SiRNA conjugate, preparation method therefor and use thereof
11896674 ยท 2024-02-13
Assignee
Inventors
- Hongyan Zhang (Kunshan, CN)
- Shan Gao (Kunshan, CN)
- Daiwu Kang (Kunshan, CN)
- Gengrong Chen (Kunshan, CN)
Cpc classification
C12N2320/32
CHEMISTRY; METALLURGY
A61K47/56
HUMAN NECESSITIES
C12N2310/345
CHEMISTRY; METALLURGY
A61K47/549
HUMAN NECESSITIES
A61K47/555
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
An siRNA conjugate having a structure as represented by formula (1) for inhibiting hepatitis B vims gene expression, comprising siRNA and a conjugated group, wherein the sense strand of the siRNA comprises a nucleotide sequence 1, and the antisense strand comprises a nucleotide sequence 2; the nucleotide sequence 1 and the nucleotide sequence 2 are, at least in part, reversely complementary to form a double-stranded region; the nucleotide sequence 1 and SEQ ID NO: 1 are equal in length and differ by no more than three nucleotides; the nucleotide sequence 2 and SEQ ID NO: 2 are equal in length and differ by no more than three nucleotides. The siRNA conjugate can specifically target liver cells and effectively solve the problem of siRNA delivery in vivo, and shows excellent activity and low toxicity to inhibit HBV gene expression while maintaining high stability of siRNA.
Claims
1. A siRNA conjugate having the structure as shown by Formula (1): ##STR00104## wherein, n1 is an integer of 1-3, and n3 is an integer of 0-4, and n1+n32; m1, m2, and m3 independently of one another are an integer of 2-10; R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14 and R.sub.15 independently of one another are one of H, methyl or ethyl; R.sub.3 is a group having the structure as shown by Formula A59: ##STR00105## wherein E.sub.1 is OH, SH or BH.sub.2, and Nu is a siRNA; each nucleotide in the siRNA is independently a modified or unmodified nucleotide; the siRNA comprises a sense strand and an antisense strand; the sense strand comprises a nucleotide sequence 1, and the antisense strand comprises a nucleotide sequence 2; the nucleotide sequence 1 and nucleotide sequence 2 are at least partly reverse complementary to form a double-stranded region, wherein the nucleotide sequence 1 and the nucleotide sequence as shown by SEQ ID NO: 1 have an equal length and no more than 3 nucleotide differences, and the nucleotide sequence 2 and the nucleotide sequence as shown by SEQ ID NO: 2 have an equal length and no more than 3 nucleotide differences: TABLE-US-00020 (SEQIDNO:1) 5-GAAAGUAUGUCAACGAAUZ-3; (SEQIDNO:2) 5-ZAUUCGUUGACAUACUUUC-3; wherein, Z is U, Z is A; the nucleotide sequence 1 comprises a nucleotide Z.sub.A at the position corresponding to Z, the nucleotide sequence 2 comprises a nucleotide Z.sub.B at the position corresponding to Z, wherein the Z.sub.B is the first nucleotide at 5 terminal of the antisense strand; R.sub.2 is any group capable of linking to the N atom on the nitrogenous backbone and linking to A59; each L.sub.1 is independently selected from the linkage combinations of one or more of Formulae A1-A26: ##STR00106## ##STR00107## ##STR00108## wherein j1 is an integer of 1-20; j2 is an integer of 1-20; R is a C.sub.1-C.sub.10 alkyl; Ra is selected from one of Formulae A27-A45: ##STR00109## ##STR00110## ##STR00111## Rb is a C.sub.1-C.sub.10 alkyl; and represents the site where a group is covalently linked; each M.sub.1 is independently selected from one of the ligands that have affinity to the asialoglycoprotein receptors (ASGP-R) on the surface of mammalian hepatocytes.
2. The siRNA conjugate according to claim 1, wherein L.sub.1 is selected from the linkage combinations of one or more of Formulae A1, A4, A5, A6, A8, A10, A11, and A13.
3. The siRNA conjugate according to claim 1, wherein L.sub.1 has a length of 3 to 25 atoms.
4. The siRNA conjugate according to claim 1, wherein m1, m2 and m3 independently of one another are an integer of 2-5.
5. The siRNA conjugate according to claim 1, wherein each M.sub.1 is independently selected from the group consisting of D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, -D-mannofuranose, -D-mannofuranose, -D-mannopyranose, 3-D-mannopyranose, -D-glucopyranose, -D-glucopyranose, -D-glucofuranose, -D-glucofuranose, -D-fructofuranose, -D-fructopyranose, -D-galactopyranose, -D-galactopyranose, -D-galactofuranose, -D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O[(R)-1-carboxyethyl]-2-deoxy--D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl--neuraminic acid, 5-thio--D-glucopyranose, methyl 2,3,4-tris-O-acetyl-1-thio-6-O-trityl-a-D-glucopyranoside, 4-thio--D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-a-D-glucoheptopyranoside, 2,5-anhydro-D-allononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, and L-4-thioribose.
6. The siRNA conjugate according to claim 1, wherein R.sub.2 comprises both a site linking to the N atom on the nitrogenous backbone and a site linking to the P atom in R.sub.3; and wherein in R.sub.2, the site linking to the N atom on the nitrogenous backbone forms an amide bond with the N atom, and the site linking to the P atom in R.sub.3 forms a phosphoester bond with the P atom.
7. The siRNA conjugate according to claim 1, wherein the conjugate has a structure as shown by Formula (3), (4), (5), (6), (7), (8), (9), (10), (11), (12), (13), (14), (15), (16), (17), (18), (19), (20), (21), or (22): ##STR00112## ##STR00113## ##STR00114## ##STR00115## ##STR00116## ##STR00117## ##STR00118## ##STR00119##
8. The siRNA conjugate according to claim 1, wherein the P atom in Formula A59 is linked to 3 terminal of the sense strand of the siRNA.
9. The siRNA conjugate according to claim 1, wherein the nucleotide difference between the nucleotide sequence 2 and the nucleotide sequence shown in SEQ ID NO: 2 includes a difference at the position of Z.sub.B, wherein Z.sub.B is selected from U, C or G.
10. The siRNA conjugate according to claim 1, wherein the sense strand further comprises nucleotide sequence 3, and the antisense strand further comprises a nucleotide sequence 4; the nucleotide sequence 3 and the nucleotide sequence 4 have a length of 1-4 nucleotides, respectively; the nucleotide sequence 3 is linked to 5 terminal of the nucleotide sequence 1; and the nucleotide sequence 4 is linked to 3 terminal of the nucleotide sequence 2; the nucleotide sequence 3 and the nucleotide sequence 4 have an equal length and are substantially reverse complementary or completely reverse complementary to each other; and wherein the nucleotide sequence 3 and the nucleotide sequence 4 both have a length of 1 nucleotide and the base of the nucleotide sequence 3 is G; or alternatively, the nucleotide sequence3 and the nucleotide sequence 4 both have a length of 2 nucleotides; in the direction from 5 terminal to 3 terminal, the bases of the nucleotide sequence 3 are U and G in succession; or alternatively, the nucleotide sequence 3 and the nucleotide sequence 4 both have a length of 3 nucleotides; in the direction from 5 terminal to 3 terminal, the bases of the nucleotide sequence 3 are U, U and G in succession; or alternatively, the nucleotide sequence 3 and the nucleotide sequence 4 both have a length of 4 nucleotides; in the direction from 5 terminal to 3 terminal, the bases of the nucleotide sequence 3 are A, U, U, and G in succession.
11. The siRNA conjugate according to claim 1, wherein the siRNA further comprises a nucleotide sequence 5, which has a length of 1-3 nucleotides and is linked to 3 terminal of the antisense strand, thereby constituting a 3 overhang of the antisense strand; and wherein the nucleotide sequence 5 has a length of 2 nucleotides; and in the direction from 5 terminal to 3 terminal, the nucleotide sequence 5 is 2 consecutive thymidine deoxyribonucleotides, 2 consecutive uridine ribonucleotides, or 2 nucleotides complementary to the target mRNA.
12. The siRNA conjugate according to claim 1, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4; and the antisense strand comprises any nucleotide sequence selected from the group consisting of the nucleotide sequences shown in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8: TABLE-US-00021 (SEQIDNO:3) 5-GAAAGUAUGUCAACGAAUU-3, (SEQIDNO:4) 5-GAAAGUAUGUCAACGAAUA-3, (SEQIDNO:5) 5-AAUUCGUUGACAUACUUUCUU-3, (SEQIDNO:6) 5-AAUUCGUUGACAUACUUUCCA-3, (SEQIDNO:7) 5-UAUUCGUUGACAUACUUUCUU-3, (SEQIDNO:8) 5-UAUUCGUUGACAUACUUUCCA-3.
13. The siRNA conjugate according to claim 1, wherein the siRNA is any one of the following siP1 to siP4: TABLE-US-00022 SiP1 (SEQIDNO:3) Sensestrand:5-GAAAGUAUGUCAACGAAUU-3, (SEQIDNO:5) Antisensestrand:5-AAUUCGUUGACAUACUUUCUU-3, siP2 (SEQIDNO:3) Sensestrand:5-GAAAGUAUGUCAACGAAUU-3, (SEQIDNO:6) Antisensestrand:5-AAUUCGUUGACAUACUUUCCA-3, siP3 (SEQIDNO:4) Sensestrand:5-GAAAGUAUGUCAACGAAUA-3, (SEQIDNO:7) Antisensestrand:5-UAUUCGUUGACAUACUUUCUU-3, siP4 (SEQIDNO:4) Sensestrand:5-GAAAGUAUGUCAACGAAUA-3, (SEQIDNO:8) Antisensestrand:5-UAUUCGUUGACAUACUUUCCA-3.
14. The siRNA conjugate according to claim 1, wherein each nucleotide in the sense strand and the antisense strand is independently a fluoro modified nucleotide or a non-fluoro modified nucleotide; a fluoro modified nucleotide refers to a nucleotide formed by substituting the 2-hydroxy of the ribose group of the nucleotide with a fluoro; a non-fluoro modified nucleotide refers to a nucleotide formed by substituting the 2-hydroxy of the ribose group of the nucleotide with a group other than a fluoro, or a nucleotide analogue; wherein the fluoro modified nucleotides are located in the nucleotide sequence 1 and the nucleotide sequence 2; and in the direction from 5 terminal to 3 terminal, the nucleotides at positions 7, 8 and 9 in the nucleotide sequence 1 are fluoro modified nucleotides; in the direction from 5 terminal to 3 terminal, the nucleotides at positions 2, 6, 14 and 16 of the nucleotide sequence 2 are fluoro modified nucleotides.
15. The siRNA conjugate according to claim 14, wherein each non-fluoro modified nucleotide is a methoxy modified nucleotide, wherein the methoxy modified nucleotide refers to a nucleotide formed by substituting the 2-hydroxy of the ribose group with a methoxy group.
16. The siRNA conjugate according to claim 1, wherein the siRNA is any one of the following siRNAs: siHB1M1 Sense strand: GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO: 11) Antisense strand: AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm (SEQ ID NO: 13) siHB2M1 Sense strand: GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:11) Antisense strand: AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm (SEQ ID NO: 14) siHB3M1 Sense strand: GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO: 12) Antisense strand: UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm (SEQ ID NO: 15) siHB4M1 Sense strand: GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO: 12) Antisense strand: UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm (SEQ ID NO: 16) siHB1M2 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO: 17) Antisense strand: AmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmUmUm (SEQ ID NO: 19) siHB2M2 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO: 17) Antisense strand: AmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCmAm (SEQ ID NO: 20) siHB3M2 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO: 18) Antisense strand: UmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmUmUm (SEQ ID NO: 21) siHB4M2 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO: 18) Antisense strand: UmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCmAm (SEQ ID NO: 22) siHB1M3 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO: 17) Antisense strand: AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm (SEQ ID NO: 13) siHB2M3 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO: 17) Antisense strand: AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm (SEQ ID NO: 14) siHB3M3 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO: 18) Antisense strand: UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm (SEQ ID NO: 15) siHB4M3 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO: 18) Anti sense strand: UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm (SEQ ID NO: 16) siHB5M1 Sense strand: UmGmGmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO: 51) Anti sense strand: UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAmUmUm (SEQ ID NO: 52) siHB6M2 Sense strand: UmGmGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO: 51) Anti sense strand: UmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCmAmAmUm (SEQ ID NO: 53) siHB7M3 Sense strand: UmGmGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO: 54) Anti sense strand: AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAmUmUm (SEQ ID NO: 55).
