Optimized genetic tool for modifying <i>Clostridium </i>bacteria

11946067 ยท 2024-04-02

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention concerns a genetic tool comprising at least two distinct nucleic acids optimized to facilitate the transformation and modification by homologous recombination of a bacterium of the genus Clostridium, typically a solventogenic bacterium.

Claims

1. A genetic tool for improving efficiency of transformation over a gene editing tool that does not include anti-CRISPR proteins, and genetic modification by homologous recombination, of a bacterium of the genus Clostridium, characterized: i) in that the genetic tool comprises: a first nucleic acid encoding at least Cas9, wherein the nucleic acid encoding Cas9 is placed under the control of an inducible promoter, and at least a second nucleic acid allowing the expression of a repair template comprising a sequence of interest allowing, by a homologous recombination mechanism, replacement of a portion of bacterial DNA targeted by Cas9 by the sequence of interest, ii) in that at least one of said nucleic acids further encodes one or more guide RNAs (gRNAs) or in that the genetic tool further comprises one or more guide RNAs, each guide RNA comprising a Cas9-enzyme-binding RNA structure and a sequence complementary to the targeted portion of the bacterial DNA, and iii) in that the first nucleic acid further comprises a sequence encoding an anti-CRISPR protein placed under the control of an inducible promoter, said genetic tool improving efficiency of transformation over a gene editing tool that does not include anti-CRISPR proteins.

2. The genetic tool according to claim 1, characterized in that the bacterium of the genus Clostridium is a solventogenic bacterium selected from C. acetobutylicum, C. cellulolyticum, C. phytofermentans, C. beijerinckii, C. saccharobutylicum, C. saccharoperbutylacetonicum, C. sporogenes, C. butyricum, C. aurantibutyricum, or C. tyrobutyricum.

3. The genetic tool according to claim 2, characterized in that when the bacterium is C. acetobutylicum, said C. acetobutylicum bacterium is strain DSM 792 (ATCC 824 or LMG 5710), and when the solventogenic bacterium is C. beijerinckii, said C. beijerinckii bacterium is strain NCIMB 8052 or strain DSM 6423 (NRRL B-593, LMG 7814 or LMG 7815).

4. The genetic tool according to claim 1, characterized in that the anti-CRISPR protein is the protein AcrIIA2 or the protein AcrIIA4.

5. The genetic tool according to claim 1, characterized in that the expression of the DNA sequence of interest allows the bacterium of the genus Clostridium to ferment at least two different sugars among 6-carbon sugars and/or among 5-carbon sugars.

6. The genetic tool according to claim 1, characterized in that the sequence of interest encodes at least one product promoting solvent production by the bacterium of the genus Clostridium.

7. The genetic tool according to claim 1, characterized in that each of the first and at least second nucleic acids present within the tool is located in a distinct expression cassette or a distinct vector.

8. A kit for transforming a bacterium of the genus Clostridium or for producing at least one solvent using a bacterium of the genus Clostridium, wherein the kit comprises the genetic tool according to claim 1 and at least one inducer adapted to the inducible promoter of expression of the selected anti-CRISPR protein used within the tool.

9. A process for genetically modifying by homologous recombination, a bacterium of the genus Clostridium, characterized in that the process comprises a step of transforming the bacterium by introducing into said bacterium a genetic tool, the genetic tool comprising: a first nucleic acid encoding at least Cas9, wherein the sequence encoding Cas9 is placed under the control of an inducible promoter, and at least a second nucleic acid allowing the expression of a repair template comprising a sequence of interest allowing, by a homologous recombination mechanism, replacement of a portion of bacterial DNA targeted by Cas9 by the sequence of interest, in that at least one of said nucleic acids further encodes one or more guide RNAs (gRNAs) or in that the genetic tool further comprises one or more guide RNAs, each guide RNA comprising a Cas9-enzyme-binding RNA structure and a sequence complementary to the targeted portion of the bacterial DNA, and in that the first nucleic acid further comprises a sequence encoding an anti-CRISPR protein placed under the control of an inducible promoter.

10. The process according to claim 9, characterized in that the process further comprises (b) a step of culturing the transformed bacterium on a medium not containing an inducer of expression of the anti-CRISPR protein.

11. The process according to claim 10 further comprising (c) a step of removing the nucleic acid containing the repair template and/or the guide RNA(s) or sequences encoding the guide RNA(s) introduced with the genetic tool.

12. The process according to claim 11, characterized in that the process further comprises one or more additional steps (d), subsequent to step (b) or to step (c), comprising (i) introducing an nth nucleic acid containing a repair template distinct from that already introduced and one or more expression cassettes for guide RNAs allowing the integration of an nth sequence of interest contained in said distinct repair template into a targeted region of the bacterium's genome, in the presence of the inducer of expression of the anti-CRISPR protein, (ii) culturing the bacterium thus transformed on a medium not containing the inducer of expression of the anti-CRISPR protein, and (iii) allowing expression of a Cas9/gRNA ribonucleoprotein complex.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1: CRISPR/Cas9 system used for genome editing as a genetic tool to create, using Cas9 nuclease, one or more double-stranded cuts in genomic DNA directed by gRNA.

(2) gRNA, guide RNA; PAM, protospacer adjacent motif. Figure modified from Jinek et al., 2012.

(3) FIG. 2: Repair by homologous recombination of a Cas9-induced double-stranded cut. PAM, protospacer adjacent motif.

(4) FIG. 3: Use of CRISPR/Cas9 in Clostridium.

(5) ermB, erythromycin resistance gene; catP (SEQ ID NO: 70), thiamphenicol/chloramphenicol resistance gene; tetR, gene whose expression product represses transcription from Pcm-tetO2/1; Pcm-2tetO1 and Pcm-tetO2/1, anhydrotetracycline (aTc)-inducible promoters (Dong et al., 2012); miniPthl, constitutive promoter (Dong et al., 2012).

(6) FIG. 4: pCas9.sub.acr plasmid map (SEQ ID NO: 23).

(7) ermB, erythromycin resistance gene; rep, origin of replication in E. coli; repH, origin of replication in C. acetobutylicum; Tthl, thiolase terminator; miniPthl, constitutive promoter (Dong et al., 2012); Pcm-tetO2/1, promoter repressed by the product of tetR and inducible by anhydrotetracycline (aTc) (Dong et al., 2012); Pbgal, a promoter repressed by the product of lacR and inducible by lactose (Hartman et al., 2011); acrlIA4, gene encoding the anti-CRISPR protein AcrII14; bgaR, gene whose expression product represses transcription from Pbgal.

(8) FIG. 5: Relative transformation rates of C. acetobutylicum DSM 792 containing pCas9.sub.ind (SEQ ID NO: 22) or pCas9.sub.acr (SEQ ID NO: 23). Frequencies are expressed as the number of transformants obtained per ?g of DNA used in the transformation, in relation to the transformation frequencies of pEC750C (SEQ ID NO: 106), and represent the means of at least two independent experiments.

(9) FIG. 6: Induction of the CRISPR/Cas9 system in strain DSM 792 transformants containing pCas9.sub.acr and an expression plasmid for the gRNA targeting bdhB, with (SEQ ID NO: 79 and SEQ ID NO: 80) or without (SEQ ID NO: 105) repair template. Em, erythromycin; Tm, thiamphenicol; aTc, anhydrotetracycline; ND, not diluted.

