TOMATO PLANTS RESISTANT TO TOBRFV, TMV, TOMV AND TOMMV AND CORRESPONDING RESISTANCE GENES

Abstract

A variants of the TM-2-2 protein, conferring recognition of the Movement Protein (MP) of the Tomato Brown Rugose Fruit Virus (ToBRFV), and wherein said variant comprises a tyrosine (Y), a phenylalanine (F) or a tryptophan (W) at the position corresponding to tyrosine 767 of the TM-2-2 protein and at least one of the following mutations: C848R, N822C, N822F, N822M, N822Y, N822W, N825H, N825K and N825T with respect to the TM-2-2 protein, potentially in combination with a F655L mutation. The present invention also relates to genetic sequences encoding such a variant protein, preferably to a mutated Tm-2-2 gene, and to plants, especially Solanum lycopersicum plants comprising in their genome the mutated gene conferring resistance to ToBRFV. The invention is also directed to parts of these plants, as well as progeny, and to the use of these sequences for providing ToBRFV resistance.

Claims

1-29. (canceled)

30. A TM-2-2 protein variant, which has at least 90% amino acid sequence identity with SEQ ID No:8, wherein said TM-2-2 protein variant confers resistance against at least ToBRFV infection in tomatoes, and wherein said TM-2-2 protein variant comprises a tyrosine (Y), a phenylalanine (F) or a tryptophan (W) at the position corresponding to tyrosine 767 of SEQ ID No:8, and one or more of the following substitutions: an arginine (R) at the position corresponding to cysteine 848 of the TM-2-2 protein (SEQ ID No:8); a cysteine (C), a phenylalanine (F), a methionine (M), a tyrosine (Y) or a tryptophan (W) at the position corresponding to asparagine 822 of the TM-2-2 protein (SEQ ID No:8), and a histidine (H), a lysine (K) or a threonine (T) at the position corresponding to serine 825 of the TM-2-2 protein (SEQ ID No:8).

31. The TM-2-2 protein variant according to claim 30, further comprising a leucine at the position corresponding to phenylalanine 655 of the TM-2-2 protein (SEQ ID NO:8).

32. A resistance gene encoding the TM-2-2 protein variant according to claim 30, conferring resistance to ToBRFV infection in tomato plants.

33. A nucleic acid construct comprising a sequence encoding the TM-2-2 protein variant according to claim 30.

34. A plant cell, comprising the resistance gene according to claim 32 within its genomic DNA, homozygously or heterozygously.

35. The cell according to claim 34 or a tissue culture of said cells, wherein the cells are derived from embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, stems, petioles, roots, root tips, seeds, flowers, cotyledons, and/or hypocotyls, and contain in their genome said resistance gene.

36. A plant resistant against ToBRFV, wherein said plant comprises in its genome the resistance gene according to claim 32, homozygously or heterozygously.

37. A S. lycopersicum plant resistant to ToBRFV, comprising a mutated Tm-2-2 gene encoding a variant of the TM-2-2 protein (SEQ ID No:8), wherein said TM-2-2 protein variant has at least 90% sequence identity with SEQ ID No:8, wherein the tyrosine (Y) at the position corresponding to position 767 of SEQ ID No:8 is not mutated or is substituted by a phenylalanine (F) or a tryptophan (W) and wherein said TM-2-2 protein variant comprises one or more of the following substitutions: the cysteine (C) at the position corresponding to position 848 of SEQ ID No:8 is substituted by an arginine (R), the asparagine (N) at the position corresponding to position 822 of SEQ ID No:8 is substituted by a cysteine (C), a phenylalanine (F), a methionine (M), a tyrosine (Y) or a tryptophan (W), and the serine (S) at the position corresponding to position 825 of SEQ ID No:8 is substituted by a histidine (H), a lysine (K) or a threonine (T).

38. The S. lycopersicum plant according to claim 37, wherein said mutated Tm-2-2 gene encodes a variant of the TM-2-2 protein further comprising a leucine at the position corresponding to phenylalanine 655 of the TM-2-2 protein (SEQ ID NO:8).

39. The S. lycopersicum plant according to claim 37, wherein said mutated Tm-2-2 gene encodes a variant of TM-2-2 protein, having SEQ ID No:9, SEQ ID No:10, SEQ ID No:17, SEQ ID No:18, SEQ ID No:19, SEQ ID No:20, SEQ ID No:21, SEQ ID No:22, SEQ ID No:23, SEQ ID No:24, SEQ ID No:25 or SEQ ID No:26.

40. The S. lycopersicum plant according to claim 37, wherein said mutated Tm-2-2 gene is obtained by gene editing, base-editing or prime-editing techniques.

41. A plant part of the S. lycopersicum plant resistant to ToBRFV, comprising a mutated Tm-2-2 gene encoding the variant of the TM-2-2 protein (SEQ ID No:8), wherein said TM-2-2 protein variant has at least 90% sequence identity with SEQ ID No:8, wherein the tyrosine (Y) at the position corresponding to position 767 of SEQ ID No:8 is not mutated or is substituted by the phenylalanine (F) or the tryptophan (W) and wherein said TM-2-2 protein variant comprises one or more of the following substitutions: the cysteine (C) at the position corresponding to position 848 of SEQ ID No:8 is substituted by an arginine (R), the asparagine (N) at the position corresponding to position 822 of SEQ ID No:8 is substituted by the cysteine (C), the phenylalanine (F), the methionine (M), the tyrosine (Y) or the tryptophan (W), and the serine (S) at the position corresponding to position 825 of SEQ ID No:8 is substituted by the histidine (H), the lysine (K) or the threonine (T), wherein said plant part comprises at least one cell according to claim 34.

42. A S. lycopersicum seed, which comprises at least one cell according to claim 34.

43. A method for obtaining transgenic S. lycopersicum plants resistant to ToBRFV, comprising: obtaining a construct comprising a sequence encoding the TM-2-2 protein variant according to claim 30, introducing said construct into a S. lycopersicum cell, regenerating a transgenic plant; optionally propagating the obtained plant.

44. A method for breeding a S. lycopersicum plant resistant to ToBRFV, and optionally to at least one of TMV, ToMV, and/or ToMMV, comprising: crossing a S. lycopersicum plant comprising the resistance gene according to claim 32 with an initial S. lycopersicum plant devoid of resistance gene, selecting in the progeny thus obtained, a plant bearing the resistance gene, optionally self-pollinating one or several times the plant obtained at step (b) and selecting in the progeny thus obtained a plant bearing the resistance gene.

45. A method of producing a S. lycopersicum plant resistant to ToBRFV, and optionally to at least one of TMV, ToMV, and/or ToMMV, comprising: obtaining a part of the plant according claim 37, vegetatively propagating said plant part to generate a plant from said plant part.

46. A method for improving the yield of tomato plants or for reducing the loss on tomato production in an environment infested or likely to be infested by ToBRFV comprising growing tomato plants comprising in their genome the resistance gene according to claim 32.

47. A method for reducing the loss on tomato production in condition of ToMV, TMV, ToMMV and/or ToBRFV infestation, comprising growing a tomato plant comprising in its genome the resistance gene according to claim 32.

48. A method of producing tomatoes comprising: growing the S. lycopersicum plant according to claim 37; allowing said plant to set fruit; and harvesting fruit of said plant.

49. A method for identifying, detecting and/or selecting mutants of the Tm-2-2 gene conferring resistance against ToBRFV, comprising: expressing transiently or constitutively in a Solanaceae plant, a mutant of the Tm-2-2 gene to be tested in presence of the movement protein (MP) of ToBRFV, detecting an interaction between the protein expressed from the mutant gene and the MP protein.

Description

LEGEND OF THE FIGURES

[0244] FIG. 1: Transient expression in N. benthamiana of different TM-2-2 variants in presence or absence of movement proteins of TMV or ToBRFV. Photo taken about 5 days post infiltration.

[0245] FIG. 2: Transient expression in N. benthamiana of different TM-2-2 variants in presence or absence of movement proteins of TMV or ToBRFV. Leaves of 2 different ages of N. benthamiana plants were infiltrated. About 50 day old plant (Left) or 43 day old plant (Right) were infiltrated with Agrobacterium cultures to transiently express different TM-2-2 protein variants in the presence or absence of movement proteins of TMV or ToBRFV. Photographs taken approximately 5 days after infiltration.

