 most enriched Biological Process GO terms among the essential genes were reported. The Benjamini Hochberg procedure was used to correct for multiple testing.
DRIVE Sensitivity Network
[0414] The DRIVE data was also used to build a co-sensitivity network (similarly to co-expression networks in expression datasets). In this case genes were used as vertices and the correlation between the sensitivity profiles of two genes defined the weight of the edge linking them (the correlation is performed across all samples using the Pearson correlation). To visualize the topology of the whole network in two dimensions a t-distributed Stochastic Neighbour Embedding (tSNE) (van der Maaten and Hinton, 2008) is used whereby the distance between two genes is defined as the square of one minus the absolute value of the correlation (1abs(cor)){circumflex over ()}2. t-SNE is a non-linear dimension reduction technique which models similar points in high dimension by nearby points in the lower dimensional space although this is not always possible. The original network is high dimensional and reducing it to only two-dimensions does necessarily result in information loss. This can be seen in
Coloring Scheme
[0415] Throughout the various figures a consistent coloring scheme was used whenever we represented CN or expression values. Namely the color is saturated to blue or red among the lowest and highest 10% of samples respectively. The median value is colored light grey and a linear scale is used between the 10th and 50th percentile (blue to grey) and 50th to 90th percentile (grey to red).
shRNA Power Analysis
[0416] To perform the shRNA power analysis we used a subset of the BGPD pool, focusing on 1381 genes with 20 and only 20 shRNAs per gene. The ATARiS solutions were built for each of the 1381 genes and the outlierness by Normality LRT was calculated. The top 100 outlier genes were recorded and used for further analysis. The ATARiS calculation was then performed on those 100 genes with 5, 10 and 15 shRNAs selected at random. This process was repeated 10 times with random resampling of the selected shRNAs. In each iteration, we recorded the number of top outlier genes for which an ATARiS solution was found.
Compound Sensitivity Calls and Comparison to DRIVE Profiles
[0417] The compound sensitivity calls are based on the results available in the CCLE (Barretina et al., 2012) and in the BYL719 report (Fritsch et al., 2014) whereby the Amax (maximum observed response) and EC50 (inflection point) using an 8-point dose-response matrix are combined to assess cell line sensitivity to compound treatment. Starting from the vector of responses Amax or EC50, we considered the distribution of response values (for Amax, log-transformed EC50) in order to assign cell lines into sensitive, and non-sensitive classes using a combination of EC50 and Amax cutoffs in a compound specific manner. In particular the cell lines below both of the following cutoffs were deemed sensitive: Amax=40% and EC50=1.95 M for Erlotinib, Amax=40% and EC50=1.95 M for PLX4720, Amax=40% and EC50=1.28 M for Lapatinib and Amax=30% and EC50=3.04 M for BYL719. For DRIVE the cell lines with phenotypic values below 1 were deemed sensitive. The consistency of compound vs shRNA response was assessed using fisher exact tests on the contingency of their respective sensitivity call (i.e. sensitive vs non-sensitive).
Results
Functional Genomic Screening Reveals 4 Categories of Dependency Outliers
[0418] In project DRIVE, deep coverage shRNA lentiviral libraries were constructed (median of shRNAs/gene) targeting 7837 genes. Gene content included known mutated/amplified cancer drivers, epigenetic genes, transcription factors, cell surface proteins, and druggable enzymes, as well as known pan-essential complexes. This library was screened across 398 cell lines to identify gene dependencies (Table 4). 2.7108 cells were infected (>1000 representation of the 151,504 member library) and passaged for 14 days post infection. Quantile normalized log fold change data was generated from next generation sequencing (NGS) counts of individual shRNAs post screen versus the shRNA abundance in the library input. The raw DRIVE data is available (dx.doi.org/10.17632/y3ds55n88r.1) and contains read counts across all interrogated shRNAs/genes and cell lines.
TABLE-US-00004 TABLE 4 Cell lines used in DRIVE PATHOLOGIST_ CELLLINE PRIMARY_SITE ANNOTATION 697 haematopoietic_and_ Leukemia: ALL lymphoid_tissue 921 eye Eye: Melanoma 127399 soft_tissue Soft_Tissue: Sarcoma_ Synovial 2313287 stomach Gastric: Carcinoma 1321n1 central_nervous_ CNS: Glioma system 769p kidney Kidney: Carcinoma 786o kidney Kidney: Carcinoma 8305c thyroid Thyroid: Carcinoma 8505c thyroid Thyroid: Carcinoma a101d skin Skin: Melanoma a172 central_nervous_ CNS: Glioma_HighGrade system a204 soft_tissue Soft_Tissue: Sarcoma_ Rhabdoid a2058 skin Skin: Melanoma a253 salivary_gland Salivary_Gland: Carcinoma a2780 ovary Ovary: Carcinoma a375 skin Skin: Melanoma a498 kidney Kidney: Carcinoma a549 lung Lung: NSCLC_Adeno a673 bone Bone: Sarcoma_Ewing a704 kidney Kidney: Carcinoma abc1 lung Lung: NSCLC_Others accmeso1 pleura Lung: Mesothelioma achn kidney Kidney: Carcinoma ags stomach Gastric: Carcinoma an3ca endometrium Endometrium: Carcinoma az521 stomach Gastric: Carcinoma bc3c urinary_tract Bladder: Carcinoma bcpap thyroid Thyroid: Carcinoma bftc909 kidney Kidney: Carcinoma bht101 thyroid Thyroid: Carcinoma bicr6 upper_aerodigestive_ Upper_Aerodigestive_ tract Tract: Carcinoma bt16 central_nervous_ PNET: Rhabdoid system bt20 breast Breast: Carcinoma bt549 breast Breast: Carcinoma bxpc3 pancreas Pancreas: Carcinoma c32 skin Skin: Melanoma caki1 kidney Kidney: Carcinoma caki2 kidney Kidney: Carcinoma cal120 breast Breast: Carcinoma cal27 upper_aerodigestive_ Upper_Aerodigestive_ tract Tract: Carcinoma cal29 urinary_tract Bladder: Carcinoma cal33 upper_aerodigestive_ Upper_Aerodigestive_ tract Tract: Carcinoma cal51 breast Breast: Carcinoma cal54 kidney Kidney: Carcinoma cal851 breast Breast: Carcinoma calu6 lung Lung: NSCLC_Others cama1 breast Breast: Carcinoma caov3 ovary Ovary: Carcinoma cas1 central_nervous_ CNS: Glioma_HighGrade system cck81 large_intestine Colorectal: Carcinoma cfpac1 pancreas Pancreas: Carcinoma chagok1 lung Lung: Others cl11 large_intestine Colorectal: Carcinoma cl34 large_intestine Colorectal: Carcinoma cmk haematopoietic_and_ Leukemia: AML lymphoid_tissue cmk115 haematopoietic_and_ Leukemia: AML lymphoid_tissue colo201 large_intestine Colorectal: Carcinoma colo205 large_intestine Colorectal: Carcinoma colo320 large_intestine Colorectal: Carcinoma colo678 large_intestine Colorectal: Carcinoma colo679 skin Skin: Melanoma colo741 skin Skin: Melanoma colo829 skin Skin: Melanoma corl105 lung Lung: NSCLC_Adeno corl23 lung Lung: NSCLC_Large_Cell cov318 ovary Ovary: Carcinoma cov362 ovary Ovary: Carcinoma cw2 large_intestine Colorectal: Carcinoma dang pancreas Pancreas: Carcinoma daoy central_nervous_ CNS: Medulloblastoma system detroit562 upper_aerodigestive_ Upper_Aerodigestive_ tract Tract: Carcinoma dld1 large_intestine Colorectal: Carcinoma dms114 lung Lung: SCLC