COMPLEX FOR TREATING OPTIC NERVE DISEASE, AND PREPARATION METHOD THEREFOR AND USE THEREOF

Abstract

Disclosed is a complex tFNA-miR22 for treating optic nerve disease, which complex is composed of tetrahedral DNA and miR-22 according to a molar ratio of 1:(1-4). The tFNA-miR22 can effectively inhibit apoptosis of retinal ganglion cells and promote the release of a brain-derived neurotrophic factor (BDNF), thereby achieving a good protection effect for the retinal ganglion cells. The tFNA-miR22 is used for preparing optic nerve protection drugs, the treatment of neurodegenerative optic nerve diseases including glaucoma is facilitated, and the tFNA-miR22 has very good application prospects.

Claims

1: A complex for treating an optic nerve disease, comprising a tetrahedral DNA and a miR-22 in a molar ratio of 1:(1-4).

2: The complex of claim 1, wherein: (a) the tetrahedral DNA is formed from 4 single-stranded DNAs through complementary base pairing; (b) the 4 single-stranded DNAs have the sequences as shown in SEQ ID NO. 1?4, respectively; (c) the tetrahedral DNA is linked to the miR-22 at one or more single-strand end thereof, or (d) the miR-22 has the sequence as shown in SEQ ID NO. 5.

3: The complex of claim 1, wherein the miR-22 is linked by a chemical bond to 1?4 of the 4 single-stranded DNAs forming the tetrahedral DNA structure.

4: The complex of claim 3, comprising a linker sequence between the miR-22 and the linked single-stranded DNA.

5: The complex of claim 4, wherein the the linker sequence is -TTTTT-.

6: A preparation method of the complex of claim 1, wherein the the preparation method comprises putting the four single-stranded DNAs forming the DNA tetrahedron at a temperature sufficient to denature them for more than 10 min, and then reducing the temperature to 2-8? C. for more than 20 min, wherein one or more of the 4 single-stranded DNAs are linked to the miR-22.

7: The preparation method of claim 6, wherein the method comprises putting the four single-stranded DNAs forming the DNA tetrahedron at 95? C. for 10 min, and reducing the temperature to 4? C. for 20 min.

8: A method for treating or preventing an optic nerve disease comprising administering to an individual in need thereof a complex of claim 1.

9: The method of claim 8, wherein the complex is formulated as a drug for the treatment of an optic nerve disease.

10: The method of claim 8, wherein the optic nerve disease is associated with a retinal ganglion cell injury.

11: The method of claim 8, wherein the optic nerve disease is associated with the regulation of a brain-derived neurogenic factor-related signaling pathway.

12: The method of claim 8, wherein the optic nerve disease is glaucoma.

13: A pharmaceutical composition for the treatment of an optic nerve disease, wherein the composition comprises a complex of claim 1 and pharmaceutically acceptable excipients.

14: A method of treating an optic nerve disease, comprising administrating a pharmaceutical composition of claim 13 to a patient in need thereof.

15: The complex of claim 2, wherein: (a) the tetrahedral DNA is formed from 4 single-stranded DNAs through complementary base pairing; (b) the 4 single-stranded DNAs have the sequences as shown in SEQ ID NO. 1?4, respectively; (c) the tetrahedral DNA is linked to the miR-22 at one or more single-strand end thereof, and (d) the miR-22 has the sequence as shown in SEQ ID NO. 5.

16: The method of claim 9, wherein the optic nerve disease is associated with a retinal ganglion cell apoptosis.

Description

DESCRIPTION OF THE DRAWINGS

[0024] FIG. 1 shows the schematic diagram of the synthesis of tetrahedral DNA and miR-22;

[0025] FIG. 2 shows the detection results of capillary electrophoresis;

[0026] FIG. 3 shows the detection results of PAGE electrophoresis of tFNA-miR22, tetrahedral DNA and its single-strands (1: S1, 2: S2, 3: S3, 4: S3-miR22, 5: S4, 6: tFNA, 7: tFNA-miR22);

[0027] FIG. 4 shows the images of tetrahedral DNA by transmission electron microscopy (a) and atomic force microscope (b), and detection results of Zeta potential and particle size of tetrahedral DNA (c-d);

[0028] FIG. 5 shows the images of tFNA-miR22 by transmission electron microscopy (a) and atomic force microscope (b), and detection results of Zeta potential and particle size of tFNA-miR22 (c-d);

