Bioengineered in vitro 3D model of human atherosclerotic plaque
11946071 ยท 2024-04-02
Assignee
Inventors
Cpc classification
C12N5/0639
CHEMISTRY; METALLURGY
C12N5/0645
CHEMISTRY; METALLURGY
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
C12Q1/6883
CHEMISTRY; METALLURGY
Abstract
The invention provides a method for the generation of a layered cellular 3 D microtissue aggregate, comprising the steps of contacting myeloid cells with a protein kinase C agonist, yielding primed myeloid cells; incubating the primed myeloid cells in the presence of LDL in a confined volume, particularly in a hanging drop culture; yielding a 3 D culture of myeloid cells; and incubating the 3 D culture together with fibroblasts in a hanging drop in the presence of LDL, yielding the layered cellular aggregate.
Claims
1. An in vitro engineered layered cellular aggregate, comprising; an inner sphere consisting essentially of plurality of myeloid cells, collagen, and cholesterol, and an outer lining consisting essentially of fibroblasts, wherein said outer lining encases said inner sphere, and wherein said cellular aggregate has a diameter of 100 ?m-500 ?m and does not contain a pre-formed, cell-free scaffold.
2. The in vitro engineered cellular aggregate according to claim 1, wherein said plurality of myeloid cells comprises monocytes, macrophages and dendritic cells.
3. The in vitro engineered cellular aggregate according to claim 2, wherein said monocytes, macrophages and dendritic cells are each present at a defined ratio, wherein said defined ratio is 20%-40%, 26%-36%, or 31% of monocytes; 25%-45%, 29%-39%, or 34% of macrophages; and 15%-45%, 20%-40%, or 31% of dendritic cells.
4. The in vitro engineered cellular aggregate according to claim 1, wherein said plurality of myeloid cells is positive for the expression of a proinflammatory marker selected from the group consisting of CXCL10, CCR7, IL23, PTGS1 and ALOX5.
5. The in vitro engineered cellular aggregate according to claim 1, wherein said plurality of myeloid cells is positive for the expression of a remodelling marker selected from the group consisting of CCL17, CCL26, DC-SIGN, IL10 and SRB1.
6. A plurality of the layered cellular aggregates according to claim 1, wherein the plurality of the layered cellular aggregates is integrated in a 96 or 384-well platform.
7. The in vitro engineered layered cellular aggregate, according to claim 1 wherein the collagen is collagen III.
8. A method for the generation of the engineered layered cellular aggregate of claim 1, comprising the steps of; a) providing a population of myeloid cells, wherein said myeloid cells are provided (i) ex-vivo from a patient by isolation from fresh blood using a double gradient centrifugation; or (ii) ex vivo as cell culture or cell line characterized by expression of monocyte/macrophage cell markers; b) in a differentiation-priming step, contacting said myeloid cells with a protein kinase C agonist, yielding primed myeloid cells; c) in a culture step, incubating said primed myeloid cells in the presence of low-density lipoprotein (LDL) in a confined volume in a hanging drop culture; yielding a 3-dimensional culture, a sphere of myeloid cells; and d) in a co-culture step, incubating said 3-dimensional culture of myeloid cells together with fibroblasts in a confined volume, in a hanging drop culture in the presence of LDL, yielding said layered cellular aggregate.
9. The method according to claim 8, wherein said protein kinase C agonist is a phorbol ester, or phorbol 12-myristate 13-acetate (PMA).
10. The method according to claim 8, wherein in said differentiation-priming step, said myeloid cells are contacted with 5-200 ng/ml PMA, with 5-50 ng/ml PMA, or with 10 ng/ml PMA, and for 36-120 hours, for 48-96 hours, or for 72 hours.
11. The method according to claim 8, wherein subsequently to said differentiation-priming step, said primed myeloid cells are contacted with lipopolysaccharide (LPS).
12. The method according to claim 11, wherein subsequently to said differentiation-priming step, primed myeloid cells are contacted with 10-100 ng/ml LPS for 30 min-3 hours, or with 10 ng/ml LPS for 1 hour.
13. The method according to claim 8, wherein said myeloid cells are human myeloid cells.
14. The method according to claim 8, wherein said fibroblasts are human fibroblasts.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25) Table 1 shows myeloid populations in ps-plaques and native carotid plaques.
(26) List 1 shows a primer table. Gene of interest, forward (FW) and reverse (RV) primer sequences are listed.