17. The siRNA conjugate according to claim 1, wherein in the siRNA, at least one phosphate group is a phosphorothioate group, and at least one linkage selected from the group consisting of the following inter-nucleotide linkages is a phosphorothioate linkage: the linkage between the first and second nucleotides at 5 terminal of the sense strand; the linkage between the second and third nucleotides at 5 terminal of the sense strand; the linkage between the first and second nucleotides at 3 terminal of the sense strand; the linkage between the second and third nucleotides at 3 terminal of the sense strand; the linkage between the first and second nucleotides at 5 terminal of the antisense strand; the linkage between the second and third nucleotides at 5 terminal of the antisense strand; the linkage between the first and second nucleotides at 3 terminal of the antisense strand; and the linkage between the second and third nucleotides at 3 terminal of the antisense strand.
18. The siRNA conjugate according to claim 1, wherein the siRNA is any one of the following siRNAs: siHB1M1S Sense strand: GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO: 23) Antisense strand: AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsUmsUm (SEQ ID NO: 25) siHB2M1S Sense strand: GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO: 23) Antisense strand: AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsCmsAm (SEQ ID NO: 26) siHB3M1S Sense strand: GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO: 24) Antisense strand: UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsUmsUm (SEQ ID NO: 27) siHB4M1S Sense strand: GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO: 24) Antisense strand: UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsCmsAm (SEQ ID NO: 28) siHB1M2 S Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO: 29) Anti sense strand: AmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmsUmsUm (SEQ ID NO:31) siHB2M2S Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO: 29) Anti sense strand: AmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmsCmsAm (SEQ ID NO: 32) siHB3M2S Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:30) Anti sense strand: UmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmsUmsUm (SEQ ID NO:33) siHB4M2S Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:30) Anti sense strand: UmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmsCmsAm (SEQ ID NO:34) siHB1M3S Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:29) Anti sense strand: AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsUmsUm (SEQ ID NO:25) siHB2M3S Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:29) Anti sense strand: AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsCmsAm (SEQ ID NO:26) siHB3M3S Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:30) Anti sense strand: UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsUmsUm (SEQ ID NO:27) siHB4M3S Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:30) Anti sense strand: UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsCmsAm (SEQ ID NO:28) siHB5M1S Sense strand: UmsGmsGmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:56) Anti sense strand: UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAmUmsUm (SEQ ID NO:57) siHB6M2S Sense strand: UmsGmsGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:56) Anti sense strand: UmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCmAmsAmsUm (SEQ ID NO:58) siHB7M3S Sense strand: UmsGmsGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:59) Antisense strand: AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAmsUmsUm (SEQ ID NO:60).
19. The siRNA conjugate according to claim 1, wherein the nucleotide at 5-terminal in the antisense strand is a 5-phosphate nucleotide or a 5-phosphate analogue modified nucleotide, wherein 5-phosphate nucleotide or 5-phosphate analogue modified nucleotide has a structure as shown by one of Formula (202), (203), (204), (205) or (206): ##STR00120## Formula (203) Formula (204) Formula (205) Formula (206) wherein R represents a group selected from the group consisting of H, OH, F and methoxy, and Base represents a base selected from A, U, C, G, and T.
20. The siRNA conjugate according to claim 1, wherein the siRNA is any one of the following siRNAs: siHB1M1P1 Sense strand: GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:11) Antisense strand: P1-AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm (SEQ ID NO:35) siHB2M1P1 Sense strand: GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:11) Antisense strand: P1-AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm (SEQ ID NO:36) siHB3M1P1 Sense strand: GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:12) Antisense strand: P1-UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm (SEQ ID NO:37) siHB4M1P1 Sense strand: GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:12) Antisense strand: P1-UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm (SEQ ID NO:38) siHB1M2P1 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:17) Antisense strand: P1-AmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmUmUm (SEQ ID NO:39) siHB2M2P1 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:17) Antisense strand: P1-AmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCmAm (SEQ ID NO:40) siHB3M2P1 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:18) Antisense strand: P1-UmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmUmUm (SEQ ID NO:41) siHB4M2P1 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:18) Antisense strand: P1-UmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCmAm (SEQ ID NO:42) siHB1M3P1 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:17) Antisense strand: P1-AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm (SEQ ID NO:35) siHB2M3P1 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:17) Antisense strand: P1-AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm (SEQ ID NO:36) siHB3M3P1 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:18) Antisense strand: P1-UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm (SEQ ID NO:37) siHB4M3P1 Sense strand: GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:18) Antisense strand: P1-UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm (SEQ ID NO:38) siHB5M1P1 Sense strand: UmGmGmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:51) Antisense strand: P1-UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAmUmUm (SEQ ID NO:61) siHB6M2P1 Sense strand: UmGmGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:51) Antisense strand: P1-UmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCmAmAmUm (SEQ ID NO:62) SiHB7M3P1 Sense strand: UmGmGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:54) Antisense strand: P1-AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAmUmUm (SEQ ID NO:63) siHB1M1SP1 Sense strand: GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:23) Antisense strand: P1-AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsUmsUm (SEQ ID NO:43) siHB2M1SP1 Sense strand: GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:23) Antisense strand: P1-AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsCmsAm (SEQ ID NO:44) siHB3M1SP1 Sense strand: GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:24) Antisense strand: P1-UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsUmsUm (SEQ ID NO:45) siHB4M1SP1 Sense strand: GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:24) Antisense strand: P1-UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsCmsAm (SEQ ID NO:46) siHB1M2SP1 Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:29) Antisense strand: P1-AmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmsUmsUm (SEQ ID NO:47) siHB2M2SP1 Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:29) Antisense strand: P1-AmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmsCmsAm (SEQ ID NO:48) siHB3M2SP1 Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:30) Antisense strand: P1-UmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmsUmsUm (SEQ ID NO:49) siHB4M2SP1 Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:30) Anti sense strand: P1-UmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmsCmsAm (SEQ ID NO:50) siHB1M3SP1 Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:29) Anti sense strand: P1-AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsUmsUm (SEQ ID NO:43) siHB2M3SP1 Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:29) Anti sense strand: P1-AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsCmsAm (SEQ ID NO:44) siHB3M3SP1 Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:30) Anti sense strand: P1-UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsUmsUm (SEQ ID NO:45) siHB4M3SP1 Sense strand: GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:30) Anti sense strand: P1-UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsCmsAm (SEQ ID NO:46) siHB5M1SP1 Sense strand: UmsGmsGmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:56) Antisense strand: P1-UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAmsUmsUm (SEQ ID NO:64) siHB6M2SP1 Sense strand: UmsGmsGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm (SEQ ID NO:56) Antisense strand: P1-UmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCmAmsAmsUm (SEQ ID NO:65) siHB7M3SP1 Sense strand: UmsGmsGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm (SEQ ID NO:58) Antisense strand: P1-AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAmsUmsUm (SEQ ID NO:66).
21. A method for treating and/or preventing a pathological condition or disease caused by HBV infection, comprising administering to a patient an effective amount of the siRNA conjugate according to claim 1; wherein the pathological condition or disease caused by HBV infection is selected from one or more of chronic liver diseases, hepatitis, hepatic fibrosis, and liver proliferative diseases.
22. A method for inhibiting the expression of an HBV gene, comprising contacting an effective amount of the siRNA conjugate according to claim 1 with hepatitis cells infected with HBV.
23. The siRNA conjugate according to claim 2, wherein L.sub.1 is selected from the linkage combinations of at least two of Formulae A1, A4, A8, A10, and A11.
24. The siRNA conjugate according to claim 3, wherein L.sub.1 has a length of 4 to 15 atoms.
25. The siRNA conjugate according to claim 4, wherein m1=m2=m3.
26. The siRNA conjugate according to claim 6, wherein R.sub.2 is selected from B5, B6, B5, or B6: ##STR00121## wherein, represents the site where a group is covalently linked; and q.sub.2 is an integer of 1-10.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
DETAILED DESCRIPTION OF THE INVENTION
(8) The specific embodiments of the present disclosure are described in detail as below. It should be understood that the specific embodiments described herein are only for the purpose of illustration and explanation of the present disclosure and are not intended to limit the present disclosure in any manner.
(9) In the context of the present disclosure, HBV gene refers to the gene having a sequence as shown in Genbank Accession No. NC_003977.2. Accordingly, the target mRNA refers to the mRNA obtained by the transcription of HBV gene.
(10) In the context of the present disclosure, unless otherwise specified, C, G, U, A, and T represent the base composition of a nucleotide; d represents that the nucleotide adjacent to the right side of the letter d is a deoxyribonucleotide; m represents that the nucleotide adjacent to the left side of the letter m is a methoxy modified nucleotide; f represents that the nucleotide adjacent to the left side of the letter f is a fluoro modified nucleotide; s represents that the two nucleotides adjacent to both sides of the letter s are linked by a phosphorothioate linkage; P1 represents that the nucleotide adjacent to the right side of P1 is a 5-phosphate nucleotide or a 5-phosphate analogue modified nucleotide, especially a vinyl phosphate modified nucleotide (expressed as VP in the Examples below), a 5-phosphate nucleotide (expressed as P in the Examples below) or a 5-thiophosphate modified nucleotide (expressed as Ps in the Examples below).
(11) In the context of the present disclosure, a fluoro modified nucleotide refers to a nucleotide formed by substituting the 2-hydroxy of the ribose group of the nucleotide with a fluoro. A non-fluoro modified nucleotide refers to a nucleotide formed by substituting the 2-hydroxy of the ribose group of the nucleotide with a non-fluoro group, or a nucleotide analogue. A nucleotide analogue refers to a group that can replace a nucleotide in a nucleic acid, while structurally differs from an adenine ribonucleotide, a guanine ribonucleotide, a cytosine ribonucleotide, a uracil ribonucleotide or thymine deoxyribonucleotide, such as an isonucleotide, a bridged nucleic acid (BNA) nucleotide or an acyclic nucleotide. The methoxy modified nucleotide refers to a nucleotide formed by substituting the 2-hydroxy of the ribose group with a methoxy group.
(12) In the context of the present disclosure, expressions complementary and reverse complementary can be interchangeably used, and have a well-known meaning in the art, namely, the bases in one strand are complementarity paired with those in the other strand of a double-stranded nucleic acid molecule. In DNA, a purine base adenine (A) is always paired with a pyrimidine base thymine (T) (or uracil (U) in RNAs); and a purine base guanine (G) is always paired with a pyrimidine base cytosine (C). Each base pair comprises a purine and a pyrimidine. While adenines in one strand are always paired with thymines (or uracils) in another strand, and guanines are always paired with cytosines, the two strands are considered as being complementary to each other; and the sequence of a strand may be deduced from the sequence of its complementary strand. Correspondingly, a mispairing means that in a double-stranded nucleic acid, the bases at corresponding positions are not presented in a manner of being complementarity paired.
(13) In the context of the present disclosure, unless otherwise specified, basically reverse complementary means that there are no more than 3 base mispairings between two nucleotide sequences involved; substantially reverse complementary means that there is no more than 1 base mispairing between two nucleotide sequences; and completely complementary means that there is no base mispairing between two nucleotide sequences.
(14) In the context of the present disclosure, when a nucleotide sequence has nucleotide difference from another nucleotide sequence, the bases of the nucleotides at the same position therebetween are changed. For example, if a nucleotide base in the second sequence is A and the nucleotide base at the same position in the first sequence is U, C, G or T, the two nucleotide sequences are considered as having a nucleotide difference at this position. In some embodiments, if a nucleotide at a position is replaced with an abasic nucleotide or a nucleotide analogue, it is also considered that there is a nucleotide difference at the position.
(15) In the context of the present disclosure, particularly in the description of the method for preparing the conjugation molecule or the siRNA conjugate of the present disclosure, unless otherwise specified, the nucleoside monomer refers to, according to the type and sequence of the nucleotides in the siRNA or siRNA conjugate to be prepared, unmodified or modified RNA phosphoramidites used in a phosphoramidite solid phase synthesis (the RNA phosphoramidites are also referred to as nucleoside phosphoramidites sometimes). The phosphoramidite solid phase synthesis is a well-known method for RNA synthesis. Nucleoside monomers used in the present disclosure all are commercially available.
(16) In the context of the present disclosure, unless otherwise specified, conjugation refers to two or more chemical moieties each with specific function being linked to each other via a covalent linkage. Correspondingly, a conjugate refers to the compound formed by covalent linkage of individual chemical moieties. Further, a siRNA conjugate represents a compound formed by covalently attaching a siRNA and one or more chemical moieties each with specific functions. In this context, the siRNA conjugate of the present disclosure is sometimes abbreviated as conjugate. More specifically, in the context of the present disclosure, a conjugation molecule should be understood as a compound capable of being conjugated to a siRNA via a reaction, thereby finally forming the siRNA conjugate of the present disclosure.