[0246] FIG. 3: plasmids for transformation of tomato

[0247] FIG. 3A: binary plasmids pJL469 (SEQ ID NO:41)

[0248] FIG. 3B: binary plasmids pJL470 (SEQ ID NO:42),

[0249] FIG. 3C: binary plasmids pJL471 (SEQ ID NO:43).

[0250] FIG. 4: Alignment of proteins of genes Tm2-2, Tm-2-14-25 and Tm2-467.

[0251] FIG. 5: Transient expression in N. benthamiana and N. tabacum of different TM-2-2 variants in presence or absence of movement proteins of ToBRFV. TM22 848R variants with different amino acids at AA 767 were transiently expressed in presence (+MP) of absence of movement protein of ToBRFV. The various amino acids at position 767 are labeled on the Figure using the standard single amino acid code to identify variant. Photo taken 2 days after agroinfiltration.

[0252] FIG. 5A: N. benthamiana

[0253] FIG. 5B: N. tabacum

EXAMPLES

[0254] The TM-2-2 protein (product of the Tm-2-2 gene) is a nucleotide binding leucine rich repeat protein (NLR) and confers resistance to TMV and ToMV by binding the movement protein (MP) produced from either virus, and signaling an effective immune response against the invading virus. The result of binding between TM-2-2 and tobamovirus MP can be observed as a hypersensitive response (tissue necrosis) in a transient expression assay in N. benthamiana.

[0255] The NLR proteins TM-2 and TM-2-2 differ by only 4 amino acids (Lanfermeijer et al. 2005). These differences are associated with different spectrums of resistance. For example the TM-2-2 variant can confer resistance to a broader range of TMV and ToMV isolates than TM-2 (Lanfermeijer et al. 2005; Lanfermeirjer 2004). One amino acid change in particular, amino acid 767 in the LRR domain, was demonstrated to be responsible for the more durable and broader host range of resistance in the TM-2-2 protein (Kobayashi et al. 2011). TM-2 and TM-2-2 proteins however provide no resistance against ToBRFV.

[0256] The present inventors have thus hypothesized that mutations in the TM-2 and TM-2-2 proteins could retain the capacity to recognize ToMV and TMV MP while conferring the capacity to also recognize ToBRFV MP.

[0257] Using the transient expression assay in N. benthamiana in order to test the capacity to recognize tobamovirus MP, the inventors have been able to test efficiently a high number of variants. They have unexpectedly isolated variants of the TM-2-2 protein which efficiently recognize the movement protein (MP) of ToBRFV, triggering a hypersensitive response when co-expressed along with the ToBRFV MP (effector). Furthermore these variants also bind and respond to the ToMV and TMV MP.

[0258] The DNA sequences of these variants have been obtained, as well as sequences of further variants also recognizing ToBRFV MP in addition to TMV and ToMV MP (examples 2, 3, 4 and 5).

[0259] By TILLING, plants comprising TM-2-2 mutants as described can be obtained (example 6), as well as by Agrobacterium transformation (example 7).

Example 1: Material and Methods

[0260] 1.1. Sequences of the Tm-2 Gene Alleles and of the MP Proteins Referred to in this Section:

TABLE-US-00001 TABLE 1 List of some tm2 gene alleles. Gene Name SEQ # Protein Phenotype induced and comments tm2 AF536199 SEQ ID No: 6 TMV-U1 (S), ToMV-GeRo (S); ToBRFV (S); SEQ ID No: 1 No HR with ToBRFV MP in N. benthamiana test Tm-2 AF536200 TM-2 TMV-U1 (R); ToMV-GeRo (S); ToBRFV (S); SEQ ID No: 2 SEQ ID No: 7 No HR with ToBRFV MP in N. benthamiana Plasmid pJL398 test Tm-2.sup.2 AF536201 TM-2-2 TMV_U1 (R); ToMV-GeRo (R); ToBRFV (S); SEQ ID No: 3 SEQ ID No: 8 No HR with ToBRFV MP in N. benthamiana Plasmid pJL366 test Tm-2.sup.14-25 SEQ ID No: 4 SEQ ID No: 9 HR with TMV, ToMV and ToBRFV MP in N. benthamiana test Tm2.sup.-467 SEQ ID No: 5 SEQ ID No: 10 HR with ToBRFV MP in N. benthamiana test Plasmid pJL467 Tm2-4 SEQ ID No: 27 TM2-4 HR with ToBRFV MP in N. benthamiana test Plasmid 517_6 SEQ ID No: 17 Tm2-5 SEQ ID No: 28 TM2-5 HR with ToBRFV MP in N. benthamiana test Plasmid SEQ ID No: 18 pJL_517_7 Tm2-825H SEQ ID No: 29 TM2-825H HR with ToBRFV MP in N. benthamiana test Plasmid 564_25 SEQ ID No: 19 Tm2-825K SEQ ID No: 30 TM2-825K HR with ToBRFV MP in N. benthamiana test Plasmid 565_10 SEQ ID No: 20 Tm2-825T SEQ ID No: 31 TM2-825T HR with ToBRFV MP in N. benthamiana test Plasmid 565_5 SEQ ID No: 21 Tm2-822C SEQ ID No: 32 TM2-822C HR with ToBRFV MP in N. benthamiana test Plasmid 607_5 SEQ ID No: 22 Tm2-822F SEQ ID No: 33 TM2-822F HR with ToBRFV MP in N. benthamiana test Plasmid 607_11 SEQ ID No: 23 Tm2-822M SEQ ID No: 34 TM2-822M HR with ToBRFV MP in N. benthamiana test Plasmid 608_18 SEQ ID No: 24 Tm2-822Y SEQ ID No: 35 TM2-822Y HR with ToBRFV MP in N. benthamiana test Plasmid 607_12 SEQ ID No: 25 Tm2-822W SEQ ID No: 36 TM2-822W HR with ToBRFV MP in N. benthamiana test Plasmid 606_1 SEQ ID No: 26 TMV-U1 = Tobacco Mosaic virus U1 strain ToMV = Tomato Mosaic Virus GeRo Strain ToBRFV = Tomato Brown Rugose Fruit virus HR = hypersensitive response R = resistant; S = Susceptible

TABLE-US-00002 TABLE 2 Amino acid sequences of selected Tobamovirus MPs referred to in the examples. MP Source AA seq Plasmid name TMV (AF546184.1 Flavum strain) SEQ ID No: 13 pJL 380 ToMV (X02144.1 OM strain) SEQ ID No: 14 pJL 481 ToBRFV (MS549394.1 Ca1A isolate) SEQ ID No: 15 pJL 379 ToMMV (KX898033) SEQ ID No: 16

1.2. Mutagenesis:

[0261] To find TM-2-2 protein variants that trigger HR in the presence of ToBRFV MP (MP_Rugose in the following), two different approaches were deployed, namely random and site-directed mutagenesis, each designed to create variation in the LRR domain of TM-2-2.

[0262] Using the Takara Diversify PCR Random Mutagenesis Kit and PCR conditions that generated, on average, 4 changes per 1000 basepairs, the last around 750 nucleotides of the TM-2-2 gene were amplified by the PCR. The resulting PCR product was cloned into a Tm-2-2 gene expression plasmid, replacing the wt 3750 nts of the Tm-2-2 gene.

[0263] When it is desirable to introduce variation at specific locations in the Tm-2-2 gene site directed mutagenesis can be used. This is accomplished by the synthesis of portions of the Tm-2-2 gene with sequence variation at specific codons of interest. For example a synthetic oligonucleotide that can be used as a primer in the PCR can be designed for amplification of part of the Tm-2-2 gene, yet still designed to have one or more non-wild type nucleotides at specific locations. Following the PCR with such an oligonucleotide primer, the PCR product can be cloned into the appropriate location of the Tm-2-2 gene. In this manner it is possible to introduce nucleotide diversity at specific locations in a gene.

1.3. Transient Expression in N. benthamiana and Evaluation of Necrosis:

[0264] Transient expression in N. benthamiana and N. tabacum was carried out essentially as described in Ma et al, and in Kobayashi et al.

[0265] The products of the ligation reaction disclosed in example 1.2 were transformed into Agrobacterium tumefaciens (GV3101) and plated on LB plates with 50 ug/ml Kanamycin and 25 ug/ml Gentamycin to select for transformed Agrobacterium.

