Use of insecticidal protein

Abstract

Related is a use of an insecticidal protein. The insecticidal protein may be used to control Monolepta hieroglyphica (Motschulsky). A method for controlling the Monolepta hieroglyphica (Motschulsky) includes: allowing the Monolepta hieroglyphica (Motschulsky) to be at least in contact with an ACe1 protein. In the present application, the ACe1 protein that can kill the Monolepta hieroglyphica (Motschulsky) is produced in bacteria and/or a plant body to control the Monolepta hieroglyphica (Motschulsky).

Claims

1. A method for controlling Monolepta hieroglyphica (Motschulsky), comprising allowing the Monolepta hieroglyphica (Motschulsky) to be at least in contact with an ACe1 protein; preferably, the ACe1 protein is present in a host cell that produces at least the ACe1 protein, and the Monolepta hieroglyphica (Motschulsky) is in contact with at least the ACe1 protein by ingesting the host cell; and more preferably, the ACe1 protein is present in at least a bacterium or a transgenic plant that generates the ACe1 protein, the Monolepta hieroglyphica (Motschulsky) is in contact with at least the ACe1 protein by ingesting the bacterium or tissue of the transgenic plant, and after contacting, the growth of the Monolepta hieroglyphica (Motschulsky) is inhibited and/or death is caused, so as to achieve the control of the damage of the Monolepta hieroglyphica (Motschulsky) to plants.

2. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 1, wherein the transgenic plant is soybean, wheat, barley, corns, tobacco, rice, rape, cotton, or sunflowers.

3. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 1, wherein the tissue of the transgenic plant is a root, a leaf, a stem, a tassel, an ear, an anther, or a filament.

4. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 1, wherein the ACe1 protein is an ACe1_3 protein, an ACe1_4 protein, an ACe1_5 protein, an ACe1_6 protein, an ACe1_8 protein, an ACe1_9 protein, an ACe1_10 protein, an ACe1_11 protein, an ACe1_12 protein, an ACe1_13 protein, an ACe1_14 protein, an ACe1_15 protein, an ACe1_16 protein, an ACe1_17 protein, an ACe1_18 protein, an ACe1_19 protein, an ACe1_20 protein, or an ACe1_21 protein.

5. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 4, wherein the ACe1 protein has any one of the amino acid sequences shown in SEQ ID NO:1 to SEQ ID NO:18.

6. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 4, wherein the ACe1 protein has any one of amino acid sequences shown in SEQ ID NO:19 to SEQ ID NO: 36; and the ACe1 protein has any one of the transgenic plant nucleotide sequences shown in SEQ ID NO:37 to SEQ ID NO:54.

7. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 1, wherein the transgenic plant further comprises at least one second nucleotide different from nucleotide encoding the ACe1 protein.

8. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 7, wherein the second nucleotide encodes a Cry-like insecticidal protein, a Vip-like insecticidal protein, a protease inhibitor, lectin, α-amylase, or a peroxidase.

9. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 8, wherein the second nucleotide encodes a Cry3Bb protein, a Cry3Aa protein, a Cry34Ab protein, or a Cry35Ab protein.

10. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 9, wherein the Cry3Bb protein, the Cry3Aa protein, the Cry34Ab protein, or the Cry35Ab protein has an amino acid sequence shown in SEQ ID NO55, SEQ ID NO:56, SEQ ID NO:57, or SEQ ID NO:58, respectively.

11. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 9, wherein the second nucleotide has a nucleotide sequence shown in SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, or SEQ ID NO:62, respectively.

12. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 7, wherein the second nucleotide is a dsRNA that inhibits an important gene in a target insect pest.

13. A method of producing a plant for controlling Monolepta hieroglyphica (Motschulsky), comprising introducing a polynucleotide sequence encoding an ACe1 protein into a genome of the plant.

14. The method of producing a plant for controlling Monolepta hieroglyphica (Motschulsky) according to claim 13, wherein the ACe1 protein has any one of the transgenic plant nucleotide sequences shown in SEQ ID NO:37 to SEQ ID NO:54.

15. The method of producing a plant for controlling Monolepta hieroglyphica (Motschulsky) according to claim 13, wherein the ACe1 protein has any one of amino acid sequences shown in SEQ ID NO:19 to SEQ ID NO: 36.

16. A method of producing a plant seed for controlling Monolepta hieroglyphica (Motschulsky), comprising hybridizing a plant obtained by the method according to claim 13 with a second plant, so as to produce a seed containing a polynucleotide sequence encoding an ACe1 protein.

17. A method of cultivating a plant for controlling Monolepta hieroglyphica (Motschulsky), comprising: planting at least one plant seed, wherein the genome of the plant seed comprises a polynucleotide sequence encoding an ACe1 protein. growing the plant seed into a plant. and growing the plant under conditions that the Monolepta hieroglyphica (Motschulsky) is artificially inoculated and/or the hazard of the Monolepta hieroglyphica (Motschulsky) naturally occurs, and harvesting a plant that has an attenuated plant damage and/or has an increased plant yield compared with other plants that do not have the polynucleotide sequences encoding the ACe1 protein.

18. The method of cultivating a plant for controlling Monolepta hieroglyphica (Motschulsky) according to claim 17, wherein the ACe1 protein has any one of the transgenic plant nucleotide sequences shown in SEQ ID NO:37 to SEQ ID NO:54.