(10) FIG. 7: Modification of the bdh locus of C. acetobutylicum DSM792 via the CRISPR/DNA endonuclease system.

(11) A, genetic organization of the bdh locus. Homologies between repair template and genomic DNA are indicated with light gray parallelograms. The hybridization sites of primers V1 and V2 are also shown.

(12) B, amplification of the bdh locus using primers V1 and V2. M, 2-log size marker (NEB); P, pGRNA-?bdhA?bdhB plasmid; WT, wild-type strain.

(13) FIG. 8: Classification of 30 solventogenic Clostridium strains, according to Poehlein et al., 2017. Note that subclade C. beijerinckii NRRL B-593 is also identified in the literature as C. beijerinckii DSM 6423.

(14) FIG. 9: pCas9ind-?catB plasmid map.

(15) FIG. 10: pCas9acr plasmid map.

(16) FIG. 11: pEC750S-uppHR plasmid map.

(17) FIG. 12: pEX-A2-gRNA-upp plasmid map.

(18) FIG. 13: pEC750S-?upp plasmid map.

(19) FIG. 14: pEC750C-?upp plasmid map.

(20) FIG. 15: pGRNA-pNF2 map.

(21) FIG. 16: PCR amplification of the catB gene in clones derived from the bacterial transformation of strain C. beijerinckii DSM 6423.

(22) Amplification of about 1.5 kb if the strain still has the catB gene, or about 900 bp if this gene is deleted.

(23) FIG. 17: Growth of strains C. beijerinckii DSM 6423 WT and ?catB on 2YTG medium and 2YTG thiamphenicol selective medium.

(24) FIG. 18: Induction of the CRISPR/Cas9acr system in transformants of strain C. beijerinckii DSM 6423 containing pCas9.sub.acr and an expression plasmid for the gRNA targeting upp, with or without repair matrix. Legend: Em, erythromycin; Tm, thiamphenicol; aTc, anhydrotetracycline; ND, not diluted.

(25) FIG. 19: FIG. 19A shows the modification of the upp locus of C. beijerinckii DSM 6423 via the CRISPR/Cas9 system. FIG. 19A shows the genetic organization of the upp locus: genes, gRNA target site and repair matrices, associated with the corresponding regions of homology on genomic DNA. The hybridization sites of the primers for PCR verification (RH010 and RH011) are also indicated.

(26) FIG. 19B shows the modification of the upp locus of C. beijerinckii DSM 6423 via the CRISPR/Cas9 system. FIG. 19B shows the amplification of the upp locus using primers RH010 and RH011. An amplification of 1680 bp is expected in the case of a wild-type gene, compared to 1090 bp for a modified upp gene. M, 100 bp-3 kb size marker (Lonza); WT, wild-type strain.

(27) FIG. 20: PCR amplification verifying the presence of plasmid pCas9.sub.ind. in strain C. beijerinckii 6423 ?catB.

(28) FIG. 21: PCR amplification (?900 bp) verifying the presence or absence of the natural pNF2 plasmid before induction (positive control 1 and 2) then after induction on medium containing aTc from the CRISPR-Cas9 system.

(29) FIG. 22: Genetic tool for modifying bacteria, adapted to bacteria of the genus Clostridium, based on the use of two plasmids (cf. WO2017/064439, Wasels et al., 2017).

(30) FIG. 23: pCas9ind-gRNA_catB plasmid map.

(31) FIG. 24: Transformation efficiency (in colonies observed per ?g of transformed DNA) for 20 ?g of pCas9.sub.ind plasmid in strain C. beijerinckii DSM6423. The error bars represent the standard error of the mean for a biological triplicate.

(32) FIG. 25: pNF3 plasmid map.

(33) FIG. 26: pEC751S plasmid map.

(34) FIG. 27: pNF3S plasmid map.

(35) FIG. 28: pNF3E plasmid map.

(36) FIG. 29: pNF3C plasmid map.

(37) FIG. 30: Transformation efficiency (in colonies observed per ?g of transformed DNA) of plasmid pCas9.sub.ind in three strains of C. beijerinckii DSM 6423. The error bars correspond to the standard deviation of the mean for a biological replicate.

(38) FIG. 31: Transformation efficiency (in colonies observed per ?g of transformed DNA) of plasmid pEC750C in two strains derived from C. beijerinckii DSM 6423. The error bars correspond to the standard deviation of the mean for a biological replicate.

(39) FIG. 32: Transformation efficiency (in colonies observed per ?g of transformed DNA) of plasmids pEC750C, pNF3C, pFW01 and pNF3E in strain C. beijerinckii DSM 6423?catB ?pNF2. The error bars correspond to the standard deviation of the mean for a biological triplicate.

(40) FIG. 33: Transformation efficiency (in colonies observed per ?g of transformed DNA) of plasmids pFW01, pNF3E and pNF3S in strain C. beijerinckii NCIMB 8052.

EXAMPLES

Example 1

(41) Materials and Methods

(42) Growing Conditions

(43) C. acetobutylicum DSM 792 was grown in 2YTG medium (16 g/l tryptone, 10 g/l yeast extract, 5 g/l glucose, 4 g/l NaCl). E. coli NEB10B was grown in LB medium (10 g/l tryptone, 5 g/l yeast extract, 5 g/l NaCl). The solid media were made by adding 15 g/l agarose to the liquid media. Erythromycin (at concentrations of 40 or 500 mg/l respectively in 2YTG or LB medium), chloramphenicol (25 or 12.5 mg/l respectively in solid or liquid LB) and thiamphenicol (15 mg/l in 2YTG medium) were used when necessary.

(44) Use of Nucleic Acids

(45) All enzymes and kits used were done so according to the suppliers' recommendations.

(46) Plasmid Construction

(47) The pCas9.sub.acr plasmid (SEQ ID NO: 23), shown in FIG. 4, was constructed by cloning the fragment (SEQ ID NO: 1) containing bgaR and acrIIA4 under the control of the Pbgal promoter synthesized by Eurofins Genomics at the SacI site of the pCas9.sub.ind vector (Wasels et al., 2017).

(48) The pGRNA.sub.ind plasmid (SEQ ID NO: 82) was constructed by cloning an expression cassette (SEQ ID NO: 83) for a gRNA under the control of promoter Pcm-2tetO1 (Dong et al., 2012) synthesized by Eurofins Genomics at the SacI site of the pEC750C vector (SEQ ID NO: 106) (Wasels et al., 2017).

(49) The pGRNA-xylB (SEQ ID NO: 102), pGRNA-xylR (SEQ ID NO: 103), pGRNA-glcG (SEQ ID NO: 104) and pGRNA-bdhB (SEQ ID NO: 105) plasmids were constructed by cloning the respective primer pairs 5-TCATGATTTCTCCATATTAGCTAG-3 (SEQ ID NO: 84) and 5-AAACCTAGCTAATATGGAGAAATC-3 (SEQ ID NO: 85), 5-TCATGTTACACTTGGAACAGGCGT-3 (SEQ ID NO: 86) and 5-AAACACGCCTGTTCCAAGTGTAAC-3 (SEQ ID NO: 87), 5-TCATTTCCGGCAGTAGGATCCCCA-3 (SEQ ID NO: 88) and 5-AAACTGGGGATCCTACTGCCGGAA-3 (SEQ ID NO: 89), 5-TCATGCTTATTACGACATAACACA-3 (SEQ ID NO: 90) and 5-AAACTGTGTTATGTCGTAATAAGC-3 (SEQ ID NO: 91) within the pGRNA.sub.ind plasmid (SEQ ID NO: 82) digested by BsaI.