[0266] Approximately 860 different Agrobacterium colonies were selected from the transformation. Each colony grown in liquid culture and used to prepare an Agrobacterium suspension for agroinfiltration using standard procedures commonly used in plant biology (Tomita et al. 2019). Prior to infiltration into N. benthamiana leaves, cultures were mixed 1:1 with a suspension of Agrobacterium that had been transformed with the tobamovirus MP expression plasmid, for example the ToBRFV MP expression plasmid pJL 379.

[0267] Infiltrated plants were kept under either LED or fluorescent lights (18 hr light, 6 hr dark) at between 22 and 25 C. With an error rate of approximately 4 changes per kb it was estimated that approximately 2500 nucleotides changes were sampled (750 bp/clone860 clones4 errors/1000 bp=2580 nt changes). In initial characterization of this library by sequencing the inventors estimated about 75% of the nucleotide changes would result in amino acid changes. If 75% of all the nucleotide mutations in the clones screened generated amino acid changes this would be approximately 1900 AA changes to the TM-2-2 protein were screened (0.752580=1935)

[0268] Approximately 6 days post infiltration infiltrated leaves were observed and the degree of necrosis (Hypersensitive Response, HR) in infiltrated zones were measured. Typically a scale from 0 to 4 was used to estimate the percentage of infiltrated zone showing necrosis. Details of the scale are as follows: 0=0% HR, 1=25% HR, 2=50% HR, 3=75% HR, 4=100% HR. As a control, plants were also infiltrated with a 1:1 mix of Agrobacterium carrying the wt Tm-2-2 expression plasmid (pJL 366) and Rugose MP expression plasmid (pJL 379).

1.4. Protocol for Evaluation of Tobamovirus Resistance:

[0269] Several Tobamovirus isolates were used to perform Bioassay: ToBRFV isolates (inter alia Jordan_2015), ToMV, TMV or other tobamovirus.

[0270] Virus isolates are maintained by frozen storage of infectious juice coming from 14 days old infected tomato leaves grinded in water (inoculum proportion: 1 g leaves for 4 ml of water). Bioassay are carried out by sap-inoculation of tomato plantlets at two-leaf stage (i.e. 14-16 days after seeding) by rubbing the cotyledons with the index finger. At least 18 plantlets (separated in 2 or 3 repetitions) per tomato lines/accessions/genotypes were tested for tobamovirus resistance.

[0271] Phenotypic evaluation of plant is carried out by plant by plant scoring, without contacting the plants. The presence of local lesions on the inoculated organs is carried out between 7 and 10 DPI. If at least one plant per genotype exhibits local lesions on inoculated organs, the genotype is considered as potentially interesting. The tobamoviruses indeed, do not generally trigger necrosis on susceptible plants.

[0272] Systemic symptoms evaluations are carried out at 14, 21 and 28 DPI, the last evaluation being optional. Symptoms are visually assessed according the following scale: 9: No visible symptoms/7: small phenotypic difference but not clearly attributable to a disease symptom/5: mild symptoms (mosaic and/or light vein banding)/3: strong symptoms (strong mosaic and/or pronounced vein banding and/or small leaves deformation)/1: very strong symptoms (leaves deformation and/or mosaic and/or highly pronounced vein banding).

[0273] After 14 and/or 28 days of test, the plants without symptoms are tested by ELISA and/or quantitative PCR to evaluate the presence of tobamovirus in plant.

1.5. TILLING (Targeting Induced Local Lesions IN Genomes):

[0274] Tilling method is applied according to the usual protocols.

[0275] All DNA reactive chemical agents (mutagens) can be used for inducing lesions in the DNA and are not limited to EMS.

[0276] Physical DNA reactive agents (mutagens) can also be used, such as: [0277] Ionizing radiations (X-Ray, gamma rays, alpha particles . . . ) heavy-ion beam irradiation [0278] Ultraviolet radiations [0279] Radioactive decay

[0280] The physical or chemical mutagen is applied on M0 seed. The M1 plants, heterozygous for all mutations introduced by the mutagen are then selfed, giving rise to the seeds M2. A portion of these seeds are stored. A sampling is then conducted on at least 8 plants M2 for sequencing. The theoretical ratios are of the plants will be heterozygous for a given mutation, will be homozygous for the mutation and will be homozygous for the absence of said mutation.

[0281] Alternatively, the screening for suitable mutations can also be conducted on M1 plants.

[0282] In the present case, insofar as the expected mutation in the Tm-2-2 gene is highly specific, it is important to test a very large population of mutants.

Example 2: Identification of a Tm2 Gene Allele that Recognizes ToBRFV MP

BACKGROUND

[0283] Tomato Brown Rugose Fruit Virus (ToBRFV) is a serious pathogen of tomatoes and peppers. It is related to other tobamoviruses such as Tobacco Mosaic Virus (TMV) and Tomato Mosaic Virus (ToMV).

[0284] Genetic Resistance against TMV and ToMV maps to the Tm-2-2 gene. The TM-2-2 protein, product of the Tm-2 gene, is a resistance (R) protein of the nucleotide binding leucine rich repeat (NLR) class, also known as NBS-LRR class. There are two commonly use alleles of the Tm-2 gene in commercial tomato germplasm, namely Tm-2 and Tm-2-2. The different alleles confer resistance to different tobamoviruses (see Table 1). The Tm-2-2 allele in particular is widely deployed in commercial tomato germplasm because it confers durable genetic resistance to two tobamoviruses (TMV and ToMV) which are significant disease threats to tomato. However ToBRFV can infect plants that carry the Tm-2 or Tm-2-2 genes and there are no identified Tm-2 alleles that confer resistance to ToBRFV. Moreover, there are no known resistance genes that provide effective resistance simultaneously against ToBRFV, TMV and ToMV.

[0285] The TM-2-2 protein confers resistance to TMV and ToMV by binding the movement protein (MP) produced from either virus, and signaling an effective immune response against the invading virus by triggering a hypersensitive response (HR) in tomato, resulting in cell death. The result of binding between TM-2-2 and tobamovirus MP, namely the HR response, can be also observed by transiently expressing TM-2-2 protein and either TMV or ToMV MP in leaves of N. benthamiana plants, following the protocol disclosed in Kobayashi et al, 2011.

[0286] Transient expression of TM-2-2 and either TMV or ToMV MP in N. benthamiana leaves (by the Agroinfiltration technique) indeed results in a hypersensitive reaction and extensive tissue necrosis in just a few days. In contrast transient expression of TM-2-2 and ToBRFV MP (MP_Rugose) in N. benthamiana leaves usually results in no, or occasionally very mild, necrosis.

[0287] The HR response assay in N. benthamiana has previously been used to identify specific amino acids in the NLR protein which are critical for recognizing tobamovirus MPs (Kobayashi et al, 2011). There is a perfect correlation between the ability of a TM2 NLR protein to trigger a robust HR response in N. benthamiana leaves (in the presence of a tobamovirus MP) and virus resistance in tomato. Moreover, transient expression of proteins by Agroinfiltration is a well established technique in plant biology.

[0288] In view of this perfect correlation, this assay in N. benthamiana can be used as a surrogate for resistance in tomato.

[0289] However, whereas the prior uses of this assay or method aimed at identifying the specific amino acids in the NLR protein which are critical for recognizing tobamovirus MPs, by detecting the mutations giving rise to loss of function, the inventors have for the first time used this method to test mutants likely to provide a gain of function, i.e. the capacity to recognize further tobamovirus MPs. The inventors have first generated a library of mutants of the Tm-2-2 gene using error prone PCR methods. This library of variants was then transiently expressed along with the ToBRFV MP in leaves of N. benthamiana plants (see Material and Methods in examples 1.2 and 1.3). After screening more than 860 transformed agrobacterium cultures, corresponding in average to 2.25 amino-acid modifications per variant, the inventors identified one colony (LP 14-25) showing a repeatable and noticeably increased HR response (as compared to the control) when co-expressed with ToBRFV MP. The inventors have moreover checked that this variant, triggering a robust HR response in the presence of ToBRFV MP, has not lost its ability to trigger also a robust HR response in the presence of TMV or ToMV MP (See FIGS. 1 and 2 and table 3).