(17) siRNA Conjugate
(18) In one embodiment, the present disclosure provides a siRNA conjugate which has the structure as shown by Formula (1):
(19) ##STR00017## wherein, n1 is an integer of 1-3, and n3 is an integer of 0-4; m1, m2, and m3 independently of one another are an integer of 2-10; R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14 and R.sub.15 independently of one another are one of H, methyl and ethyl; R.sub.3 is a group having the structure as shown by Formula A59:
(20) ##STR00018## wherein E.sub.1 is OH, SH or BH.sub.2, and Nu is a siRNA;
(21) In the siRNA, each nucleotide is independently a modified or unmodified nucleotide; the siRNA comprises a sense strand and an antisense strand; the sense strand comprises a nucleotide sequence 1, and the antisense strand comprises a nucleotide sequence 2; the nucleotide sequence 1 and the nucleotide sequence 2 are at least partly reverse complementary to form a double-stranded region, wherein the nucleotide sequence 1 and the nucleotide sequence as shown by SEQ ID NO: 1 have an equal length and no more than 3 nucleotide differences, or in some embodiments, no more than 1 nucleotide difference, and the nucleotide sequence 2 and the nucleotide sequence as shown by SEQ ID NO: 2 have an equal length and no more than 3 nucleotide differences, or in some embodiments, no more than 1 nucleotide difference:
(22) TABLE-US-00004 5-GAAAGUAUGUCAACGAAUZ-3; (SEQIDNO:1) 5-ZAUUCGUUGACAUACUUUC-3; (SEQIDNO:2) wherein, Z is U, Z is A; the nucleotide sequence 1 comprises a nucleotide Z.sub.A at the position corresponding to Z, the nucleotide sequence 2 comprises a nucleotide Z.sub.B at the position corresponding to Z, wherein the Z.sub.B is the first nucleotide at 5 terminal of the antisense strand. In this context, the term position correspondence means being at the same position in the nucleotide sequences when counting from the same terminals of the nucleotide sequences. For example, the first nucleotide at 3 terminal of the nucleotide sequence 1 is a nucleotide at the position corresponding to the first nucleotide at 3 terminal of SEQ ID NO: 1.
(23) R.sub.2 is any group capable of linking to the N atom on the nitrogenous backbone and linking to A59; each L.sub.1 is independently selected from the linkage combinations of one or more of Formulae A1-A26:
(24) ##STR00019## ##STR00020## ##STR00021## wherein j1 is an integer of 1-20; j2 is an integer of 1-20; R is a C.sub.1-C.sub.10 alkyl; Ra is selected from one of Formulae A27-A43:
(25) ##STR00022## ##STR00023## ##STR00024## Rb is a C.sub.1-C.sub.10 alkyl; and represents the site where a group is covalently linked; each M.sub.1 is independently selected from one of the ligands that have affinity to asialoglycoprotein receptors (ASGP-R) on the surface of mammalian hepatocytes.
(26) In some embodiments, n1 may be an integer of 1-3, and n3 may be an integer of 0-4 to ensure that the number of the M.sub.1 ligand in the conjugate is at least 2. In some embodiments, n1+n32, so that the number of the M.sub.1 ligand in the conjugate is at least 3, thereby allowing the M.sub.1 ligand to bind to the asialoglycoprotein receptors on the surface of hepatocytes more easily, which may further facilitate the endocytosis of the conjugate into cells. Experiments have shown that when the number of M.sub.1 ligand is greater than 3, the ease of binding the M.sub.1 ligand to the asialoglycoprotein receptors on the surface of hepatocytes is not significantly increased. Therefore, in view of various aspects such as the synthesis convenience, structure/process costs 13 and delivery efficiency, in some embodiments, n1 is an integer of 1-2, n3 is an integer of 0-1, and n1+n3=23.
(27) In some embodiments, when m1, m2, and m3 independently of one another are selected from an integer of 2-10, the steric positions among many M.sub.1 ligands may be suitable for the binding between the M.sub.1 ligands and the asialoglycoprotein receptors on the surface of hepatocytes. In order to make the conjugate provided by the present disclosure have simpler structure, easier synthesis and/or reduced cost, in some embodiments of the disclosure, m1, m2 and m3 independently of one another are an integer of 2-3, and in some embodiments, m1=m2=m3.
(28) Those skilled in the art would understand that when R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, and R.sub.15 independently of one another being selected from H, methyl and ethyl, they would not change the properties of the conjugate of the present disclosure, while could all achieve the purpose of the present disclosure. Nevertheless, in order to simplify the compound provided by the present disclosure and facilitate the synthesis, in some embodiments, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, and R.sub.15 are all H.
(29) R.sub.2 is selected to achieve the linkage between A39 and the N atom on the nitrogenous backbone. In the context of the present disclosure, a nitrogenous backbone refers to a chain structure in which N atoms are coadjacently linked to carbon atoms to which R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, and R.sub.15 are attached. In some embodiments, R.sub.2 may be any linking group capable of attaching the group as shown by Formula (A59) to the N atom on the nitrogenous backbone by suitable means. In some embodiments, in the case where the siRNA conjugate of the present disclosure is prepared by a solid phase synthesis process, R.sub.2 group needs to comprise both a site linking to the N atom on the nitrogenous backbone and a site linking to the P atom in R.sub.3. In some embodiments, in R.sub.2, the site linking to the N atom on the nitrogenous backbone forms an amide bond with the N atom, and the site linking to the P atom in R.sub.3 forms a phosphoester bond with the P atom. In some embodiments, R.sub.2 is selected from B5, B6, B5 or B6:
(30) ##STR00025## wherein represents the site where the group is covalently linked; q2 is an integer of 1-10; in order to simplify the conjugates provided in the present disclosure, in some embodiments, q2 is an integer of 1-5.
(31) According to the siRNA conjugate of the present disclosure, considering the availability of starting materials, in one embodiment, E.sub.1 is OH or SH.
(32) L.sub.1 is used to link the M.sub.1 ligand to the N atom on the nitrogenous backbone, thereby providing liver targeting function for the siRNA conjugate of the present disclosure. When L.sub.1 is selected from the linkage combinations of one or more of Formulae A1-A26, they could all achieve the above purpose. In order to make the steric positions among the M.sub.1 ligands more suitable for the binding between the M.sub.1 ligands and the asialoglycoprotein receptors on the surface of hepatocytes, and save cost, in some embodiments, L.sub.1 is selected from the linkage combinations of one or more of Formulae A1, A4, A5, A6, A8, A10, A11, and A13; in some embodiments, L.sub.1 is selected from the linkage combinations of at least two of Formulae A1, A4, A8, A10, and A11; in some embodiments, L.sub.1 is selected from the linkage combinations of at least two of Formulae A1, A8 and A10.
(33) In order to realize the above function of L.sub.1, in some embodiments, the length of L.sub.1 may be 3 to 25, 3 to 20, 4 to 15, or 5 to 12 atoms. Unless otherwise specified, in the context of the present disclosure, the length of L.sub.1 refers to the number of the chain-forming atoms in the longest atomic chain formed from the atom linked to the N atom on the nitrogenous backbone to the atom linked to the M.sub.1 ligand in L.sub.1.
(34) In Formulae A1-A26, j1, j2, R, Ra, and Rb are respectively selected to achieve the linkage between the M.sub.1 ligands and the N atom on the nitrogenous backbone, and to make the steric positions among the M.sub.1 ligands more suitable for the binding between the M.sub.1 ligands and the asialoglycoprotein receptor on the surface of hepatocytes. Therefore, in some embodiments of the present disclosure, j1 is an integer of 2-10, and in one embodiment, is an integer of 3-5. j2 is an integer of 2-10, and in one embodiment, is an integer of 3-5. R is a C.sub.1-C.sub.4 alkyl, and in one embodiment, is one of methyl, ethyl and isopropyl. Ra is one of Formulae A27, A28, A29, A30, and A30, and in one embodiment, is A27 or A28. Rb is a C.sub.1-C.sub.5 alkyl, and in one embodiment, is one of methyl, ethyl, isopropyl, and butyl.
(35) M.sub.1 ligand is used to bind to the asialoglycoprotein receptor on the surface of hepatocytes so as to facilitate the endocytosis of the conjugate into cells. Therefore, M.sub.1 ligand may be any ligand that has affinity to the asialoglycoprotein receptor (ASGP-R) on the surface of mammalian hepatocytes. The types of these ligands are well-known to those skilled in the art. For example, each M.sub.1 ligand may be independently selected from the group consisting of polysaccharides, modified polysaccharides, monosaccharides and monosaccharide derivatives. In some embodiments, each M.sub.1 ligand may be independently selected from the group consisting of glucose and its derivatives, mannose and its derivatives, galactose and its derivatives, xylose and its derivatives, ribose and its derivatives, fucose and its derivatives, lactose and its derivatives, maltose and its derivatives, arabinose and its derivatives, fructose and its derivatives, and sialic acid.
(36) In some embodiments, each M.sub.1 ligand may be independently selected from the group consisting of D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, -D-mannofuranose, -D-mannofuranose, -D-mannopyranose, -D-mannopyranose, -D-glucopyranose, -D-glucopyranose, -D-glucofuranose, -D-glucofuranose, -D-fructofuranose, -D-fructopyranose, -D-galactopyranose, -D-galactopyranose, -D-galactofuranose, -D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O[(R)-1-carboxyethyl]-2-deoxy--D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl--neuraminic acid, 5-thio--D-glucopyranose, methyl 2,3,4-tris-O-acetyl-1-thio-6-O-trityl--D-glucopyranoside, 4-thio--D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio--D-glucoheptopyranoside, 2,5-anhydro-D-allononitrile, ribose, D-ribose, D-4-thioribose, L-ribose and L-4-thioribose. In some embodiments, each M.sub.1 ligand is N-acetylgalactosamine (GalNAc). Other ligand selections may be found, for example, in the disclosure of CN105378082A, which is incorporated herein by reference in its entirety.
(37) According to some specific embodiments of the present disclosure, the conjugate of the present disclosure has a structure as shown by Formula (3), (4), (5), (6), (7), (8), (9), (10), (11), (12), (13), (14), (15), (16), (17), (18), (19), (20), (21) or (22):
(38) ##STR00026## ##STR00027## ##STR00028## ##STR00029## ##STR00030## ##STR00031## ##STR00032## ##STR00033##
(39) The P atom in Formula A59 may be linked to any possible position in the siRNA sequence. In some embodiments, the P atom in Formula A59 may be linked to any nucleotide in the sense or antisense strand of the siRNA. In some embodiments, the P atom is linked to any nucleotide in the sense strand of the siRNA. In some embodiments, the P atom in Formula A59 may be linked to a terminal region of the sense or antisense strand of the siRNA. In some embodiments, the P atom is linked to a terminal region of the sense strand of the siRNA. Said terminal region refers to the first 4 nucleotides counted from one terminal of the sense or antisense strand. In some embodiments, the P atom in Formula A59 may be linked to either terminal of the sense or antisense strand of the siRNA. In some embodiments, the P atom is linked to 3 terminal of the sense strand of the siRNA. In the case where the P atom in Formula A39 is linked to the above position in the sense strand of the siRNA, after entering into cells, the conjugate provided by the present disclosure can release a separate antisense strand of the siRNA during unwinding, thereby blocking the translation of the HBV mRNA into protein and inhibiting the expression of hepatitis B virus (HBV) gene.
(40) The P atom in Formula A39 may be linked to any possible position of a nucleotide in the siRNA. In some embodiments, the P atom in Formula A39 may be linked to position 5, 2 or 3, or to the base of a nucleotide. In some embodiments, the P atom in Formula A59 may be linked to position 2, 3, or 5 of a nucleotide in the siRNA by forming a phosphodiester bond. In some embodiments, the P atom in Formula A59 is linked to an oxygen atom formed by dehydrogenation of 3-hydroxy of the nucleotide at 3 terminal of the sense strand in the siRNA (in this case, the P atom and the corresponding phosphate group may be considered as the P atom and the phosphate group in the nucleotide), or the P atom in Formula A59 is linked to a nucleotide by substituting a hydrogen atom in 2-hydroxy of a nucleotide of the sense strand in the siRNA, or the P atom in Formula A59 is linked to a nucleotide by substituting a hydrogen atom in 5-hydroxy of the nucleotide at 5 terminal of the sense strand in the siRNA.
(41) Each nucleotide in the siRNA (hereinafter referred to as Nu) in the siRNA conjugate of the present disclosure is independently a modified or unmodified nucleotide. The siRNA comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence 1, and the antisense strand comprises a nucleotide sequence 2; the nucleotide sequence 1 and the nucleotide sequence 2 are at least partly reverse complementary to form a double-stranded region; the nucleotide sequence 1 and the nucleotide sequence shown in SEQ ID NO: 1 have an equal length and no more than 3 nucleotides differences; and the nucleotide sequence 2 and the nucleotide sequence shown in SEQ ID NO: 2 have an equal length and no more than 3 nucleotides differences:
(42) TABLE-US-00005 5-GAAAGUAUGUCAACGAAUZ-3; (SEQIDNO:1) 5-ZAUUCGUUGACAUACUUUC-3; (SEQIDNO:2)
wherein Z is U; Z is A; the nucleotide sequence 1 comprises a nucleotide Z.sub.A at the position corresponding to Z; the nucleotide sequence 2 comprises a nucleotide Z.sub.B at the position corresponding to Z; the Z.sub.B is the first nucleotide from 5 terminal of the antisense strand.