(50) The pGRNA-?bdhB plasmid (SEQ ID NO: 79) was constructed by cloning the DNA fragment obtained by overlapping PCR assembly of the PCR products obtained with the primers 5-ATGCATGGATCCAAACGAACCCAAAAAGAAAGTTTC-3 (SEQ ID NO: 92) and 5-GGTTGATTTCAAATCTGTGTAAACCTACCG-3 (SEQ ID NO: 93) on the one hand, 5-ACACAGATTTGAAATCAACCACTTTAACCC-3 (SEQ ID NO: 94) and 5-ATGCATGTCGACTCTTAAGAACATGTATAAAGTATGG-3 (SEQ ID NO: 95) on the other hand, in the pGRNA-bdhB vector digested by BamHI and SacI.

(51) The pGRNA-?bdhA?bdhB plasmid (SEQ ID NO: 80) was constructed by cloning the DNA fragment obtained by overlapping PCR assembly of the PCR products obtained with the primers 5-ATGCATGGATCCAAACGAACCCAAAAAGAAAGTTTC-3 (SEQ ID NO: 96) and 5-GCTAAGTTTTAAATCTGTGTAAACCTACCG-3 (SEQ ID NO: 97) on the one hand, 5-ACACAGATTTAAAACTTAGCATACTTCTTACC-3 (SEQ ID NO: 98) and 5-ATGCATGTCGACCTTCTAATCTCCTCTACTATTTTAG-3 (SEQ ID NO: 99) on the other hand, in the pGRNA-bdhB vector digested by BamHI and SacI.

(52) Transformation

(53) C. acetobutylicum DSM 792 was transformed according to the protocol described by Mermelstein et al., 1993. The selection of C. acetobutylicum DSM 792 transformants already containing a Cas9 expression plasmid (pCas9.sub.ind or pCas9.sub.acr) transformed with a plasmid containing a gRNA expression cassette was performed on solid 2YTG medium containing erythromycin (40 mg/l), thiamphenicol (15 mg/l) and lactose (40 nM).

(54) Induction of Cas9 Expression

(55) The induction of cas9 expression was achieved through the growth of transformants obtained on a solid 2YTG medium containing erythromycin (40 mg/l), thiamphenicol (15 mg/l) and the inducer of expression of cas9 and of the gRNA, aTc (1 mg/l).

(56) Amplification of the Bdh Locus

(57) Verification of the editing of the C. acetobutylicum DSM 792 genome at the bdhA and bdhB gene locus was performed by PCR using the Q5? High-Fidelity DNA Polymerase (NEB) enzyme with primers V1 (5-ACACATTGAAGGGAGCTTTT-3, SEQ ID NO: 100) and V2 (5-GGCAACAACATCAGGCCTTT-3, SEQ ID NO: 101).

(58) Results

(59) Transformation Efficiency

(60) In order to evaluate the impact of the insertion of the acrIIA4 gene on the transformation frequency of the cas9 expression plasmid, different gRNA expression plasmids were transformed in strain DSM 792 containing pCas9.sub.ind (SEQ ID NO: 22) or pCas9.sub.acr(SEQ ID NO: 23), and the transformants were selected on a medium supplemented with lactose. The transformation frequencies obtained are presented in FIG. 5.

(61) Generation of ?bdhB and ?bdhA?bdhB Mutants

(62) The targeting plasmid containing the expression cassette for the gRNA targeting bdhB (pGRNA-bdhB-SEQ ID NO: 105) as well as two derived plasmids containing repair matrices allowing the deletion of the bdhB gene alone (pGRNA-AbdhB-SEQ ID NO: 79) or bdhA and bdhB genes (pGRNA-AbdhAAbdhB-SEQ ID NO: 80) were transformed in strain DSM 792 containing pCas9.sub.ind (SEQ ID NO: 22) or pCas9.sub.acr (SEQ ID NO: 23). The resulting transformation frequencies are presented in Table 2:

(63) TABLE-US-00002 TABLE 2 Transformation frequencies of strain DSM 792 containing pCas9.sub.ind or pCas9.sub.acr with plasmids targeting bdhB. Frequencies are expressed as the number of transformants obtained per ?g of DNA used in the transformation, and represent the means of at least two independent experiments. DSM 792 pCas9.sub.ind pCas9.sub.acr pEC750C 32.6 ? 27.1 cfu/?g 24.9 ? 27.8 cfu/?g pGRNA-bdhB 0 cfu/?g 17.0 ? 10.7 cfu/?g pGRNA-?bdhB 0 cfu/?g 13.3 ? 4.8 cfu/?g pGRNA-?bdhA?bdhB 0 cfu/?g 33.1 ? 13.4 cfu/?g

(64) The transformants obtained underwent a phase of induction of the expression of the CRISPR/Cas9 system via a passage on medium supplemented with anhydrotetracycline (aTc) (FIG. 6).

(65) The desired modifications were confirmed by PCR on the genomic DNA of two aTc-resistant colonies (FIG. 7).

(66) Conclusions

(67) The CRISPR/Cas9-based genetic tool described in Wasels et al. (2017) uses two plasmids:

(68) the first plasmid, pCas9.sub.ind, contains cas9 under the control of an aTc-inducible promoter, and

(69) the second plasmid, derived from pEC750C, contains the expression cassette for a gRNA (placed under the control of a second aTc-inducible promoter) as well as an editing template for repairing the double-stranded break induced by the system.

(70) However, the inventors observed that some gRNAs still appeared to be too toxic, despite the control of their expression as well as that of Cas9 using aTc-inducible promoters, thus limiting the efficiency of bacterial transformation by the genetic tool and thus the modification of the chromosome.

(71) In order to improve this genetic tool, the cas9 expression plasmid was modified, via the insertion of an anti-CRISPR gene, acrIIA4, under the control of a lactose-inducible promoter. The transformation efficiencies of different gRNA expression plasmids have thus been significantly improved, allowing transformants to be obtained for all plasmids tested.

(72) It was also possible to edit the bdhB locus within the C. acetobutylicum DSM 792 genome using plasmids that could not be introduced into strain DSM 792 containing pCas9.sub.ind. The modification frequencies observed are the same as those observed previously (Wasels et al., 2017), with 100% of the colonies tested modified.

(73) In conclusion, the modification of the cas9 expression plasmid allows better control of the Cas9-gRNA ribonucleoprotein complex, advantageously facilitating the production of transformants in which the action of Cas9 can be triggered in order to obtain mutants of interest.

Example 2

(74) Materials and Methods

(75) Growing Conditions

(76) C. beijerinckii DSM 6423 was grown in 2YTG medium (16 g/l tryptone, 10 g/l yeast extract, 5 g/l glucose, 4 g/l NaCl). E. coli NEB 10-beta and INV110 were grown in LB medium (10 g/l tryptone, 5 g/l yeast extract, 5 g/l NaCl). The solid media were prepared by adding 15 g/l agarose to the liquid media. Erythromycin (at concentrations of 20 or 500 mg/l respectively in 2YTG or LB medium), chloramphenicol (25 or 12.5 mg/l respectively in solid or liquid LB), thiamphenicol (15 mg/l in 2YTG medium) or spectinomycin (at concentrations of 100 or 650 mg/l respectively in LB or 2YTG medium) were used if necessary.