TABLE-US-00003 TABLE 3 HR response of various TM2 protein variants to tobamovirus movement proteins. TMV_U1 MP ToBRFV MP Protein SEQ ID No: 13 SEQ ID No: 15 tm2 Tm-2-2 + Tm2-14-25 + + Tm2-467 + + = no HR response when proteins are co-expressed in N. benthamiana leaves. + = strong HR response when proteins are co-expressed in N. benthamiana leaves.

[0290] Detailed analysis of this variant revealed that it was different from the TM-2-2 protein at 2 amino acids (F655L and C848R). This new variant is called Tm2-14-25 (see Table 1).

[0291] Through additional analysis, using standard molecular techniques, including site-directed mutagenesis, the inventors mapped the ability to recognize ToBRFV MP to a single amino acid change (C848R). The inventors identify this new Tm-2 allele as Tm2-467 (see Table 1 and Table 4).

[0292] This experiment revealed that C848R change to TM-2-2 was both involved and sufficient for detection and response to MP-Rugose (ToBRFV MP).

TABLE-US-00004 TABLE 4 reports the HR response of different variants: Construct AA changes to HR when expressed Name TM-2-2 with MP Rugose LP_14-25 F655L, C848R 4 pJL 466 F655L <1 pJL 467 C848R 4 pJL 366 None (wt TM-2-2) <1

[0293] An alignment of the proteins TM2-2, TM2-14-25 and TM2-467 (protein products of the Tm-2-2, Tm2-14-25 and Tm2-467 genes, respectively) is presented in FIG. 4.

[0294] Since both TM2-14-25 and TM2-467 proteins recognize ToBRFV MP it is apparent that the amino acid change they share is responsible for the ability to robustly recognize ToBRFV MP (as compared to TM-2-2 protein). It is also observed that the protein can have additional mutations (such as the change unique to TM2-14-25) and still recognizes ToBRFV MP. Both TM2-14-25 and TM2-467 proteins still recognize TMV and ToMV MPs.

[0295] Either TM2_14-25 or TM2-467 protein sequences can confer improved resistance to ToBRFV in tomato, while simultaneously conferring resistance against TMV and ToMV.

Example 3: Additional Mutants

[0296] As detailed in the preceding example, the inventors have shown that a single amino acid change in the TM-2-2 protein is sufficient for triggering a robust HR response in the presence of ToBRFV MP, without loss of resistance against TMV and ToMV.

[0297] In order to better characterize this mutation, and additional mutations likely to improve the resistance, other amino acid variations were created, using a site-directed approach. Selected codons in the LRR domain were changed to encode for non-wild type amino acids. Functional screening of the protein variants was performed by agroinfiltration and transient expression in N. benthamiana in the presence of MP_rugose (as described above). In some cases, selected amino acid changes were screened in a TM-2-2 protein background that also had the 848R change discussed in example 2. Results of some of the screens are shown in Tables 5-11.

Position 848

[0298]

TABLE-US-00005 TABLE 5 Tests for mutants at position 848 Construct AA at HR when expressed Name 848 with MP Rugose pJL 366 C (wt) <1 pJL 468_A A <1 pJL 468_D D <1 pJL 468_E E <1 pJL 468_H H <1 pJL 468_K K ~1 pJL 468_L L <1 pJL 468_M M <1 pJL 468_N N <1 pJL 468_P P <1 pJL 468_Q Q <1 pJL 468_R R 4 pJL 468_S S ~1 pJL 468_T T ~1

[0299] Conclusion: None of the amino acid variations at position 848 creates a TM-2-2 variant that elicits a similar let alone a stronger hypersensitive response in the presence of MP_Rugose than C848R.

Position 857

[0300] The impact of AA variation at position 857 was also tested, this position being near position 848 and in the vicinity of amino acid 848 in the 3D structure of the TM-2-2 protein. The results are presented in table 6.

TABLE-US-00006 TABLE 6 Tests for mutants at position 857, with or without C848R variation. Construct HR to MP Name AA 848 AA 857 Rugose pJL 366 C (wt) K (wt) <1 pLP 14-25 R K 3 pJL 480Q R Q 3 pJL 480E R E <1 pJL 480T R T <1 pJL 480R R R <1 pJL 480I R I <1

[0301] Conclusion: several AA changes at position 857, with AA 848 as R, reduce the HR response to MP Rugose. Other AA changes near 848R can however preserve the response to MP Rugose.

[0302] Variations at position 857 are thus allowable but to a limited extent. Acceptable variations can be easily tested.

Position 767

[0303] The impact of AA variation at position 767 (only) was also tested (without variation at position 848). The amino acid at this position has been demonstrated by Kobayasi et al as being decisive for the differences between TM-2 and TM-2-2 resistances. The results are presented in table 7.

TABLE-US-00007 TABLE 7 Construct Name AA 767 HR to MP Rugose pJL 366 Y (wt) <1 L11_10 I 0 L11_11 C 0 L11_15 L 0 L11_16 G 0 L11_19 N 0 L11_20 V 0 L11_1 R <1

[0304] Conclusion: Of 7 different AA variants at position 767 tested, none improved the ability to detect and respond to MP Rugose, in the absence of theC848R mutation.

Position 769

[0305] The impact of AA variation at position 767 (only) was also tested (without variation at position 848). The results are presented in table 8.

TABLE-US-00008 TABLE 8 Construct Name AA 769 HR to MP Rugose pJL 366 S (wt) <1 L12_11 G <1 L12_12 R <1 L12_4 F <1 L12_16 E <1 L12_3 V <1 L12_A A 0

[0306] Conclusion: Testing TM22 variants with 6 different (non wt) AA at position 769 did not reveal any variants that are better at binding and responding to MP Rugose, than the C848R variant.

Position 767 in the TM-2-2 848R Background

[0307] The impact of AA variation at position 767, in addition to the C848R variation, was also tested. The results are presented in table 9.

TABLE-US-00009 TABLE 9 Construct Name AA 767 AA 769 AA 848 HR to MP Rugose pJL 511_1 S A R 0 pJL 511_2 S S (wt) R 0 pJL 511_3 Y A R 4 pJL 511_5 Y (wt) S (wt) R 4 pJL 511_8 D A R 0 pJL 511_12 D S (wt) R 0

[0308] Conclusion: Detection of MP Rugose is dependent upon the AAs at both positions 767 and 848. The TM-2-2 variant with AA 848 as R and 767 as Y can detect and respond to MP_Rugose. However changing AA 767 to S or D dramatically reduces the ability of the protein to respond to MP_Rugose. This indicates that both residues 767 and 848 are important for binding MP_Rugose.

[0309] Further investigations by the inventors have demonstrated that position 767 can however be substituted by W and F without significantly reducing the ability of the protein to respond to MP_Rugose, and even enhancing this ability (see example 4).

Position 822

[0310] The impact of AA variation at position 822 was also tested, in the context of the C848R variation, this position 822 being proposed to be in the vicinity of amino acid 848 in the 3D structure of the TM-2-2 protein. The results are presented in table 10.

TABLE-US-00010 TABLE 10 Construct Name AA 822 AA 848 HR to MP Rugose pJL 366 N (wt) C (wt) <1 pLP 14-25 N R 4 pJL 476_S S R 4 pJL 476_I I R 0 pJL 476_F F R 2 pJL 476_C C R 2 pJL 476_T T R <1 pJL 477_H H R <1 pJL 477_D D R <1 pJL 476_K K R 0 pJL 476_R R R 0

[0311] Conclusions: Various amino acids at position 822, can reduce ability of TM22 848R to bind and respond to MP_rugose but other variations are allowable. Amino acids N and S are preferred at position 822 when 848 is R.

[0312] Further investigations by the inventors have demonstrated that position 822 can however be substituted by C, F, M, Y and W and provide the ability of the protein to respond to MP_Rugose even in the absence of the C848R mutation (see example 5).

[0313] In summary, in the process of identifying this mutant and further mutants comprising mutations allowing this gain of function, more than 1000 different variants were screened, using a combination of site directed and random mutagenesis. It is to be noted that some members of the libraries of mutants obtained by random mutagenesis were screened in HR assay without being sequenced.

[0314] Table 11 below details the different variants which were screened for response to ToBRFV MP, with mention of the tested mutation if known.