EXAMPLES
Example 1: Methods
(27) Isolation of myeloid cells from blood.
(28) Myeloid cells were isolated from fresh human blood using a double gradient centrifugation. The blood was provided by the Zurich blood bank (Blutspende Z?richNr.6676) and maintained at room temperature in slow rocking motion until processing. First, 20m1 of blood from each donor were diluted 1:2 with 1?PBS (Sigma) at room temperature and layered onto a Ficoll? solution (1.077 g/ml, Sigma). Samples were then centrifuged at 400 g for 30 min without break. Second, a 46% iso-osmotic Percoll? gradient was performed to separate the lymphocytes from the PBMCs as previously described (Menck, K., J Vis Exp, e51554, doi:10.3791/51554 (2014)). Briefly, the buffy coat was re-suspended in 20 ml of xVivo15? chemically defined medium (Lonza) without red phenol and carefully layered on top of a Percoll? solution prepared with 50% RPMI medium with red phenol (Sigma), 46% Percoll? (GE Healthcare) and 4% 1?PBS (Sigma). The second gradient was centrifuged at 550 g for 30 min without break and the white cell ring at the interphase was collected for further processing.
(29) Myofibroblasts isolation.
(30) Human umbilical vein myofibroblasts (HUVM) were isolated from human umbilical cords. The tissues were processed in accordance to the ethical permit released by the Kantonale Ethikkommission Z?rich (KEK-Stv-21-2006). Briefly, umbilical cords were stored after labor at 4? C. in DMEM medium (Sigma) prepared with 10% FBS (Gibco), 1% GlutaMax? (Gibco) and 1% Penn/Strep (Gibco) for maximum 2 h prior to processing. The umbilical vein was carefully extracted from the umbilical cord and the inner lumen was flashed twice with 1?PBS. The adventitia layer was peeled off with the help of forceps and scalpel. The intima layer was removed by incubating the inner lumen for 30 min in a 1 mg/ml collagenase/dispase (Roche) solution in 1?PBS. The remaining endothelial cells were washed out from the lumen with 1?PBS. The remaining media layer was minced into small pieces of approximately 2 mm length and let adhere for 10 min on the bottom of a petri dish. The tunica media fragments were then covered in DMEM medium and maintained at 37? C., 5% CO.sub.2 and 95% humidity. The medium was replaced every 48 h. After about 20 days myofibroblasts sprouting from the minced pieces reached about 80% confluence and were ready for sub-culturing.
(31) Cell culture.
(32) HUVM were cultured in DMEM medium with 10% FBS and 1% GlutaMax? and the medium was replaced every 48-72 h. For sub-culturing, HUVM were detached using trypsin 0.5% (Sigma) for 4 min and seeded at a cell density of 4,000 cells/cm.sup.2. HUVM were expanded up to passage 5 prior to use for the experiments in this study. Human monocytic leukaemia cell line (thp-1) isolated from the peripheral blood of a 1-year-old human male with acute monocytic leukemia, were purchased from Sigma. Thp-1 cells were cultured in suspension in xVivo15? medium and the medium was replaced every 2-3 days. Thp-1 cells were seeded at a density of about 100,000 cells/ml and sub-cultured at a density of 800,000 cells/ml.
(33) Ps-plaque biofabrication.
(34) The pseudo-plaque production pipeline encompasses three steps: differentiation, priming and hanging-drop. First, fresh blood-derived myeloid cells or thp-1 cells were seeded onto petri dishes for 72 h and differentiated in chemically defined xVivo15? medium with 10% FBS in order to achieve a macrophage/dendritic cell phenotype. To induce thp-1 differentiation 10 ng/m1 of phorbol 12-myristate 13-acetate (PMA, Sigma) were added to the culture medium. Second, a priming step was performed to obtain heterogeneous macrophage/dendritic cell populations with both pro-inflammatory and remodelling phenotypes. For this purpose the differentiated cells were rinsed in 1?PBS and treated for 1 h in xVivo15? medium with 10% FCS and lOng/m1 lipopolysaccharide (LPS, Sigma). Finally, the primed cells were transferred in hanging-drop culture. Briefly, adhesive myeloid-derived cells were mechanically detached by 20 min incubation in 0.05 mM EDTA (Life Technologies) in ?PBS at 4? C. and gentle scraping. Cells were re-suspended at a cell density of 2.4?10.sup.6 cells/ml in presence of LDL 50 ?g/ml (LEE Biosolutions) in xVivo15? medium with 10% FBS. Droplets of 10 ?l were pipetted on the lead of a 10 cm diameter petri dish and kept in hanging-drop culture for 48 h. To the core of myeloid-derived cells assembled during the 48h incubation, an external layer of HUVM was added. HUVM were prepared at a cell density of 4?10.sup.5 cells/ml in DMEM medium with or without 50 ?g/ml LDL and 10 ?l of the cell suspension were carefully added to each pre-existing drop and cultured in hanging-drop for further 48h.