(77) Nucleic Acids and Plasmid Vectors

(78) All enzymes and kits used were used according to the suppliers' recommendations.

(79) The colony PCR tests followed the following protocol:

(80) An isolated C. beijerinckii DSM 6423 colony was resuspended in 100 ?L of 10 mM Tris, pH 7.5, 5 mM EDTA. This solution is heated to 98? C. for 10 min without agitation. 0.5 ?L of this bacterial lysate can then be used as a PCR matrix in 10 ?L reactions with Phire (Thermo Scientific), Phusion (Thermo Scientific), Q5 (NEB) or KAPA2G Robust (Sigma-Aldrich) polymerase.

(81) The list of primers used for all constructions (name/DNA sequence) is detailed below:

(82) TABLE-US-00003 ?catB_fwd: (SEQIDNO:1) TGTTATGGATTATAAGCGGCTCGAGGACGTCAAACCATGTTAATCATTGC ?catB_rev: (SEQIDNO:2) AATCTATCACTGATAGGGACTCGAGCAATTTCACCAAAGAATTCGCTAGC ?catB_gRNA_rev: (SEQIDNO:41) AATCTATCACTGATAGGGACTCGAGGGGCAAAAGTGTAAAGACAAGCTTC RH076: (SEQIDNO:3) CATATAATAAAAGGAAACCTCTTGATCG RH077: (SEQIDNO:4) ATTGCCAGCCTAACACTTGG RH001: (SEQIDNO:5) ATCTCCATGGACGCGTGACGTCGACATAAGGTACCAGGAATTAGAGCAGC RH002: (SEQIDNO:6) TCTATCTCCAGCTCTAGACCATTATTATTCCTCCAAGTTTGCT RH003: (SEQIDNO:7) ATAATGGTCTAGAGCTGGAGATAGATTATTTGGTACTAAG RH004: (SEQIDNO:8) TATGACCATGATTACGAATTCGAGCTCGAAGCGCTTATTATTGCATTAGC pEX-fwd: (SEQIDNO:9) CAGATTGTACTGAGAGTGCACC pEX-rev: (SEQIDNO:10) GTGAGCGGATAACAATTTCACAC pEC750C-fwd: (SEQIDNO:11) CAATATTCCACAATATTATATTATAAGCTAGC M13-rev: (SEQIDNO:12) CAGGAAACAGCTATGAC RH010: (SEQIDNO:13) CGGATATTGCATTACCAGTAGC RH011: (SEQIDNO:14) TTATCAATCTCTTACACATGGAGC RH025: (SEQIDNO:15) TAGTATGCCGCCATTATTACGACA RH134: (SEQIDNO:16) GTCGACGTGGAATTGTGAGC pNF2_fwd: (SEQIDNO:39) GGGCGCACTTATACACCACC pNF2_rev: (SEQIDNO:40) TGCTACGCACCCCCTAAAGG RH021: (SEQIDNO:107) ACTTGGGTCGACCACGATAAAACAAGGTTTTAAGG RH022: (SEQIDNO:108) TACCAGGGATCCGTATTAATGTAACTATGATATCAATTCTTG aad9-fwd2: (SEQIDNO:109) ATGCATGGTCCCAATGAATAGGTTTACACTTACTTTAGTTTTATGG aad9-rev: (SEQIDNO:110) ATGCGAGTTAACAACTTCTAAAATCTGATTACCAATTAG RH031: (SEQIDNO:111) ATGCATGGATCCCAATGAATAGGTTTACACTTACTTTAGTTTTATGG RH032: (SEQIDNO:112) ATGCGAGAGCTCAACTTCTAAAATCTGATTACCAATTAG RH138: (SEQIDNO:113) ATGCATGGATCCGTCTGACAGTTACCAGGTCC RH139: (SEQIDNO:114) ATGCGAGAGCTCCAATTGTTCAAAAAAATAATGGCGGAG RH140: (SEQIDNO:115) ATGCATGGATCCCGGCAGTTTTTCTTTTTCGG RH141: (SEQIDNO:116) ATGCGAGAGCTCGGTTAAATACTAGTTTTTAGTTACAGAC

(83) The following plasmid vectors were prepared:

(84) Plasmid No. 1: pEX-A258-?catB (SEQ ID NO: 17)

(85) It contains the ?catB fragment of synthesized DNA cloned into plasmid pEX-A258. This ?catB fragment comprises i) an expression cassette for a guide RNA targeting the catB gene (chloramphenicol resistance gene encoding a chloramphenicol-O-acetyltransferase-SEQ ID NO: 18) from C. beijerinckii DSM6423 under the control of an anhydrotetracycline-inducible promoter (expression cassette: SEQ ID NO: 19), and ii) an editing matrix (SEQ ID NO: 20) comprising 400 homologous bp located upstream and downstream of the catB gene.

(86) Plasmid No. 2: pCas9ind-?catB (see FIG. 9 and SEQ ID NO: 21)

(87) It contains the ?catB fragment amplified by PCR (primers ?catB_fwd and ?catB_rev) and cloned into pCas9ind (described in patent application WO2017/064439-SEQ ID NO: 22) after digestion of the different DNA by the restriction enzyme XhoI.

(88) Plasmid No. 3: pCas9acr (see FIG. 10 and SEQ ID NO: 23)

(89) Plasmid No. 4: pEC750S-uppHR (see FIG. 11 and SEQ ID NO: 24)

(90) It contains a repair matrix (SEQ ID NO: 25) used for the deletion of the upp gene and consisting of two homologous DNA fragments upstream and downstream of the upp gene (respective sizes: 500 (SEQ ID NO: 26) and 377 (SEQ ID NO: 27) base pairs). The assembly was obtained using the Gibson cloning system (New England Biolabs, Gibson assembly Master Mix 2X). To that end, the upstream and downstream parts were amplified by PCR from the genomic DNA of strain DSM 6423 (see Mat?de Gerando et al., 2018 and accession number PRJEB11626 (see Worldwide Website: ebi.ac.uk/ena/data/view/PRJEB11626)) using the respective primers RH001/RH002 and RH003/RH004. These two fragments were then assembled in the previously linearized pEC750S by enzymatic restriction (SalI and SacI restriction enzymes).

(91) Plasmid No. 5: pEX-A2-gRNA-upp (see FIG. 12 and SEQ ID NO: 28)

(92) This plasmid comprises the gRNA-upp DNA fragment corresponding to an expression cassette (SEQ ID NO: 29) for a guide RNA targeting the upp gene (protospacer targeting upp (SEQ ID NO: 31)) under the control of a constitutive promoter (non-coding RNA of sequence SEQ ID NO: 30), inserted into a replication plasmid named pEX-A2.

(93) Plasmid No. 6: pEC750S-?upp (see FIG. 13 and SEQ ID NO: 32)

(94) It is based on plasmid pEC750S-uppHR (SEQ ID NO: 24) and additionally contains the DNA fragment containing an expression cassette for a guide RNA targeting the upp gene under the control of a constitutive promoter.