TABLE-US-00011 TABLE11 OverviewofvariantsofTM22 screenedforresponsetoMP_Rugose Approx# AA screened LINE Library position before specific ID type targeted Strategy sequencing AAtested 1 site 767 Degenerate YICLGNVRS directed codons/syntheticoligos D 2 site 769 Degenerate SGRFEVA directed codons/syntheticoligos 3 random 611-861 errorpronepcr 860 unknown 4 site 822 Degenerate NSIFCTYHD directed codons/syntheticoligos KR 5 site 825 Degenerate AITPCFYNR directed codons/syntheticoligos S 6 site 827 Degenerate 96 VGLQHFSM directed codons/syntheticoligos 7 site 848 Degenerate ADEHKLMNP directed codons/syntheticoligos QRST 8 site 851 Degenerate ACEFGHKLN directed codons/syntheticoligos PQRSTVW 9 site 857 Degenerate KQETRI directed codons/syntheticoligos TOTAL 956 81

[0315] In Summary, 767Y and 848R in TM-2-2 appear as critical residues for binding and responding to MP_Rugose according to these tests (further modifications appear however to be permissive, see example 4). Other amino acid changes at other locations of the LRR domain can often lead to mild or sometimes significant, decreases in MP_Rugose binding, but not all; suitable amino acid changes can easily be tested by the assay described in the present invention.

[0316] The amino acids in the vicinity of amino acid 848 in the 3D structure of TM-2-2 are likely to be less prone to mutations without loss of binding to the ToBRFV.

[0317] In other experiments libraries of variants at a single codon were screened. An example of one such experiment, at codon 827, and its results are shown below:

[0318] Degenerate codon libraries at codon 827 in TM-2-2 848R gene background

TABLE-US-00012 Library Degenerate # isolates Name codon Possible AA (#) screened HR response to MP Rugose Library 1 HWK K,N,M,I,Q,H,L,Y,F (9) 41 NONE better than TM22 848R Library 2 KVS D,E,A,G,S,C,W,Y (7) 41 NONE better than TM22 848R Library 3 MSA T,R,P,L 14 NONE better than TM22 848R

[0319] Degenerate codon libraries screened at codon 827 in TM22 (848C) gene background

TABLE-US-00013 # isolates Library Codon AA possible (#) screened HR to MP Rugose Library 4 HWK K,N,M,I,Q,H,L,Y,F (9) 41 NONE better than TM22 848R Library 5 KVS D,E,A,G,S,C,W,Y (7) 41 NONE better than TM22 848R Library 6 MSA T,R,P,L 14 NONE better than TM22 848R

[0320] The results obtained with libraries 1-6, similar to results obtained at other positions, demonstrate that the variation at position 848 is very important and that variations of other codons in the LRR region of TM-2-2 do not produce variants that have an improved recognition and response to MP_rugose. In any event, the mutation at position 848 appears necessary for the MP_rugose recognition.

Example 4: Further Modification at Position 767 and Validation in Different Nicotiana Species

[0321] Further modifications at position 767 of the TM-2-2 protein variant comprising the C848R substitution have be tested in different Nicotiana species.

[0322] Specifically, plants (N. benthamiana and N. tabacum) were infiltrated with Agrobacterium cultures containing plasmids with T-DNAs for expression of a TM-2-2 protein variant alone, or co-expression of a TM-2-2 protein variant and MP_Rugose.

[0323] The results are presented on FIG. 5. Letter by spots on leaf denote the amino acid at position 767 in TM-2-2 848R variant background. TM-2-2 variants were expressed alone (Letter only) or co-expressed with Rugose MP (+MP).

[0324] Plants have been photographed48 hours post infiltration.

[0325] Results show that TM-2-2 767Y 848R (TM2-467); 767F 848R (TM2-4), and 767W 848R (TM2-5) all trigger an HR response in presence of MP_Rugose in either N. benthamiana (FIG. 5A) or N. tabacum cv Xanthi (FIG. 5B). The 767W and Y variants appear to be more responsive to MP rugose than the 767F variant in this assay. In contrast TM-2-2 variants with R, Q or G amino acids at position 767 did not trigger HR in presence of MP_Rugose.

Example 5: Identification of Further Tm2 Gene Alleles that Recognize ToBRFV MP

[0326] In view of the importance of the C848R mutation, further mutants have been tested wherein amino acids in the vicinity of C848, in the 3D-structure, are mutated. Namely the 20 different amino acids have been tested at position 822 and at position 825 of the TM2-2 protein, in the absence of the C848R mutation.

[0327] Plants (N. benthamiana) were infiltrated with Agrobacterium cultures containing plasmids with T-DNAs for expression of a TM-2-2 protein variant alone, or co-expression of a TM-2-2 protein variant and MP_Rugose.

[0328] The variants giving rise to an intense hypersensitive response are reported in table 12, with the details of the alleles at positions 767, 822, 825 and 848. All other variants at positions 822 and 825, in combination with C848 (wt) and Y767 (wt), do not give rise to HR to MP Rugose.

TABLE-US-00014 TABLE 12 further variants at position 822 and 825 and results of the HR to MP Rugose test Name of Position Position Position Position HR to MP Nb of AA changes wrt Plasmid the allele 767 822 825 848 Rugose TM2-2 (SEQ ID No. 8) name TM2-825H Y (wt) N (wt) H C (wt) ++ 1 564_25 TM2-825K Y (wt) N (wt) K C (wt) ++ 1 565_10 TM2-825T Y (wt) N (wt) T C (wt) ++ 1 565_5 TM2_822C Y (wt) C S (wt) C (wt) ++ 1 607_5 TM2_822F Y (wt) F S (wt) C (wt) ++ 1 607_11 TM2_822M Y (wt) M S (wt) C (wt) ++ 1 608_18 TM2_822Y Y (wt) Y S (wt) C (wt) ++ 1 607_12 TM2_822W Y (wt) W S (wt) C (wt) ++ 1 606_1

[0329] In conclusion, in addition to the C848R mutation of the TM2-2 protein, the N822C, N822F, N822M, N822Y, N822W, S825H, S825K and S825T mutations of the TM2-2 protein are also sufficient for conferring resistance to ToBRFV, as can be deduced from the HR response to MP_Rugose.

Example 6: Providing Non-Transgenic Plants Carrying the New Variants of Tm2 Recognizing the ToBRFV MP by TILLING (Targeted Induced Local Lesions in Genomes) Strategy

[0330] In Mutagenized Population:

[0331] A large variant tomato population is created using a physical or chemical mutagen agent, well known to the skilled person, that induced all kind of random mutations in genomic sequence by nucleotide substitution. The parental line used for the population is a line which preferably carries the Tm2.sup.2 gene at homozygous level. This line is resistant to ToMV, TMV and susceptible to ToBRFV.

[0332] A massive screening of the population is done at M1 or M2 step (protocol detailed in example 1.5) to identify variations in the Tm2 gene (Solyc09 g018220) using well known screening methods, which are preferably molecular assay based or sequenced based.

[0333] Plants carrying variations in Tm2 gene are selfed for seed production. The following generation (M2 or M3) are genotyped for the targeted variation and heterozygous or homozygous plants (fixation of the variation) are used for phenotyping and for introgression in Elite line by MABC (marker-assisted backcrossing) or other classical breeding method. Several backcrosses are performed to remove other variations in the genetic background.

[0334] Plants carrying the variation are phenotyped for ToBRFV and other tobamovirus resistance using the protocol detailed in example 1.4.

Example 7: Provision of Transgenic Plants Carrying the New Variants of Tm2 Recognizing the ToBRFV MP

[0335] Anabelle tomato line is used for Agrobacterium transformation with Tm2-2 variants as identified in the previous sections of the results.

[0336] Seeds are surface-sterilized for 20 min in 2% sodium hypochlorite containing 2 drops of Tween20 under agitation then washed 3 times with sterile distilled water.

[0337] Seeds are then cultivated in plastic jars with MS medium (M0222, Duchefa) pH 5.9 containing 20 g/l sucrose and 0.8% microagar and placed at 25 C. under light (3000-4000 lux, 16 h photoperiod). Explants are excised from cotyledons of 10 days seedlings. Using a sterile forceps and razorblade, both ends of each cotyledon are removed and cotyledons are then cut into 2 pieces. Explants are placed onto 10 cm diameter Petri dishes containing CC medium (MS medium pH5.9 containing 20 g/l sucrose and 0.8% microagar supplemented with 2 mg/l NAA, 1 mg/l BAP, 160 mg/l glucuronic acid and 40 mg/l acetosyringone) and placed at 25 C. under light (3000-4000 lux, 16 h photoperiod) for one day.