(35) Flow cytometry.
(36) Biopsies of carotid branches were obtained from patients undergoing carotid endarterectomy and shunting, secondary to vascular stenosis (Ethik Kommission der Universit?t Witten/HerdeckeNr.79/2012). Carotid plaques and biofabricated ps-plaques were digested with 1 mg/ml collagenase/dispase solution in 1?PBS for 15 min at 37? C. Cells were gently pipetted through a cell strainer with the mesh size of 40 ?m (Falcon) and incubated for 5 min at 4? C. with magnetic beads coated with anti CD45 antibodies, according to the provider instructions (MACS Miltenyi Biotec). CD45+ cells were magnetically sorted and stained with Zombie Aqua? fixable viability kit (BioLegend) for 5 min and fixed over night at 4? C. in a 1% Paraformaldehyde (PFA, Sigma) solution in 1?PBS. The single cell suspension was stained for 15 min at room temperature in FACS buffer prepared with 5% FCS and 0.01% NaN.sub.3 (Sigma) in 1?PBS with an optimized FACS antibody panel including: CD14-PerCP (#325631, Biolegend), CD16-Alexa700 (#360717, Biolegend), CD11b-Alexa594 (#101254, Bioloegend), CD11c-PE-Cy5 (#301609, Biolegend), CD36-BV605 (#563518, Becton Dickinson) and SRA-1-PE (#REA460, MACS Miltenyi Biotec). Each antibody was previously titrated to establish the optimal working concentration. Samples were acquired using LSRFortessa? analyser (Becton Dickinson) and signal compensation was performed using OneComp eBeads? (eBioscience).
(37) VI-SNE Workflow.
(38) The FCS files obtained from the FACS analysis were pre-processed using the software Flowjo (FlowJo, LLC). First, cell populations of interest were gated according to forward and side scatter (FSC and SSC) parameters. Second, singlets were gated and Zombie Aqua? dye negative events, representing the alive population of interest, were exported for further processing. Data post-processing was performed using the R platform and the Cytofkit package. Briefly, pre-processed FCS files from each sample were loaded onto Cytofkit, randomly down-sampled to 2,000 events (ceil; n=2,000) and computed using t-Distributed Stochastic Neighbor Embedding (t-SNE) algorithm (Van Der Maaten, L, J Mach Learn Res 9, 26 (2008)). Each event recorded was positioned in a specific location of the high-dimensional space. The output was a vi-SNE biaxial plot where distances between events are representatives of cell proximity in high-dimensional rather than two-dimensional space. The proximity between events is based on similarities in surface marker expression levels. Different myeloid subsets were positioned in separate regions in high-dimensional space according to surface marker similarities. Automatic gating of myeloid subsets was performed through a preliminary clustering step with PhenoGraph algorithm (k=42) and a following metaclustering step with FlowSOM algorithm (k=10).
(39) Immunofluorescence and Immunohistochemistry.