(95) This fragment was inserted into a pEX-A2, called pEX-A2-gRNA-upp. The insert was then amplified by PCR with primers pEX-fwd and pEX-rev, then digested with restriction enzymes XhoI and NcoI. Finally, this fragment was cloned by ligation into the pEC750S-uppHR first digested by the same restriction enzymes to obtain pEC750S-?upp.

(96) Plasmid No. 7: pEC750C-?upp (see FIG. 14 and SEQ ID NO: 33)

(97) The cassette with the guide RNA and the repair matrix were then amplified with primers pEC750C-fwd and M13-rev. The amplicon was digested by enzymatic restriction with the enzymes XhoI and SacI, then cloned by enzymatic ligation into pEC750C to obtain pEC750C-?upp.

(98) Plasmid No. 8: pGRNA-pNF2 (see FIG. 15 and SEQ ID NO: 34)

(99) This plasmid is based on pEC750C and contains an expression cassette for a guide RNA targeting plasmid pNF2 (SEQ ID NO: 118).

(100) Plasmid No. 9: pCas9ind-gRNA_catB (see FIG. 23 and SEQ ID NO: 38)

(101) It contains the sequence encoding the guide RNA targeting the catB locus amplified by PCR (primers ?catB_fwd and ?catBgRNA_rev) and cloned into pCas9ind (described in patent application WO2017/064439) after digestion of the different DNA by the restriction enzyme XhoI and ligation.

(102) Plasmid No. 10: pNF3 (see FIG. 25 and SEQ ID NO: 119)

(103) It contains a part of pNF2, including the origin of replication and a gene encoding a plasmid replication protein (CIBE_p20001), amplified with primers RH021 and RH022. This PCR product was then cloned at the SalI and BamHI restriction sites in plasmid pUC19 (SEQ ID NO: 117).

(104) Plasmid No. 11: pEC751S (see FIG. 26 and SEQ ID NO: 121)

(105) It contains all the elements of pEC750C (SEQ ID NO: 106), except the chloramphenicol resistance gene catP (SEQ ID NO: 70). The latter was replaced by the aad9 gene of Enterococcus faecalis (SEQ ID NO: 130), which confers resistance to spectinomycin. This element was amplified with primers aad9-fwd2 and aad9-rev from plasmid pMTL007S-E1 (SEQ ID NO: 120) and cloned into the AvaII and HpaI sites of pEC750C, instead of the catP gene (SEQ ID NO: 70).

(106) Plasmid No. 12: pNF3S (see FIG. 27 and SEQ ID NO: 123)

(107) It contains all the elements of pNF3, with an insertion of the aad9 gene (amplified with primers RH031 and RH032 from pEC751S) between the BamHI and SacI sites.

(108) Plasmid No. 13: pNF3E (see FIG. 28 and SEQ ID NO: 124)

(109) It contains all the elements of pNF3, with an insertion of the ermB gene of Clostridium difficile (SEQ ID NO: 131) under the control of the miniPthl promoter. This element was amplified from pFW01 with primers RH138 and RH139 and cloned between the BamHI and SacI sites of pNF3E.

(110) Plasmid No. 14: pNF3C (see FIG. 29 and SEQ ID NO: 125)

(111) It contains all the elements of pNF3, with an insertion of the catP gene of Clostridium perfringens (SEQ ID NO: 70). This element was amplified from pEC750C with primers RH140 and RH141 and cloned between the BamHI and SacI sites of pNF3E.

(112) Results No. 1

(113) Processing of Strain C. beijerinckii DSM 6423

(114) The plasmids were introduced and replicated in an E. coli dam.sup.? dcm.sup.? strain (INV110, Invitrogen). This allows the removal of Dam and Dcm methylations on the pCas9ind-?catB plasmid before introducing it by transformation into strain DSM 6423 according to the protocol described by Mermelstein et al. (1993), with the following modifications: the strain is transformed with a larger amount of plasmid (20 ?g), with an OD.sub.600 of 0.8, and using the following electroporation parameters: 100 ?, 25 ?F, 1400 V. Streaking on Petri dishes containing erythromycin (20 ?g/mL) produced C. beijerinckii DSM 6423 transformants containing the pCas9ind-?catB plasmid.

(115) Induction of Cas9 Expression and Production of Strain C. beijerinckii DSM 6423 ?catB

(116) Several erythromycin-resistant colonies were then taken up in 100 ?L of culture medium (2YTG) and diluted in series up to a dilution factor of 10.sup.4 in culture medium. For each colony, 8 ?L of each dilution was deposited on a Petri dish containing erythromycin and anhydrotetracycline (200 ng/mL) to induce expression of the gene encoding the Cas9 nuclease.

(117) After extraction of genomic DNA, the deletion of the catB gene in the clones grown on this dish was verified by PCR, using primers RH076 and RH077 (see FIG. 16).

(118) Verification of the Sensitivity to Thiamphenicol of Strain C. beijerinckii DSM 6423 ?catB

(119) To ensure that the deletion of the catB gene indeed confers a new sensitivity to thiamphenicol, comparative analyses on agar medium were carried out. Precultures of C. beijerinckii DSM 6423 and C. beijerinckii DSM 6423 ?catB were prepared on 2YTG medium and then 100 ?L of these precultures was spread on 2YTG agar media optionally supplemented with thiamphenicol at a concentration of 15 mg/L. FIG. 17 shows that only the initial C. beijerinckii DSM 6423 strain is capable of growing on a thiamphenicol supplemented medium.

(120) Deletion of the Upp Gene by the CRISPR-Cas9 Tool in Strain C. beijerinckii DSM 6423 ?catB

(121) A clone of strain C. beijerinckii DSM 6423 ?catB was first transformed with the pCas9.sub.acr vector not having methylation at the motifs recognized by dam and dcm methyltransferases (prepared from an Escherichia coli bacterium with the dam.sup.? dcm.sup.? genotype). The verification of the presence of plasmid pCas9.sub.acr maintained in strain C. beijerinckii DSM 6423 was verified by colony PCR with primers RH025 and RH134.

(122) An erythromycin-resistant clone was then transformed with pEC750C-?upp demethylated beforehand. The colonies thus obtained were selected on medium containing erythromycin (20 ?g/mL), thiamphenicol (15 ?g/mL) and lactose (40 mM).

(123) Several of these clones were then resuspended in 100 ?L of culture medium (2YTG) and diluted in series in culture medium (to a dilution factor of 10.sup.4). Five microliters of each dilution was placed on a Petri dish containing erythromycin, thiamphenicol and anhydrotetracycline (200 ng/mL) (see FIG. 18).

(124) For each clone, two aTc-resistant colonies were tested by colony PCR with primers to amplify the upp locus (see FIG. 19).

(125) Deletion of the Natural pNF2 Plasmid by the CRISPR-Cas9 Tool in Strain C. beijerinckii DSM 6423 ?catB

(126) A clone of strain C. beijerinckii DSM 6423 ?catB was first transformed with vector pCas9.sub.ind not having methylation at the motifs recognized by Dam and Dcm methyltransferases (prepared from an Escherichia coli bacterium having the dam.sup.? dcm genotype). The presence of plasmid pCas9.sub.ind in strain C. beijerinckii DSM6423 was verified by PCR with primers pCas9.sub.ind_fwd (SEQ ID NO: 42) and pCas9.sub.ind_rev (SEQ ID NO: 43) (see FIG. 20).

(127) An erythromycin-resistant clone was then used to transform pGRNA-pNF2, prepared from an Escherichia coli bacterium having the dam.sup.? dcm.sup.? genotype.