dms273 lung Lung: SCLC du145 prostate Prostate: Carcinoma ebc1 lung Lung: NSCLC_Squamous efm192a breast Breast: Carcinoma f36p haematopoietic_and_ Leukemia: AML lymphoid_tissue fadu upper_aerodigestive_ Upper_Aerodigestive_ tract Tract: Carcinoma fuji soft_tissue Soft_Tissue: Sarcoma_ Synovial fuov1 ovary Ovary: Carcinoma g401 soft_tissue Soft_Tissue: Sarcoma_ Rhabdoid g402 soft_tissue Soft_Tissue: Sarcoma_ Rhabdoid gamg central_nervous_ CNS: Glioma system gb1 central_nervous_ CNS: Glioma_HighGrade system gi1 central_nervous_ CNS: Glioma system gistt1 gastrointestinal_tract_ Undefined: GIST (site_indeterminate) gp2d large_intestine Colorectal: Carcinoma hcc1359 lung Lung: NSCLC_Large_Cell hcc15 lung Lung: NSCLC_Squamous hcc1500 breast Breast: Carcinoma hcc1806 breast Breast: Carcinoma hcc1833 lung Lung: NSCLC_Adeno hcc1954 breast Breast: Carcinoma hcc38 breast Breast: Carcinoma hcc4006 lung Lung: NSCLC_Adeno hcc44 lung Lung: NSCLC_Adeno hcc827 lung Lung: NSCLC_Adeno hcc827gr lung Lung: NSCLC_Adeno hcc95 lung Lung: NSCLC_Squamous hct116 large_intestine Colorectal: Carcinoma hct15 large_intestine Colorectal: Carcinoma hec1a endometrium Endometrium: Carcinoma hec265 endometrium Endometrium: Carcinoma hec50b endometrium Endometrium: Carcinoma hec6 endometrium Endometrium: Carcinoma hel haematopoietic_and_ Leukemia: AML lymphoid_tissue he19217 haematopoietic_and_ Leukemia: AML lymphoid_tissue hep3b217 liver Liver: HCC hepg2 liver Liver: HCC heya8 ovary Ovary: Carcinoma hgc27 stomach Gastric: Carcinoma hle liver Liver: HCC hlf liver Liver: HCC hmc18 breast Breast: Carcinoma hrt18 large_intestine Colorectal: Carcinoma hs294t skin Skin: Melanoma hs578t breast Breast: Carcinoma hs695t skin Skin: Melanoma hs729 soft_tissue Soft_Tissue: Sarcoma_ Rhabdoid hs852t skin Skin: Melanoma hs939t skin Skin: Melanoma hs944t skin Skin: Melanoma hsc3 upper_aerodigestive_ Upper_Aerodigestive_ tract Tract: Carcinoma hssyii soft_tissue Soft_Tissue: Sarcoma_ Synovial ht1080 soft_tissue Soft_Tissue: Sarcoma_ Fibro ht115 large_intestine Colorectal: Carcinoma ht1197 urinary_tract Bladder: Carcinoma ht1376 urinary_tract Bladder: Carcinoma ht29 large_intestine Colorectal: Carcinoma ht55 large_intestine Colorectal: Carcinoma hug1n stomach Gastric: Carcinoma huh1 liver Liver: HCC huh6 liver Liver: Hepatoblastoma huh7 liver Liver: HCC hupt3 pancreas Pancreas: Carcinoma hupt4 pancreas Pancreas: Carcinoma igr1 skin Skin: Melanoma igr37 skin Skin: Melanoma igr39 skin Skin: Melanoma igrov1 ovary Ovary: Carcinoma im95 stomach Gastric: Carcinoma ipc298 skin Skin: Melanoma ishikawaheraklio02er endometrium Endometrium: Carcinoma jhh6 liver Liver: HCC jhh7 liver Liver: HCC jhos2 ovary Ovary: Carcinoma jhuem2 endometrium Endometrium: Carcinoma jimt1 breast Breast: Carcinoma jl1 pleura Lung: Mesothelioma jmsu1 urinary_tract Bladder: Carcinoma k029ax skin Skin: Melanoma kasumi1 haematopoietic_and_ Leukemia: AML lymphoid_tissue kasumi2 haematopoietic_and_ Leukemia: ALL lymphoid_tissue kelly autonomic_ganglia PNET: Neuroblastoma km12 large_intestine Colorectal: Carcinoma kmrc1 kidney Kidney: Carcinoma kmrc20 kidney Kidney: Carcinoma kms27 haematopoietic_and_ Lymphoma: Multiple_ lymphoid_tissue Myeloma kms28bm haematopoietic_and_ Lymphoma: Multiple_ lymphoid_tissue Myeloma kms34 haematopoietic_and_ Lymphoma: Multiple_ lymphoid_tissue Myeloma kns42 central_nervous_ CNS: Glioma system kns62 lung Lung: NSCLC_Squamous kns81 central_nervous_ CNS: Glioma_HighGrade system kp1n pancreas Pancreas: Carcinoma kp3 pancreas Pancreas: Carcinoma kp4 pancreas Pancreas: Carcinoma kpl1 breast Breast: Carcinoma kpnsi9s autonomic_ganglia PNET: Neuroblastoma kpnyn autonomic_ganglia PNET: Neuroblastoma ks1 central_nervous_ CNS: Glioma_HighGrade system ku1919 urinary_tract Bladder: Carcinoma kym1 soft_tissue Soft_Tissue: Sarcoma_ Rhabdoid kyse150 oesophagus Oesophagus: Carcinoma kyse180 oesophagus Oesophagus: Carcinoma kyse30 oesophagus Oesophagus: Carcinoma kyse410 oesophagus Oesophagus: Carcinoma kyse450 oesophagus Oesophagus: Carcinoma kyse510 oesophagus Oesophagus: Carcinoma kyse70 oesophagus Oesophagus: Carcinoma l33 pancreas Pancreas: Carcinoma lclc103h lung Lung: NSCLC_Large_Cell li7 liver Liver: HCC lk2 lung Lung: NSCLC_Squamous lmsu stomach Gastric: Carcinoma ln18 central_nervous_ CNS: Glioma_HighGrade system ln229 central_nervous_ CNS: Glioma_HighGrade system lncapclonefgc prostate Prostate: Carcinoma lovo large_intestine Colorectal: Carcinoma loximvi skin Skin: Melanoma ls180 large_intestine Colorectal: Carcinoma ls411n large_intestine Colorectal: Carcinoma ls513 large_intestine Colorectal: Carcinoma ludlu1 lung Lung: NSCLC_Squamous mcf7 breast Breast: Carcinoma mdamb157 breast Breast: Carcinoma mdamb231 breast Breast: Carcinoma mdamb415 breast Breast: Carcinoma mdamb436 breast Breast: Carcinoma mdamb453 breast Breast: Carcinoma mdamb468 breast Breast: Carcinoma mdst8 large_intestine Colorectal: Carcinoma me180 cervix Cervix: Carcinoma mel285 eye Eye: Melanoma melho skin Skin: Melanoma meljuso skin Skin: Melanoma mewo skin Skin: Melanoma mfe280 endometrium Endometrium: Carcinoma mfe296 endometrium Endometrium: Carcinoma mfe319 endometrium Endometrium: Carcinoma miapaca2 pancreas Pancreas: Carcinoma mkn1 stomach Gastric: Carcinoma mkn45 stomach Gastric: Carcinoma mkn7 stomach Gastric: Carcinoma molm13 haematopoietic_and_ Leukemia: AML lymphoid_tissue molm16 haematopoietic_and_ Leukemia: AML lymphoid_tissue monomac1 haematopoietic_and_ Leukemia: AML lymphoid_tissue monomac6 haematopoietic_and_ Leukemia: AML lymphoid_tissue mpp89 pleura Lung: Mesothelioma nb1 autonomic_ganglia PNET: Neuroblastoma ncih1048 lung Lung: SCLC ncih1299 lung Lung: NSCLC_Others ncih1355 lung Lung: NSCLC_Adeno ncih1373 lung Lung: NSCLC_Adeno ncih1435 lung Lung: NSCLC_Adeno ncih1437 lung Lung: NSCLC_Adeno ncih1568 lung Lung: NSCLC_Adeno ncih1573 lung Lung: NSCLC_Adeno ncih1581 lung Lung: NSCLC_Large_Cell ncih1693 lung Lung: NSCLC_Adeno ncih1703 lung Lung: NSCLC_Squamous ncih1792 lung Lung: NSCLC_Adeno ncih1793 lung Lung: NSCLC_Adeno ncih1838 lung Lung: NSCLC_Adeno ncih1944 lung Lung: NSCLC_Adeno ncih196 lung Lung: SCLC ncih1975 lung Lung: NSCLC_Adeno ncih2009 lung Lung: NSCLC_Adeno ncih2030 lung Lung: NSCLC_Adeno ncih2052 pleura Lung: Mesothelioma ncih2066 lung Lung: SCLC ncih2110 lung Lung: NSCLC_Others ncih2122 lung Lung: NSCLC_Adeno ncih2126 lung Lung: NSCLC_Adeno ncih2170 lung Lung: NSCLC_Squamous ncih2172 lung Lung: NSCLC_Others ncih2228 lung Lung: NSCLC_Adeno ncih2286 lung Lung: SCLC ncih2291 lung Lung: NSCLC_Adeno ncih23 lung Lung: NSCLC_Adeno ncih28 pleura Lung: Mesothelioma ncih358 lung Lung: NSCLC_Adeno ncih441 lung Lung: NSCLC_Adeno ncih446 lung Lung: SCLC ncih460 lung Lung: NSCLC_Large_Cell ncih508 large_intestine Colorectal: Carcinoma ncih522 lung Lung: NSCLC_Adeno ncih661 lung Lung: NSCLC_Large_Cell ncih716 large_intestine Colorectal: Carcinoma ncih747 large_intestine Colorectal: Carcinoma ncih838 lung Lung: NSCLC_Adeno ncin87 stomach Gastric: Carcinoma nihovcar3 ovary Ovary: Carcinoma nugc3 stomach Gastric: Carcinoma ocum1 stomach Gastric: Carcinoma oe21 oesophagus Oesophagus: Carcinoma omm1 eye Eye: Melanoma osrc2 kidney Kidney: Carcinoma oums23 large_intestine Colorectal: Carcinoma ov90 ovary Ovary: Carcinoma ovcar4 ovary Ovary: Carcinoma ovcar8 ovary Ovary: Carcinoma ovsaho ovary Ovary: Carcinoma panc0203 pancreas Pancreas: Carcinoma panc0403 pancreas Pancreas: Carcinoma panc0504 pancreas Pancreas: Carcinoma panc1 pancreas Pancreas: Carcinoma panc1005 pancreas Pancreas: Carcinoma patu8902 pancreas Pancreas: Carcinoma patu8988t pancreas Pancreas: Carcinoma pecapj34clonec12 upper_aerodigestive_ Upper_Aerodigestive_ tract Tract: Carcinoma pecapj41cloned2 upper_aerodigestive_ Upper_Aerodigestive_ tract Tract: Carcinoma pfeiffer haematopoietic_and_ Lymphoma: NH_B_cell lymphoid_tissue pk1 pancreas Pancreas: Carcinoma rcc4 kidney Kidney: Carcinoma rchacv haematopoietic_and_ Leukemia: ALL lymphoid_tissue rd soft_tissue Soft_Tissue: Sarcoma_ Rhabdoid reh haematopoietic_and_ Leukemia: ALL lymphoid_tissue rerflcms lung Lung: NSCLC_Others rh30 soft_tissue Soft_Tissue: Sarcoma_ Rhabdoid rh41 soft_tissue Soft_Tissue: Sarcoma_ Rhabdoid rko large_intestine Colorectal: Carcinoma rl haematopoietic_and_ Lymphoma: NH_B_cell lymphoid_tissue rmgi ovary Ovary: Carcinoma rmugs ovary Ovary: Carcinoma rpmi7951 skin Skin: Melanoma rpmi8226 haematopoietic_and_ Lymphoma: Multiple_ lymphoid_tissue Myeloma rt112 urinary_tract Bladder: Carcinoma rvh421 skin Skin: Melanoma saos2 bone Bone: Sarcoma_Osteo sbc5 lung Lung: SCLC scc25 upper aerodigestive_ Upper_Aerodigestive_ tract Tract: Carcinoma sem haematopoietic_and_ Leukemia: ALL lymphoid_tissue sf268 central_nervous_ CNS: Glioma_HighGrade system sf295 central_nervous_ CNS: Glioma_HighGrade system sh4 skin Skin: Melanoma shp77 lung Lung: SCLC sjrh30 soft_tissue Soft_Tissue: Sarcoma_ Rhabdoid sjsa1 bone Bone: Sarcoma_Osteo skco1 large_intestine Colorectal: Carcinoma skes1 bone Bone: Sarcoma_Ewing skhep1 liver Liver: Carcinoma _Adeno skmel2 skin Skin: Melanoma skmel28 skin Skin: Melanoma skmel3 skin Skin: Melanoma skmel30 skin Skin: Melanoma skmel5 skin Skin: Melanoma sknas autonomic_ganglia PNET: Neuroblastoma sknbe2 autonomic_ganglia PNET: Neuroblastoma skndz autonomic_ganglia PNET: Neuroblastoma sknfi autonomic_ganglia PNET: Neuroblastoma sknmc bone Bone: Sarcoma_Ewing sknsh autonomic_ganglia PNET: Neuroblastoma snb19 central_nervous_ CNS: Glioma_HighGrade system sngm endometrium Endometrium: Carcinoma snu1 stomach Gastric: Carcinoma snu1079 biliary_tract Biliary_Tract: Carcinoma snu1105 central_nervous_ CNS: Glioma_HighGrade system snu349 kidney Kidney: Carcinoma snu407 large_intestine Colorectal: Carcinoma snu410 pancreas Pancreas: Carcinoma snu423 liver Liver: HCC snu449 liver Liver: HCC snu61 large_intestine Colorectal: Carcinoma snu685 endometrium Endometrium: Others snu719 stomach Gastric: Carcinoma snu738 central_nervous_ CNS: Glioma system snu761 liver Liver: HCC snu81 large_intestine Colorectal: Carcinoma snu886 liver Liver: HCC snuc2a large_intestine Colorectal: Carcinoma snuc4 large_intestine Colorectal: Carcinoma sq1 lung Lung: NSCLC_Squamous ss1a soft_tissue Soft_Tissue: Sarcoma_ Synovial su8686 pancreas Pancreas: Carcinoma sudhl4 haematopoietic_and_ Lymphoma: NH_B_cell lymphoid_tissue sudhl6 haematopoietic_and_ Lymphoma: NH_B_cell lymphoid_tissue suit2 pancreas Pancreas: Carcinoma sum52pe breast Breast: Carcinoma sw1088 central_nervous_ CNS: Glioma system sw1271 lung Lung: SCLC sw1353 bone Bone: Sarcoma_Chondro sw1417 large_intestine Colorectal: Carcinoma sw1463 large_intestine Colorectal: Carcinoma sw1573 lung Lung: NSCLC_Squamous sw1783 central_nervous_ CNS: Glioma_HighGrade system sw1990 pancreas Pancreas: Carcinoma sw403 large_intestine Colorectal: Carcinoma sw48 large_intestine Colorectal: Carcinoma sw480 large_intestine Colorectal: Carcinoma sw579 thyroid Thyroid: Carcinoma sw620 large_intestine Colorectal: Carcinoma sw780 urinary_tract Bladder: Carcinoma sw948 large_intestine Colorectal: Carcinoma syo1 soft_tissue Soft_Tissue: Sarcoma_ Synovial t24 urinary_tract Bladder: Carcinoma t47d breast Breast: Carcinoma tc71 bone Bone: Sarcoma_Ewing tccpan2 pancreas Pancreas: Carcinoma tccsup urinary_tract Bladder: Carcinoma te1 oesophagus Oesophagus: Carcinoma te10 oesophagus Oesophagus: Carcinoma te11 oesophagus Oesophagus: Carcinoma te14 oesophagus Oesophagus: Carcinoma te4 oesophagus Oesophagus: Carcinoma te6 oesophagus Oesophagus: Carcinoma te9 oesophagus Oesophagus: Carcinoma ten endometrium Endometrium: Carcinoma thp1 haematopoietic and_ Leukemia: AML lymphoid_tissue tuhr4tkb kidney Kidney: Carcinoma tyknu ovary Ovary: Carcinoma u118mg central_nervous_ CNS: Glioma system u251mg central_nervous_ CNS: Glioma system u2os bone Bone: Sarcoma_Osteo u87mg central_nervous_ CNS: Glioma system uacc257 skin Skin: Melanoma uacc62 skin Skin: Melanoma ublc1 urinary_tract Bladder: Carcinoma umuc3 urinary_tract Bladder: Carcinoma vmrcrcw kidney Kidney: Carcinoma wm115 skin Skin: Melanoma wm1799 skin Skin: Melanoma wm2664 skin Skin: Melanoma wm793 skin Skin: Melanoma wm88 skin Skin: Melanoma wsudlc12 haematopoietic_and_ Lymphoma: NH_B_cell lymphoid_tissue yd38 upper_aerodigestive_ Upper_Aerodigestive_ tract Tract: Carcinoma ymb1 breast Breast: Carcinoma
[0419] shRNA activity was aggregated to gene level activity by two complimentary methods, ATARiS and Redundant siRNA Activity (RSA)(
[0420] Using RSA to categorize each gene as inert, active or essential (
TABLE-US-00005 TABLE 5 List of essential genes GENESYMBOLS ABCB7 ABCE1 AFG3L2 ALYREF ANAPC1 ANAPC4 AP2M1 ATP6V0C AURKB BCL2L1 BOP1 BRD4 BUB1B CAPZB CCND1 CCT2 CCT3 CCT7 CHAF1A CHD4 CKAP5 CLTC COPA COPB2 COPS2 COPS4 COPS5 COPS6 COPZ1 CWC22 DDB1 DDX18 DDX21 DDX23 DHX8 DHX9 DYNC1I2 E2F5 EIF2B3 EIF2S2 EIF3A EIF3B EIF3G EIF4A3 EIF4E EIF4G1 EWSR1 FAU GNB2L1 GPS1 HCFC1 HNRNPC HNRNPM HNRNPU HSPD1 HSPE1 IK INCENP INO80 KIF11 KPNB1 LOC440563 MAD2L1 MED11 MED14 MED28 METAP2 MPRIP MYBL2 NAA10 NACA NCBP1 NCL NEDD1 NEDD8 NUP214 NUP98 NUTF2 NXF1 PCNA PHF5A POLA1 POLR2A POLR2B POLR2D PPIE PPP2R1A PPWD1 PRPF19 PSMA3 PSMA4 PSMA6 PSMB5 PSMC1 PSMC2 PSMC3 PSMC5 PSMC6 PSMD12 PSMD2 RAD21 RAD51 RAN RBM22 RBM42 RBX1 RNPS1 RPA1 RPA2 RPL14 RPL35 RPL7 RPS15A RPS16 RPS18 RPS21 RPS27A RRM1 RTF1 RUVBL1 RUVBL2 SEC13 SF3A1 SF3B1 SF3B14 SF3B2 SFPQ SHFM1 SIN3A SKP1 SMC2 SMC4 SMG1 SMU1 SNRNP200 SNRNP70 SNRPB SRSF1 SRSF3 SRSF9 SUPT5H SUPT6H SYMPK TACC3 TCERG1 TFDP1 TONSL TPR TRRAP TSC22D4 TUBB U2AF1 U2AF2 U2SURP UBA1 UBA52 UBC USP39 VARS VCP WDR43 WDR5 XAB2 XPO1 YBX1 YY1 ZNF207
TABLE-US-00006 TABLE 6 CYCLOP genes GENESYMBOLS ABCE1 ALYREF ANAPC4 ATP6V1B2 AURKB BIRC5 BRIX1 BUD31 CARS CASP8AP2 CCNK CCT2 CCT3 CDC27 CDC45 CDC73 CHAF1A CHAF1B COPA COPB2 COPS6 COPZ1 CTDP1 CTR9 CWC22 DDX10 DDX23 DDX46 DDX47 DDX56 DHX15 DHX16 EEF2 EIF2S2 EIF3A EIF3B EIF3G EIF3I EIF4A3 FAU IK KAT8 MAD2L1 MCM5 MCM7 MCRS1 MED11 MED28 MED7 NOL11 NRF1 NUP98 NUTF2 NXT1 PCNA PHF5A PLK1 PLRG1 POLD2 POLR2A POLR2B POLR2D PPIL2 PPWD1 PRPF4 PRPF4B PSMA3 PSMA4 PSMA6 PSMC1 PSMC2 PSMC3 PSMC4 PSMC5 PSMC6 PSMD12 PSMD2 PWP2 RAE1 RAN RBM22 RBM28 RBM39 RBM42 RBX1 RFC2 RIOK1 RNPS1 RPA1 RPA2 RPA3 RPL35 RPL7 RPP14 RPP40 RPS15A RPS16 RPS18 RPS21 RRM1 RRP9 SEC13 SEH1L SF3A1 SF3B4 SHFM1 SKIV2L2 SMNDC1 SMU1 SNRPB SNRPF SRSF1 SRSF3 SUPT16H SUPT5H SUPT6H TRIP13 TXN U2AF1 U2AF2 UBA52 UBL5 URI1 USP39 USPL1 VARS VCP WDR3 WDR46 WDR61 WDR82 XAB2 XRCC6