(40) Myofibroblasts were fixed for 20 min in 4% PFA in 1?PBS and maintained in 1?PBS at 4? C. until further processing and not more than 7 days. Cells were stained with the primary antibodies anti-alpha smooth muscle actin (aSMA, # ab7817, Abcam) and anti-smooth muscle myosin heavy chain (SMMHC, # ab53219, Abcam) overnight at 4? C. and with secondary antibodies (anti-mouse #715-605-151, Jackson Immuno Research; anti-rabbit # A11008, Life Technologies) and phalloidin (# A12381, Life technologies) for 1 h at 37? C. Nuclei were counterstained with DAPI and the slides were mounted in Vectaschield? (Vector Laboratories). The ps-plaques were carefully washed in 1?PBS and fixed in PFA as described above. Plaques were dehydrated overnight in a solution of 25% sucrose (Sigma) in 1?PBS, embedded in OCT matrix (CellPath) and stored at ?20? C. Slices of 5 ?m were cut, rehydrated in 1?PBS for 15 min and stained with primary antibodies: anti-Collagen type Ill (# ab7778, Abcam), anti-aSMA and anti-CD45-PeCy5 (#304009, BioLegend) overnight at 4? C. Secondary antibody staining was performed (anti-mouse, 715-545-151, Jackson Immuno Research; anti-rabbit # A11008, Life Technologies) for 1 h at 37? C. For the Filippin sections were quenched for 10 min with 1.5 mg/ml glycine (Sigma) in 1?PBS prior to addition of 250 ?g/ml Filippin III dye (Sigma) at room temperature for 2 h. Sections were washed 3 times in 1?PBS and nuclei were counterstained with propidium iodide 1 mg/ml (BioLegend) for 5 min. Slides were mounted in Vectaschield?. Images were acquired in grey scale with the confocal microscope (Leica SP8). Image post-processing, specifically the choice of appropriate pseudo-colours, was performed using ImageJ.
(41) RT-qPCR.
(42) Total RNA was extracted using the GenElute Mammalian Total RNA Kit (Sigma), following the manufacturer's instructions. Reverse transcription was performed for each sample in a 20 ?l reaction mixture containing 1 ?g of RNA, 1?PCR buffer, 5 mM MgCl.sub.2, 10 mM of each dNTP, 0.625 ?M oligo d(T).sub.16, 1.875 ?M random hexamers, 20 U RNase inhibitor and 50 U MuLV reverse transcriptase (all from Life Technologies). The conditions for the reverse transcription were the following: 25? C. for 10 min, 42? C. for 1 h, followed by 99? C. for 5 min. The resulting cDNA was amplified in duplicate by quantitative real-time PCR in 10 ?l reaction mixture with 200 nM of each specific primer (List 1) and 1?Fast Syber Green qPCR MasterMix (Applied Biosystems). For the amplification reaction, StudioQuant 7 was used (Applied Biosystem). The amplification program was set as follows: 95? C. for 5 min, followed by 40 cycles at 95? C. for 10 sec, 60? C. for 15 sec, 72? C. for 20 sec. GAPDH and 18S served as housekeeping genes and their amplification data were averaged and used for sample normalization. The software Excel (Microsoft) was used for the comparative quantification analysis.
(43) Ps-Plaque Viability Assay.
(44) Cell viability within the plaque was measured using CellTiter-Glo? 3D Cell Viability Assay (Promega). Briefly, the biofabricated plaques were washed in 1?PBS and dispensed in a opaque-walled 96 well plate (Costar). Each ps-plaque (1 plaque/well) was dispensed in 15 ?l of 1?PBS. Equal volume of CellTiter-Glo? 3D Reagent was added to each well for a final volume of 30 ?l. Luminescence was measured after a 30 min of incubation at room temperature with SPECTRAmax? Gemini-XS (Bucher biotech) and ATP levels were reported in relative luminescence units (RLU).
(45) Quantification of Ps-Plaque Area and Necrotic Area.
(46) For the measure of the plaque necrotic area, every plaque was stained for 40 min in a solution of calcein (5 ?M) and eth-1 (15 ?M) from the LIVE/DEAD? Viability/Cytotoxicity Kit, for mammalian cells (Life Technologies). Ps-plaques were imaged using an inverted microscope (Leica, DM IL LED) and post-processed in ImageJ. Briefly, images underwent colour 2D Parallel iterative deconvolution using the WPL method (Max number of iteration=5; Max number of threads.sup.2=4). The results of the point of spread function obtained from the deconvolution were normalized and the green and red channels were thresholded with the MaxEntropy setting. The ps-plaque necrotic area was measured as necrotic area over alive area and indicated as percentage. Plaque dimension was measured using the bright field images of the plaque circular cross section. First, the image was converted to 8-bit format and thresholded with the MaxEntropy method. Second, the area of the particles was analysed from objects with a dimension larger than 1,000 px in order to exclude debris or single cells not belonging to the bioengineered plaque. Plaque area was reported in mm.sup.2.
(47) Statistical Analysis.