(128) Several colonies obtained on media containing erythromycin (20 ?g/mL) and thiamphenicol (15 ?g/mL) were resuspended in culture media and diluted in series to a dilution factor of 10.sup.4. Eight microliters of each dilution were placed on a Petri dish containing erythromycin, thiamphenicol and anhydrotetracycline (200 ng/mL) in order to induce expression of the CRISPR/Cas9 system.

(129) The absence of the natural pNF2 plasmid was verified by PCR with primers pNF2_fwd (SEQ ID NO: 39) and pNF2_rev (SEQ ID NO: 40) (see FIG. 21).

(130) Conclusions

(131) During this work, the inventors succeeded in introducing and maintaining different plasmids within strain Clostridium beijerinckii DSM 6423. They were able to remove the catB gene using a CRISPR-Cas9 tool based on the use of a single plasmid. The sensitivity to thiamphenicol of the recombinant strains obtained was confirmed by tests on agar media.

(132) This deletion allowed them to use more effectively the CRISPR-Cas9 tool requiring two plasmids described in patent application FR1854835. Two examples were carried out to demonstrate the interest of the present application: the deletion of the upp gene and the removal of a natural plasmid not essential for strain Clostridium beijerinckii DSM 6423.

(133) Results No. 2

(134) Transformation of C. beijerinckii Strains

(135) The plasmids prepared in strain E. coli NEB 10-beta are also used to transform strain C. beijerinckii NCIMB 8052. In contrast, for C. beijerinckii DSM 6423, the plasmids are first introduced and replicated in an E. coli dam.sup.? dcm.sup.? strain (INV110, Invitrogen). This allows the removal of Dam and Dcm methylations on the plasmids of interest before their introduction by transformation into strain DSM 6423.

(136) Transformation is otherwise carried out similarly for each strain, i.e. according to the protocol described by Mermelstein et al. 1992, with the following modifications: the strain is transformed with a larger amount of plasmid (5-20 ?g), with an OD.sub.600 of 0.6-0.8, and the electroporation parameters are 100 ?, 25 ?F, 1400 V. After 3 hours of regeneration in 2YTG, the bacteria are streaked on a Petri dish (2YTG agar) containing the desired antibiotic (erythromycin: 20-40 ?g/mL; thiamphenicol: 15 ?g/mL; spectinomycin: 650 ?g/mL).

(137) Comparison of Transformation Efficiencies of C. beijerinckii DSM 6423 Strains

(138) Transformations were carried out in biological replicates in the following C. beijerinckii strains: DSM 6423 wild-type, DSM 6423 ?catB and DSM 6423 ?catB ?pNF2 (FIG. 30). To that end, the pCas9.sub.ind vector, which is notably difficult to use to modify a bacterium because it does not allow good transformation efficiencies, was used. It also contains a gene that gives the strain resistance to erythromycin, an antibiotic to which all three strains are sensitive.

(139) The results indicate an increase in transformation efficiency by a factor of about 15-20 due to the loss of the natural pNF2 plasmid.

(140) Transformation efficiency was also tested for plasmid pEC750C, which confers thiamphenicol resistance, only in strains DSM 6423 ?catB and DSM 6423 ?catB ?pNF2, since the wild-type strain is resistant to this antibiotic (FIG. 31). For this plasmid, the gain in transformation efficiency is even more obvious (improvement by a factor of about 2000).

(141) Comparison of the Transformation Efficiencies of pNF3 Plasmids with Other Plasmids

(142) In order to determine the transformation efficiency of plasmids containing the origin of replication of the natural pNF2 plasmid, plasmids pNF3E and pNF3C were introduced into strain C. beijerinckii DSM 6423 ?catB ?pNF2. The use of vectors containing erythromycin or chloramphenicol resistance genes allows the transformation efficiency of the vector to be compared according to the nature of the resistance gene. Plasmids pFW01 and pEC750C were also transformed. These two plasmids contain resistance genes to different antibiotics (erythromycin and thiamphenicol respectively) and are commonly used to transform C. beijerinckii and C. acetobutylicum.

(143) As shown in FIG. 32, vectors based on pNF3 have excellent transformation efficiency, and are particularly suitable for use in C. beijerinckii DSM 6423 ?catB ?pNF2. In particular, pNF3E (which contains an erythromycin resistance gene) shows a significantly higher transformation efficiency than pFW01, which has the same resistance gene. This same plasmid could not be introduced into the wild-type C. beijerinckii DSM 6423 strain (0 colonies obtained with 5 ?g of plasmids transformed into biological replicates), which demonstrates the impact of the presence of the natural pNF2 plasmid.

(144) Verification of the Transformability of pNF3 Plasmids in Other Strains/Species

(145) To illustrate the possibility of using this new plasmid in other solventogenic Clostridium strains, the inventors performed a comparative analysis of the transformation efficiencies of plasmids pFW01, pNF3E and pNF3S in the ABE strain C. beijerinckii NCIMB 8052 (FIG. 33). As strain NCIMB 8052 is naturally resistant to thiamphenicol, pNF3S, conferring resistance to spectinomycin, was used in place of pNF3C.

(146) The results show that strain NCIMB 8052 is transformable with plasmids based on pNF3, which proves that these vectors are applicable to the species C. beijerinckii in the broad sense.

(147) The applicability of the suite of synthetic vectors based on pNF3 was also tested in the reference strain C. acetobutylicum DSM 792. A transformation test thus showed the possibility of transforming this strain with plasmid pNF3C (transformation efficiency of 3 colonies observed per ?g of transformed DNA compared to 120 colonies/?g for plasmid pEC750C).

(148) Verification of the Compatibility of pNF3 Plasmids with the Genetic Tool Described in Application FR18/73492

(149) Patent application FR18/73492 describes the ?catB strain and the use of a two-plasmid CRISPR/Cas9 system requiring the use of an erythromycin resistance gene and a thiamphenicol resistance gene. To demonstrate the interest of the new suite of pNF3 plasmids, vector pNF3C was transformed in strain ?catB already containing the pCas9.sub.acr plasmid. The transformation, performed in duplicate, showed a transformation efficiency of 0.625?0.125 colonies/?g DNA (mean?standard error), which proves that a vector based on pNF3C can be used in combination with pCas9.sub.acr in the ?catB strain.

(150) In parallel with these results, part of plasmid pNF2 comprising its origin of replication (SEQ ID NO: 118) could be successfully reused to create a new suite of shuttle vectors (SEQ ID NO: 119, 123, 124 and 125), modifiable as desired, allowing in particular their replication in an E. coli strain as well as their reintroduction into C. beijerinckii DSM 6423. These new vectors have advantageous transformation efficiencies for genetic editing, for example in C. beijerinckii DSM 6423 and its derivatives, in particular using the CRISPR/Cas9 tool comprising two different nucleic acids.

(151) These new vectors have also been successfully tested in another C. beijerinckii strain (NCIMB 8052), and Clostridium species (in particular C. acetobutylicum), demonstrating their applicability in other organisms of the phylum Firmicutes. A test is also performed on Bacillus.

(152) Conclusions

(153) These results show that suppression of the natural pNF2 plasmid significantly increases the transformation frequencies of the bacteria that contained it (by a factor of about 15 for pFW01 and a factor of about 2000 for pEC750C). This result is particularly interesting in the case of bacteria of the genus Clostridium, known to be difficult to transform, and in particular for strain C. beijerinckii DSM 6423 which naturally suffers from a low transformation efficiency (less than 5 colonies/?g plasmid).