(43) In some embodiments, the nucleotide sequence 1 and the nucleotide sequence shown in SEQ ID NO: 1 have no more than 1 nucleotide difference; and/or the nucleotide sequence 2 and the nucleotide sequence shown in SEQ ID NO: 2 have no more than 1 nucleotide difference.
(44) In some embodiments, the nucleotide difference between the nucleotide sequence 2 and the nucleotide sequence shown in SEQ ID NO: 2 includes a difference at the position of the nucleotide Z.sub.B, and Z.sub.B is selected from U, C or G. In some embodiments, the nucleotide difference is a difference at the position of the nucleotide Z.sub.B, and Z.sub.B is selected from U, C or G, and Z.sub.A is a nucleotide complementary to Z.sub.B. These nucleotide differences will not significantly reduce the ability of the siRNA conjugates to inhibit the target gene, and these siRNA conjugates comprising the nucleotide differences are also within the scope of the present disclosure.
(45) In some embodiments, the nucleotide sequence 1 is basically reverse complementary, substantially reverse complementary, or completely reverse complementary to the nucleotide sequence 2.
(46) In some embodiments, the sense strand further comprises a nucleotide sequence 3, and the antisense strand further comprises a nucleotide sequence 4. The nucleotide sequences 3 and 4 respectively have a length of 1-4 nucleotides. The nucleotide sequence 3 is linked to 3 terminal of the nucleotide sequence 1, and the nucleotide sequence 4 is linked to 3 terminal of the nucleotide sequence 2. The nucleotide sequence 3 and the nucleotide sequence 4 have an equal length, and are substantially reverse complementary or completely reverse complementary to each other. In some embodiments, the nucleotide sequence 3 is completely reverse complementary to the nucleotide sequence 4. Therefore, the sense strand and the antisense strand may have a length of 19-23 nucleotides.
(47) In some embodiments, Nu may have a nucleotide sequence 3 and a nucleotide sequence 4 respectively selected from the following groups:
(48) The nucleotide sequence 3 and the nucleotide sequence 4 both have a length of 1 nucleotide. The base of the nucleotide sequence 3 is G; in this case, the double-stranded region may have a length of 20 nucleotides, i.e., the length ratio of the sense strand to the antisense strand in Nu may be 20/20.
(49) Alternatively, the nucleotide sequence 3 and the nucleotide sequence 4 both have a length of 2 nucleotides. In the direction from 5 terminal to 3 terminal, the bases of the nucleotide sequence 3 are U and G in succession; in this case, the double-stranded region may have a length of 21 nucleotides, i.e., the length ratio of the sense strand to the antisense strand of in Nu may be 21/21.
(50) Alternatively, the nucleotide sequence 3 and the nucleotide sequence 4 both have a length of 3 nucleotides. In the direction from 5 terminal to 3 terminal, the bases of the nucleotide sequence 3 are U, U and G in succession; in this case, the double-stranded region may have a length of 22 nucleotides, i.e., the length ratio of the sense strand to the antisense strand in Nu may be 22/22.
(51) Alternatively, the nucleotide sequence 3 and the nucleotide sequence 4 both have a length of 4 nucleotides. In the direction from 5 terminal to 3 terminal, the bases of the nucleotide sequence 3 are A, U, U and G in succession; in this case, the double-stranded region may have a length of 23 nucleotides, i.e., the length ratio of the sense strand to the antisense strand in Nu may be 23/23.
(52) In some embodiments, the nucleotide sequence 3 has a length of 2 nucleotides. In the direction from 3 terminal to 3 terminal, the bases of the nucleotide sequence 3 are U and G in succession.
(53) In some embodiments, in the above groups, the nucleotide sequence 3 and the nucleotide sequence 4 have an equal length and are completely reverse complementary to each other. Thus, once the bases of the nucleotide sequence 3 are provided, the bases of the nucleotide sequence 4 are also determined.
(54) In some embodiments, Nu further comprises a nucleotide sequence 5, which has a length of 1-3 nucleotides and is linked to 3 terminal of the antisense strand, thereby forming a 3 overhang of the antisense strand. In some embodiments, the nucleotide sequence 3 has a length of 1 or 2 nucleotides. As such, the length ratio of the sense strand to the antisense strand in Nu may be 19/20, 19/21, 20/21, 20/22, 21/22, 21/23, 22/23, 22/24, 23/24, or 23/25.
(55) In some embodiments, the nucleotide sequence 3 has a length of 2 nucleotides. Moreover, in the direction from 5 terminal to 3 terminal, the nucleotide sequence 5 comprises 2 consecutive thymidine deoxyribonucleotides, 2 consecutive uridine ribonucleotides or 2 nucleotides complementary to the target mRNA. Thus, in some embodiments, the length ratio of the sense strand to the antisense strand in Nu is 19/21 or 21/23. Here, Nu exhibits better silencing activity against HBV mRNA and/or activity of effectively reducing the expression of the surface antigen HBsAg.
(56) In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4, and the antisense strand comprises any nucleotide sequence selected from the group consisting of the nucleotide sequences shown in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8.
(57) TABLE-US-00006 5-GAAAGUAUGUCAACGAAUU-3, (SEQIDNO:3) 5-GAAAGUAUGUCAACGAAUA-3, (SEQIDNO:4) 5-AAUUCGUUGACAUACUUUCUU-3, (SEQIDNO:5) 5-AAUUCGUUGACAUACUUUCCA-3, (SEQIDNO:6) 5-UAUUCGUUGACAUACUUUCUU-3, (SEQIDNO:7) 5-UAUUCGUUGACAUACUUUCCA-3. (SEQIDNO:8)
(58) In some embodiments, Nu is any one of the following siP1-siP4:
(59) TABLE-US-00007 siP1 (SEQIDNO:3) Sensestrand: 5-GAAAGUAUGUCAACGAAUU-3, (SEQIDNO:5) Antisensestrand: 5-AAUUCGUUGACAUACUUUCUU-3, siP2 (SEQIDNO:3) Sensestrand: 5-GAAAGUAUGUCAACGAAUU-3, (SEQIDNO:6) Antisensestrand: 5-AAUUCGUUGACAUACUUUCCA-3, siP3 (SEQIDNO:4) Sensestrand: 5-GAAAGUAUGUCAACGAAUA-3, (SEQIDNO:7) Antisensestrand: 5-UAUUCGUUGACAUACUUUCUU-3, siP4 (SEQIDNO:4) Sensestrand: 5-GAAAGUAUGUCAACGAAUA-3, (SEQIDNO:8) Antisensestrand: 5-UAUUCGUUGACAUACUUUCCA-3.
(60) As described above, the nucleotides in Nu are independently of one another modified or unmodified nucleotides. In some embodiments, the nucleotides in Nu are unmodified nucleotides; in some embodiments, some or all nucleotides in Nu are modified nucleotides, wherein the modifications in the nucleotides would not cause significant impairment or loss of the function of the siRNA conjugate of the present disclosure for inhibiting the expression of HBV gene.
(61) Currently, there are many means in the art that can be used to modify siRNA, including backbone modification (also known as internucleotide linkage modification, such as phosphate group modification), ribose group modification, base modification, and the like (see, for example, J. K., Watts, G. F. Deleavey and M. J. Damha, Chemically Modified siRNA: tools and applications. Drug Discov Today, 2008. 13(19-20): p. 842-55, which is incorporated herein by reference in its entirety).
(62) In the context of the present disclosure, the term modified nucleotide used herein refers to a nucleotide formed by substituting the 2-hydroxy of the ribose group with other groups, a nucleotide analogue, or a nucleotide in which the base is a modified base.
(63) In some embodiments, at least one nucleotide in the sense or antisense strand is a modified nucleotide, and/or at least one phosphate group is a phosphate group with modified group(s). In other words, at least a portion of the phosphate and/or ribose groups in the phosphate-ribose backbone of at least one single strand of the sense strand and the antisense strand are phosphate and/or ribose groups with modified groups.
(64) In some embodiments of the present disclosure, all nucleotides in the sense strand and/or the antisense strand are modified nucleotides. In some embodiments, each nucleotide in the sense strand and the antisense strand is independently a fluoro modified nucleotide or a non-fluoro modified nucleotide.
(65) The inventors of the present disclosure have surprisingly found that when Nu is the following siRNA, a high degree of balance between the stability in serum and the gene silencing efficiency is achieved in animal experiments.
(66) In some embodiments, the fluoro modified nucleotides are in the nucleotide sequence 1 and the nucleotide sequence 2, wherein the nucleotide sequence 1 comprises no more than 5 fluoro modified nucleotides, and the nucleotides at positions 7, 8 and 9 in the nucleotide sequence 1 in the direction from 5 terminal to 3 terminal are fluoro modified nucleotides; the nucleotide sequence 2 comprises no more than 7 fluoro modified nucleotides, and the nucleotides at positions 2, 6, 14 and 16 in the direction from 5 terminal to 3 terminal in the nucleotide sequence 2 are fluoro modified nucleotides.
(67) In some embodiments, in the direction from 5 terminal to 3 terminal, the nucleotides at positions 7, 8 and 9 or 3, 7, 8 and 9 of the nucleotide sequence 1 in the sense strand are fluoro modified nucleotides, and the nucleotides at the other positions in the sense strand are non-fluoro modified nucleotides; and the nucleotides at positions 2, 6, 14 and 16 or 2, 6, 8, 9, 14 and 16 of the nucleotide sequence 2 in the antisense strand are fluoro modified nucleotides, and the nucleotides at the other positions in the antisense strand are non-fluoro modified nucleotides.
(68) The fluoro modified nucleotide refers to a nucleotide formed by substituting the 2-hydroxy of the ribose group of the nucleotide with a fluoro group, which has a structure as shown by Formula (207). The non-fluoro modified nucleotide refers to a nucleotide formed by substituting the 2-hydroxy of the ribose group of the nucleotide with a non-fluoro group, or a nucleotide analogue. In some embodiments, each non-fluoro modified nucleotide is independently selected from the group consisting of a nucleotide formed by substituting the 2-hydroxy of the ribose group of the nucleotide with a non-fluoro group, or a nucleotide analogue.
(69) A nucleotide formed by substituting the 2-hydroxy of the ribose group with a non-fluoro group is well-known to those skilled in the art, and can be selected from one of 2-alkoxy modified nucleotide, 2-substituted alkoxy modified nucleotide, 2-alkyl modified nucleotide, 2-substituted alkyl modified nucleotide, 2-amino modified nucleotide, 2-substituted amino modified nucleotide and 2-deoxy nucleotide.
(70) In some embodiments, the 2-alkoxy modified nucleotide is a methoxy modified nucleotide (2-OMe), as shown by Formula (208). The 2-substituted alkoxy modified nucleotide is, for example, a 2-O-methoxyethoxy modified nucleotide (2-MOE) as shown by Formula (209). The 2-amino modified nucleotide (2-NH.sub.2) is as shown by Formula (210). The 2-deoxy nucleotide (DNA) is as shown by Formula (211).
(71) ##STR00034##
(72) A nucleotide analogue refers to a group that can replace a nucleotide in the nucleic acid, while structurally differs from an adenine ribonucleotide, a guanine ribonucleotide, a cytosine ribonucleotide, a uracil ribonucleotide or thymine deoxyribonucleotide, such as an isonucleotide, a bridged nucleic acid (BNA) nucleotide or an acyclic nucleotide.
(73) A BNA is a nucleotide that is constrained or is not accessible. BNA can contain a 5-, 6-membered or even a 7-membered ring bridged structure with a fixed C3-endo sugar puckering. The bridge is typically incorporated at the 2- and 4-position of the ribose to afford a 2, 4-BNA nucleotide, such as LNA, ENA and cET BNA, which are as shown by Formula (212), (213) and (214), respectively.
(74) ##STR00035##
(75) An acyclic nucleotide is a nucleotide in which the ribose ring is opened, such as an unlocked nucleic acid (UNA) nucleotide and a glycerol nucleic acid (GNA) nucleotide, which are as shown by Formula (215) and (216), respectively.
(76) ##STR00036##
wherein R is H, OH or alkoxy (O-alkyl).
(77) An isonucleotide is a compound in which the position of the base on the ribose ring in the nucleotide is changed, such as a compound in which the base is transposed from position-1 to position-2 or -3 on the ribose ring, as shown by Formula (217) or (218) respectively.