[0338] Agrobacterium tumefaciens strains A1224, A1225 and A1250 were obtained by electroporation of the binary plasmids pJL470, pJL471 and pJL469, respectively (see FIGS. 3A, 3B and 3C), into Agrobacterium tumefaciens strain GV3101.

[0339] A single colony of Agrobacterium tumefaciens containing T-DNA plasmid was cultivated in 15 ml LB broth containing rifampicin 10 g/ml and kanamycin 50 g/ml in a shaker (200 rpm) at 28 C. for 20 h. Bacteria are pelleted by centrifugation of the overnight suspension for 20 mn at 1000 g and resuspended in sterile CC liquid medium (MS medium pH5.9 containing 20 g/l sucrose supplemented with 2 mg/l NAA, 1 mg/l BAP, 160 mg/l glucuronic acid and 40 mg/l acetosyringone) to an OD600 nm of 0.1

[0340] In a sterile beaker, cotyledonary explants are soaked in the Agrobacterium suspension for 15 min under slow agitation (100 rpm). With sterile forceps, explants are blotted on a sterile filter paper then transferred to solid CC medium (MS medium pH5.9 containing 20 g/l sucrose and 0.8% microagar supplemented with 2 mg/l NAA, 1 mg/l BAP, 160 mg/l glucuronic acid and 40 mg/l acetosyringone). Plates are placed at 25 C. under light (3000-4000 lux, 16 h photoperiod) for 48 hr

[0341] Explants are rinsed two times with 100 ml of liquid MS medium pH 5.9 containing 20 g/l sucrose and supplemented of 100 mg/l amoxicillin 20 mg/l clavulanic acid then blotted onto a sterile paper then transferred to solid selection medium (MS medium containing 20 g/l sucrose and 0.8% microagar supplemented with 1 mg/l zeatin, 100 mg/l amoxicillin 20 mg/l clavulanic acid and 100 mg/l kanamycin) (10 explants/Petri dish). Petri dishes are placed at 25 C. under light (3000-4000 lux, 16 h photoperiod). and medium is refreshed every 2 weeks until shoot regeneration.

[0342] Shoots and plantlets are isolated and placed in plastic jars containing rooting medium (MS medium pH5.9 containing 20 g/l sucrose and 0.8% microagar supplemented with 0.5 mg/l IAA, 100 mg/l amoxicillin 20 mg/l clavulanic acid and 100 mg/l kanamycin). Jars are placed at 25 C. under light (3000-4000 lux, 16 h photoperiod).

[0343] Well rooted plantlets are transferred to soil. Agar is carefully removed by rinsing roots with water and plants are put in trays with soil and transferred to greenhouse.

[0344] Two weeks after acclimatization, plants are sampled and a piece of young leaf is analyzed by flow cytometry to select diploid plants. Genomic DNA is extracted from a young leaf disk and a PCR amplification of nptII gene is performed, using the primers:

TABLE-US-00015 Forwardprimer:npt2F (SEQIDNO:37) CCTGCCGAGAAAGTATCC and Reverseprimer:npt2R (SEQIDNO:38) GCCAACGCTATGTCCTGA
to screen the transformants.

[0345] Transformants could be also characterized by PCR amplification with the following primers:

TABLE-US-00016 Forwardprimer:tm2-2-F2 (SEQIDNO:39) TTCCTCCAAATCTCATCAAGC, and Reverseprimer:thsp-R (SEQIDNO:40) CAACAAGCCAAGAgAAAACACA.

[0346] The plants obtained by this protocol have been tested in order to confirm the resistance to ToBRFV, as well as resistance to TMV, ToMV and ToMMV.

[0347] Molecular quantification of ToBRFV sequence in infected plants has also been carried out by quantitative PCR (qPCR) with TaqMan probes, to also confirm the reduction of virus replication.

[0348] The protocol for the molecular quantification of ToBRFV by qPCR is as follows:

[0349] The young wrapper leaf at head grown are sampled (3 to 4 leaves per plant). The leaves are ground in liquid nitrogen and an aliquot of 100 mg is kept for RNA extraction. For each sample, 100 mg of grounded leaves are used for RNA extraction

[0350] RNA extraction is performed using the Maxwell 16 LEV Plant RNA Kit from Promega and the Maxwell extraction robot (Promega). Extracted RNA are stored at 20 C.

[0351] qPCR for virus quantification is performed using the TaqMan universal Master Mix (ThermoFisher Scientific) with Kit Gotaq Probe OneStep RTqPCR system A6120 Promega, following the manufacturer instructions.

[0352] Primers and probes used are disclosed in the table below:

TABLE-US-00017 primer Sequence SEQIDNO LM_TBRFV-1-F AGATTTCCCTG SEQIDNO:44 GCTTTTGGA LM_TBRFV-1-R CTCTTTCTGAT SEQIDNO:45 ATCAAGCACT LM_TBRFV-1- CAAGGAGAGAC SEQIDNO:46 probe TGCTAAATCGG

[0353] The amplified fragment is 187 bp.

Mix:

[0354] Kit TaqMan universal Master Mix, Applied Biosystem ThermoFisher Scientific.

TABLE-US-00018 Product Initial concentration Final concentration L/well Water (nuclease free) Qsp 20 L 7.1 Primer Reverse LM_TBRFV-1-R 10 M 0.5 M (200 nM-1 M) 1 Primer Forward LM_TBRFV-1-F 10 M 0.5 M (200 nM-1 M) 1 Probe LM_TBRFV-1-probe 5 M 0.25 M (100-300 nM) 0.5 Gotaq Probe qPCR master mix 2X 1X 10 GoScript RT Mix for 1 step RT-qPCR 50X 1X 0.4

[0355] The total volume of the mix is 20 L; 2 L of RNA are added; such that the final volume is 22 L.

Thermocycler:

[0356] Reverse transcription: 15 minutes at 45 C.; [0357] Inactivation of Reverse transcription and Activation: 2 minutes at 95 C.; [0358] cycles comprising: [0359] Denaturation: 15 seconds at 95 C., [0360] Annealing primers: 15 seconds at 54 C.; and [0361] Annealing probes: 30 seconds at 48 C.

[0362] For each sample, 3 replicates are performed. Standard dilution curves are used for the relative quantification.

[0363] A melting curve is performed at the end of the protocol in the StepOne to ensure the specificity of the detection/quantification

[0364] The Ct of each sample is reported on the standard curve to calculate the relative quantity of virus in each sample.

Results:

[0365] Anabelle tomato line, which is susceptible to ToMV, TMV, ToBRFV and ToMMV is used for Agrobacterium transformation with Tm2-2 variants as identified in the previous sections of the results. Infection by ToBRFV was carried out as disclosed on point 1.4, on transformants (presence of the T-DNA is checked as disclosed above) and on different controls (untransformed Anabelle). The phenotype of the plants is then scored at 14 DPI and 21 DPI. Presence of viral DNA is quantified by qPCR at 28 DPI, giving rise to a Ct value. The Ct or threshold cycle value is the cycle number at which the fluorescence generated within a reaction crosses the fluorescence threshold, corresponding to a fluorescent signal significantly above the background fluorescence. At the threshold cycle (Ct), a detectable amount of the amplified product has been generated during the early exponential phase of the reaction. The threshold cycle is inversely proportional to the original relative expression level of the gene of interest, i.e. the higher the Ct value, the higher the resistance level (it means the virus multiplication in plant is lower). The value of the susceptible plants transformed by a T-DNA providing an unmutated sequence of Tm2-2 can be used as control. A difference of Ct of 3.32 means a difference of 10 fold regarding virus quantity in the sample.

[0366] The test is reproduced twice (test 1 and test 2).

[0367] The results are detailed in the following table 13.

[0368] In this table, REP means the repetition number, Plt nb means the number of the plant. When present is indicated in the column T-DNA genotype, this means that the presence of the T-DNA has been checked by PCR, as disclosed above.

[0369] The results reported in this table clearly show that the resistance observed in the surrogate assay with transient expression in N. benthamiana is indeed representative of the resistance in tomato plants comprising the resistance gene.