[0029] FIG. 6 shows the establishment of in vivo and in vitro modeling of optic nerve injury by NMDA and the detection results of cell activity of the NMDA-treated retinal ganglion cells with different concentrations of tFNA-miR22: A-B: CCK-8 activity detection and drug inhibition rates of the cells which were stimulated by different concentrations of NMDA for 1 h and cultured in complete medium for 3, 6, 12, and 24 h; C: biosafety detection of tFNA-miR22; D: CCK-8 activity detection of cells which were treated with 4 nM NMDA and then treated with different concentrations of tFNA-miR22, tetrahedral DNA and single-stranded miR-22 for 24 h; E: cell morphology in each group after the above treatment under ordinary light microscope. Data from A?D refer to mean?standard deviation (with sample size of each group?3);

[0030] FIG. 7 shows a schematic diagram of the establishment of an in vivo model;

[0031] FIG. 8 shows the results of hematoxylin-eosin staining;

[0032] FIG. 9 shows the images of immunofluorescence staining of retinal flat-mounts and data analysis, and the data refer to mean?standard deviation (with sample size of each group?3);

[0033] FIG. 10 shows the results of the cell penetration rate of tFNA-miR22 and single-stranded miR-22 (Cy5 fluorescent-labeled) within 3, 6, 12 and 24 h detected by flow cytometry;

[0034] FIG. 11 shows the uptake results of tFNA-miR22 and single-stranded miR-22 (Cy5 fluorescent-labeled) for 6 h detected by immunofluorescence;

[0035] FIG. 12 shows the effect of 62.5 nM tFNA-miR22, tetrahedral DNA and single-stranded mi-R22 on cell cycle detected by flow cytometry and data analysis, the statistical data refer to mean?standard deviation (with sample size of each group?3);

[0036] FIG. 13 shows the apoptosis of cells in each group detected by flow cytometry and statistical data analysis, the statistical data refer to mean?standard deviation (with sample size of each group?3).

[0037] FIG. 14 shows (A) the expression of apoptosis-related proteins detected by Western blot; (B) statistical analysis of anti-apoptotic protein Bcl-2; (C) statistical analysis of apoptotic protein Bax; (D) statistical analysis of apoptotic protein Caspase-3;

[0038] FIG. 15 shows the immunofluorescence staining of anti-apoptotic protein Bcl-2 and statistical analysis;

[0039] FIG. 16 shows the immunofluorescence staining of apoptosis protein Bax and statistical analysis;

[0040] FIG. 17 shows the immunofluorescence staining of apoptotic protein Caspase-3 and statistical analysis;

[0041] FIG. 18 shows the relevant detection of TrKb-Creb-BDNF signaling pathway: A: expression level of TrkB/BDNF protein analyzed by Western blot (GAPDH as internal reference); B: relative expression level of TrkB protein; C: relative expression level of BDNF protein; D: expression level of Ntrk2 gene; E: expression level of BDNF gene;

[0042] FIG. 19 shows (A) expression of ERK1/2-CREB protein analyzed by Western blot. (B) relative expression levels of ERK1/2 and phosphorylated ERK1/2 protein; (C) relative expression levels of CREB and phosphorylated CREB proteins;

[0043] FIG. 20 shows the expression of TrkB selectively activated by tFNA-miR22 detected by immunofluorescence and statistical analysis;

[0044] FIG. 21 shows the expression of BDNF detected by immunofluorescence and statistical analysis;

[0045] FIG. 22 shows the expression of p-ERK1/2 detected by immunofluorescence and statistical analysis;

[0046] FIG. 23 shows the expression of p-CREB detected by immunofluorescence and statistical analysis;

[0047] FIG. 24 shows the expression results of TrkB protein and BDNF protein by immunohistochemical staining.

DETAILED DESCRIPTION OF THE INVENTION

[0048] The raw materials and equipment used in the present invention are known products and commercially available.

Example 1. Synthesis of the Complex of tFNA and miR-22 (tFNA-miR22)

[0049] Four DNA single strands, one of which was connected to miR22 at its end (S1, S2, S3-miR22, S4), were dissolved in TM Buffer (10 mM Tris-HCl, 50 Min MgCl.sub.2, pH=8.0) at a final concentration of 1000 nM for each of the four DNA single strands, fully mixed, rapidly heated to 95? C., maintaining for 10 min, and then rapidly cooled to 4? C., maintaining for more than 20 min, to obtain tFNA-miR22.