(78) ##STR00037##
(79) Wherein, Base represents a base, such as A, U, G, C or T; R is H, OH, F or a non-fluoro group described above.
(80) In some embodiments, a nucleotide analogue is selected from the group consisting of an isonucleotide, LNA, ENA, cET, UNA, and GNA. In some embodiments, each non-fluoro modified nucleotide is a methoxy modified nucleotide. In the context of the present disclosure, the methoxy modified nucleotide refers to a nucleotide formed by substituting the 2-hydroxy of the ribose group with a methoxy group.
(81) In the context of the present disclosure, a fluoro modified nucleotide, a 2-fluoro modified nucleotide, a nucleotide in which 2-hydroxy of the ribose group is substituted with a fluoro group and a 2-fluororibosyl have the same meaning, referring to the nucleotide formed by substituting the 2-hydroxy of the ribose group with a fluoro group, having the structure as shown by Formula (207). A methoxy modified nucleotide, a 2-methoxy modified nucleotide, a nucleotide in which 2-hydroxy of a ribose group is substituted with a methoxy and a 2-methoxyribosyl have the same meaning, referring to the nucleotide that 2-hydroxy of the ribose group in the nucleotide is substituted with methoxy, having the structure as shown by Formula (208).
(82) In some embodiments, Nu is a siRNA with the following modifications: in the direction from 5 terminal to 3 terminal, the nucleotides at positions 7, 8 and 9 or 5, 7, 8 and 9 of the nucleotide sequence 1 in the sense strand are fluoro modified nucleotides, and the nucleotides at the other positions in the sense strand are methoxy modified nucleotides; and the nucleotides at positions 2, 6, 14 and 16 or 2, 6, 8, 9, 14 and 16 of the nucleotide sequence 2 in the antisense strand are fluoro modified nucleotides, and the nucleotides at the other positions in the antisense strand are methoxy modified nucleotides.
(83) In some embodiments, Nu is a siRNA with the following modifications: in the direction from 5 terminal to 3 terminal, the nucleotides at positions 7, 8 and 9 of the nucleotide sequence 1 in the sense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the sense strand are methoxy modified nucleotides; and the nucleotides at positions 2, 6, 14 and 16 of the nucleotide sequence 2 in the antisense strand are fluoro modified nucleotides, and the nucleotides at the other positions in the antisense strand are methoxy modified nucleotides; alternatively, in the direction from 5 terminal to 3 terminal, the nucleotides at positions 5, 7, 8 and 9 of the nucleotide sequence 1 in the sense strand are fluoro modified nucleotides, and the nucleotides at the other positions in the sense strand are methoxy modified nucleotides; and, in the direction from 5 terminal to 3 terminal, the nucleotides at positions 2, 6, 8, 9, 14 and 16 of the nucleotide sequence 2 in the antisense strand are fluoro modified nucleotides, and the nucleotides at the other positions in the antisense strand are methoxy modified nucleotides; alternatively, in the direction from 5 terminal to 3 terminal, the nucleotides at positions 5, 7, 8 and 9 of the nucleotide sequence 1 in the sense strand are fluoro modified nucleotides, and the nucleotides at other positions in the sense strand are methoxy modified nucleotides; and, in the direction from 5 terminal to 3 terminal, the nucleotides at positions 2, 6, 14 and 16 of the nucleotide sequence 2 in the antisense strand are fluoro modified nucleotides, and the nucleotides at the other positions in the antisense strand are methoxy modified nucleotides.
(84) In some embodiments, Nu is any siRNA shown in Table 1A.
(85) TABLE-US-00008 TABLE1A SomespecificsiRNAsequencesinthesiRNA conjugatesofthepresentdisclosure SEQ ID No. Sequencedirection5-3 NO siHB1M1 Sense GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm 11 strand Antisense AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm 13 strand siHB2M1 Sense GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm 11 strand Antisense AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm 14 strand siHB3M1 Sense GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm 12 strand Antisense UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm 15 strand siHB4M1 Sense GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm 12 strand Antisense UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm 16 strand siHB1M2 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm strand 17 Antisense AmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmUmUm 19 strand siHB2M2 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 17 strand Antisense AmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCmAm 20 strand siHB3M2 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 18 strand Antisense UmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmUmUm 21 strand siHB4M2 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 18 strand Antisense UmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCmAm 22 strand siHB1M3 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 17 strand Antisense AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm 13 strand siHB2M3 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 17 strand Antisense AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm 14 strand siHB3M3 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 18 strand Antisense UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm 15 strand siHB4M3 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 18 strand Antisense UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm 16 strand siHB5M1 Sense UmGmGmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm 51 strand Antisense UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAmUmUm 52 strand siHB6M2 Sense UmGmGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 51 strand Antisense UmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCmAmAmUm 53 strand SiHB7M3 Sense UmGmGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 54 strand Antisense AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAmUmUm 55 strand
(86) The siRNAs with the above modifications not only have lower costs, but also enhance the stability of the nucleic acid by making it difficult to the cleavage of the ribonucleases in blood, such that the nucleic acid has stronger resistance against nuclease hydrolysis.
(87) In some embodiments, the nucleotide has a modification on the phosphate group. In the context of the present disclosure, the modification on a phosphate group may be a phosphorothioate modification as shown by Formula (201), that is, the substitution of a non-bridging oxygen atom in a phosphodiester bond used as a linkage between adjacent nucleotides with a sulfur atom so that the phosphodiester bond is changed to a phosphorothioate diester bond. This modification can stabilize the structure of the siRNA, while maintaining high specificity and high affinity of base pairing.
(88) ##STR00038##
(89) In some embodiments, in the siRNA, at least one linkage selected from the group consisting of the following inter-nucleotide linkages is a phosphorothioate linkage: the linkage between the first and second nucleotides at 5 terminal of the sense strand; the linkage between the second and third nucleotides at 5 terminal of the sense strand; the linkage between the first and second nucleotides at 3 terminal of the sense strand; the linkage between the second and third nucleotides at 3 terminal of the sense strand; the linkage between the first and second nucleotides at 5 terminal of the antisense strand; the linkage between the second and third nucleotides at 5 terminal of the antisense strand; the linkage between the first and second nucleotides at 3 terminal of the antisense strand; and the linkage between the second and third nucleotides at 3 terminal of the antisense strand.
(90) In some embodiments, Nu is any siRNA shown in Table 1B.
(91) TABLE-US-00009 TABLE1B SomespecificsiRNAsequencesinthesiRNA conjugatesofthepresentdisclosure SEQ ID No. Sequencedirection5-3 NO siHB1M1S Sense GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm 23 strand Antisense AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsUmsUm 25 strand siHB2M1S Sense GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm 23 strand Antisense AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsCmsAm 26 strand siHB3M1S Sense GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm 24 strand Antisense UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsUmsUm 27 strand siHB4M1S Sense GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm 24 strand Antisense UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsCmsAm 28 strand siHB1M2S Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 29 strand Antisense AmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmsUmsUm 31 strand siHB2M2S Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 29 strand Antisense AmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmsCmsAm 32 strand siHB3M2S Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 30 strand Antisense UmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmsUmsUm 33 strand siHB4M2S Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 30 strand Antisense UmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmsCmsAm 34 strand siHB1M3S Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 29 strand Antisense AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsUmsUm 25 strand siHB2M3S Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 29 strand Antisense AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsCmsAm 26 strand siHB3M3S Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 30 strand Antisense UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsUmsUm 27 strand siHB4M3S Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 30 strand Antisense UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsCmsAm 28 strand siHB5M1S Sense UmsGmsGmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm 56 strand Antisense UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAmUsmsUm 57 strand siHB6M2S Sense UmsGmsGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 56 strand Antisense UmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCmAmsAmsUm 58 strand SiHB7M3S Sense UmsGmsGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 59 strand Antisense AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAmsUmsUm 60 strand
(92) In some embodiments, the nucleotide at 5-terminal of the antisense strand sequence of the siRNA molecule is a 5-phosphate nucleotide or a 5-phosphate analogue modified nucleotide.
(93) As well-known to those skilled in the art, the 5-phosphate nucleotide may has the following structure:
(94) ##STR00039##
(95) Meanwhile, common types of the 5-phosphate analogue modified nucleotide are well-known to those skilled in the art, such as, the following four nucleotides as shown by Formula (203)-(206) as disclosed in Anastasia Khvorova and Jonathan K. Watts, The chemical evolution of oligonucleotide therapies of clinical utility. Nature Biotechnology, 2017, 35(3): 238-48:
(96) ##STR00040##
wherein R represents a group selected from the group consisting of H, OH, F and methoxy; and Base represents a base selected from A, U, C, G, or T.
(97) In some embodiments, the 5-phosphate nucleotide or 5-phosphate analogue modified nucleotide is a nucleotide with 5-phosphate modification as shown by Formula (202); a nucleotide with E-vinylphosphonate (E-VP) modification as shown by Formula (203) or a nucleotide with 5-phosphorothioate modification as shown by Formula (203).
(98) In some embodiments, Nu is any siRNA shown in Table 1C or Table 1D.
(99) TABLE-US-00010 TABLE1C SomespecificsiRNAsequencesinthesiRNAconjugates ofthempresentdisclosure SEQ ID No. Sequencedirection5-3 NO siHB1M1P1 Sense GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm 11 strand Antisense P1-AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm 35 strand siHB2M1P1 Sense GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm 11 strand Antisense P1-AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm 36 strand siHB3M1P1 Sense GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm 12 strand Antisense P1-UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm 37 strand siHB4M1P1 Sense GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm 12 strand Antisense P1-UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm 38 strand siHB1M2P1 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 17 strand Antisense P1-AmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmUmUm 39 strand siHB2M2P1 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 17 strand Antisense P1-AmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCmAm 40 strand siHB3M2P1 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 18 strand Antisense P1-UmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmUmUm 41 strand siHB4M2P1 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 18 strand Antisense P1-UmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCmAm 42 strand siHB1M3P1 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 17 strand Antisense P1-AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm 35 strand siHB2M3P1 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 17 strand Antisense P1-AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm 36 strand siHB3M3P1 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 18 strand Antisense P1-UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmUmUm 37 strand siHB4M3P1 Sense GmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 18 strand Antisense P1-UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAm 38 strand siHB5M1P1 Sense UmGmGmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm 51 strand Antisense P1-UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAmUmUm 61 strand siHB6M2P1 Sense UmGmGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 51 strand Antisense P1-UmAfUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCmAmAmUm 62 strand SiHB7M3P1 Sense UmGmGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 54 strand Antisense P1-AmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCmAmUmUm 63 strand
(100) TABLE-US-00011 TABLE1D SomespecificsiRNAsequencesinthesiRNAconjugates ofthepresentdisclosure SEQ ID No. Sequencedirection5-3 NO siHB1M1SP1 Sense GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm 23 strand Antisense P1-AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCms 43 strand UmsUm siHB2M1SP1 Sense GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmUm 23 strand Antisense P1-AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCms 44 strand CmsAm siHB3M1SP1 Sense GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm 24 strand Antisense P1-UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCms 45 strand UmsUm siHB4M1SP1 Sense GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm 24 strand Antisense P1-UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCms 46 strand CmsAm siHB1M2SP1 Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 29 strand Antisense P1-AmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCms 47 strand UmsUm siHB2M2SP1 Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 29 strand Antisense P1-AmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCms 48 strand CmsAm siHB3M2SP1 Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 30 strand Antisense P1-UmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCms 49 strand UmsUm siHB4M2SP1 Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 30 strand Antisense P1-UmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCms 50 strand CmsAm siHB1M3SP1 Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 29 strand Antisense P1-AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCms 43 strand UmsUm siHB2M3SP1 Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 29 strand Antisense P1-AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCms 44 strand CmsAm siHB3M3SP1 Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 30 strand Antisense P1-UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCms 45 strand UmsUm siHB4M3SP1 Sense GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 30 strand Antisense P1-UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCms 46 strand CmsAm siHB5M1SP1 Sense UmsGmsGmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm 56 strand Antisense P1- 64 strand UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCm AmsUmsUm siHB6M2SP1 Sense UmsGmsGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmAm 56 strand Antisense P1- 65 strand UmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmCmCm AmsAmsUm siHB7M3SP1 Sense UmsGmsGmAmAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUmUm 58 strand Antisense P1- 66 strand AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmCm AmsUmsUm
(101) The inventors of the present disclosure have surprisingly found that the siRNA conjugate of the present disclosure, i.e., the siRNA conjugates comprising the above siRNAs (such as the siRNAs shown in the above Table 1A to Table 1D), exhibits a significantly improved stability in serum without significantly reduced silencing activity against HBV mRNA, and further shows excellent inhibitory effect on the expression of HBsAg and HBV DNA. In addition, the siRNA conjugate of the present disclosure exhibits lower off-target effect.