[0421] To enable the discovery of features predictive of sensitivity we developed a bioinformatics pipeline. K-means (k=3) clustering of gene profiles was used to delineate sensitive and insensitive populations and these classifications were used to interrogate the feature sets of the CCLE (Barretina et al., 2012) (
TABLE-US-00007 TABLE 7 Outlier Genes GENE- Outlier SL SYMBOLS NormLRT COSMIC Categories TFs Category CCND3 162.870303 COSMIC Expression No based driver CEBPA 153.418645 COSMIC Expression Yes based driver ESR1 169.993436 COSMIC Expression Yes based driver FOXA1 310.331357 COSMIC Expression Yes based driver GATA3 150.110946 COSMIC Expression Yes based driver IRF4 130.621536 COSMIC Expression Yes based driver MPL 199.391783 COSMIC Expression No based driver MYB 428.577929 COSMIC Expression Yes based driver SPI1 126.187818 NA Expression Yes based driver TFAP2C 135.194288 NA Expression Yes based driver CCNE1 222.975977 COSMIC Expression No based driver, Genetic driver EGFR 215.162316 COSMIC Expression No based driver, Genetic driver ERBB2 202.7234 COSMIC Expression No based driver, Genetic driver FLI1 374.081522 COSMIC Expression Yes based driver, Genetic driver FLT3 181.975578 COSMIC Expression No based driver, Genetic driver HNF1B 303.35821 NA Expression Yes based driver, Genetic driver KRAS 422.806377 COSMIC Expression No based driver, Genetic driver MITF 448.656615 COSMIC Expression Yes based driver, Genetic driver RUNX1 250.864185 COSMIC Expression Yes based driver, Genetic driver SOX10 332.169486 NA Expression Yes based driver, Genetic driver TCF4 162.480095 NA Expression Yes based driver, Genetic driver TP63 208.585807 NA Expression Yes based driver, Genetic driver YAP1 149.244774 NA Expression Yes Paralog based driver, Lethality Genetic driver Synthetic Lethal CTNNB1 594.609381 COSMIC Expression Yes Vertical based driver, Pathway Synthetic Lethal MDM2 196.167736 COSMIC Expression No Vertical based driver, Pathway Synthetic Lethal RPL22L1 402.692583 NA Expression No Paralog based driver, Lethality Synthetic Lethal BRAF 531.881638 COSMIC Genetic No driver FGFR2 191.242888 COSMIC Genetic No driver GNAI2 134.261063 NA Genetic No driver NRAS 676.169317 COSMIC Genetic No driver PIK3CA 174.729074 COSMIC Genetic No driver CDK4 299.060123 COSMIC Genetic No Paralog driver, Lethality Synthetic Lethal MAP2K1 211.716658 COSMIC Genetic No Vertical driver, Pathway Synthetic Lethal MCL1 137.484834 NA Genetic No Parallel driver, Pathway Synthetic Lethal PIK3CB 200.9034 NA Genetic No Vertical driver, Pathway Synthetic Lethal ALDH18A1 312.292299 NA Metabolism No ASNS 364.831874 NA Metabolism No ATF4 151.976198 NA Metabolism Yes DUT 139.923982 NA Metabolism No GPX4 156.651727 NA Metabolism No MTHFD1 125.201059 NA Metabolism No PRPS2 180.386172 NA Metabolism No SCAP 162.984828 NA Metabolism No SCD 236.478109 NA Metabolism No SDHB 157.896827 COSMIC Metabolism No SDHD 129.245894 COSMIC Metabolism No CFL1 129.184533 NA NA No IGF1R 140.232414 NA NA No OPA1 127.211196 NA NA No PRKRA 141.21485 NA NA No WRN 355.504847 COSMIC NA No WSB2 143.914228 NA NA No ARF4 131.64709 NA Synthetic No Paralog Lethal Lethality ARID1B 144.090824 COSMIC Synthetic No Paralog Lethal Lethality CBFB 214.131504 COSMIC Synthetic Yes Vertical Lethal Pathway CDK2 174.359727 NA Synthetic No Vertical Lethal Pathway HSPA8 137.94353 NA Synthetic No Parallel Lethal Pathway MDM4 137.125361 COSMIC Synthetic No Vertical Lethal Pathway PEA15 171.200618 NA Synthetic No Vertical Lethal Pathway PRMT5 167.013646 NA Synthetic No Collateral Lethal Lethality SMARCA2 572.344152 NA Synthetic No Paralog Lethal Lethality TYMS 242.600363 NA Synthetic No Parallel Lethal Pathway VPS4A 171.551709 NA Synthetic No Collateral Lethal Lethality CDKN2A 165.538544 COSMIC Tumor No Suppressor TP53 162.046367 COSMIC Tumor Yes Suppressor
[0422] Genetic drivers of cancer dependency and modifiers of oncogene addiction Mutated oncogenes (e.g. NRAS, BRAF and KRAS) are among the most robust dependencies observed in DRIVE (
[0423] Recurrent gene amplification of either mutated alleles or wild-type alleles are a common mechanism for oncogene activation. Forty genes demonstrate a strong correlation between dependence and gene amplification (
[0424] In using deep shRNA libraries we discovered not only the direct dependence on key drivers, but also genes that can act as modifiers. Indeed, modifiers of oncogene dependence can be observed in DRIVE. For example, EGFR dependence in lung and other solid tumors is not only associated with amplification and expression of EGFR but also with high levels of Amphiregulin (AREG) (
[0425] Expression correlation analysis identifies oncogenes and lineage specific transcription factors The second class of cancer dependent genes was comprised of those in which high-level expression of the target gene was a top correlated feature. To further explore this class we directly correlated gene expression and gene dependence. 57 genes had a negative correlation (0.3 or better) where high levels of target gene expression were associated with significant growth effects upon shRNA-induced target knockdown (
[0426] The transcriptional repressor ZEB1 shows a correlation between gene expression and gene dependence observed across multiple lineages. ZEB1 dependence is linked to both self-expression and lack of expression of CDH1, a transcriptional repression target of ZEB1 (Grooteclaes and Frisch, 2000)(
[0427] Within the expression outlier class is a large collection of lineage transcription factors (
HNF1B functions developmentally to control distinct aspects of kidney, pancreatic and liver tissue specification with adult tissue expression also seen in the gonads and lung. In DRIVE, cancer dependence for HNF1B is observed in kidney, pancreatic, liver, lung and ovarian cell lines and shows a correlation between expression and dependence (
[0428] Within the hematopoietic lineage, specific subtypes have unique transcription factor dependencies (
[0429] While no specific transcription factor requirements were identified for the maintenance of basal breast cancers, analysis of luminal breast cancer confirmed the network of transcription factors that coordinate the regulation of hormonal signaling including ESR1, FOXA1, GATA3 and TFAP2C (
Synthetic Lethal Classes
[0430] As used herein, synthetic lethality (SL) included any altered cell state (genetic, metabolic or otherwise) that was linked to a definable non-self genetic dependence. Within this class we observed distinct subsets including those where synthetic lethality was linked to a pathway, to loss of a paralog or to collateral lethality. In the parallel pathways of de novo synthesis and salvage of thymidine, TYMP (thymidine phosphorylase) mediates the reduction of thymidine to thymine. This activity reduces cellular thymidine which is normally produced by the activity of TYMS (thymidylate synthase) as part of the de novo pathway. A subset of cancer cell lines display an altered ratio of TYMP (high) to TYMS (low) expression leading to the apparent cellular dependence on residual TYMS (