(48) vi-SNE cluster counts and PCR comparative quantitations were analysed using multiple comparison analysis. First, Gaussian distribution of the data was confirmed with Shapiro-Wilk normality test. Second, repeated measures (RM) two-way ANOVA with Tukey's multiple comparison test was applied. Luminescence, plaque and necrotic area were analysed with paired t-test. All statistical analyses were performed with GraphPad Prism Version 6, GraphPad Software, San Diego, Calif., USA). Significance was accepted at p<0.05. All data are presented as mean?s.d.
Example 2: Differentiation-Priming Strategy Promotes Population Redistribution in Cells from Myeloid Origin
(49) A two-step bioengineering method for the assembly of the ps-plaque was established (
Example 3: Defining the Gravity-Guided Biofabrication of Human Atherosclerotic Plaques
(50) Primed cells were detached from the petri dish and cultured in hanging drop for 48 h to foster cell aggregation. LDL was added to the culture medium to mimic the atherosclerotic niche composition. At the end of the 48 h incubation, myofibroblasts isolated from the human umbilical vein (HUVM) were added to the hanging drop to establish a co-culture system (
Example 4: vi-SNE Analysis Reveals Plasmacytoid and Activated Dendritic Cells as Main Myeloid Components in Human Fibroatheroma
(51) To corroborate the ps-plaque model the inventors conducted a comparison study between bioengineered and human atherosclerotic plaques isolated from patients that underwent carotid endarterectomy. First, they sorted CD45+ populations from bioengineered blood-derived ps-plaques (b-plaques), thp1-derived ps-plaques (t-plaques) and human carotid plaques. Second, they analysed and compared the population distribution within the samples using flow cytometry. The inventors observed large similarities in population distribution within b-plaques and t-plaques. In detail, they found that the main cell populations are classical monocytes, macrophages, activated dendritic cells and plasmacytoid dendritic cells (
Example 5: Low-Density Lipoprotein Promotes the Differentiation of a Precursor Myeloid Population in Biofabricated Plaques
(52) The inventors investigated the effects of LDL on the differentiation of myeloid (CD45+) subpopulations isolated from b- and t-plaques. To do so, they biofabricated ps-plaques using either the established protocol based on LDL-enriched medium or using LDL-free medium. They applied the vi-SNE workflow to compare the respective cell populations. In b-plaques they observed a reduced count of precursors in LDL-enriched versus LDL-free controls (p<0.001,
Example 6: The Hanging-Drop Environment Allows the Establishment of a Pro-Inflammatory Niche
(53) To uncover possible transcriptional effects exerted by LDL on key target genes, the inventors investigated the expression profiles of the myeloid component during two steps of the ps-plaque biofabrication: (i) after 48 h in hanging-drop (T1) and (ii) at the end of the hanging-drop process (T2). They compared T1 and T2 from ps-plaques produced in LDL-free or LDL-enriched environments. Surprisingly, despite the induction of dendritic cell-specific intercellular adhesion molecule DC-SIGN (p<0.001 versus p=0.003,
Example 7: Low-Density Lipoprotein Enhances Cell Death in Ps-Plaques Biofabricated with Primed Blood Cells
(54) To further explore the effects of LDL on the ps-plaque model the inventors conducted a bivalent analysis. First, they investigated the cell viability within the ps-plaque. They measured and compared the ATP levels produced by the biofabricated plaques in LDL-enriched and LDL-free medium using a luminescence-based ATP assay. The inventors did not find any significant LDL-dependent differences in ATP levels in either b- or t-plaques (
DISCUSSION