[0050] The sequences of the four single strands (5.fwdarw.3) were as follows:

TABLE-US-00001 S1: (SEQIDNO.1) ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACAT TCCTAAGTCTGAA S2: (SEQIDNO.2) ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGAC TTAGGAATGTTCG S3: (SEQIDNO.3) ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAG AGCATGCCCATCC S4: (SEQIDNO.4) ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGG CATGCTCTTCCCG miR-22: (SEQIDNO.5) AAGCUGCCAGUUGAAGAACUGU S3-miR22-3p: (SEQIDNO.6) AAGCUGCCAGUUGAAGAACUGU-TTTTT-ACTACTATGGCGGGTGATAAA ACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC

[0051] Wherein, the 5 end of S1 was optionally linked to a Cy5 fluorescent label group for tracing tFNA-22.

2. Identification

[0052] The DNA single-strands and synthetic tFNA-miR22 were detected by capillary electrophoresis and PAGE electrophoresis. The morphology of tFNA and tFNA-miR22 were detected by transmission electron microscopy. The zeta potential and particle size of tFNA and tFNA-miR22 were detected by dynamic light scattering.

3. Identification Results

[0053] As shown in FIGS. 1-3, the electrophoresis results showed that the molecular weight of tFNA-miR22 band was significantly higher than that of the single-stranded DNAs and the tetrahedral DNA, indicating that the single-stranded DNAs were assembled together.

[0054] As shown in FIGS. 4-5, the tetrahedral structure particles were detected by transmission electron microscopy. It was found by dynamic light scattering that the zeta potential of tFNA was 5.6 and the particle size was 17.96 nm; the zeta potential of tFNA-miR22 was 8.23 mV and the particle size was 17.18 nm, indicating that tFNA-miR22 was successfully synthesized and stable.

[0055] The beneficial effects of the present invention will be further described by way of experimental examples. The tFNA involved in the experimental examples was prepared by the method of Example 1.

Experimental Example 1. Uptake of tFNA-miR22 by Injured Retinal Ganglion Cells

1. Experimental Methods

1.1 Test of the Optimal Modeling Concentration (In Vitro Simulation of Optic Ganglion Cell Injury)

[0056] RGC-5 cells (a type of mouse retinal ganglion cells) were cultured in groups in 96-well plates with 1*10.sup.4 cells per well. Each group was treated with different concentrations of N-methyl-D-aspartate (NMDA) for 1 h, and then cultured with complete medium for 24 h and then the cell activity was detected by CCK-8 assay. It was found that the drug inhibition rate of 4 mM NMDA was about 40%, so 4 mM was selected as the optimal modeling concentration (FIG. 6: A-B).

1.2 Test of the Optimal Anti-Cell Injury Concentration of Drug (Cell Proliferation Experiment)

[0057] RGC-5 cells were cultured in groups in 96-well plates with 1*10.sup.4 cells per well. Each experimental group except the blank group was treated with 4 nM NMDA for 1 h, and then cultured for another 24 h with a culture medium containing 0 nM, 62.5 nM, 125 nM and 250 nM tFNA and tFNA-miR22 prepared in the example 1, as well as the single-stranded miR-22, respectively. Samples were taken and detected for cell activity by CCK-8 assay. It was found that tFNA at 62.5 nM had no obvious proliferative effect, while tFNA-miR22 at this concentration could significantly promote the proliferation of RGC-5 cells, moreover, the proliferation ratio of the cell viability treated with tFNA-miR22 compared to the cell viability of the NMDA control group was even higher than the sum of the proliferation ratios of the cell viability of miR22 or tFNA alone compared to the cell viability of the NMDA control group, indicating that the combination of miR22 and tFNA into tFNA-miR22 played a synergistic role in promoting the proliferation of NMDA-injured ganglion cells. Therefore, 62.5 nM was selected as the optimal drug concentration for this experiment. (FIG. 6: D).

1.3 Test of Material Uptake by Injured Cells

[0058] RGC-5 cells treated with 4 mM NMDA for 1 h were grouped and then exposed to and treated with Cy5-labeled single-stranded miR-22 (62.5 nM) and tFNA-miR22 (62.5 nM) for 3 h, 6 h, 12 h, and 24 h, respectively, and compared with the injured group (i.e., untreated with tFNA and tFNA-miR22). All groups were washed 3 times with phosphate buffer and detected with flow cytometry. It was found that the fluorescence intensity of tFNA-miR22 reached its peak at 6 h (FIG. 11). Therefore, RGC-5 cells treated for 6 h by the above method were selected to prepare cell slides, and the uptake of single-stranded miR-22 and tFNA-miR22 was observed by immunofluorescence staining.