[0431] In addition to parallel pathway SL, we observed 8 distinct vertical pathway SL outlier dependences. These included dependence on p-catenin (CTNNB1) in the context of genetic loss of APC (
[0432] There has been significant interest in identifying synthetic lethal interactions pertaining to the RAS pathway. In DRIVE, we do not detect robust synthetic lethal interactions for mutant KRAS and previously published synthetic lethal interactions are not confirmed in this dataset (Barbie et al., 2009; Kim et al., 2016; Luo et al., 2009; Scholl et al., 2009; Singh et al., 2012; Zimmermann et al., 2013)(
[0433] We, and others, have described synthetic lethal interactions among paralogous genes where one paralog is genetically inactivated through mutation and/or deletion. Specifically, we found that the loss of the SWI/SNF complex member BRG1 explains the sensitivity observed upon BRM depletion in NSCLC cell lines (Hoffman et al., 2014). Here, we observed a similar relationship for ARID1A and ARID1B (Helming et al., 2014) in which mutation of ARID1A renders cells dependent on ARID1B (
[0434] We also observed paralog SL relationships where low or absent expression (rather than mutation) of a paralog is associated with dependence on the other. As previously discussed, CDK4 and CDK6 show largely non-overlapping dependence in the CCLE. In fact, the best predictor of CDK4 dependence in DRIVE is low expression of CDK6. Similarly, the best predictor of YAP1 sensitivity is low expression of the paralog WWTTR1 (TAZ). ARF4 and 5 are the only two class II members of the ADP-ribosylation factor family (Jackson and Bouvet, 2014). We observed a novel synthetic lethal relationship where low expression of ARF5 predicts for ARF4 dependency (
[0435] The VPS4A paralog dependence is also an example of collateral synthetic lethality where bystander deletion of a neighboring gene leads to cancer dependence (
DRIVE Sensitivity Network Uncovers Signaling Pathways, Protein Complexes and Lineage Biology
[0436] The density of shRNAs used per gene, the extensive set of cell lines tested and the robustness of the observed dependency correlations led us to test whether the viability effects of each gene knockdown would be varied and robust enough to find correlated gene-gene interactions based only on the gene knockdown data. To test this, a correlation matrix was calculated in which each gene profile was correlated with every other gene profile creating a matrix of 21,493,846 pairwise comparisons. This can be represented as a network where each gene represents a node and each edge represents the pairwise similarity between genes. We defined the distance between two genes as the squared absolute value of the Pearson correlation. The DRIVE Sensitivity Network (DSN) interactive tool (Network Viz tab @ oncologynibr.shinyapps.io/drive/) allows for a single or multi-gene entry point to explore their local correlation neighborhoods. In
[0437] Within the global network, we observed a dense and large neighborhood comprised of essential genes (large circles) as defined in
[0438] The recapitulation of the p53 pathway is robust in DRIVE. Known negative regulators (e.g. MDM2, MDM4, USP7, PPM1D) all show dependence effects in the WT p53 setting. Conversely, knockdown of p53 or positive regulators (e.g. TP53BP1, USP28, and CDKN1A) promote the growth of cells harboring WT p53. Nearly all known key regulators of p53 were discovered in this unbiased network. As an illustration of progressive cluster build using the DSN interactive tool, we show the p53 network when a range of 2-10 nearest neighbors (NN) is used (
[0439] A network relationship between genes that appear to have similar functional consequences when depleted from cells was also observed. For instance, the PRC2 complex members form a tight interaction network suggesting very similar functional consequences of EZH2, EED and SUZ12 knockdown consistent with their function as a unit. In addition, the nearby neighborhood location of the MLL/menin (MEN1) and ASH1L methyltransferase complexes suggests a functional concordance between these proteins and the PRC2 complex. Interestingly, the histone acetyltransferases p300 and the MOZ complex, comprised in part by KAT6A (MYST3, MOZ) and BRPF1, is located nearby to all three methyltransferases suggesting an interplay of acetylation and methylation with likely similar effects on cancer dependence.
[0440] Two cell cycle neighborhoods were observed within the DSN. The CCNE1/CDK2 axis is active in cell lines with low RB expression or high CCNE1 expression. Here, E2F3 appeared uniquely required for CDK2-mediated cell cycle progression along with SKP2 and CKS1B. These proteins collaborate to degrade p27 (CDKN2B) (Ganoth et al., 2001), hence their knockdown would likely stabilize p27 leading to CDK2 inhibition. Interestingly, an E2 enzyme, UBE2Q1, was found in the CDK2 node suggesting that it may take part in p27 degradation. Not surprisingly, anti-correlations with CDKN2A and RB1 were also observed. A second sub-network of cell-cycle control genes regulating G2/M was observed in the DSN. This included Cyclin A2 and B1 along with FOXM1 that controls transcriptional events required for this transition including upregulation of CDC25B that controls activation of CDK1. Interference with the timely activation of the anaphase promoting complex (FBXO5) or the mitotic spindle checkpoint (BUB1B, MAD2L1) had apparently deleterious effects on a similar group of cell lines. BTG1, a GO/G1 cell cycle inhibitor, is anti-correlated within this network consistent with its role in inhibiting early cell cycle progression.
[0441] The critical balance between BCL2 family members has been highlighted as both MCL1 and BCL2L1 (BCLXL) demonstrate complex dependency profiles that contain expression of both pro- and anti-apoptotic family members in order to maintain cell survival. WSB2 (WD40 repeat and SOCS box protein) has an outlier profile but one that does not contain robust features predictive of dependence yet does demonstrate multiple connections to the apoptosis pathway in the DSN. The most robust association is anti-correlation of WSB2 and BAX. WSB2 positive correlations include MCL1 and C8orf33. WSB2 is thought to be a component of DDB1/CUL4 E3 ligase complexes (He et al., 2006). The anti-correlation between WSB2 and BAX raises the possibility that WSB2 acts as a negative regulator of BAX protein levels through ubiquitin-mediated degradation.
[0442] In addition to pathway and protein complex networks, genes with lineage specific activity can be detected as DSN neighborhoods. In the melanoma sub-network, nodes were observed that highlight both TF dependencies (MITF and SOX10) but also oncogenic signaling pathways. The MAPK node was robust (BRAF, MAPK1) likely due to the prevalence of mutant BRAF. However, the importance of fine tuning this pathway was also highlighted as inhibition of the negative pathway regulators, PEA15 and DUSP4, was similarly detrimental. The colon neighborhood, likely dominated by APC mutation, included the obligate CTNNB1 partner, TCF7L2, as well as a collection of transcription factors including GATA6, SMAD4 and YAP1.