19. The method of cultivating a plant for controlling Monolepta hieroglyphica (Motschulsky) according to claim 17, wherein the ACe1 protein has any one of amino acid sequences shown in SEQ ID NO:19 to SEQ ID NO: 36.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0085] FIG. 1 is a construction flowchart of a recombinant expression vector DBN01-P containing an ACe1 nucleotide sequence for the use of the insecticidal protein according to the present application.

[0086] FIG. 2 is a construction flowchart of a recombinant expression vector DBN001-T containing an ACe1 nucleotide sequence for the use of the insecticidal protein according to the present application.

[0087] FIG. 3 is a construction flowchart of a plant recombinant expression vector DBN001-B containing an ACe1 nucleotide sequence for the use of the insecticidal protein according to the present application.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0088] The technical schemes of the use of the insecticidal protein of the present application are further described below by specific embodiments.

Example 1: Acquisition and Synthesis of a Gene

[0089] 1. Acquisition of Nucleotide Sequence

[0090] Amino acid sequences of an ACe1 insecticidal protein are shown in SEQ ID NO:1 to 18 in Table 1. An ACe1 bacterial nucleotide sequence encoding the amino acid sequence corresponding to the ACe1 insecticidal protein in bacteria is shown in any one of SEQ ID NO: 19 to 36 in Table 1. In the transgenic plant, an ACe1 transgenic plant nucleotide sequence encoding the amino acid sequence of the ACe1 insecticidal protein is shown in any one of SEQ ID NO:37 to 54 in Table 1.

TABLE-US-00001 TABLE 1 ACe1 protein and corresponding amino acid and nucleotide sequence thereof Bacterial Amino acid nucleotide Transgenic plant Insecticidal sequence sequence nucleotide sequence protein name ID NO. ID NO. ID NO. ACe1_3 SEQ ID NO: 1 SEQ ID NO: 19 SEQ ID NO: 37 ACe1_4 SEQ ID NO: 2 SEQ ID NO: 20 SEQ ID NO: 38 ACe1_5 SEQ ID NO: 3 SEQ ID NO: 21 SEQ ID NO: 39 ACe1_6 SEQ ID NO: 4 SEQ ID NO: 22 SEQ ID NO: 40 ACe1_8 SEQ ID NO: 5 SEQ ID NO: 23 SEQ ID NO: 41 ACe1_9 SEQ ID NO: 6 SEQ ID NO: 24 SEQ ID NO: 42 ACe1_10 SEQ ID NO: 7 SEQ ID NO: 25 SEQ ID NO: 43 ACe1_11 SEQ ID NO: 8 SEQ ID NO: 26 SEQ ID NO: 44 ACe1_12 SEQ ID NO: 9 SEQ ID NO: 27 SEQ ID NO: 45 ACe1_13 SEQ ID NO: 10 SEQ ID NO: 28 SEQ ID NO: 46 ACe1_14 SEQ ID NO: 11 SEQ ID NO: 29 SEQ ID NO: 47 ACe1_15 SEQ ID NO: 12 SEQ ID NO: 30 SEQ ID NO: 48 ACe1_16 SEQ ID NO: 13 SEQ ID NO: 31 SEQ ID NO: 49 ACe1_17 SEQ ID NO: 14 SEQ ID NO: 32 SEQ ID NO: 50 ACe1_18 SEQ ID NO: 15 SEQ ID NO: 33 SEQ ID NO: 51 ACe1_19 SEQ ID NO: 16 SEQ ID NO: 34 SEQ ID NO: 52 ACe1_20 SEQ ID NO: 17 SEQ ID NO: 35 SEQ ID NO: 53 ACe1_21 SEQ ID NO: 18 SEQ ID NO: 36 SEQ ID NO: 54

[0091] 2. Synthesis of Above Nucleotide Sequence

[0092] The bacterial nucleotide sequences (as shown in SEQ ID NO:19 to SEQ ID NO:36 in the sequence listing) of the above 18 ACe1 proteins and the plant nucleotide sequences (as shown in SEQ ID NO:38, SEQ ID NO:42, SEQ ID NO:48 in the sequence listing) of 3 ACe1 proteins are synthesized.

Example 2: Construction of Recombinant Expression Vector and Transformation of Recombinant Expression Vector into Escherichia coli to Obtain an ACe1 Protein

[0093] 1. Construction of Recombinant Expression Vector Containing ACe1 Gene

[0094] The bacterial nucleotide sequences of the ACe1 proteins (ACe1_3 to ACe1_6, ACe1_8 to ACe1_21) synthesized in the Example 1 are linked into a protein expression vector pET28a (Novagen, USA, CAT: 69864-3); operation steps are performed according to the specification of the product pET28a vector of Novagen, so as to obtain recombinant expression vectors DBN01-P to DBN18-P; and a construction flow is shown in FIG. 1 (where Kan represents a kanamycin resistance gene, f1 ori represents the origin of replication of phage f1, Lac1 is a Lad initiation codon, ACe1_3 is an ACe1_3 bacterial nucleotide sequence (SEQ ID NO:19), and MCS represents multiple cloning sites).

[0095] The ACe1 protein and names of the corresponding recombinant expression vectors thereof are shown in Table 2.