(55) With the biofabrication of the ps-plaque the inventors aimed at replicating cellular architecture and extracellular microenvironment of a human atherosclerotic plaque to close an open modelling gap in the field of atherosclerosis research. It has been described that the fibroatheroma cellular composition is mainly characterized by macrophages and dendritic cells retaining pro-inflammatory and remodelling abilities. To achieve plaque cell populations as similar as possible to human atherosclerotic plaque phenotypes, the inventors established a differentiation-priming protocol based on a mild LPS stimulation of cultured adhesive myeloid cells. To visualize and quantify the effects of this procedure on cell population remodelling they used the vi-SNE workflow. With this strategy they identified a total of 15 cell populations, differently distributed among samples. The inventors were able to classify these populations according to the prevalence of specific surface markers. They were also able to track intra-population density shifts and changes in numbers of events. The sensitivity of the vi-SNE analysis allowed the identification of under-represented myeloid populations, otherwise difficult to identify with commonly used flow cytometry analysis tools. Thanks to the vi-SNE workflow the inventors identified in blood-derived myeloid samples both plasmacytoid dendritic cells (PDC) and pre-classical dendritic cells (pre-cDCs). Interestingly, although thp-1 cells and blood-derived myeloid populations share remarkable similarities concerning population distribution, PDC are almost absent from thp-1 samples before the differentiation-priming treatment, emphasizing the differences between the thp-1 cell line and their physiological counterparts previously discussed by Bosshart and Heinzelmann. Moreover, the vi-SNE analysis reported a yet unidentified myeloid population in both thp-1 and blood derived samples. The inventors observed a significant decrease of this population upon differentiation-priming treatment in both blood-derived and thp-1 samples. The decrease was concomitant to a significant increase in pre-cDC count in blood-derived samples and to an increase in PDC in thp-1 samples. Based on the current myeloid differentiation map and on their observations the inventors propose that the yet unidentified population could be classified as a circulating common precursor of pre-cDC and PDC, differentiating from the common dendritic cell precursors located in the bone marrow (
(56) TABLE-US-00001 TABLE 1 Myeloid populations in ps-plaques and native carotid plaques. Plaque % b- % t- % % nat. % components Abbreviation plaque % total plaque total plaque total Monocytes Classical Mocl 24.92 26.31 34.64 35.14 0.2 0.23 Intermediate Moin 0.97 0.44 0.03 Non classical Monc 0.42 0.06 0.00 Macrophages Derived from MOcl M?1 26.66 29.59 38.06 39.18 0.04 0.23 Derived from MOcl M?2 1.38 0.11 0.00 Derived from MOin M?3 0.27 0.21 0.05 Activated aM? 1.28 0.8 0.14 Dendritic Plamacytoid PDC 5.37 43.83 4.37 24.86 86.68 99.54 cells Differentiated PDC Diff PDC 3.85 2.76 4.21 Pre-classical Pre-cDC 5.12 0.31 0.06 Classical cDC 1.6 0.42 1.01 Activated aDC 0.93 0.40 2.27 Activated SRA-1.sup.high aDCSRA-1 6.58 4.18 5.15 Progenitors Prog 20.38 12.42 0.16 debris 0.27 0.82 0.00 0.00
(57) List 1 shows primers. Gene of interest, forward (FW) and reverse (RV) primer sequences are listed.
(58) TABLE-US-00002 SEQIDNO01:CXCL10for GCAAGCCAATDTGTCCACG SEQIDNO02:CXCL10rev ACADTCCTTGCTAACTGCDTCAG SEQIDNO03:CCR7for GAAAGTCCAGAAACTGDCCCACCTGC SEQIDNO04:CCR7rev CCCCTCTGAAGAACCGAACCACTCCD SEQIDNO05:CCL17for CCAGGGATGCCATCGTDDGTAACTGTGC SEQIDNO06:CCL17rev CCTCACTGTCCCTCTTCTTCGTCCCTGGAA SEQIDNO07:CCL26for GCCTGADTGCAGCATCATGATGG SEQIDNO08:CCL26rev CGGATGACAADCAGCTGAGTCAC SEQIDNO09:DC-SIGNfor TCGAGGATACAAGAGCDAGCA SEQIDNO10:DC-SIGNrev AAGGAGCCCAGCCAAGAG SEQIDNO11:IL10for CTGTGAAAACAAGAGCAACCC SEQIDNO12:IL10rev GAAGCTTCTGDCCCTCCC SEQIDNO13:IL23for GCAGATTCCAAGCCTCAGTC SEQIDNO14:IL23rev DCAACATATGCAGGTCCCA SEQIDNO15:PTGS1for CCCCAGTGAATCCCTGDGD SEQIDNO16:PTGS1rev AAGGTGGCADGACAAACTCC SEQIDNO17:ALOX5for CCCCGACDTGAGAAAATCT SEQIDNO18:ALOX5rev GGCTGCACTCTACCATCTCC SEQIDNO19:SRB1for TCCTCACDCCTCAACCCTG SEQIDNO20:SRB1rev TCCCAGTDGTCCAATGCC SEQIDNO21:GAPDHfor GTCACTGGTGGACCTGACCT SEQIDNO22:GAPDHrev ACCTGGTGCTCAGTGTAGCC SEQIDNO23:18Sfor CCCGGGGAGGTAGTGACGAAAAAT SEQIDNO24:18Srev GCCCGCTCCCAAGATCCAACTAC