(102) Preparation of the siRNA Conjugate of the Present Disclosure
(103) The siRNA conjugate of the present disclosure may be prepared by any appropriate synthesis routes.
(104) In one embodiment, the siRNA conjugate of the present disclosure may be prepared by the following method, comprising successively linking nucleoside monomers in 3 to 5 direction according to the nucleotide type and sequence in the sense strand and antisense strands of the siRNA respectively, under the condition of phosphoramidite solid phase synthesis, wherein the step of linking each nucleoside monomer includes a four-step reaction of deprotection, coupling, capping, and oxidation or sulfurization; isolating the sense strand and the antisense strand of the siRNA; and annealing, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide. The siRNA comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence 1, and the antisense strand comprises a nucleotide sequence 2, and the nucleotide sequence 1 and the nucleotide sequence 2 are at least partly reverse complementary to form a double-stranded region. The nucleotide sequence 1 and the nucleotide sequence shown in SEQ ID NO: 1 have an equal length and no more than 3 nucleotides differences, and in some embodiments, no more than 1 nucleotide difference; and the nucleotide sequence 2 and the nucleotide sequence shown in SEQ ID NO: 2 have an equal length and no more than 3 nucleotides differences, and in some embodiments, no more than 1 nucleotide difference:
(105) TABLE-US-00012 (SEQIDNO:1) 5-GAAAGUAUGUCAACGAAUZ-3; (SEQIDNO:2) 5-ZAUUCGUUGACAUACUUUC-3; wherein Z is U; Z is A; the nucleotide sequence 1 comprises a nucleotide Z.sub.A at the position corresponding to Z; the nucleotide sequence 2 comprises a nucleotide Z.sub.B at the position corresponding to Z; the nucleotide Z.sub.B is the first nucleotide from 3 terminal of the antisense strand.
(106) Moreover, the method further comprises: contacting the compound as shown by Formula (321) with a nucleoside monomer or a nucleotide sequence linked to a solid phase support under coupling reaction condition and in the presence of a coupling agent, thereby linking the compound as shown by Formula (321) to the nucleotide sequence through a coupling reaction. Hereinafter, the compound as shown by Formula (321) is also called a conjugation molecule.
(107) ##STR00041## wherein, R.sub.4 is a group comprising any functional group that may be conjugated to a siRNA via a phosphodiester bond by a reaction; Each S.sub.1 is independently a group formed by substituting all active hydroxyl in M.sub.1 with the group YCOO, wherein each Y is independently selected from the group consisting of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl, and alkylphenyl;
(108) The definitions and options of n1, n3, m1, m2, m3, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, R.sub.15, L.sub.1, M.sub.1 are respectively as described above; R.sub.4 is selected to achieve the linkage to the N atom on the nitrogenous backbone and to provide a suitable reaction site for synthesizing the siRNA conjugate as shown by Formula (1). In some embodiments, R.sub.4 comprises a R.sub.2 linking group or protected R.sub.2 linking group. Moreover, R.sub.4 comprises a functional group that can react with a siRNA to form a structure as shown by Formula (A59).
(109) In some embodiments, R.sub.4 comprises a group 1, or R.sub.4 comprises a group 1 and a group 2, wherein the group 1 comprises a functional group that can react with a group on a siRNA or a 23 nucleoside monomer to form a phosphite ester; and the group 2 comprises a functional group that can form a covalent bond with a hydroxy group or an amino group, or comprises a solid phase support linked via the covalent bond. In some embodiments, the functional group that can react with a group on a siRNA or a nucleoside monomer to form a phosphite ester is a phosphoramidite, a hydroxy or a protected hydroxy which, after removal of the protecting group, can form a hydroxy to participate in the reaction. The functional group that can form a covalent bond with a hydroxy group or an amino group is a phosphoramidite, a carboxyl or a carboxylate salt. The solid phase support linked via the covalent bond is a solid phase support linked via a phosphoester bond, a carboxyl ester bond, or an amide bond. In some embodiments, the solid phase support is a resin.
(110) In some embodiments, the group 1 comprises hydroxy, OR.sub.k or a group as shown by Formula (C3); the group 2 has a structure as shown by Formula (C1), (C2), (C3), (C1), or (C3):
(111) ##STR00042## wherein q.sub.1 is an integer of 1-4, X is O or NH, M.sup.+ is a cation, R.sub.k is a hydroxy protecting group, Resin represents a solid phase support, and represents the site where a group is covalently linked.
(112) In some embodiments, the group 1 comprises a phosphoramidite functional group, such as the group as shown by Formula (C3). The phosphoramidite group can form a phosphite ester with a hydroxy at any position on a nucleotide (such as a 2- or 3-hydroxy) by coupling reaction, and the phosphite ester can form a phosphodiester bond or phosphorothioate ester bond as shown by Formula (A59) via oxidation or sulfurization, so as to conjugate the conjugation molecule to a siRNA. Here, whether the group 2 is present will not affect the obtaining of the siRNA conjugate as shown by Formula (1). Under such circumstances, after obtaining a sense or antisense strand of the siRNA by a method such as phosphoramidite solid phase synthesis, the compound as shown by Formula (321) is reacted with a hydroxy on the terminal nucleotide of the nucleotide sequence, and the resultant phosphite ester forms a phosphodiester bond or phosphorothioate bond by a subsequent oxidation or sulfurization, thereby conjugating the compound as shown by Formula (321) to a siRNA.
(113) In some embodiments, the group 1 comprises a protected hydroxy group, and the group 2 comprises a carboxyl functional group, a carboxylate functional group or a phosphoramidite functional group, such as the functional group as shown by Formula (C1), (C2) or (C3). When the group 2 comprises a carboxyl functional group or a carboxylate functional group, the compound as shown by Formula (321) can react via an esterification or an amidation reaction with a hydroxy or an amino group on a solid phase support such as a resin, to form a solid phase support linked via a carboxylate ester bond or a solid phase support linked via an amide bond. When the group 2 comprises a phosphoramidite functional group, the compound as shown by Formula (321) can be coupled with a hydroxy group on a universal solid phase support, such as a resin, and by oxidation, form a solid phase support linked via a phosphodiester bond. Subsequently, starting from the above product linked to a solid phase support, the nucleoside monomers are linked sequentially by a phosphoramidite solid phase synthesis method, thereby obtaining a sense or antisense strand of the siRNA linked to the conjugation molecule. During the phosphoramidite solid phase synthesis, the group 1 is deprotected, and then coupled with a phosphoramidite group on a nucleoside monomer under coupling reaction condition.
(114) In one embodiment, the group 1 comprises a hydroxy or a protected hydroxy group, and the group 2 comprises a solid phase support linked via a carboxylate ester bond, an amide bond or a phosphoester bond as shown by Formula (C1) or (C3). Under such circumstances, starting from the compound as shown by Formula (321) in place of the solid phase support, the nucleoside monomers are linked sequentially by a phosphoramidite solid phase synthesis method, thereby obtaining a sense or antisense strand of the siRNA linked to a conjugation molecule. In some embodiments, the carboxylate functional group may be expressed as COO.sup. M.sup.+, wherein M.sup.+ is a cation such as one of a metal cation, an ammonium cation NH.sub.4.sup.+ and an organic ammonium cation. In one embodiment, the metal cation may be an alkali metal cation, such as K.sup.+ or Na.sup.+. In order to increase solubility and facilitate the reaction, in some embodiments, the organic ammonium cation is an ammonium cation formed by a tertiary amine, or a quaternary ammonium cation, such as an ammonium cation formed by triethylamine or N,N-diisopropylethylamine. In some embodiments, the carboxylate is a triethylamine carboxylate or an N,N-diisopropylethylamine carboxylate.
(115) In some embodiments, R.sub.4 comprises a structure as shown by Formula (B9), (B10), (B9), (B10), (B11), (B12), (B11) or (B12):
(116) ##STR00043## ##STR00044## wherein q.sub.1 is an integer of 1-4, q.sub.2 is an integer of 1-10, X is O or NH, M.sup.+ is a cation, R.sub.k is a hydroxy protecting group, Resin represents a solid phase support, and represents a site where a group is covalently linked. From the viewpoint of synthesis convenience and cost, in some embodiments, q.sub.1 is 1 or 2, and q.sub.2 is an integer of 1-5. In some embodiments, R.sub.4 comprises a structure as shown by Formula (B9) or (B10). In some embodiments, R.sub.4 comprises a structure as shown by Formula (B11) or (B12).
(117) The hydroxy protecting group R.sub.k is selected to replace the hydrogen on the hydroxyl in R.sub.4 to form a non-reactive group. The protecting group R.sub.k can be removed in the subsequent reaction process to release an active hydroxyl again to participate in the subsequent reaction. The types of the protecting group are well-known to those skilled in the art. For example, the protecting group R.sub.k is one or more of Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4-dimethoxytrityl), and TMTr (4,4,4-trimethoxytrityl). In some embodiments, R.sub.k may be DMTr, i.e., 4,4-dimethoxytrityl.
(118) According to the description above, those skilled in the art would easily understand that as compared with the well-known phosphoramidite solid phase synthesis methods in the art, an siRNA conjugate in which a conjugation molecule is linked to any possible position of the nucleotide sequence can be obtained through the above group 1 and an optional group 2. For example, the conjugation molecule is linked to a terminal region of the nucleotide sequence or to a terminal of the nucleotide sequence. Correspondingly, unless otherwise specified, in the following description regarding conjugate preparation, when referring to the reactions such as deprotection, coupling, capping, oxidation, sulfurization, it will be understood that the reaction conditions and agents involved in the well-known phosphoramidite solid phase synthesis methods in the art would also apply to these reactions. Exemplary reaction conditions and agents will be described in detail hereinafter.
(119) Each S.sub.1 is independently a group formed by substituting all active hydroxyl groups in M.sub.1 with the group YCOO. During preparation of the siRNA conjugate from the compound as shown by Formula (321), the active hydroxyl in the M.sub.1 is protected by the group YCOO, and the protecting group is removed in the subsequent steps to obtain a M.sub.1 ligand.
(120) In some embodiments, each S.sub.1 is independently one of Formulae A46-A54:
(121) ##STR00045## ##STR00046##
(122) In some embodiments, S.sub.1 is Formula A49 or A50.
(123) In some embodiments, each Y is independently selected from one of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl, and alkylphenyl. For the purpose of simplifying the conjugation molecule of the present disclosure, in one embodiment, Y is methyl.
(124) As mentioned previously, the method for preparing the siRNA conjugate of the present disclosure further comprises the following step: synthesizing the other strand of the siRNA (for example, when a sense strand of the siRNA linked to a conjugation molecule is synthesized in the above step, the method further comprises synthesizing an antisense strand of the siRNA by the solid phase synthesis method, and vice versa); isolating the sense strand and the antisense strand; and annealing. In particular, in the isolating step, the solid phase support linked to the nucleotide sequence and/or conjugation molecule is cleaved, and the necessary protecting group is removed (in this case, each S.sub.1 group in the compound as shown by Formula (321) is converted to the corresponding M.sub.1 ligand), thereby obtaining a sense strand (or antisense strand) of the siRNA linked to the conjugation molecule and the corresponding antisense strand (or sense strand). The sense strand and the antisense strand are annealed to form a double-stranded RNA structure, thereby obtaining a siRNA conjugate as shown by Formula (1).
(125) In some embodiments, the method for preparing the siRNA conjugate comprises the following steps: contacting the compound as shown by Formula (321) with the first nucleoside monomer at 3 terminal of the sense or antisense strand under coupling reaction condition in the presence of a coupling agent, thereby linking the compound as shown by Formula (321) to the first nucleotide in the sequence; successively linking nucleoside monomers in 3 to 5 direction to synthesize the sense or antisense strand of the siRNA according to the desired nucleotide type and sequence of the sense or antisense strand, under the condition of phosphoramidite solid phase synthesis; wherein the compound of Formula (321) is a compound in which R.sub.4 comprises a group 1 comprising a protected hydroxy and a group 2 with a structure as shown by Formula (C1) or (C3), and the compound of Formula (321) is deprotected before linked to the first nucleoside monomer; and the linking of each nucleoside monomer comprises a four-step reaction of deprotection, coupling, capping, and oxidation or sulfurization; thus obtaining a sense or antisense strand of nucleic acid linked to the conjugation molecule; successively linking nucleoside monomers in 3 to 5 direction to synthesize the sense or antisense strand of nucleic acid according to the nucleotide type and sequence of the sense or antisense strand, under the condition of phosphoramidite solid phase synthesis; wherein the linking of each nucleoside monomer includes a four-step reaction of deprotection, coupling, capping, and oxidation or sulfurization; removing the protecting groups and cleaving the solid phase support; isolating and purifying the sense strand and the antisense strand of nucleic acid; and annealing.