TABLE-US-00002 TABLE 2 ACe1 protein and names of corresponding recombinant expression vectors thereof Insecticidal protein name Recombinant expression vector ACe1_3 DBN01-P ACe1_4 DBN02-P ACe1_5 DBN03-P ACe1_6 DBN04-P ACe1_8 DBN05-P ACe1_9 DBN06-P ACe1_10 DBN07-P ACe1_11 DBN08-P ACe1_12 DBN09-P ACe1_13 DBN10-P ACe1_14 DBN11-P ACe1_15 DBN12-P ACe1_16 DBN13-P ACe1_17 DBN14-P ACe1_18 DBN15-P ACe1_19 DBN16-P ACe1_20 DBN17-P ACe1_21 DBN18-P

[0096] 2. Transformation of recombinant expression vector into Escherichia coli to obtain ACe1 protein

[0097] Then, the recombinant expression vectors DBN01 to DBN18-P are transformed into Escherichia coli BL21(DE3) competent cells (Transgen, China, CAT: CD501) by a heat shock method; a positive colony is picked and placed in an LB liquid medium (10 g/L of a tryptone, 5 g/L of a yeast extract, 10 g/L of NaCl, 100 mg/L of an ampicillin, and pH is adjusted to 7.5 with NaOH); and culture is performed for 16 h at 37° C. and at 200 r/min. The culture solution is then transferred to an YT culture medium according to the proportion of 1:10; and culture is performed at 37° C. and at 200 r/min. When an OD=600 value of the culture solution reaches 0.6-0.8, IPTG is added until a final concentration is 0.5 mM, so as to perform inducible expression for 6 h, and the culture solution is centrifuged to collect the cells; the supernatant is discarded, resuspending is performed after PBS is added, and then ultrasonic disruption is performed; and the expression protein is detected by SDS-PAGE, the protein concentration is estimated, and preservation is performed at −20° C. for later use.

Example 3, Identification of Inhibitory Activity Against Monolepta hieroglyphica (Motschulsky) by Feeding ACe1 Protein

[0098] Inhibitory activity against the Monolepta hieroglyphica (Motschulsky), the Callosobruchus chinensis (Linnaeus) and the Henosepilachna vigintioctomaculata (Motschulsky) is detected with the series of ACe1 proteins (ACe1_3 to ACe1_6, ACe1_8 to ACe1_21) obtained in 2 of Example 2. A total of 18 treatments are designed for each pest, which respectively are ACe1_3 to ACe1_6, or ACe1_8 to ACe1_21; and 1 negative control treatment is designed, which is GFP.

[0099] Monolepta hieroglyphica (Motschulsky): protein liquid of ACe1_3 to ACe1_6, ACe1_8 to ACe1_21, and GFP are respectively mixed in feed, and a final concentration is 50 μg/g. Each group of treatments is repeated for 3 times.

[0100] Callosobruchus chinensis (Linnaeus): mung beans are immersed in the protein liquid of ACe1_3 to ACe1_6, ACe1_8 to ACe1_21, and GFP according to the concentration of 50 μg/g. Each group of treatments is repeated for 3 times.

[0101] Henosepilachna vigintioctomaculata (Motschulsky): potato leaves are immersed in the protein liquid of ACe1_3 to ACe1_6, ACe1_8 to ACe1_21, and GFP according to the concentration of 50 μg/g. Each group of treatments is repeated for 3 times.

TABLE-US-00003 TABLE 3 Results of inhibitory activity against Monolepta hieroglyphica (Motschulsky), the Callosobruchus chinensis (Linnaeus) and the Henosepilachna vigintioctomaculata (Motschulsky) by feeding ACe1 protein Test insect Monolepta Callosobruchus Henosepilachna Serial number hieroglyphica chinensis vigintioctomaculata of proteins (Motschulsky) (Linnaeus) (Motschulsky) ACe1_3 + − − ACe1_4 + − − ACe1_5 + − − ACe1_6 + − − ACe1_8 + − − ACe1_9 + − − ACe1_10 + − − ACe1_11 + − − ACe1_12 − NT NT ACe1_13 + − − ACe1_14 + − − ACe1_15 + NT NT ACe1_16 + − − ACe1_17 + − − ACe1_18 + − − ACe1_19 + NT NT ACe1_20 − NT NT ACe1_21 − NT NT GFP − − − “+” means that there is an inhibitory activity; “−” means that there is no inhibitory activity; and “NT” stands for not tested

[0102] Results of Table 3 show that, the ACe1_3 to ACe1_6, ACe1_8 to ACe1_11, or ACe1_13 to ACe1_19 proteins have desirable inhibitory activity against the Monolepta hieroglyphica (Motschulsky), and have no inhibitory activity against the Callosobruchus chinensis (Linnaeus) (same family) and the Henosepilachna vigintioctomaculata (Motschulsky) that belong to the same Coleoptera.

[0103] The above results fully indicate that the toxicity of the anti-insect protein to insects is not necessarily related to the family of insects, but is inseparable from the mechanism of action of the anti-insect protein. That is to say, the enzymatic cleavage activation in insect gut, receptor binding on the insect gut and a physicochemical environment in the insect gut are key points for achieving the effect of a β-pore forming protein, and the interaction between the β-pore forming protein and enzymes and receptors in insects is complex and unpredictable.