[0370] These results moreover demonstrate that the mutant TM-2-2 gene, with at least the C848R mutation provides resistance against ToBRFV infection, and that the presence of the F655L mutation may improve the resistance.

[0371] The results regarding the resistance evaluated by visual symptoms (AUDPC Area under the disease progress curve at 0, 14 and 21 DPI) and the resistance evaluated by qPCR Ct (corresponding to viral presence) can be summarized in the following table depending on the genotype. The visual symptoms are evaluated with respect to a susceptible control, wherein + means less symptoms than the control, and means no improvement. The Ct evaluated by qPCR is also evaluated with respect to a susceptible control, wherein + means less viral sequences detected and means no improvement.

TABLE-US-00019 genotype description Visual symptoms qPCR Ct TM-2-2 Negative control Control control (transformed) TM-2-2 with mutation Single mutation + + C848R TM-2-2 with mutations Double mutation + ++ C848R and F665L Anabelle Susceptible control (untransformed) Resistance source Resistant control + Not tested (untransformed

[0372] The inventors have then checked the resistance to other tobamoviruses, especially ToMV race 0, TMV and ToMMV of the plants transformed with T-DNA comprising the Tm2-2 variant with the double mutation (C848R and F655L). The results are reported in table 14 and clearly show that the plants comprising the T-DNA (i.e. marked as present in the last column) are resistant to all these tobamoviruses, in addition to ToBRFV as shown in table 13 (same mutant code).

[0373] These results entirely confirm the results presented in the preceding examples, namely that mutants of the TM-2-2 gene may provide resistance against ToBRFV infection to tomato plants, whilst simultaneously providing resistance against ToMV, TMV and ToMMV.

TABLE-US-00020 TABLE 13 results of ToBRFV infection of initially susceptible plants, transformed with different T-DNA, or untransformed. Test Plt T-DNA SCORING SCORING ct 28 nb DESCRIPTION Mutant plant code REP Nb GENOTYPE 14 DPI 21 DPI DPI 1 Susceptible variety transformed with Tm2-14-25 52T-SL-ANA-A1224-1099-3745 1 9 PRESENT 9 7 24.19 1 Susceptible variety transformed with Tm2-14-25 52T-SL-ANA-A1224-1099-3745 3 7 PRESENT 7 7 21.94 1 Susceptible variety transformed with Tm2-467 7T-SL-ANA-A1225-990-3331 1 7 PRESENT 9 7 14.54 1 Susceptible variety transformed with Tm2-467 7T-SL-ANA-A1225-990-3331 2 5 PRESENT 9 7 14.09 1 Susceptible variety transformed with Tm2-467 7T-SL-ANA-A1225-983-3421 3 9 PRESENT 7 7 7.58 1 Susceptible variety without Tm2.sup.2 na 1 1 5 1 1 Susceptible variety without Tm2.sup.2 na 1 2 5 1 1 Susceptible variety without Tm2.sup.2 na 1 3 5 1 1 Susceptible variety without Tm2.sup.2 na 1 4 3 1 1 Susceptible variety without Tm2.sup.2 na 1 5 3 1 1 Susceptible variety without Tm2.sup.2 na 1 6 5 1 1 Susceptible variety without Tm2.sup.2 na 1 7 5 3 1 Susceptible variety without Tm2.sup.2 na 1 8 5 1 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 1 1 PRESENT 5 1 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 1 4 PRESENT 5 3 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 1 6 PRESENT 5 1 10.73 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 1 8 PRESENT 7 3 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 1 9 PRESENT 5 3 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 2 1 PRESENT 5 5 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 2 2 PRESENT 7 1 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 2 4 PRESENT 9 3 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 2 6 PRESENT 5 3 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 2 7 PRESENT 7 1 10.83 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 2 9 PRESENT 5 1 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 3 3 PRESENT 5 3 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 3 5 PRESENT 5 5 11.05 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 3 6 PRESENT 7 3 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 3 7 PRESENT 5 5 7.06 1 Susceptible variety with Tm2.sup.2 (without mutation) 54T-SL-ANA-A1250-1074-3521 3 8 PRESENT 5 3 2 Susceptible variety without Tm2.sup.2 1 P2 3 3 2 Susceptible variety without Tm2.sup.2 1 P3 3 3 2 Susceptible variety without Tm2.sup.2 1 P5 3 3 2 Susceptible variety without Tm2.sup.2 1 P6 3 3 2 Susceptible variety without Tm2.sup.2 1 P7 3 3 2 Susceptible variety without Tm2.sup.2 1 P8 3 3 2 Susceptible variety transformed with Tm2-14-25 52T-SL-ANA-A1224-1099-3745 2 P14 PRESENT 9 7 21.16 2 Susceptible variety transformed with Tm2-14-25 52T-SL-ANA-A1224-1099-3745 2 P15 PRESENT 7 7 26.83 2 Susceptible variety transformed with Tm2-14-25 52T-SL-ANA-A1224-1099-3582 2 P3 PRESENT 9 7 25.74 2 Susceptible variety transformed with Tm2-14-25 52T-SL-ANA-A1224-1099-3582 2 P9 PRESENT 9 7 27.57 2 Susceptible variety transformed with Tm2-14-25 1 P2 PRESENT 5 7 22.35

TABLE-US-00021 TABLE 14 resistance of the transformants, transformed with Tm2-14-25 (double mutants) to ToMV, TMV and ToMMV. R stands for resistant and S for susceptible. Mutant plant code Plant Nb Strain Score T-DNA 52T-SL-ANA-A1224-1099-3745 2 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 3 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 4 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 5 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 7 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 9 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 10 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 12 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 14 ToMV race0 R Present 52T-SL-ANA-A1224-1099-3745 15 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 17 ToMV race0 R Present 52T-SL-ANA-A1224-1099-3745 19 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 20 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 25 ToMV race0 R Present 52T-SL-ANA-A1224-1099-3745 28 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 29 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 30 ToMV race0 R Present 52T-SL-ANA-A1224-1099-3745 31 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 32 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 33 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 34 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 36 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 39 ToMV race0 R Present 52T-SL-ANA-A1224-1099-3745 41 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 42 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 44 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 47 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 49 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 51 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 53 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 54 ToMV race0 S 52T-SL-ANA-A1224-1099-3745 3 TMV S 52T-SL-ANA-A1224-1099-3745 5 TMV S 52T-SL-ANA-A1224-1099-3745 6 TMV S 52T-SL-ANA-A1224-1099-3745 8 TMV S 52T-SL-ANA-A1224-1099-3745 9 TMV S 52T-SL-ANA-A1224-1099-3745 14 TMV R Present 52T-SL-ANA-A1224-1099-3745 15 TMV S 52T-SL-ANA-A1224-1099-3745 16 TMV R Present 52T-SL-ANA-A1224-1099-3745 18 TMV S 52T-SL-ANA-A1224-1099-3745 19 TMV S 52T-SL-ANA-A1224-1099-3745 20 TMV S 52T-SL-ANA-A1224-1099-3745 21 TMV S 52T-SL-ANA-A1224-1099-3745 22 TMV S 52T-SL-ANA-A1224-1099-3745 23 TMV S 52T-SL-ANA-A1224-1099-3745 24 TMV R Present 52T-SL-ANA-A1224-1099-3745 25 TMV S 52T-SL-ANA-A1224-1099-3745 28 TMV S 52T-SL-ANA-A1224-1099-3745 32 TMV S 52T-SL-ANA-A1224-1099-3745 34 TMV R Present 52T-SL-ANA-A1224-1099-3745 36 TMV S 52T-SL-ANA-A1224-1099-3745 38 TMV S 52T-SL-ANA-A1224-1099-3745 39 TMV S 52T-SL-ANA-A1224-1099-3745 40 TMV R Present 52T-SL-ANA-A1224-1099-3745 42 TMV R Present 52T-SL-ANA-A1224-1099-3745 46 TMV R Present 52T-SL-ANA-A1224-1099-3745 47 TMV S 52T-SL-ANA-A1224-1099-3745 51 TMV S 52T-SL-ANA-A1224-1099-3745 52 TMV R Present 52T-SL-ANA-A1224-1099-3745 53 TMV S 52T-SL-ANA-A1224-1099-3745 54 TMV R Present 52T-SL-ANA-A1224-1099-3745 2 ToMMV R Present 52T-SL-ANA-A1224-1099-3745 3 ToMMV R Present 52T-SL-ANA-A1224-1099-3745 4 ToMMV S 52T-SL-ANA-A1224-1099-3745 5 ToMMV S 52T-SL-ANA-A1224-1099-3745 6 ToMMV S 52T-SL-ANA-A1224-1099-3745 8 ToMMV R Present 52T-SL-ANA-A1224-1099-3745 10 ToMMV R Present 52T-SL-ANA-A1224-1099-3745 11 ToMMV S 52T-SL-ANA-A1224-1099-3745 12 ToMMV S 52T-SL-ANA-A1224-1099-3745 13 ToMMV S 52T-SL-ANA-A1224-1099-3745 14 ToMMV R Present 52T-SL-ANA-A1224-1099-3745 15 ToMMV S 52T-SL-ANA-A1224-1099-3745 17 ToMMV R Present 52T-SL-ANA-A1224-1099-3745 18 ToMMV S 52T-SL-ANA-A1224-1099-3745 19 ToMMV S 52T-SL-ANA-A1224-1099-3745 20 ToMMV S 52T-SL-ANA-A1224-1099-3745 21 ToMMV S 52T-SL-ANA-A1224-1099-3745 23 ToMMV S 52T-SL-ANA-A1224-1099-3745 24 ToMMV S 52T-SL-ANA-A1224-1099-3745 26 ToMMV S 52T-SL-ANA-A1224-1099-3745 29 ToMMV S 52T-SL-ANA-A1224-1099-3745 30 ToMMV S 52T-SL-ANA-A1224-1099-3745 31 ToMMV S 52T-SL-ANA-A1224-1099-3745 32 ToMMV S 52T-SL-ANA-A1224-1099-3745 34 ToMMV S 52T-SL-ANA-A1224-1099-3745 36 ToMMV S 52T-SL-ANA-A1224-1099-3745 37 ToMMV R Present 52T-SL-ANA-A1224-1099-3745 39 ToMMV S 52T-SL-ANA-A1224-1099-3745 40 ToMMV S 52T-SL-ANA-A1224-1099-3745 41 ToMMV S 52T-SL-ANA-A1224-1099-3745 42 ToMMV S 52T-SL-ANA-A1224-1099-3745 44 ToMMV S 52T-SL-ANA-A1224-1099-3745 45 ToMMV S 52T-SL-ANA-A1224-1099-3745 49 ToMMV R Present 52T-SL-ANA-A1224-1099-3745 50 ToMMV S 52T-SL-ANA-A1224-1099-3745 52 ToMMV S 52T-SL-ANA-A1224-1099-3745 53 ToMMV S