REFERENCES

(154) Banerjee, A., Leang, C., Ueki, T., Nevin, K. P., & Lovley, D. R. (2014). Lactose-inducible system for metabolic engineering of Clostridium ljungdahlii. Applied and environmental microbiology, 80(8), 2410-2416. Chen J.-S., Hiu S. F. (1986) Acetone-butanol-isopropanol production by Clostridium beijerinckii (synonym, Clostridium butylicum). Biotechnol. Lett. 8:371-376. Cui, L., & Bikard, D. (2016). Consequences of Cas9 cleavage in the chromosome of Escherichia coli. Nucleic acids research, 44(9), 4243-4251. Currie, D. H., Herring, C. D., Guss, A. M., Olson, D. G., Hogsett, D. A., & Lynd, L. R. (2013). Functional heterologous expression of an engineered full length CipA from Clostridium thermocellum in Thermoanaerobacterium saccharolyticum. Biotechnology for biofuels, 6(1), 32. DiCarlo, J. E., Norville, J. E., Mali, P., Rios, X., Aach, J., & Church, G. M. (2013). Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic acids research, 41(7), 4336-4343. Dong, H., Tao, W., Zhang, Y., & Li, Y. (2012). Development of an anhydrotetracycline-inducible gene expression system for solvent-producing Clostridium acetobutylicum: A useful tool for strain engineering. Metabolic engineering, 14(1), 59-67. Dong, D., Guo, M., Wang, S., Zhu, Y., Wang, S., Xiong, Z., & Huang, Z. (2017). Structural basis of CRISPR-SpyCas9 inhibition by an anti-CRISPR protein. Nature, 546(7658), 436. Dupuy, B., Mani, N., Katayama, S., & Sonenshein, A. L. (2005). Transcription activation of a UV-inducible Clostridium perfringens bacteriocin gene by a novel a factor. Molecular microbiology, 55(4), 1196-1206. Egholm, M., Buchardt, O., Nielsen, P. E., & Berg, R. H. (1992). Peptide nucleic acids (PNA). Oligonucleotide analogs with an achiral peptide backbone. Journal of the American Chemical Society, 114(5), 1895-1897. Fonfara, I., Le Rhun, A., Chylinski, K., Makarova, K. S., Lecrivain, A. L., Bzdrenga, J., & Charpentier, E. (2013). Phylogeny of Cas9 determines functional exchangeability of dual-RNA and Cas9 among orthologous type II CRISPR-Cas systems. Nucleic acids research, 42(4), 2577-2590. Garcia-Doval C, Jinek M. Molecular architectures and mechanisms of Class 2 CRISPR-associated nucleases. Curr Opin Struct Biol. 2017 December; 47:157-166. doi: 10.1016/j.sbi.2017.10.015 Ajouter au projet Citavi par DOI. Epub 2017 Nov. 3. Review. George H. A., Johnson J. L., Moore W. E. C., Holdeman, L. V., Chen J. S. (1983) Acetone, Isopropanol, and Butanol Production by Clostridium beijerinckii (syn. Clostridium butylicum) and Clostridium aurantibutyricum. Appl. Env. Microbiol. 45:1160-1163. Gonzales y Tucker R D, Frazee B. View from the front lines: an emergency medicine perspective on clostridial infections in injection drug users. Anaerobe. 2014 December; 30:108-15. Hartman, A. H., Liu, H., & Melville, S. B. (2011). Construction and characterization of a lactose-inducible promoter system for controlled gene expression in Clostridium perfringens. Applied and environmental microbiology, 77(2), 471-478. Heap, J. T., Ehsaan, M., Cooksley, C. M., Ng, Y. K., Cartman, S. T., Winzer, K., & Minton, N. P. (2012). Integration of DNA into bacterial chromosomes from plasmids without a counter-selection marker. Nucleic acids research, 40(8), e59-e59. Heap, J. T., Kuehne, S. A., Ehsaan, M., Cartman, S. T., Cooksley, C. M., Scott, J. C., & Minton, N. P. (2010). The ClosTron: mutagenesis in Clostridium refined and streamlined. Journal of microbiological methods, 80(1), 49-55. Heap, J. T., Pennington, O. J., Cartman, S. T., Carter, G. P., & Minton, N. P. (2007). The ClosTron: a universal gene knock-out system for the genus Clostridium. Journal of microbiological methods, 70(3), 452-464. Heap, J. T., Pennington, O. J., Cartman, S. T., & Minton, N. P. (2009). A modular system for Clostridium shuttle plasmids. Journal of microbiological methods, 78(1), 79-85. Hidalgo-Cantabrana, C., O'Flaherty, S., & Barrangou, R. (2017). CRISPR-based engineering of next-generation lactic acid bacteria. Current opinion in microbiology, 37, 79-87. Hiu S. F., Zhu C.-X., Yan R.-T., Chen J.-S. (1987) Butanol-ethanol dehydrogenase and butanol-ethanol-isopropanol dehydrogenase: different alcohol dehydrogenases in two strains of Clostridium beijerinckii (Clostridium butylicum). Appl. Env. Microbiol. 53:697-703. Huang, H., Chai, C., Li, N., Rowe, P., Minton, N. P., Yang, S., & Gu, Y. (2016). CRISPR/Cas9-based efficient genome editing in Clostridium ljungdahlii, an autotrophic gas-fermenting bacterium. ACS synthetic biology, 5(12), 1355-1361. Huggins, A. S., Bannam, T. L. and Rood, J. I. (1992) Comparative sequence analysis of the catB gene from Clostridium butyricum. Antimicrob. Agents Chemother. 36, 2548-2551. Ismaiel A. A., Zhu C. X., Colby G. D., Chen, J. S. (1993). Purification and characterization of a primary-secondary alcohol dehydrogenase from two strains of Clostridium beijerinckii. J. Bacteriol. 175:5097-5105. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337(6096), 816-821. Jones D. T., Woods D. R. (1986) Acetone-butanol fermentation revisited. Microbiological Reviews 50:484-524. Kolek J., Sedlar K., Provaznik I., Patakova P. (2016). Dam and Dcm methylations prevent gene transfer into Clostridium pasteurianum NRRL B-598: development of methods for electrotransformation, conjugation, and sonoporation. Biotechnol Biofuels. 9:14. Li, Q., Chen, J., Minton, N. P., Zhang, Y., Wen, Z., Liu, J., & Gu, Y. (2016). CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnology journal, 11(7), 961-972. Makarova, K. S., Haft, D. H., Barrangou, R., Brouns, S. J., Charpentier, E., Horvath, P., & Van Der Oost, J. (2011). Evolution and classification of the CRISPR-Cas systems. Nature Reviews Microbiology, 9(6), 467. Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., & Horvath, P. (2015). An updated evolutionary classification of CRISPR-Cas systems. Nature Reviews Microbiology, 13(11), 722. Marino, N. D., Zhang, J. Y., Borges, A. L., Sousa, A. A., Leon, L. M., Rauch, B. J., & Bondy-Denomy, J. (2018). Discovery of widespread type I and type V CRISPR-Cas inhibitors. Science, 362(6411), 240-242. M?t? de G?rando, H., Wasels, F., Bisson, A., Clement, B., Bidard, F., Jourdier E., Lopez-Contreras A., Lopes Ferreira N. (2018). Genome and transcriptome of the natural isopropanol producer Clostridium beijerinckii DSM 6423. BMC genomics. 