Example 4, Construction of Plant Expression Vector

[0104] 1. Construction of Recombinant Cloning Vector Containing an ACe1 Gene

[0105] The synthesized ACe1_4 plant nucleotide sequence is linked to a cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), and an operation step is performed according to instructions of a pGEM-T vector product of Promega Company, to obtain a recombinant cloning vector DBN001-T, and its construction process is shown in FIG. 2 (herein, Amp represents an ampicillin resistance gene; f1ori represents the origin of replication of phage f1; LacZ is an LacZ initiation codon; SP6 is an SP6 RNA polymerase promoter; T7 is a T7 RNA polymerase promoter; ACe1_4 is the ACe1_4 plant nucleotide sequence (SEQ ID NO:38); and MCS represents multiple cloning sites).

[0106] Then, the recombinant cloning vector DBN001-T is transformed into Escherichia coli T1 competent cells (Transgen, Beijing, China, CAT: CD501) by a heat shock method, and a white bacterial colony is picked, and placed in a Luria-Bertani (LB) liquid medium (10 g/L of a tryptone, 5 g/L of a yeast extract, 10 g/L of NaCl, 100 mg/L of an ampicillin, and pH is adjusted to 7.5 with NaOH) and cultured overnight at 37° C. Plasmids thereof are extracted by an alkaline method and stored at −20° C. for future use.

[0107] After the extracted plasmid is identified by enzyme digestion, the positive colonies are sequenced and verified, and results show that the ACe1_4 plant nucleotide sequence inserted in the recombinant cloning vector DBN001-T is the nucleotide sequence shown in the sequence listing (SEQ ID NO:38). That is to say, the ACe1_4 plant nucleotide sequence is correctly inserted.

[0108] According to the above method for constructing the recombinant cloning vector DBN001-T, the synthesized ACe1_9 nucleotide sequence is linked to the cloning vector pGEM-T, to obtain a recombinant cloning vector DBN002-T, herein ACe1_9 is the ACe1_9 nucleotide sequence (SEQ ID NO:42). It is verified by the enzyme digestion and sequencing that the ACe1_9 nucleotide sequence in the recombinant cloning vector DBN002-T is correctly inserted.

[0109] According to the above method for constructing the recombinant cloning vector DBN001-T, the synthesized ACe1_15 nucleotide sequence is linked to the cloning vector pGEM-T, to obtain a recombinant cloning vector DBN003-T, herein ACe1_15 is the ACe1_15 nucleotide sequence (SEQ ID NO:48). It is verified by the enzyme digestion and sequencing that the ACe1_15 nucleotide sequence in the recombinant cloning vector DBN003-T is correctly inserted.

[0110] 2. Construction of Recombinant Expression Vector Containing an ACe1 Gene

[0111] Recombinant cloning vector DBN001-T and expression vector DBNBC-01 (vector framework: pCAMBIA2301 (which may be provided by the CAMBIA institution)) are digested with restriction endonucleases, and an excised ACe1_4 plant nucleotide sequence fragment is inserted between the restriction endonuclease sites of the expression vector DBNBC-01. It is well-known to those skilled in the art to construct a vector with a conventional enzyme digestion method, the recombinant expression vector DBN001-B is constructed, and the construction flow is shown in FIG. 3 (Kan: kanamycin gene; RB: right border; prUbi: maize ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:63); ACe1_4: ACe1_4 plant nucleotide sequence (SEQ ID NO:38); tNos: terminator of nopaline synthase gene (SEQ ID NO:64); Hpt: hygromycin phosphotransferase gene (SEQ ID NO:65); and LB: left border).

[0112] The recombinant expression vector DBN001-B is transformed into the Escherichia coli T1 competent cells with the heat shock method; the white colony is picked and placed in the LB liquid medium (10 g/L of the tryptone, 5 g/L of the yeast extract, 10 g/L of NaCl, 50 mg/L of the kanamycin, and pH is adjusted to 7.5 with NaOH); and culture is performed overnight at 37° C., and plasmids thereof are extracted by an alkaline method. The extracted plasmid is identified by the restriction endonuclease digestion, and the positive clone is sequenced and identified. The results show that the nucleotide sequence in the recombinant expression vector DBN001-B is the nucleotide sequence shown in SEQ ID NO:38 in the sequence listing, that is, the ACe1_4 plant nucleotide sequence.

[0113] According to the method for constructing the recombinant expression vector DBN001-B, the ACe1_9 nucleotide sequence cut from the recombinant cloning vector DBN002-T is inserted into the expression vector DBNBC-01, so as to obtain the recombinant expression vector DBN002-B. Enzyme digestion and sequencing verify that the nucleotide sequence in the recombinant expression vector DBN002-B includes the nucleotide sequence shown in SEQ ID NO: 42 in the sequence listing, that is, the ACe1_9 nucleotide sequence. The ACe1_9 nucleotide sequence may be connected to the Ubi promoter and the Nos terminator.