BIBLIOGRAPHY

[0374] Baggs, E., Dagdas, G., and Krasileva, K. V. 2017. NLR diversity, helpers and integrated domains: making sense of the NLR IDentity. Curr Opin Plant Biol 38:59-67. [0375] Calder, V. L., and Palukaitis, P. 1992. Nucleotide sequence analysis of the movement genes of resistance breaking strains of tomato mosaic virus. J Gen Virol 73 (Pt 1):165-168. [0376] Ishibashi et al, 2007. An inhibitor of viral RNA replication is encoded by a plant resistance gene. PNAS 104 (34) 13833-13838. [0377] Kapos, P., Devendrakumar, K. T., and Li, X. 2019. Plant NLRs: From discovery to application. Plant Sci 279:3-18. [0378] Kobayashi, M., Yamamoto-Katou, A., Katou, S., Hirai, K., Meshi, T., Ohashi, Y., and Mitsuhara, I. 2011. Identification of an amino acid residue required for differential recognition of a viral movement protein by the Tomato mosaic virus resistance gene Tm-2(2). J Plant Physiol 168:1142-1145. [0379] Lanfermeijer, F. C., Warmink, J., and Hille, J. 2005. The products of the broken Tm-2 and the durable Tm-2(2) resistance genes from tomato differ in four amino acids. J Exp Bot 56:2925-2933. [0380] Lanfermeijer, F. C., Dijkhuis, J., Sturre, M. J., de Haan, P., and Hille, J. 2003. Cloning and characterization of the durable tomato mosaic virus resistance gene Tm-2(2) from Lycopersicon esculentum. Plant Mol Biol 52:1037-1049. [0381] Lanfermeirjer, F., Jiang, G, Ferwerda, M A, Kijkhuis, J, de Haan, P, Yang, R, Hille, J. 2004. The durable resistance gene Tm-22 from tomato confers resistance against ToMV in tobacco and preserves its viral specificity. Plant Science 167:687-692. [0382] Luria N. et al. 2017. A New Israeli Tobamovirus Isolate Infects Tomato Plants Harboring Tm-2.sup.2 Resistance Genes. PLoS One; 12(1): e0170429. [0383] Ma, L., Lukasik, E, Gawehns F, Takken F L W. 2012. The use of agroinfiltration for transient expression of plant resistance and fungal effector proteins in Nicotiana benthamiana leaves. Methods Mol Biol 835:61-74. [0384] Meshi, T., Motoyoshi, F., Maeda, T., Yoshiwoka, S., Watanabe, H., and Okada, Y. 1989. Mutations in the tobacco mosaic virus 30-kD protein gene overcome Tm-2 resistance in tomato. Plant Cell 1:515-522. [0385] Mondragon-Palomino, M., Meyers, B. C., Michelmore, R. W., and Gaut, B. S. 2002. Patterns of positive selection in the complete NBS-LRR gene family of Arabidopsis thaliana. Genome Res 12:1305-1315. [0386] Nagai, A., Duarte M. L. L., Chaves A. LR., Peres L. EP., dos Santos D. Y. A. C. 2019. Tomato mottle mosaic virus in Brazil and its relationaship with Tm-2.sup.2 gene. Eur J Plant Pathol 155, 353-359. [0387] Salem N. et al, 2015. A new tobamovirus infecting tomato crops in Jordan. Arch. Virol. 161 (2), 503-506. [0388] Segretin, M. E., Pais, M., Franceschetti, M., Chaparro-Garcia, A., Bos, J. I. B., Banfield, M. J., and Kamoun, S. 2014. Single Amino Acid Mutations in the Potato Immune Receptor R3a Expand Response to Phytophthora Effectors. Molecular Plant-Microbe Interactions@ 27:624-637. [0389] Slootweg, E., Koropacka, K., Roosien, J., Dees, R., Overmars, H., Lankhorst, R. K., van Schaik, C., Pomp, R., Bouwman, L., Helder, J., Schots, A., Bakker, J., Smant, G., and Goverse, A. 2017. Sequence Exchange between Homologous NB-LRR Genes Converts Virus Resistance into Nematode Resistance, and Vice Versa. Plant Physiol 175:498-510. [0390] Sui, X. et al, 2017. Molecular and Biological Characterization of Tomato mottle mosaic virus and Development of RT-PCR Detection. Plant Disease 101, 704-711. [0391] Tomita, R., Sekine, K. T., Tateda, C., and Kobayashi, K. 2019. Identification and Functional Analysis of NB-LRR-Type Virus Resistance Genes: Overview and Functional Analysis of Candidate Genes. Methods Mol Biol 2028:1-10. [0392] Wang, J., Chen, T., Han, M., Qian, L., Li, J., Wu, M., Han, T., Cao, J., Nagalakshmi, U., Rathjen, J. P., Hong, Y., and Liu, Y. 2020. Plant NLR immune receptor Tm-22 activation requires NB-ARC domain-mediated self-association of CC domain. PLoS Pathog 16:e1008475. [0393] Weber, H., and Pfitzner, A. J. 1998. Tm-2(2) resistance in tomato requires recognition of the carboxy terminus of the movement protein of tomato mosaic virus. Mol Plant Microbe Interact 11:498-503. [0394] Weber, H., Schultze, S., and Pfitzner, A. J. 1993. Two amino acid substitutions in the tomato mosaic virus 30-kilodalton movement protein confer the ability to overcome the Tm-2(2) resistance gene in the tomato. J Virol 67:6432-6438. [0395] Weber, H., Ohnesorge, S., Silber, M. V., and Pfitzner, A. J. 2004. The Tomato mosaic virus 30 kDa movement protein interacts differentially with the resistance genes Tm-2 and Tm-2(2). Arch Virol 149:1499-1514.