Discussion
[0443] In Project DRIVE, a high-density shRNA library was used to assess the consequences of gene inactivation for half of the expressed genome of the CCLE in 398 cancer cell lines. The data and tools for interrogation as a resource for the further elucidation of therapeutic targets in cancer is provided herein. The breadth of cell line coverage allowed for a diversity of genomic backgrounds to be probed and for relationships with similar functional consequences to be identified. In addition, network relationships for essential genes were assembled due to incomplete gene depletion by RNA interference. The robustness of the dependence data and in particular the nodal relationship of known protein complexes and pathways in the DRIVE Sensitivity Network, suggested that the drawbacks of RNAi, namely off-target effects and inefficient target knockdown, were addressed by the use of appropriate deep coverage libraries and computational methods. We retrospectively conducted a power analysis to compare our ability to detect outliers with a decreasing number of shRNAs/gene (
[0444] To further consider the robustness of this shRNA screen, we compared small data sets generated by CRISPR studies to the results seen in DRIVE (Munoz et al., 2016). Here, we found a consistent and significant overlap of selective dependencies when comparing shRNA and CRISPR screens across 5 models with libraries of comparable content and depth. Note that the shRNA library used in that study (2722 genes, with an average coverage of 20 reagents per gene) is a subset of the BGPD pool used in DRIVE. While CRISPR did uncover more essential genes, every essential gene scored by shRNA was also found by CRISPR, resulting in zero shRNA false-positives. As further orthogonal validation of the DRIVE dataset, we have also intersected selected DRIVE profiles with sensitivity calls from pharmacological treatment with a number of small molecule inhibitors with clinically validated modes of action, namely EGFR (erlotinib), ERBB2 (lapatinib), BRAF (PLX4720) and PIK3CA (BYL719, alpelisib). We observed an association of models sensitive to genetic target modulation (DRIVE) and sensitive to small molecule inhibitor treatment across the respective pairs (
[0445] The molecular characterization of the CCLE allows for the exploration of correlations between gene dependence and genetic, expression or other features of the cell line set. By analyzing feature correlations to ATARiS scores, all responses can be categorized as either self or non-self (synthetic lethal). Two out of our three defined outlier classes (genetic drivers, expression based drivers) are self-associations meaning they are driven by characteristics of the target of the shRNA itself. The synthetic lethal class represents relationships in which a non-self association is most highly correlated with the shRNA knockdown phenotype. These can be further broken down by the specific relationships uncovered by DRIVE: pathway, paralog or collateral lethality. The metabolism class also likely represents synthetic lethal relationships but the molecular features to explain the sensitivity are not yet characterized or are unclear. Two metabolic neighborhoods found in the network analysis (SCAP/SCD/SREBF1 and ASNS/ATF4/EIF2AK4) represent known biological pathways yet no currently available molecular feature explains sensitivity to these nodes. Similarly, dependence on WSB2 did not correlate with definable genetic or expression features yet the DRIVE network correlations with BCL2 family members form the basis of a testable hypothesis. Since our outlier approach is agnostic to the direction of the population skew, tumor suppressors CDKN2A and p53 are both detected. Knockdown of these tumor suppressors results in growth enhancement in cell lines that are wild-type for their respective genes. Some of the most robust DRIVE/DRIVE correlations and anti-correlations were seen with p53 and its pathway components (
[0446] Ultimately the goal of this project was to define drug targets for treating cancers within defined patient populations. The combination of the ATARiS gene summary and sensitivity feature prediction pipeline coupled with the outlier approach identified robust and selective cancer dependencies and outlined a biological hypothesis for the phenotype. It allowed for relationships to be discovered beyond those that could be predicted a priori, such as by hotspot mutational analysis. In Project DRIVE, we observed both known and novel mutation dependencies that begin to assign functional significance to the cancer mutational landscape. This dataset also helped to ascribe function (or not) to mutated genes unearthed by cancer genome sequencing efforts that have lacked functional validation, assuming they are present in the screening set. Additionally, DRIVE further refined what we know about some of the most prevalent lesions in cancer. The search for KRAS synthetic lethal interactions has been stymied by false discovery and the data here raise the likelihood that no single synthetic lethal gene may be found across all KRAS mutant tumors. While we affirm that the majority of KRAS mutant cancer cell lines are indeed dependent on continued expression of KRAS, we observed that some of the most commonly used KRAS mutant models are not KRAS dependent, when interrogated as monolayer cell cultures. Hence, studies of therapeutic approaches aiming at ablating KRAS dependence will need to carefully consider these findings.
[0447] The DRIVE dataset added significantly to our understanding of cancer dependencies and synthetic lethal relationships, including those for the most prevalent tumor suppressors. The homozygous and heterozygous deletion of p53, homozygous deletion of CDKN2A and homozygous deletion of SMAD4 all result in specific collateral synthetic lethality involving a diverse set of genes (UBC, POLR2A, AURKB, MEDI 1, PRMT5 and VPS4A). For ARID1A/ARID1B, RPL22/RPL22L1 and SMARCA4/SMARCA2, inactivating mutations in the first paralog resulted in dependence on the second. For CDK4, YAP, and ARF4, lack of expression of their paralogs predicted dependence. Given the sub-genome nature of our library and our focus on the top outliers coupled with the expansion of the mammalian genome, this class of paralog relationships is only likely to grow. The identification of synthetic lethal relationships for most major tumor suppressors (
[0448] We have created for project DRIVE, a public portal of gene dependence profiles (oncologynibr.shinyapps.io/drive/) that affords the cancer community a resource to validate or de-validate experimental findings across nearly 400 cell lines rapidly by interactive query. Furthermore, the DRIVE network associations can be used in combination with emerging large scale datasets (e.g. proteomic, transcriptional) to confirm the discovery of novel complex and pathway components. The functional genomics now provided by project DRIVE complements the molecular characterization by TCGA and ICGC to bring us closer to an understanding of the molecular drivers of cancer.
EMBODIMENTS
[0449] 1. A method for reducing, e.g., inhibiting, proliferation of cancer cells, e.g., cancer cells of a cancer disclosed in Tables 1 or 2, comprising administering to a subject in need thereof, an inhibitor, e.g., an inhibitor of a target disclosed in Tables 1 or 2, in an amount that is effective to inhibit proliferation of the cancer cells, wherein: [0450] i) the target is chosen from: MITF, MYB, FLI1, ASNS, WRN, SOX10, ALDH18A1, FOXA1, HNFIB, RUNX1, CBFB, TP63, CDK2, VPS4A, TCF4, CEBPA, GATA3, ARID1B, PRKRA, HSPA8, IRF4, SPI1, MTHFD1, ADAR, and NFE2L2; and [0451] ii) the cancer is chosen from: hematopoietic cancer (e.g., ALL, AML, MM or DLBCL), skin cancer, lung cancer, colorectal cancer (CRC), stomach cancer, thyroid cancer, melanoma, uveal melanoma, pancreatic cancer, endometrial cancer, Ewing's sarcoma, breast cancer, CNS cancer, kidney cancer, bladder cancer, esophageal cancer, upper aerodigestive cancer, neuroblastoma, ovarian cancer, liver cancer, and colon cancer.
2. A composition comprising an inhibitor, e.g., an inhibitor of any of the targets disclosed in Tables 1 or 2, for use in treating a cancer e.g., a cancer disclosed in Tables 1 or 2, in a subject, wherein: [0452] i) the target is chosen from: MITF, MYB, FLI1, ASNS, WRN, SOX10, ALDH18A1, FOXA1, HNFIB, RUNX1, CBFB, TP63, CDK2, VPS4A, TCF4, CEBPA, GATA3, ARID1B, PRKRA, HSPA8, IRF4, SPI1, MTHFD1, ADAR, and NFE2L2; and [0453] ii) the cancer is chosen from: hematopoietic cancer (e.g., ALL, AML, MM or DLBCL), skin cancer, lung cancer, colorectal cancer (CRC), stomach cancer, thyroid cancer, melanoma, uveal melanoma, pancreatic cancer, endometrial cancer, Ewing's sarcoma, breast cancer, CNS cancer, kidney cancer, bladder cancer, esophageal cancer, upper aerodigestive cancer, neuroblastoma, ovarian cancer, liver cancer, and colon cancer.
3. The method of embodiment 1 or the composition for use of embodiment 2, wherein the inhibitor is a compound capable of inhibiting the expression, e.g., mRNA or protein expression, of the target.
4. The method of embodiment 1 or the composition for use of embodiment 2, wherein the inhibitor is a compound capable of inhibiting a normal cellular function of the target protein.
5. The method of embodiment 1 or the composition for use of embodiment 2, wherein the inhibitor is selected from the group consisting of: an RNAi agent, a CRISPR, a TALEN, a zinc finger nuclease, a mRNA, an antibody or derivative thereof, a chimeric antigen receptor T cell (CART) or a low molecular weight compound.
6. The method of embodiment 1 or the composition for use of embodiment 2, wherein the inhibitor is a low molecular weight compound, such as a low molecular weight compound disclosed herein.
7. The method of embodiment 1 or the composition for use of embodiment 2, wherein the inhibitor is an RNAi agent, such as a shRNA, or siRNA disclosed herein.
8. The method of embodiment 1 or the composition for use of embodiment 2, wherein the inhibitor is an antibody or derivative thereof, such as an antibody or derivative thereof targeting a HLA-peptide complex comprising a peptide of any of the targets disclosed herein.
9. The method of embodiment 1 or the composition for use of embodiment 2, wherein the method comprises administering to a subject in need thereof, an inhibitor, e.g., an inhibitor of any of the targets disclosed in Tables 1 or 2, in combination with a second therapeutic agent.
10. The method or the composition for use of embodiment 9, wherein the second therapeutic agent is an anti-cancer agent, anti-allergic agent, anti-nausea agent (or anti-emetic), pain reliever, or cytoprotective agent.
11. The method or the composition for use of any one of embodiments 1-10, wherein the target is MITF and the cancer is a skin cancer or uveal cancer.
12. The method or the composition for use of any one of embodiments 1-10, wherein the target is MYB and the cancer is a hematopoietic cancer (e.g., ALL or AML) or colorectal cancer (CRC).
13. The method or the composition for use of any one of embodiments 1-10, wherein the target is FLI1 and the cancer is a hematopoietic cancer (e.g., ALL, AML, MM or DLBCL) or Ewing's sarcoma.
14. The method or the composition for use of any one of embodiments 1-10, wherein the target is ASNS and the cancer is a breast, colorectal, pancreatic or skin cancer.
15. The method or the composition for use of any one of embodiments 1-10, wherein the target is WRN and the cancer displays microsatellite instability (MSI+).
16. The method or the composition for use of any of embodiments 1-15, wherein the cancer is a colorectal (CRC), an endometrial cancer or a stomach cancer.
17. The method or the composition for use of any one of embodiments 1-10, wherein the target is SOX10 and the cancer is a melanoma (e.g., a skin or uveal melanoma) or a central nervous system (CNS) cancer.