[0114] According to the method for constructing the recombinant expression vector DBN001-B, the ACe1_15 nucleotide sequence cut from the recombinant cloning vector DBN003-T is inserted into the expression vector DBNBC-01, so as to obtain the recombinant expression vector DBN003-B. Enzyme digestion and sequencing verify that the nucleotide sequence in the recombinant expression vector DBN003-B includes the nucleotide sequence shown in SEQ ID NO: 48 in the sequence listing, that is, the ACe1_15 nucleotide sequence. The ACe1_15 nucleotide sequence may be connected to the Ubi promoter and the Nos terminator.

[0115] 3. Transformation of Recombinant Expression Vector into Agrobacterium

[0116] The correctly constructed recombinant expression vector DBN001-B, DBN002-B or DBN003-B is transformed into agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT: 18313-015) by a liquid nitrogen method, and its transformation conditions are as follows: 100 μl of the agrobacterium LBA4404, and 3 μl of a plasmid DNA (recombinant expression vector); it is placed in liquid nitrogen for 10 minutes, and a warm water bath is performed at 37° C. for 10 minutes; the transformed agrobacterium LBA4404 is inoculated in an LB test tube, cultured for 2 hours under conditions of a temperature of 28° C. and a rotation speed of 200 rpm, and spread on an LB plate containing 50 mg/L of rifampicin and 100 mg/L of kanamycin until a positive single clone grows, the single clone is picked for culture and plasmids thereof are extracted, the restriction endonuclease is used to verify the recombinant expression vector DBN001-B, DBN002-B or DBN003-B after being enzyme-digested, and results show that the structure of the recombinant expression vector DBN001-B, DBN002-B or DBN003-B is completely correct.

Example 5, Obtaining of Transgenic Corn Plants

[0117] According to the conventional agrobacterium infection method, the immature embryos of the aseptically cultured maize variety Zong 31 (Z31) are co-cultured with the agrobacterium transformed with the recombinant expression vector described in step 3 in the Example 4, to transfer the T-DNA (including the promoter sequence of maize ubiquitin gene, the ACe1_4 nucleotide sequence, the ACe1_9 nucleotide sequence, the ACe1_15 nucleotide sequence, the Hpt gene and the Nos terminator sequence) in the recombinant expression vector DBN001-B, DBN002-B or DBN003-B constructed in 2 in the Example 4 into a maize genome, so as to obtain a corn plant transformed with the ACe1_4 nucleotide sequence, a corn plant transformed with the ACe1_9 nucleotide sequence, a corn plant transformed with the ACe1_15 nucleotide sequence. In addition, a wild corn plant is used as a control.

[0118] For agrobacterium-mediated transformation of corns, briefly, immature embryos are isolated from the corns and are in contact with agrobacterium suspension. The agrobacterium can deliver the ACe1_4 nucleotide sequence, the ACe1_9 nucleotide sequence, and/or the ACe1_15 nucleotide sequence to at least one cell (step 1: infection step) of one of the embryos. In this step, the embryos are preferably immersed in the agrobacterium suspension (OD.sub.660=0.4-0.6, an infection medium (4.3 g/L of MS salt, MS vitamins, 300 mg/L of casein, 68.5 g/L of sucrose, 36 g/L of glucose, 40 mg/L of Acetosyringone (AS), and 1 mg/L of 2,4-dichlorophenoxyacetic acid (2,4-D), pH 5.3) to initiate inoculation. The embryos are co-cultured with the agrobacterium for a period of time (3 days) (Step 2: co-culture step). Preferably, the embryos are cultured in a solid culture medium (4.3 g/L of the MS salt, the MS vitamins, 300 mg/L of casein, 20 g/L of sucrose, 10 g/L of glucose, 100 mg/L of AS, 1 mg/L of 2,4-D, and 8 g/L of agar, pH5.8) after the infection step. After this co-culture phase, there may be an optional “recovery” step. In the “recovery” step, in a recovery culture medium (4.3 g/L of the MS salt, the MS vitamins, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of 2,4-D, and 8 g/L of agar, pH5.8), there is at least one antibiotic known (cephalosporin) to inhibit the growth of the agrobacterium, and a selective agent for a plant transformant (Step 3: recovery step) is not added. Preferably, the embryos are cultured on a solid medium with the antibiotic without the selective agent, as to eliminate the agrobacterium and provide a recovery period for infected cells. Next, the inoculated embryos are grown on a culture medium containing the selective agent (hygromycin) and a grown transformed callus is selected (Step 4: selection step). Preferably, the embryos are cultured in the solid culture medium (4.3 g/L of the MS salt, the MS vitamins, 300 mg/L of casein, 5 g/L of sucrose, 50 mg/L of hygromycin, 1 mg/L of 2,4-D, and 8 g/L of agar, pH5.8) containing the selective agent, so as to cause the transformed cells to selectively grow. The callus are then regenerated into plants (Step 5: regeneration step), preferably, the callus grown on the medium containing the selective agent is cultured on the solid medium (MS differentiation medium and MS rooting medium) to regenerate the plant.

[0119] The screened resistant callus is transferred to the MS differentiation medium (4.3 g/L of the MS salt, the MS vitamins, 300 mg/L of casein, 30 g/L of sucrose, 2 mg/L of 6-benzyladenine, 50 mg/L of hygromycin, and 8 g/L of agar, pH5.8), and culture differentiation is performed at 25° C. The differentiated seedling is transferred to the MS rooting medium (2.15 g/L of the MS salt, the MS vitamins, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of indole-3-acetic acid, and 8 g/L of agar, pH5.8); and the seedling is cultured to a height of about 10 cm at 25° C., and then moved to a greenhouse to grow until fruiting. In the greenhouse, culture is performed for 16 h at 28° C. every day, and then culture is performed for 8 h at 20° C.