2. Results

[0059] As shown in FIGS. 10-11, the results of cell flow cytometry showed that within 24 h, the fluorescence intensity of tFNA-miR22 reached a peak of 55.3% at 6 h, and gradually decreased to 40.4% with the increase of treatment time, while the fluorescence intensity of single-stranded miR-22 increased slowly with the treatment time, and reached a peak of 33.5% at 24 h. The results of immunofluorescence staining in FIG. 11 showed that tFNA-miR22 was widely accumulated in the cytoplasm and perinuclear of RGC-5 at 6 h, while single-stranded miR-22 mainly adhered to the surface of cell membranes.

[0060] The above results indicate that tFNA-miR22 can be taken up more rapidly and efficiently by injured RGC-5 cells, while miR-22 that is not attached to tFNA is difficult to be taken up by RGC-5 cells.

Experimental Example 2. tFNA-miR22 Inhibits NMDA-Induced Cell Injury

1. Experimental Methods

[0061] RGC-5 cells were treated with 4 mM NMDA for 1 h, and then treated with 62.5 nM single-stranded miR-22, tFNA or tFNA-miR22 for 24 h, and detected as follows: [0062] 1) Cell morphology was observed by phase contrast microscope; [0063] 2) Cell cycle was detected by flow cytometry; [0064] 3) Cell apoptosis rate was detected by flow cytometry; [0065] 4) Expression of Bax, caspase-3 and Bcl-2 was detected by immunofluorescence and Western blot.

2. Results

[0066] 1) FIG. 6C showed that tFNA-miR22 had no significant cytotoxicity, indicating that tFNA-miR22 has good biological safety.

[0067] 2) FIG. 6E shows that compared with tFNA and single-stranded miR-22, tFNA-miR22 can significantly protect the morphology of retinal ganglion cells.

[0068] 3) FIG. 12 shows that compared with tFNA and single-stranded miR-22, tFNA-miR22 can significantly promote cell self-renewal by regulating cell mitosis; and it can be clearly seen that the mitosis of the NMDA-treated cells was affected, and compared with the control group, the percentage of cells in G2-M phase in the NMDA group significantly decreased; and after the treatment with tFNA or miR22 alone, the percentage of cells in G2-M phase even further decreased. However, after the treatment with tFNA-miR22, the percentage of cells in G2-M phase significantly increased, even comparable to the control group without NMDA interference. It can be seen that the combination of tFNA and miR-22 had an opposite effect compared with use of them alone. They can synergize with each other to significantly promote cell mitosis and self-renewal.

[0069] 4) FIG. 13-17 showed that tFNA-miR22 can inhibit NMDA-induced apoptosis compared with tFNA or single-stranded miR-22, i.e., tFNA-miR22 can reduce the NMDA-induced up-regulated expression level of apoptosis protein caspase-3 and Bax, and reduce the NMDA-induced down-regulated expression level of anti-apoptosis protein BCL-2.

[0070] The above results indicate that tFNA-miR22 has good biosafety and protective effect on retinal ganglion cells. tFNA-miR22 can regulate cell mitosis, promote cell self-renewal, and can reduce the expression of pro-apoptotic proteins caspase-3 and Bax by increasing the expression of anti-apoptosis protein BCL-2, thereby reducing the cell injury caused by NMDA, so as to further play a role in cell protection, and has a significantly better effect than tFNA or single-strand miR-22 alone.

Experimental Example 3. Effect of tFNA-miR22 on TrkB/BDNF Signaling Pathway

1. Experimental Methods

[0071] RGC-5 cells were treated according to the method of Experimental example 2, and detected as follows: [0072] 1) BDNF and Trkb proteins were detected by Western blot and immunofluorescence; [0073] 2) Expression levels of BDNF and Ntrk2 were detected by RT-PCR; [0074] 3) ERK1/2, p-ERK1/2, CREB and p-CREB proteins were detected by Western blot and immunofluorescence.

2. Results

[0075] 1) The detection of Western blot in FIG. 18A-C showed that the levels of BDNF and TrkB were significantly increased in tFNA-miR22-treated cells. Real-time quantitative PCR results in FIG. 18D-E showed that the gene expression of Ntrk2 and BDNF were significantly increased in tFNA-miR22-treated cells compared with the rest of the groups.

[0076] 2) The detection of Western blot in FIG. 19 showed that the total proteins of ERK and CREB in tFNA-miR22-treated cells were increased to a certain extent, and could promote the phosphorylation of ERK1/2 and CREB.

[0077] 3) The detection results of immunofluorescence of the above proteins shown in FIGS. 20-23 were consistent with the detection results of Western blot.