(126) In some embodiments, the method for preparing the siRNA conjugate comprises the following steps: successively linking nucleoside monomers in 3 to 3 direction to synthesize the sense strand or the antisense strand according to the nucleotide type and sequence of the sense or antisense strand in the double-stranded siRNA; wherein the linking of each nucleoside monomer comprises a four-step reaction of deprotection, coupling, capping, and oxidation or sulfurization, thus obtaining a sense strand linked to the solid phase support and an antisense strand linked to the solid phase support; contacting the compound as shown by Formula (321) with the sense strand linked to the solid phase support or the antisense strand linked to the solid phase support under coupling reaction condition in the presence of a coupling agent, thereby linking the compound as shown by Formula (321) to the sense strand or the antisense strand; wherein the compound of Formula (321) is a compound in which R.sub.4 comprises a group 1 which comprises a phosphoramidite group; removing the protecting groups and cleaving the solid phase support; respectively isolating and purifying the sense or antisense strand of the siRNA; and annealing; wherein the sense or antisense strand of the siRNA is linked to a conjugation molecule.
(127) In one embodiment, the P atom in formula A59 is linked to 3 terminal of the sense strand of the siRNA, and the method for preparing the siRNA conjugate of the present disclosure comprises: (1) removing the hydroxyl protecting group R.sub.k in the compound of Formula (321), wherein the compound of Formula (321) is a compound in which R.sub.4 comprises a group 1 and a group 2, wherein the group 1 comprises a protected hydroxy OR.sub.k, and the group 2 has a structure as shown by Formula (C1) or (C3); contacting the deprotected product with a nucleoside monomer to obtain a nucleoside monomer linked to a solid phase support via the conjugation molecule, under coupling reaction condition in the presence of a coupling agent; (2) starting from the nucleoside monomer linked to a solid phase support via the conjugation molecule, synthesizing a sense strand of the siRNA in 3 to 5 direction by a phosphoramidite solid phase synthesis method; (3) synthesizing an antisense strand of the siRNA by a phosphoramidite solid phase synthesis method; and (4) isolating the sense strand and the antisense strand of the siRNA and annealing the same to obtain the siRNA conjugate of the present disclosure; wherein in step (1), the method for removing the protecting group R.sub.k in the compound of Formula (321) comprises contacting the compound of Formula (321) with a deprotection agent under deprotection condition. The deprotection condition comprises a temperature of 0-30 C., and in one embodiment, 13-33 C., and a reaction time of 30-300 seconds, and in one embodiment, 30-130 seconds. The deprotection agent may be selected from one or more trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and monochloroacetic acid, and in one embodiment, the deprotection agent is dichloroacetic acid. The molar ratio of the deprotection agent to the compound as shown by Formula (321) may be 10:1 to 1000:1, and in some embodiments, 30:1 to 300:1.
(128) The coupling reaction condition and the coupling agent may be any conditions and agents suitable for the above coupling reaction. For the purpose of simplifying the process, the same condition and agent as those of the coupling reaction in the solid phase synthesis method can be used.
(129) Typically, the coupling reaction condition comprises a reaction temperature of 0-50 C., and in one embodiment, 15-35 C. The molar ratio of the compound of Formula (321) to the nucleoside monomer may be 1:1 to 1:50, and in one embodiment, 1:2 to 1:5. The molar ratio of the compound of Formula (321) to the coupling agent may be 1:1 to 1:50, and in one embodiment, 1:3 to 1:10. The reaction time may be 200-3000 seconds, and in one embodiment, 500-1500 seconds. The coupling agent may be selected from one or more of 1H-tetrazole, 5-ethylthio-1H-tetrazole and 5-benzylthio-1H-tetrazole, and in one embodiment, is 5-ethylthio-1H-tetrazole. The coupling reaction may be performed in an organic solvent. The organic solvent may be selected from one or more of anhydrous acetonitrile, anhydrous DMF and anhydrous dichloromethane, and in one embodiment, is anhydrous acetonitrile. With respect to the compound as shown by Formula (321), the amount of the organic solvent may be 3-50 L/mol, and in one embodiment, 5-20 L/mol.
(130) In step (2), a sense strand S of the siRNA conjugate is synthesized in 3 to 5 direction by the phosphoramidite solid phase synthesis method, starting from the nucleoside monomer linked to a solid phase support via a conjugation molecule prepared in the above steps. In this case, the conjugation molecule is linked to 3 terminal of the resultant sense strand.
(131) Other conditions for the solid phase synthesis in steps (2) and (3), including the deprotection condition for the nucleoside monomer, the type and amount of the deprotection agent, the coupling reaction condition, the type and amount of the coupling agent, the capping reaction condition, the type and amount of the capping agent, the oxidation reaction condition, the type and amount of the oxidation agent, the sulfurization reaction condition, and the type and amount of the sulfurization agent, adopt various conventional agents, amounts, and conditions in the art.
(132) In one embodiment, for example, the solid phase synthesis in steps (2) and (3) can use the following conditions:
(133) The deprotection condition for the nucleoside monomer comprises a reaction temperature of 0-50 C., and in one embodiment, 15-35 C., and a reaction time of 30-300 seconds, and in one embodiment, 30-130 seconds. The deprotection agent may be selected from one or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and monochloroacetic acid, and in 3 one embodiment, is dichloroacetic acid. The molar ratio of the deprotection agent to the protecting group 4,4-dimethoxytrityl on the solid phase support is 2:1 to 100:1, and in one embodiment, is 3:1 to 30:1.
(134) The coupling reaction condition comprises a reaction temperature of 0-30 C., and in one embodiment, 13-33 C. The molar ratio of the nucleic acid sequence linked to the solid phase support to the nucleoside monomer is 1:1 to 1:30, and in one embodiment, is 1:5 to 1:15. The molar ratio of the nucleic acid sequence linked to the solid phase support to the coupling agent is 1:1 to 1:100, and in one embodiment, is 1:30 to 1:80. The selection of the reaction time and the coupling agent can be same as described above.
(135) The capping reaction condition comprises a reaction temperature of 0-50 C., and in one embodiment, 15-35 C., and a reaction time of 5-500 seconds, and in one embodiment, 10-100 seconds. The selection of the capping agent can be same as above. The molar ratio of the total amount of the capping agent to the nucleic acid sequence linked to the solid phase support may be 1:100 to 100:1, and in one embodiment, is 1:10 to 10:1. In the case where the capping agent uses equimolar acetic anhydride and N-methylimidazole, the molar ratio of acetic anhydride, N-methylimidazole, and the nucleic acid sequence linked to the solid phase support may be 1:1:10-10:10:1, and in one embodiment, is 1:1:2-2:2:1.
(136) The oxidation reaction condition comprises a reaction temperature of 0-50 C., and in one embodiment, 15-35 C., and a reaction time of 1-100 seconds, and in one embodiment, 5-50 seconds. In one embodiment, the oxidation agent is iodine (in one embodiment provided as iodine water). The molar ratio of the oxidation agent to the nucleic acid sequence linked to the solid phase support in the coupling step may be 1:1 to 100:1, and in one embodiment, is 5:1 to 50:1. In some embodiments, the oxidation reaction is performed in a mixed solvent in which the ratio of tetrahydrofuran:water:pyridine is 3:1:1-1:1:3. The sulfurization reaction condition comprises a reaction temperature of 0-50 C., and in one embodiment, 15-35 C., and a reaction time of 50-2000 seconds, and in one embodiment, 100-1000 seconds. In one embodiment, the sulfurization agent is xanthene hydride. The molar ratio of the sulfurization agent to the nucleic acid sequence linked to the solid phase support in the coupling step is 10:1 to 1000:1, and in one embodiment, is 10:1 to 500:1. In some embodiments, the sulfurization reaction is performed in a mixed solvent in which the ratio of acetonitrile:pyridine is 1:3-3:1.
(137) The method further comprises isolating the sense strand and the antisense strand of the siRNA after linking all nucleoside monomers and before the annealing. Methods for isolation are well-known to those skilled in the art and generally comprise cleaving the synthesized nucleotide sequence from the solid phase support, removing protecting groups on the bases, phosphate groups and ligands, purifying and desalting.
(138) The conventional cleavage and deprotection methods in the synthesis of siRNAs can be used to cleave the synthesized nucleotide sequence from the solid phase support, and remove the protecting groups on the bases, phosphate groups and ligands. For example, the resultant nucleotide sequence linked to the solid phase support is contacted with concentrated aqueous ammonia; during deprotection, the protecting group YCO.sup. in groups A46-A54 is converted to a hydroxyl group, and thus the S.sub.1 groups are converted to corresponding M.sub.1 ligands, providing the conjugate as shown by Formula (1); wherein the concentrated aqueous ammonia may be aqueous ammonia of a concentration of 25-30 wt %. The amount of the concentrated aqueous ammonia may be 0.2 ml/mol-0.8 ml/mol with respect to the target siRNA.
(139) When there is at least one 2-TBDMS protection on the synthesized nucleotide sequence, the method further comprises contacting the nucleotide sequence removed from the solid phase support with triethylamine trihydrofluoride to remove the 2-TBDMS protection. Here, the resultant target siRNA sequence comprises the corresponding nucleoside having free 2-hydroxy. The amount of pure triethylamine trihydrofluoride is 0.4 ml/mol-1.0 ml/mol with respect to the target siRNA sequence. As such, the siRNA conjugate of the present disclosure can be obtained.
(140) Methods for purification and desalination are well-known to those skilled in the art. For example, nucleic acid purification may be performed using a preparative ion chromatography purification column with a gradient elution of NaBr or NaCl; after collection and combination of the product, the desalination may be performed using a reverse phase chromatography purification column.
(141) The non-bridging oxygen or sulfur atom in the phosphodiester bond or phosphorothioate diester bond between the nucleotides in the resultant siRNA conjugate usually binds to a sodium ion, and the siRNA conjugate is usually present in the form of a sodium salt. The well-known ion-exchange methods may be used, in which the sodium ion may be replaced with hydrogen ion and/or other cations, thereby providing other forms of siRNA conjugates. The cations will be described in detail hereinafter.
(142) During synthesis, the purity and molecular weight of the nucleic acid sequence may be determined at any time, in order to better control the synthesis quality. Such determination methods are well-known to those skilled in the art. For example, the purity of the nucleic acid may be determined by ion exchange chromatography, and the molecular weight may be determined by liquid chromatography-mass spectrometry (LC-MS).
(143) Methods for annealing are also well-known to those skilled in the art. For example, the synthesized sense strand (S strand) and antisense strand (AS strand) may be simply mixed in water for injection at an equimolar ratio, heated to 70-95 C., and then cooled at room temperature to form a double-stranded structure via hydrogen bond. Hence, the siRNA conjugate of the present disclosure can be obtained.
(144) After obtaining the siRNA conjugate of the present disclosure, in one embodiment, the synthesized siRNA conjugate can also be characterized by the means such as molecular weight detection using the methods such as LC-MS, to confirm that the synthesized siRNA conjugate is the designed siRNA conjugate of interest, and the sequence of the synthesized siRNA is the sequence of the desired siRNA sequence to be synthesized, for example, is one of the sequences listed in Tables 1A-1D above.
(145) The compound as shown by Formula (321) may be prepared by the following method comprising: contacting a compound as shown by Formula (313) with a cyclic anhydride in an organic solvent under esterification reaction condition in the presence of a base and an esterification catalyst; isolating the compound as shown by Formula (321) by ion exchange:
(146) ##STR00047## wherein the definitions and options of n1, n3, m1, m2, m3, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, R.sub.15, L.sub.1 and S.sub.1 are respectively as described above; R.sub.6 has a structure as shown by Formula (A61):
(147) ##STR00048## wherein, R.sub.i is any group capable of linking to the N atom on the nitrogenous backbone, linking to R.sub.kO and linking to a free hydroxy group; R.sub.k is a hydroxy protecting group. In this case, a compound as shown by Formula (321) is obtained, wherein R.sub.4 comprises a group 1 which comprises a hydroxy protecting group and a group 2 which comprises a structure as shown by Formula (C1) or (C2).
(148) The esterification reaction condition includes a reaction temperature of 0-100 C. and a reaction time of 8-48 hours. In one embodiment, the esterification reaction condition comprises a reaction temperature of 10-40 C. and a reaction time of 20-30 hours.
(149) The organic solvent is one or more of an epoxy solvent, an ether solvent, an haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In one embodiment, the epoxy solvent is dioxane and/or tetrahydrofuran, the ether solvent is diethyl ether and/or methyl tertbutyl ether, and the haloalkane solvent is one or more of dichloromethane, trichloromethane and 1,2-dichloroethane. In one embodiment, the organic solvent is dichloromethane. With respect to the compound as shown by Formula (313), the amount of the organic solvent is 3-30 L/mol, and in one embodiment, 3-20 L/mol.