Example 6, Obtaining of Transgenic Soybean Plants

[0120] According to the conventional agrobacterium infection method, the cotyledon node tissue of the aseptically cultured soybean variety Jack is co-cultured with the agrobacterium transformed with the recombinant expression vector described in 3 in the Example 4, to transfer the T-DNA (including the promoter sequence of maize ubiquitin, the ACe1_4 nucleotide sequence, the ACe1_9 nucleotide sequence, the ACe1_15 nucleotide sequence, the Hpt gene and the Nos terminator sequence) in the recombinant expression vector DBN001-B, DBN002-B or DBN003-B constructed in 2 in the Example 4 into a soybean genome, so as to obtain a corn plant transformed with the ACe1_4 nucleotide sequence, a corn plant transformed with the ACe1_9 nucleotide sequence, a corn plant transformed with the ACe1_15 nucleotide sequence. In addition, a wild corn plant is used as a control.

[0121] For agrobacterium-mediated transformation of soybean, briefly, mature soybean seeds are grown in a soybean germination medium (3.1 g/L of a B5 salt, a B5 vitamin, 20 g/L of a sucrose, 8 g/L of an agar, and pH 5.6) for germination, the seeds are inoculated on to germination medium, and cultured under the following conditions: the temperature is 25±1° C.; and the photoperiod (light/dark) is 16/8 h. After 4-6 days of germination, an aseptic seedling of soybean at a swollen green cotyledon node is taken, a hypocotyl is cut at 3-4 mm below the cotyledon node, a cotyledon is cut longitudinally, and a terminal bud, a lateral bud and a seed root are removed. It is wounded at the cotyledon node with the back of a scalpel, and a wounded cotyledon node tissue contacts with agrobacterium suspension, herein the agrobacterium may deliver RX nucleotide sequence to the wounded cotyledon node tissue (Step 1: infection step). In this step, the cotyledon node tissue is preferably immersed in the agrobacterium suspension (OD.sub.660=0.5-0.8), a culture medium (2.15 g/L of an MS salt, a B5 vitamin, 20 g/L of a sucrose, 10 g/L of a glucose, 40 mg/L of an acetosyringone (AS), 4 g/L of 2-morpholineethanesulfonic acid (MES), 2 mg/L of a zeatin (ZT), and pH 5.3) is infected to start inoculation. The cotyledon node tissue is co-cultured with the agrobacterium for a period of time (3 days) (Step 2: co-culture step). Preferably, the cotyledon node tissue is cultured in a solid culture medium (4.3 g/L of the MS salt, the B5 vitamin, 20 g/L of the sucrose, 10 g/L of the glucose, 4 g/L of MES, 2 mg/L of ZT, 8 g/L of the agar, and pH 5.6) after the infection step. After this co-culture phase, there may be an optional “recovery” step. In the “recovery” step, in a recovery culture medium (3.1 g/L of the B5 salt, the B5 vitamin, 1 g/L of MES, 30 g/L of the sucrose, 2 mg/L of ZT, 8 g/L of the agar, 150 mg/L of a cephalosporin, 100 mg/L of a glutamic acid, 100 mg/L of an aspartic acid, and pH 5.6), there is at least one antibiotic known (cephalosporin) to inhibit the growth of the agrobacterium, and a selective agent for a plant transformant (Step 3: recovery step) is not added. Preferably, a cotyledon node regenerated tissue piece is cultured on a solid medium with the antibiotic without the selective agent, as to eliminate the agrobacterium and provide a recovery period for infected cells. Next, the cotyledon node regenerated tissue piece is grown on a culture medium containing the selective agent (hygromycin) and a grown transformed callus is selected (Step 4: selection step). Preferably, the cotyledon node regenerated tissue piece is cultured in a screening solid medium with the selective agent (3.1 g/L of the B5 salt, the B5 vitamin, 1 g/L of MES, 30 g/L of the sucrose, 1 mg/L of 6-benzyl adenine (6-BAP), 8 g/L of the agar, 150 mg/L of the cephalosporin, 100 mg/L of the glutamic acid, 100 mg/L of the aspartic acid, 50 mg/L of the hygromycin, and pH 5.6), so that the transformed cells are selectively grown. The transformed cells are then regenerated into a plant (Step 5: regeneration step), preferably, the cotyledon node regenerated tissue piece grown on the medium containing the selective agent is cultured on a solid medium (B5 differentiating medium and B5 rooting medium) to regenerate the plant.

[0122] The screened resistant tissue piece is transferred to the B5 differentiating medium (3.1 g/L of the B5 salt, the B5 vitamin, 1 g/L of MES, 30 g/L of the sucrose, 1 mg/L of ZT, 8 g/L of the agar, 150 mg/L of the cephalosporin, 50 mg/L of the glutamic acid, 50 mg/L of the aspartic acid, 1 mg/L of a gibberellin, 1 mg/L of an auxin, 50 mg/L of the hygromycin, and pH 5.6), cultured and differentiated at 25° C. The differentiated seedling is transferred to the B5 rooting medium (3.1 g/L of the B5 salt, the B5 vitamin, 1 g/L of MES, 30 g/L of the sucrose, 8 g/L of the agar, 150 mg/L of the cephalosporin, 1 mg/L of indole-3-butyric acid (IBA)), and on the rooting medium, it is cultured to a height of about 10 cm at 25° C., and then moved to a greenhouse to grow until fruiting. In the greenhouse, culture is performed for 16 h at 26° C. every day, and then culture is performed for 8 h at 20° C.