[0078] The purpose of this experimental example is to further confirm the mechanism of tFNA-miR22 in producing protective effect on optic nerve.

[0079] Brain-derived growth factor (BDNF) is a powerful neuroprotective agent, especially for retinal ganglion cells. BDNF is one of the key neurotrophic factors in glaucoma. By binding to its receptor TrkB, BDNF may activate the extracellular signal-regulated kinase (ERK), which leads to the phosphorylation of cAMP response element-binding protein (CREB), thereby inducing the transcription of various genes associated with neuronal survival and promoting cell survival.

[0080] The above results indicate that tFNA-miR22 selectively activates TrkB, and by activating the downstream signaling pathway (ERK-CREB), promotes the release of BDNF to reduce cell injury and promote cell survival.

Experimental Example 4: Treatment of NMDA-Induced Optic Nerve Injury Model Mice with tFNA-miR22

1. Experimental Methods

[0081] Establishment of NMDA-Induced Optic Nerve Injury Model

[0082] 1) Selection and grouping of experimental animals: The experimental subjects were 6-week-old healthy male C57BL/6J mice, weighing 18-20 g. After examination, there was no obvious crooked neck, the cornea was transparent, the iris blood vessels were clear, the pupils were large and round, and they were sensitive to light reflection. The experimental animals were randomly divided into five ABCDE groups by random number table method, which were blank control group, NMDA injury group, tFNA alone treatment group (62.5 nM), miR-22 alone treatment group and tFNA-miR22 treatment group (62.5 nM), respectively.

[0083] (2) Group treatment: After the mice were satisfactorily anesthetized, both eyes of the mice in each group were taken as experimental eyes and the eye surface was disinfected with 10% tincture of iodine. Under the surgical microscope, a 32 G needle was punctured at 1 mm from the temporal temporalis margin of the horn sclera, and then 2 ?L drug was injected into the vitreous cavity with a 10 ?L microsyringe. Group A: normal mice without surgery; Group B: injected with 2 ?L of NMDA prepared in saline at a final concentration of 20 ?M; Group C: injected with 1 ?L of NMDA (20 ?M)+1 ?L of tFNAs (62.5 nM); Group D: injected with 1 ?L of NMDA (20 ?M)+1 ?L of miR-22 (62.5 nM); Group E: injected with 1 ?L NMDA (20 ?M)+1 ?L tFNAs-miR22 (62.5 nM). After the operation, erythromycin ophthalmic ointment was applied to the conjunctival sac. The animals were sacrificed 7 days after the operation to remove the eyeball with a section of the optic nerve retained. The following morphological tests were carried out: [0084] A) Retinal histological changes were observed by HE staining; [0085] B) Immunofluorescence staining of whole retinal flat-mounts: RGCs counting; [0086] C) Expression of BDNF and Tkrb was observed by immunohistochemical IHC staining of routine retinal sections.

2. Results

[0087] 1) The results of HE staining in FIG. 8 showed that after tFNAs-miR22 treatment, the retinal thickness increased significantly and the number of ganglion cells increased significantly.

[0088] 2) The immunofluorescence staining results of the flat-mounts are shown in FIG. 9. After tFNAs-miR22 treatment, the number of ganglion cells increased significantly, with statistical significance; the number of ganglion cells in tFNA-miR22 treatment group significantly increased compared with the NMDA control group, while the number of ganglion cells after treated with tFNA or miR22 alone was almost unchanged compared with the NMDA treatment group.

[0089] 3) IHC staining results are shown in FIG. 24. After tFNAs-miR22 treatment, the expressions of BDNF and Tkrb in the retina were significantly increased.

[0090] It can be concluded that the tFNA-miR22 group significantly increased the survival rate of optic ganglia cells compared with the other groups, indicating that the complex tFNA-miR22 of the present invention has an optic nerve protective effect, and can be used in the treatment of neurodegenerative optic nerve diseases including glaucoma; and has a significantly better effect than tFNA and miR-22 alone, indicating that the two have a synergistic effect.

[0091] In summary, the present invention provides a neuroprotective drug that can be used to treat neurodegenerative optic nerve diseases including glaucoma, which comprises tFNA-miR22 composed of a tetrahedral DNA and a miR-22 in a molar ratio of 1:(1-4). tFNA-miR22 can not only be effectively taken up by injured RGC-5 cells, but also effectively inhibit the apoptosis of retinal ganglion cells, and promote the release of brain-derived nerve factor (BDNF), thereby playing a good protective effect on retinal ganglion cells.