19:242. Mearls, E. B., Olson, D. G., Herring, C. D., & Lynd, L. R. (2015). Development of a regulatable plasmid-based gene expression system for Clostridium thermocellum. Applied microbiology and biotechnology, 99(18), 7589-7599. Mermelstein, L. D., & Papoutsakis, E. T. (1993). In vivo methylation in Escherichia coli by the Bacillus subtilis phage phi 3T I methyltransferase to protect plasmids from restriction upon transformation of Clostridium acetobutylicum ATCC 824. Applied and environmental microbiology, 59(4), 1077-1081. Mermelstein L. D., Welker N. E., Bennett G. N., Papoutsakis E. T. (1992). Expression of cloned homologous fermentative genes in Clostridium acetobutylicum ATCC 824 10:190-195. Mermelstein L. D., Welker N. E., Bennett G. N., Papoutsakis E. T. (1993). Expression of cloned homologous fermentative genes in Clostridium acetobutylicum ATCC 824 10:190-195. Moon H G, Jang Y S, Cho C, Lee J, Binkley R, Lee S Y. One hundred years of clostridial butanol fermentation. FEMS Microbiol Lett. 2016 February; 363(3). Nagaraju, S., Davies, N. K., Walker, D. J. F., K?pke, M., & Simpson, S. D. (2016). Genome editing of Clostridium autoethanogenum using CRISPR/Cas9. Biotechnology for biofuels, 9(1), 219. Nariya, H., Miyata, S., Kuwahara, T., & Okabe, A. (2011). Development and characterization of a xylose-inducible gene expression system for Clostridium perfringens. Applied and environmental microbiology, 77(23), 8439-8441. Newcomb, M., Millen, J., Chen, C. Y., & Wu, J. D. (2011). Co-transcription of the celC gene cluster in Clostridium thermocellum. Applied microbiology and biotechnology, 90(2), 625-634. Pawluk, A., Davidson, A. R., & Maxwell, K. L. (2018). Anti-CRISPR: Discovery, mechanism and function. Nature Reviews Microbiology, 16(1), 12. Poehlein A., Solano J. D. M., Flitsch S. K., Krabben P., Winzer K., Reid S. J., Jones D. T., Green E., Minton N. P., Daniel R., D?rre P. (2017). Microbial solvent formation revisited by comparative genome analysis. Biotechnol Biofuels. 10:58. Pyne, M. E., Bruder, M. R., Moo-Young, M., Chung, D. A., & Chou, C. P. (2016). Harnessing heterologous and endogenous CRISPR-Cas machineries for efficient markerless genome editing in Clostridium. Scientific reports, 6. Rauch, B. J., Silvis, M. R., Hultquist, J. F., Waters, C. S., McGregor, M. J., Krogan, N. J., & Bondy-Denomy, J. (2017). Inhibition of CRISPR-Cas9 with bacteriophage proteins. Cell, 168(1-2), 150-158. Rajewska M., Wegrzyn K, Konieczny I., FEMS Microbiol Rev. 2012 March; 36(2). AT-rich region and repeated sequencesthe essential elements of replication origins of bacterial replicons:408-34. Ransom, E. M., Ellermeier, C. D., & Weiss, D. S. (2015). Use of mCherry red fluorescent protein for studies of protein localization and gene expression in Clostridium difficile. Applied and environmental microbiology, 81(5), 1652-1660. Rogers P., Chen J.-S., Zidwick M. (2006) in The prokaryotes. 3rd edition, Vol. 1, edited by Dworkin M (Springer, New York, USA, 2006). 3rd edition, Vol. 1, pp. 672-755. Schwarz S, Kehrenberg C, Doublet B, Cloeckaert A. Molecular basis of bacterial resistance to chloramph?nicol and florfenicol. FEMS Microbiol Rev. 2004 November; 28(5):519-42. Stella S, Alc?n P, Montoya G. Class 2 CRISPR-Cas RNA-guided endonucleases: Swiss Army knives of genome editing. Nat Struct Mol Biol. 2017 November; 24(11):882-892. doi: 10.1038/nsmb.3486. Wang, S., Dong, S., Wang, P., Tao, Y., & Wang, Y. (2017). Genome Editing in Clostridium saccharoperbutylacetonicum N1-4 with the CRISPR-Cas9 System. Applied and Environmental Microbiology, 83(10), e00233-17. Wang Y, Li X, Milne C B, et al. Development of a gene knockout system using mobile group II introns (Targetron) and genetic disruption of acid production pathways in Clostridium beijerinckii. Appl Environ Microbiol. 2013; 79(19): 5853-63. Wang, Y., Zhang, Z. T., Seo, S. O., Choi, K., Lu, T., Jin, Y. S., & Blaschek, H. P. (2015). Markerless chromosomal gene deletion in Clostridium beijerinckii using CRISPR/Cas9 system. Journal of biotechnology, 200, 1-5. Wang, Y., Zhang, Z. T., Seo, S. O., Lynn, P., Lu, T., Jin, Y. S., & Blaschek, H. P. (2016). Bacterial genome editing with CRISPR-Cas9: deletion, Integration, single nucleotide modification, and desirable clean mutant selection in Clostridium beijerinckii as an example. ACS synthetic biology, 5(7), 721-732. Wasels, F., Jean-Marie, J., Collas, F., L?pez-Contreras, A. M., & Ferreira, N. L. (2017 September). A two-plasmid inducible CRISPR/Cas9 genome editing tool for Clostridium acetobutylicum. Journal of microbiological methods, 140, 5-11. Xu, T., Li, Y., Shi, Z., Hemme, C. L., Li, Y., Zhu, Y., & Zhou, J. (2015). Efficient genome editing in Clostridium cellulolyticum via CRISPR-Cas9 nickase. Applied and environmental microbiology, 81(13), 4423-4431. Yadav, R., Kumar, V., Baweja, M., & Shukla, P. (2018). Gene editing and genetic engineering approaches for advanced probiotics: A Review. Critical reviews in food science and nutrition, 58(10), 1735-1746. Yue Chen, Bruce A. McClane, Derek J. Fisher, Julian I. Rood, Phalguni Gupta; Construction of an Alpha Toxin Gene Knockout Mutant of Clostridium perfringens Type A by Use of a Mobile Group II Intron; Appl. Environ. Microbiol. November 2005, 71 (11) 7542-7547; DOI: 10.1128/AEM.71.11.7542-7547.2005. Zhang, J., Liu, Y. J., Cui, G. Z., & Cui, Q. (2015). A novel arabinose-inducible genetic operation system developed for Clostridium cellulolyticum. Biotechnology for biofuels, 8(1), 36. Zhang C., Tinggang L. Jianzhong H. (2018) Characterization and genome analysis of a butanol-isopropanol-producing Clostridium beijerinckii strain BGS1. Biotechnol Biofuels (2018) 11:280. Zhong, J., Karberg, M., & Lambowitz, A. M. (2003). Targeted and random bacterial gene disruption using a group II intron (targetron) vector containing a retrotransposition-activated selectable marker. Nucleic acids research, 31(6), 1656-1664.