Example 7: Verification of Transgenic Corn Plant or Transgenic Soybean Plant with TaqMan

[0123] About 100 mg of leaves of the corn plant transformed with the ACe1_4 nucleotide sequence, the ACe1_9 nucleotide sequence, or the ACe1_15 nucleotide sequence are taken as samples, and its genome DNA is extracted with Qiagen's DNeasy Plant Maxi Kit, and the copy number of the Hpt genes is detected by a Taqman probe fluorescence quantitative PCR method to determine the copy number of ACe1_4, ACe1_9, ACe1_15 genes. At the same time, the wild corn plant is used as a control, and the detection and analysis are performed according to the above method. The experiment is repeated for 3 times, and the average value is taken.

[0124] A specific method to detect the copy number of the Hpt genes is as follows.

[0125] Step 11, 100 mg of the leaves of the corn plant transformed with the ACe1_4 nucleotide sequence, the ACe1_9 nucleotide sequence, or the ACe1_15 nucleotide sequence and the wild-type corn plant are taken respectively, and grinded into uniform slurry with liquid nitrogen in a mortar, and 3 replicates for each sample are taken.

[0126] Step 12, Qiagen's DNeasy Plant Mini Kit is used to extract the genome DNA of the above sample, and a specific method refers to its product specification.

[0127] Step 13, NanoDrop 2000 (Thermo Scientific) is used to measure the genome DNA concentration of the above sample.

[0128] Step 14, the genome DNA concentration of the above sample is adjusted to the same concentration value, and the range of the concentration value is 80-100 ng/μl.

[0129] Step 15, the Taqman probe fluorescence quantitative PCR method is used to identify the copy number of the sample, the sample with the known copy number after the identification is used as a standard substance, and the sample of the wild corn plant is used as a control, 3 replicates for each sample are taken, and its average value is taken; and fluorescence quantitative PCR primer and probe sequences are as follows.

[0130] The following primers and probes are used to detect the Hpt nucleotide sequence.

[0131] Primer 1: cagggtgtcacgttgcaaga is as shown in SEQ ID NO:66 in the sequence listing.

[0132] Primer 2: ccgctcgtctggctaagatc is as shown in SEQ ID NO:67 in the sequence listing.

[0133] Probe 1: tgcctgaaaccgaactgcccgctg is as shown in SEQ ID NO:68 in the sequence listing. A PCR reaction system is as follows.

TABLE-US-00004 JumpStart ™ Taq ReadyMix ™ (Sigma) 10 μl  50× primer/probe mixture 1 μl Genomic DNA 3 μl Water (ddH2O) 6 μl

[0134] The 50× primer/probe mixture contains 45 μl of each primer at a concentration of 1 mM, 50 μl of the probe at a concentration of 100 μM and 860 μl of 1×TE buffer, and is stored in a centrifuge tube at 4° C.

[0135] PCR reaction conditions are as follows.

TABLE-US-00005 Step Temperature Time 21 95° C. 5 min 22 95° C. 30 s 23 60° C. 1 min 24 Returning to Step 22, and repeating for 40 times

[0136] Data is analyzed with SDS 2.3 software (Applied Biosystems).

[0137] The experimental results by analyzing the copy number of the Hpt genes show that, the ACe1_4 nucleotide sequence, the ACe1_9 nucleotide sequence, or the ACe1_15 nucleotide sequence has been integrated into the genome of the tested corn plants, and the corn plant transformed with the ACe1_4 nucleotide sequence, the corn plant transformed with the ACe1_9 nucleotide sequence, or the corn plant transformed with the ACe1_15 nucleotide sequence all obtain single-copy transgenic corn plants.

[0138] According to the method for verifying the transgenic corn plant with TaqMan, the transgenic soybean plant is detected and analyzed. The experimental results by analyzing the copy number of the Hpt genes show that, the ACe1_4 nucleotide sequence, the ACe1_9 nucleotide sequence, or the ACe1_15 nucleotide sequence has been integrated into the genome of the tested soybean plants, and the soybean plants transformed with the ACe1_4 nucleotide sequence, the ACe1_9 nucleotide sequence, or the ACe1_15 nucleotide sequence all obtain single-copy transgenic plants.

Example 8, Identification of Inhibitory Activity of Transgenic Corn Plants

[0139] The corn plant transformed with the ACe1_4 nucleotide sequence, the corn plant transformed with the ACe1_9 nucleotide sequence, or the corn plant transformed with the ACe1_15 nucleotide sequence, the corresponding wild corn plant, and the corn plant identified as non-transgenic by Taqman are detected for the inhibitory activity against the Monolepta hieroglyphica (Motschulsky).