18. The method or the composition for use of any one of embodiments 1-10, wherein the target is ALDH18A1 and the cancer is a breast, lung, pancreatic or skin cancer.
19. The method or the composition for use of any one of embodiments 1-10, wherein the target is FOXA1 and the cancer is a breast, or prostate cancer.
20. The method or the composition for use of any one of embodiments 1-10, wherein the target is HNF1B and the cancer is a kidney or a lung cancer.
21. The method or the composition for use of any one of embodiments 1-10, wherein the target is RUNX1 and the cancer is a hematopoietic cancer (e.g., ALL or AML).
22. The method or the composition for use of any one of embodiments 1-10, wherein the target is CBFB and the cancer is a hematopoietic cancer (e.g., ALL or AML).
[0454] 23. The method or the composition for use of any one of embodiments 1-10, wherein the target is TP63 and the cancer is a squamous cancer (e.g., bladder, esophageal or upper aerodigestive cancer).
24. The method or the composition for use of any one of embodiments 1-10, wherein the target is CDK2 and the cancer is a breast, endometrial, ovarian or lung cancer.
25. The method or the composition for use of any one of embodiments 1-10, wherein the target is VPS4A and the cancer is a breast, CRC, lung, stomach, pancreatic or upper aerodigestive cancer.
26. The method or the composition for use of any one of embodiments 1-10, wherein the target is TCF4 and the cancer is a hematopoietic cancer or a neuroblastoma.
27. The method or the composition for use of any one of embodiments 1-10, wherein the target is CEBPA and the cancer is a liver cancer or AML.
28. The method or the composition for use of any one of embodiments 1-10, wherein the target is GATA3 and the cancer is a breast cancer or neuroblastoma.
29. The method or the composition for use of any one of embodiments 1-10, wherein the target is ARID1B and the cancer is a cancer as described in Table 1 or 2.
30. The method or the composition for use of any one of embodiments 1-10, wherein the target is PRKRA and the cancer is a cancer as described in Table 1 or 2.
31. The method or the composition for use of any one of embodiments 1-10, wherein the target is HSPA8 and the cancer is a colorectal cancer (CRC) or skin cancer.
32. The method or the composition for use of any one of embodiments 1-10, wherein the target is IRF4 and the cancer is multiple myeloma (MM).
33. The method or the composition for use of any one of embodiments 1-10, wherein the target is SPI1 and the cancer is a hematopoietic cancer, (e.g., AML or ALL).
34. The method or the composition for use of any one of embodiments 1-10, wherein the target is MTHFD1 and the cancer is a breast cancer, colorectal cancer, lung cancer, pancreatic cancer or hematopoietic cancer (e.g., AML or ALL).
35. The method or the composition for use of any one of embodiments 1-10, wherein the target is ADAR and the cancer is a breast cancer, a lung cancer, an esophageal cancer, an upper aerodigestive cancer, a pancreatic cancer or a skin cancer.
36. The method or the composition for use of any one of embodiments 1-10, wherein the target is NFE2L2 and the cancer is a lung cancer, an esophageal cancer or a kidney cancer.
37. A method of evaluating or predicting the responsiveness of a subject having a cancer (e.g., any of the cancers disclosed in Tables 1 or 2), to a therapeutic treatment (e.g., a treatment with an inhibitor, e.g., an inhibitor of any of the targets disclosed in Tables 1 or 2), wherein the method comprises: [0455] evaluating the presence or absence of a genetic alteration (e.g., a genetic alteration as described in Table 2), e.g., gene amplification, copy number deletion, duplication or presence of microsatellite instability, wherein: [0456] (i) the presence of the alteration is indicative that the subject is likely to respond to the therapeutic treatment; or [0457] (ii) the absence of the alteration is indicative that the subject is less likely to respond to the therapeutic treatment; [0458] for at least one time point, e.g., prior to administration of the therapeutic treatment, thereby evaluating the subject, or predicting the responsiveness of the subject to a therapeutic treatment.
38. The method of embodiment 37, wherein responsive to said evaluation or prediction, the method further comprises selecting the subject for administration in an amount effective to treat the cancer, an inhibitor (e.g., an inhibitor of any of the targets disclosed in Tables 1 or 2) to treat the cancer (e.g., any of the cancers disclosed in Tables 1 or 2) in the subject.
39. The method of embodiment 37, wherein responsive to said evaluation or prediction, the method further comprises administering an inhibitor (e.g., an inhibitor of any of the targets disclosed in Tables 1 or 2) in an amount effective to treat the cancer (e.g., any of the cancers disclosed in Tables 1 or 2) in the subject.
40. A method of evaluating or predicting the responsiveness of a subject having a cancer (e.g., any of the cancers disclosed in Tables 1 or 2), to a therapeutic treatment (e.g., a treatment with an inhibitor, e.g., an inhibitor of any of the targets disclosed in Tables 1 or 2), wherein the method comprises: [0459] evaluating the expression level (e.g., high or low expression of, e.g., mRNA or protein) or activity, of a target (e.g., a target disclosed in Tables 1 or 2) or a downstream target of a target (e.g., one or more downstream targets of a target disclosed in Table 2), comprising: [0460] (i) measuring the expression level or activity of the target or a target-associated molecule (e.g., a downstream effector disclosed in Table 2), in the subject for at least one time point (e.g., prior to administration of the therapeutic treatment), e.g., using a method described herein, and [0461] (ii) (optionally) comparing the expression level or activity of the target or a target-associated molecule (e.g., a downstream effector disclosed in Table 2) (sample value) at least one time point with a reference level or activity (reference value), wherein: [0462] a) a higher sample value compared to the reference value is indicative that the subject is likely to respond to the therapeutic treatment; and [0463] b) a sample value that is the same or lower compared to the reference value is indicative that the subject is less likely to respond to the therapeutic treatment;
thereby evaluating the subject, or predicting the responsiveness of the subject to a therapeutic treatment.
41. The method of embodiment 40, wherein, the reference value is the expression level or activity of a target (e.g., a target disclosed in Tables 1 or 2) or a target-associated molecule (e.g., a downstream effector disclosed in Table 2), of a sample taken from a healthy, e.g., normal, subject.
42. The method of embodiment 40, wherein responsive to said evaluation or prediction, the method further comprises selecting the subject for administration in an amount effective to treat the cancer, an inhibitor (e.g., an inhibitor of any of the targets disclosed in Tables 1 or 2) to treat the cancer (e.g., any of the cancers disclosed in Tables 1 or 2) in the subject.
43. The method of embodiment 40, wherein responsive to said evaluation or prediction, the method further comprises administering an inhibitor (e.g., an inhibitor of any of the targets disclosed in Tables 1 or 2) in an amount effective to treat the cancer (e.g., any of the cancers disclosed in Tables 1 or 2) in the subject.
44. The method of any of embodiments 37-43, wherein the subject has a skin cancer or a uveal cancer, which cancer has or is identified as having high MITF expression, and the therapeutic treatment is a MITF inhibitor.
45. The method of any of embodiments 37-43, wherein the subject has a hematopoietic cancer (e.g., ALL or AML) or colorectal cancer (CRC), which cancer has or is identified as having high MYB expression, and the therapeutic treatment is a MYB inhibitor.
46. The method of any of embodiments 37-43, wherein the subject has a hematopoietic cancer (e.g., ALL, AML, MM or DLBCL) or Ewing's sarcoma, which cancer has or is identified as having high FLI1 expression, and the therapeutic treatment is a FLI1 inhibitor.
47. The method of any of embodiments 37-43, wherein the subject has a breast, colorectal, pancreatic or skin cancer, which cancer has or is identified as having high ASNS expression, and the therapeutic treatment is an ASNS inhibitor.
48. The method of any of embodiments 37-43, wherein the subject has a breast, colorectal, pancreatic or skin cancer, which cancer has or is identified as having low ASNS expression, and the therapeutic treatment is an ASNS agonist.
49. The method of any of embodiments 37-43, wherein the subject has a colorectal (CRC), endometrial or stomach cancer, which cancer has or is identified as having a microsatellite instability (MSI+), and the therapeutic treatment is a WRN inhibitor.
50. The method of any of embodiments 37-43, wherein the subject has a melanoma (e.g., a skin or uveal melanoma) or a central nervous system (CNS) cancer, which cancer has or is identified as having high SOX10 expression, and the therapeutic treatment is a SOX10 inhibitor.
51. The method of any of embodiments 37-43, wherein the subject has a breast, lung, pancreatic or skin cancer, which cancer has or is identified as having high ALDH18A1 expression, and the therapeutic treatment is an ALDH18A1 inhibitor.
52. The method of any of embodiments 37-43, wherein the subject has a breast, lung, pancreatic or skin cancer, which cancer has or is identified as having low ALDH18A1 expression, and the therapeutic treatment is an ALDH18A1 agonist.
53. The method of any of embodiments 37-43, wherein the subject has a breast, or prostate cancer, which cancer has or is identified as having high FOXA1 expression, and the therapeutic treatment is a FOXA1 inhibitor.