[0140] Fresh leaves (heart leaves) of the corn plant transformed with the ACe1_4 nucleotide sequence, the corn plant transformed with the ACe1_9 nucleotide sequence, or the corn plant transformed with the ACe1_15 nucleotide sequence, the wild corn plant, and the corn plant (Stage V3-V4) identified as non-transgenic by Taqman are taken respectively, washed with sterile water and dried with gauze; then, the veins are removed from the corn leaves, the leaves are cut into strips of about 1 cm×2 cm, and 1 piece of the cut strip-like leaf is taken and put the leaf on a moisturizing filter paper at the bottom of a circular plastic petri dish; 10 Monolepta hieroglyphica (Motschulsky) (larvae) are put in each petri dish; after the insect-testing petri dish is covered, the petri dish is put for 1 day under the conditions of a temperature of 24±2° C., a relative humidity of 70%-80%, and a photoperiod (light/dark) of 24:0; from the second day after infestation, the positive leaves are replaced every 2 days until the end of the experiment at Day 10 to test whether there was a significant difference in survival rate. A total of 3 lines are transformed into ACe1_4 nucleotide sequences; a total of 3 lines are transformed into ACe1_9 nucleotide sequences; a total of 3 lines are transformed into ACe1_15 nucleotide sequences; 1 line is identified as non-transgenic (NGM) by Taqman; and 1 line is identified as wild (CK). 5 lines are selected from each line for test, and each plant is tested repeatedly for 3 times. Results are shown in Table 4.

TABLE-US-00006 TABLE 4 Inhibitory activity experimental results of transgenic corn plant inoculated with Monolepta hieroglyphica (Motschulsky) Serial number Test insect of proteins Monolepta hieroglyphica (Motschulsky) ACe1_4 + ACe1_9 + ACe1_15 + NGM − CK − “+” means that there is an inhibitory activity; and “−” means that there is no inhibitory activity

[0141] The results show that, the corn plant transformed with the ACe1_4 plant nucleotide sequence, the corn plant transformed with the ACe1_9 plant nucleotide sequence, or the corn plant transformed with the ACe1_15 plant nucleotide sequence have a desirable lethal effect on the Monolepta hieroglyphica (Motschulsky).

Example 9, Identification of Inhibitory Activity of Transgenic Soybean Plants

[0142] The soybean plant transformed with the ACe1_4 nucleotide sequence, the soybean plant transformed with the ACe1_9 nucleotide sequence, or the soybean plant transformed with the ACe1_15 nucleotide sequence, the corresponding wild soybean plant, and the non-transgenic soybean plant identified by Taqman are detected for the inhibitory activity against the Monolepta hieroglyphica (Motschulsky).

[0143] According to the method for detecting inhibitory activity of corn leaves, inhibitory activity analysis is performed on the transgenic soybean plants.

[0144] A total of 3 lines are transformed into ACe1_4 nucleotide sequences; a total of 3 lines are transformed into ACe1_9 nucleotide sequences; a total of 3 lines are transformed into ACe1_15 nucleotide sequences; 1 line is identified as non-transgenic (NGM) by Taqman; and 1 line is identified as wild (CK). 5 lines are selected from each line for test, and each plant is tested repeatedly for 3 times. Results are shown in Table 5.

TABLE-US-00007 TABLE 5 Inhibitory activity experimental results of transgenic soybean plant inoculated with Monolepta hieroglyphica (Motschulsky) Serial number Test insect of proteins Monolepta hieroglyphica (Motschulsky) ACe1_4 + ACe1_9 + ACe1_15 + NGM − CK − “+” means that there is an inhibitory activity; and “−” means that there is no inhibitory activity

[0145] The results show that, the soybean plant transformed with the ACe1_4 plant nucleotide sequence, the soybean plant transformed with the ACe1_9 plant nucleotide sequence, or the soybean plant transformed with the ACe1_15 plant nucleotide sequence have a lethal effect on the Monolepta hieroglyphica (Motschulsky).

[0146] Therefore, it indicates that the ACe1 protein (ACe1_4, ACe1_9, ACe1_15) shows resistance activity against the Monolepta hieroglyphica (Motschulsky) both in bacteria and in plants, and this activity is sufficient to have adverse effects on the growth of the Monolepta hieroglyphica (Motschulsky), so that the Monolepta hieroglyphica (Motschulsky) can be controlled in the fields. In addition, it is also possible to reduce the occurrence of diseases on the transgenic ACe1 plants by controlling the damage of the Monolepta hieroglyphica (Motschulsky), thereby greatly improving the yield and quality of the transgenic ACe1 plants.

[0147] In conclusion, through the use of the insecticidal protein of the present application, ACe1 protein that can kill the Monolepta hieroglyphica (Motschulsky) is produced in bacteria and/or a plant body to control the Monolepta hieroglyphica (Motschulsky). Compared with an agricultural control method, a chemical control method, a physical control method and a biological control method used in the prior art, the present application achieves the protection of whole growth period and whole plant on the plants so as to control the infestation of the Monolepta hieroglyphica (Motschulsky), and is pollution-free, residue-free, stable in effect, thorough, simple, convenient and economical.

[0148] Finally, it should be noted that the above embodiments are only used to illustrate the technical schemes of the present application and not to limit them. Although the present application is described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical schemes of the present application may be modified or equivalently replaced without departing from the spirit and scope of the technical schemes of the present application.