54. The method of any of embodiments 37-43, wherein the subject has a kidney or a lung cancer, which cancer has or is identified as having high HNF1B expression, and the therapeutic treatment is a HNF1B inhibitor.
55. The method of any of embodiments 37-43, wherein the subject has a hematopoietic cancer (e.g., ALL or AML), which cancer has or is identified as having high RUNX1 expression, and the therapeutic treatment is a RUNX1 inhibitor.
56. The method of any of embodiments 37-43, wherein the subject has a hematopoietic cancer (e.g., ALL or AML), which cancer has or is identified as having high RUNX1 or IKZF1 expression, and the therapeutic treatment is a CBFB inhibitor.
57. The method of any of embodiments 37-43, wherein the subject has a squamous cancer (e.g., bladder, esophageal or upper aerodigestive cancer), which cancer has or is identified as having high TP63 expression, and the therapeutic treatment is a TP63 inhibitor.
58. The method of any of embodiments 37-43, wherein the subject has a breast, endometrial, ovarian or lung cancer, which cancer has or is identified as having high CCNE1 expression or gene amplification, and the therapeutic treatment is a CDK2 inhibitor.
59. The method of any of embodiments 37-43, wherein the subject has a breast, CRC, lung, stomach, pancreatic or upper aerodigestive cancer, which cancer has or is identified as having a copy number deletion of VPS4B, and the therapeutic treatment is a VPS4A inhibitor.
60. The method of any of embodiments 37-43, wherein the subject has a hematopoietic cancer or a neuroblastoma, which cancer has or is identified as having high TCF4 expression, and the therapeutic treatment is a TCF4 inhibitor.
61. The method of any of embodiments 37-43, wherein the subject has a liver cancer or AML, which cancer has or is identified as having high CEBPA expression, and the therapeutic treatment is a CEBPA inhibitor.
62. The method of any of embodiments 37-43, wherein the subject has a breast cancer or neuroblastoma, which cancer has or is identified as having high GATA3 expression, and the therapeutic treatment is a GATA3 inhibitor.
63. The method of any of embodiments 37-43, wherein the subject has a cancer, which has or is identified as having an ARID1A mutation or low expression, and the inhibitor is an ARID1B inhibitor.
64. The method of any of embodiments 37-43, wherein the subject has a cancer, which has or is identified as having high EIF2AK2 expression, and the therapeutic treatment is a PRKRA inhibitor.
65. The method of any of embodiments 37-43, wherein the subject has a colorectal cancer (CRC) or skin cancer, which cancer has or is identified as having low HSP1A1 expression, and the therapeutic treatment is an HSPA8 inhibitor.
66. The method of any of embodiments 37-43, wherein the subject has multiple myeloma (MM), which cancer has or is identified as having high IRF4 expression, and the therapeutic treatment is an IRF4 inhibitor.
67. The method of any of embodiments 37-43, wherein the subject has a hematopoietic cancer (e.g., AML or ALL), which cancer has or is identified as having high SPI1 expression and the therapeutic treatment is an SPI1 inhibitor.
68. The method of any of embodiments 37-43, wherein the subject has a breast cancer, colorectal cancer, lung cancer, pancreatic cancer or hematopoietic cancer (e.g., AML or ALL), which cancer has or is identified as having high MTHFD1 expression, and the therapeutic treatment is a MTHFD1 inhibitor.
69. The method of any of embodiments 37-43, wherein the subject has a breast cancer, colorectal cancer, lung cancer, pancreatic cancer or hematopoietic cancer (e.g., AML or ALL), which cancer has or is identified as having low MTHFD1 expression, and the therapeutic treatment is a MTHFD1 agonist.
70. The method of any of embodiments 37-43, wherein the subject has a breast cancer, a lung cancer, an esophageal cancer, an upper aerodigestive cancer, a pancreatic cancer or a skin cancer, which cancer has or is identified as being positive for interferon stimulated gene (ISG) signature, and the therapeutic treatment is an ADAR inhibitor.
71. The method of any of embodiments 37-43, wherein the subject has a lung cancer, an esophageal cancer or a kidney cancer, which cancer has or is identified as having a KEAP1 mutation, an NFE2L2 mutation, high SQSTM1 expression, or positive for an NFE2L2 gene signature, and the therapeutic treatment is an NFE2L2 inhibitor.
72. A method of evaluating the effectiveness of a therapeutic treatment (e.g., a treatment with an inhibitor, e.g., an inhibitor of any of the targets disclosed in Tables 1 or 2), in a subject having a cancer (e.g., any of the cancers disclosed in Tables 1 or 2), comprising measuring the level (e.g., mRNA or protein) or activity (e.g., enzyme activity) of a target (e.g., a target of the inhibitor administered), in the subject (e.g., in a sample from the subject) for at least two time points, e.g., a first time point (e.g., prior to administration of the therapeutic treatment) and a second time point (e.g., after administration of the therapeutic treatment), e.g., using a method described herein, wherein: [0464] (i) a decrease in the expression or activity of the target or a target-associated molecule (e.g., a downstream effector disclosed in Table 2) between the first time point and the second time point is indicative that the subject is responding to the therapeutic treatment; and [0465] (ii) an increase, or no change in the expression or activity of the target or a target-associated molecule (e.g., a downstream effector disclosed in Table 2) between the first time point and the second time point is indicative that the subject is not responding to the therapeutic treatment [0466] thereby evaluating the effectiveness of the therapeutic treatment in the subject.
73. The method of embodiment 72, wherein responsive to said evaluation, the method further comprises administering an inhibitor, e.g., the same inhibitor, at a higher dose, e.g., at a dose at least 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, or 10-fold higher, compared to the first administration of the inhibitor to treat the disease.
74. The method of embodiment 72, wherein responsive to said evaluation, the method further comprising administering a second therapy, e.g., a therapy disclosed herein, to the subject, thereby treating the cancer.
75. A method of monitoring cancer relapse in a subject having a cancer (e.g., any of the cancers disclosed in Tables 1 or 2), who has responded or partially responded to a therapeutic treatment (e.g., a treatment with an inhibitor, e.g., an inhibitor of any of the targets disclosed in Tables 1 or 2), comprising measuring the level (e.g., mRNA or protein) or activity (e.g., enzyme activity) of a target (e.g., a target of the inhibitor administered), in the subject (e.g., in a sample from the subject) for at least two time points, e.g., a first time point (e.g., prior to administration of the therapeutic treatment) and a second time point (e.g., after administration of the therapeutic treatment), e.g., using a method described herein, wherein: [0467] (i) an increase in the expression or activity of the target or a target-associated molecule (e.g., a downstream effector disclosed in Table 2) between the first time point and the second time point is indicative that the cancer is relapsing; and [0468] (ii) the absence of an increase, e.g., a decrease, in the expression or activity of the target or a target-associated molecule (e.g., a downstream effector disclosed in Table 2) between the first time point and the second time point is indicative that the cancer is not relapsing.
76. The method of embodiment 75, wherein: [0469] (i) an increase in the expression or activity of the target or a target-associated molecule (e.g., a downstream effector disclosed in Table 2) at a subsequent (e.g., second, third, fourth, fifth, sixth, or seventh or later) time point relative to a prior (e.g., first, second, third, fourth, fifth, or sixth or later) time point, among the at least two time points, indicates that the cancer is relapsing; and [0470] (ii) the absence of an increase in the expression or activity of the target or a target-associated molecule (e.g., a downstream effector disclosed in Table 2) at a subsequent (e.g., second, third, fourth, fifth, sixth, or seventh or later) time point relative to a prior (e.g., first, second, third, fourth, fifth, or sixth or later) time point, among the at least two time points, indicates that the cancer is not relapsing.
77. A method of treating a subject having a cancer, e.g., a cancer disclosed in Tables 1 or 2, comprising in response to a determination that the subject, after having responded or partially responded to a first therapeutic treatment, (e.g., a treatment with an inhibitor, e.g., an inhibitor of any of the targets disclosed in Tables 1 or 2), has experienced, or has been identified as having experienced an increase in expression or activity of the target or a target-associated molecule (e.g., a downstream effector disclosed in Table 2), administering a second therapy, e.g., a second therapy disclosed herein, thereby treating the cancer.
78. A kit for predicting the sensitivity of a subject having a cancer associated with reduced, e.g., defective, activity of any of the targets disclosed in Tables 1 or 2, wherein the reduced activity of the target is due to gene inactivation mechanisms (e.g. epigenetic mechanisms), for treatment with an inhibitor, e.g., an inhibitor for the target, comprising: [0471] i) reagents capable of: [0472] a) detecting human cancer cells harboring genetic abnormalities, e.g., one or more of mutations, deletions, insertions, translocations, or microsatellite instability, or other gene inactivation mechanisms (e.g. epigenetic mechanisms); or [0473] b) detecting expression level (e.g., mRNA or protein), or activity (e.g., enzyme activity), of a target (e.g., a target of the inhibitor administered) or a target-associated molecule (e.g., a downstream effector disclosed in Table 2) in human cancer cells from a subject; and [0474] ii) instructions for how to use said kit.