(150) In some embodiments, the cyclic anhydride is one of succinic anhydride, glutaric anhydride, adipic anhydride or pimelic anhydride, and in one embodiment, the cyclic anhydride is succinic anhydride. The molar ratio of the cyclic anhydride to the compound as shown by Formula (313) is 1:1 to 10:1, and in one embodiment, 2:1 to 3:1.
(151) The esterification catalyst may be any catalyst capable of catalyzing esterification, such as 4-dimethylaminopyridine. The molar ratio of the catalyst to the compound as shown by Formula (313) is 1:1 to 10:1, and in one embodiment, is 2:1 to 3:1.
(152) In some embodiments, the base may be any inorganic base, organic base or combination thereof. Considering solubility and product stability, the base may be, for example, an organic base of tertiary amine. In one embodiment, the organic base of tertiary amine is triethylamine or N,N-diisopropylethylamine. The molar ratio of the organic base of tertiary amine to the compound as shown by Formula (313) is 1:1 to 20:1, and in one embodiment, is 3:1 to 10:1.
(153) The ion exchange serves the function of converting the compound as shown by Formula (321) into a desired form of carboxylic acid or carboxylic salt, and the methods of ion exchange are well-known to those skilled in the art. The above conjugation molecule in which the cation is M.sup.+ may be obtained by using suitable ion exchange solution and ion exchange condition, which is not described here in detail. In one embodiment, a triethylamine phosphate solution is used in the ion exchange reaction, and the concentration of the triethylamine phosphate solution is 0.2-0.8 M. In one embodiment, the concentration of the triethylamine phosphate solution is 0.4-0.6 M, and with respect to the compound as shown by Formula (313), the amount of the triethylamine phosphate solution is 3-6 L/mol, and in one embodiment, 4-3 L/mol.
(154) The compound as shown by Formula (321) may be isolated from the reaction mixture using any suitable isolation methods. In some embodiments, the compound as shown by Formula (321) may be isolated by removal of solvent via evaporation followed by chromatography, for example, using the following chromatographic conditions for isolation:normal phase purification of silica gel: 200-300 mesh silica gel filler, gradient elution of 1 wt % triethylamine in dichloromethane:methanol=100:18-100:20; reverse phase purification: C18 and C8 reverse phase filler, gradient elution of methanol:acetonitrile=0.1:1-1:0.1. In some embodiments, the solvent may be directly removed to obtain a crude product of the compound as shown by Formula (321), which may be directly used in subsequent reactions.
(155) In some embodiments, the method for preparing the compound as shown by Formula (321) further comprises: contacting the product obtained from the above ion exchanging reaction with a solid phase support with amino or hydroxy groups in an organic solvent under condensation reaction condition in the presence of a condensation agent and an organic base of tertiary amine. In this case, a compound as shown by Formula (321) is obtained, wherein R.sub.4 comprises a group 1 which comprises a hydroxy protecting group and a group 2 which a structure as shown by Formula (C1).
(156) The solid phase support is one of the supports used in solid phase synthesis of siRNA, some of which are well-known to those skilled in the art. For example, the solid phase support may be selected from the solid phase supports containing an active hydroxy or amino functional group, and in one embodiment, is an amino or hydroxy resin. For the purpose of facilitating subsequent solid phase synthesis of nucleic acid, in one embodiment, the amino or hydroxy resin has the following parameters: particle size of 100-400 mesh, and surface amino or hydroxy loading of 0.2-0.5 mmol/g. The ratio of the compound as shown by Formula (321) to the solid phase support is 10-400 mol/g. In one embodiment, the ratio of the compound of Formula (321) to the solid phase support is 30 mol/g to 200 mol/g.
(157) The organic solvent is one or more of acetonitrile, an epoxy solvent, an ether solvent, an haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In one embodiment, the epoxy solvent is dioxane and/or tetrahydrofuran; the ether solvent is diethyl ether and/or methyl tertbutyl ether; the haloalkane solvent is one or more of dichloromethane, trichloromethane and 1,2-dichloroethane. In one embodiment, the organic solvent is acetonitrile. With respect to the compound as shown by Formula (321), the amount of the organic solvent is 20-200 L/mol, and in one embodiment, 50-100 L/mol.
(158) The condensation agent may be benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate, 3-diethoxyphosphoryl-1,2,3-benzotrizin-4(3H)-one and/or O-benzotriazol-tetramethyluronium hexafluorophosphate. In one embodiment, the condensation agent is O-benzotriazol-tetramethyluronium hexafluorophosphate. The molar ratio of the condensation agent to the compound as shown by Formula (321) is 1:1 to 20:1, and in one embodiment, 1:1 to 5:1.
(159) In some embodiments, the organic base of tertiary amine is triethylamine and/or N,N-diisopropylethylamine, and in one embodiment, N,N-diisopropylethylamine. The molar ratio of the organic base of tertiary amine to the compound as shown by Formula (321) is 1:1 to 20:1, and in one embodiment, 1:1 to 5:1.
(160) In some embodiments, the method for preparing the compound as shown by Formula (321) further comprises: contacting the resultant condensation product with a capping agent and an acylation catalyst in an organic solvent under capping reaction condition, and isolating the compound as shown by Formula (321). The capping reaction is used to remove any active functional group that does not completely react, so as to avoid producing unnecessary by-products in subsequent reactions. The capping reaction condition comprises a reaction temperature of 0-50 C., and in one embodiment, 15-35 C., and a reaction time of 1-10 hours, and in one embodiment, 3-6 hours. The capping agent may be a capping agent used in solid phase synthesis of siRNA, which are well-known to those skilled in the art.
(161) In some embodiments, the capping agent is composed of capping agent 1 (cap1) and capping agent 2 (cap2). The cap1 is N-methylimidazole, and in one embodiment, provided as a mixed solution of N-methylimidazole in pyridine/acetonitrile, wherein the volume ratio of pyridine to acetonitrile is 1:10 to 1:1, and in one embodiment, 1:3 to 1:1. In one embodiment, the ratio of the total volume of pyridine and acetonitrile to the volume of N-methylimidazole is 1:1 to 10:1, and in one embodiment, 3:1 to 7:1. The cap2 is acetic anhydride. In one embodiment, the cap2 is provided as a solution of acetic anhydride in acetonitrile, wherein the volume ratio of acetic anhydride to acetonitrile is 1:1 to 1:10, and in one embodiment, 1:2 to 1:6. In some embodiments, the ratio of the volume of the mixed solution of N-methylimidazole in pyridine/acetonitrile to the weight of the compound of Formula (321) is 3 ml/g-30 ml/g, and in one embodiment, 15 ml/g-30 ml/g. The ratio of the volume of the solution of acetic anhydride in acetonitrile to the weight of the compound of Formula (321) is 0.5 ml/g-10 ml/g, and in one embodiment, 1 ml/g-5 ml/g.
(162) In one embodiment, the capping agent comprises equimolar acetic anhydride and N-methylimidazole. The organic solvent is one or more of acetonitrile, an epoxy solvent, an ether solvent, an haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In one embodiment, the organic solvent is acetonitrile. With respect to the compound as shown by Formula (321), the amount of the organic solvent is 10-30 L/mol, and in one embodiment, 3-30 L/mol.
(163) The acylation catalyst may be selected from any catalyst that may be used for esterification condensation or amidation condensation, such as alkaline heterocyclic compounds. In one embodiment, the acylation catalyst is 4-dimethylaminopyridine. The weight ratio of the catalyst to the compound as shown by Formula (321) may be 0.001:1 to 1:1, and in one embodiment, 0.01:1 to 0.1:1.
(164) The compound as shown by Formula (321) may be isolated from the reaction mixture by any suitable separation methods. In some embodiments, the compound of Formula (321) may be obtained by thoroughly washing with an organic solvent and filtering to remove unreacted reactants, excess capping agent and other impurities, wherein the organic solvent is selected from acetonitrile, dichloromethane, or methanol. In one embodiment, the organic solvent is acetonitrile.
(165) In some embodiments, the preparation of the conjugation molecule as shown by Formula (321) comprises contacting a compound as shown by Formula (313) with a phosphorodiamidate in an organic solvent under coupling reaction condition in the presence of a coupling agent, and isolating the compound as shown by Formula (321). In this case, a compound as shown by Formula (321) is obtained, wherein R.sub.4 comprises a group 1 comprising a hydroxy protecting group and a group 2 having a structure as shown by Formula (C3).
(166) The coupling reaction condition comprises a reaction temperature of 0-50 C., such as 15-35 C. The molar ratio of the compound of Formula (313) to the phosphorodiamidate is 1:1 to 1:30, such as 1:5 to 1:15. The molar ratio of the compound of Formula (313) to the coupling agent is 1:1 to 1:100, such as 1:50 to 1:80. The reaction time is 200-3000 seconds, such as 500-1500 seconds. The phosphorodiamidate may be, for example, bis(diisopropylamino)(2-cyanoethoxy)phosphine, which may be commercially available or synthesized according to methods well-known in the art. The coupling agent is selected from one or more of 1H-tetrazole, 5-ethylthio-1H-tetrazole and 5-benzylthio-1H-tetrazole, such as 5-ethylthio-1H-tetrazole. The coupling reaction may be performed in an organic solvent. The organic solvent is selected from one or more of anhydrous acetonitrile, anhydrous DMF and anhydrous dichloromethane, such as anhydrous acetonitrile. With respect to the compound as shown by Formula (313), the amount of the organic solvent is 3-50 L/mol, such as 5-20 L/mol. By performing the coupling reaction, the hydroxy group in the compound (313) reacts with the phosphorodiamidate to form a phosphoramidite group. In some embodiments, the solvent may be directly removed to obtain a crude product of the compound as shown by Formula (321), which may be directly used in subsequent reactions.
(167) In some embodiments, the method for preparing the compound as shown by Formula (321) further comprises: further contacting the isolated product with a solid phase support with hydroxy groups in an organic solvent under coupling reaction condition in the presence of a coupling agent, followed by capping, oxidation, and isolation, to obtain the compound as shown by Formula (321), where R.sub.4 comprises a group 1 comprising a hydroxy protecting group and a group 2 having a structure as shown by Formula (C3).
(168) The solid phase support is a well-known support in the art for solid phase synthesis of a nucleic acid, such as a deprotected universal solid phase support, which is commercially available (NittoPhase HL UnyLinker 300 Oligonucleotide Synthesis Support, Kinovate Life Sciences, as shown by Formula B80):
(169) ##STR00049##
(170) A deprotection reaction is well known to those skilled in the art. In one embodiment, the deprotection condition comprises a temperature of 0-50 C., such as 15-35 C., and a reaction time of 30-300 seconds, such as 50-150 seconds. The deprotection agent may be selected from one or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and monochloroacetic acid. In some embodiments, the deprotection agent is dichloroacetic acid. The molar ratio of the deprotection agent to the protecting group -DMTr (4,4-dimethoxytrityl) on the solid phase support is 2:1 to 100:1, such as 3:1 to 30:1. Through such deprotection, reactive free hydroxy groups are obtained on the surface of the solid phase support, for facilitating the subsequent coupling reaction.
(171) The coupling reaction condition and the coupling agent may be selected as above. Through such a coupling reaction, the free hydroxy groups formed in the deprotection react with the phosphoramidite groups, so as to form a phosphite ester linkage.
(172) The capping reaction condition comprises a temperature of 0-50 C., such as 15-35 C., and a reaction time of 5-500 seconds, such as 10-100 seconds. The capping reaction is carried out in the presence of the capping agent. The selection and amount of the capping agent are as above.
(173) The oxidation reaction condition may comprise a temperature of 0-50 C., such as 15-35 C., and a reaction time of 1-100 seconds, such as 5-50 seconds. The oxidation agent may be, for example, iodine (in some embodiments, provided as iodine water). The molar ratio of the oxidation agent to the phosphite ester group is 1:1 to 100:1, such as 5:1 to 50:1. In some embodiments, the oxidation reaction is performed in a mixed solvent in which the ratio of tetrahydrofuran:water:pyridine=3:1:1-1:1:3.
(174) In one embodiment, R.sub.6 is one of the groups as shown by Formula B7 or B8:
(175) ##STR00050## wherein q.sub.2 is as defined above.
(176) In this case, the compound shown in the Formula (313) may be obtained by the following preparation method comprising: contacting the compound as shown by Formula (314) with a compound as shown by Formula (A-1) or (A-2) in an organic solvent under amidation reaction condition in the presence of a condensation agent for amidation reaction and an organic base of tertiary amine, followed by isolation:
(177) ##STR00051## wherein, the definitions and options of n1, n3, m1, m2, m3, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, R.sub.15, L.sub.1, S.sub.1, q.sub.2 and R.sub.k are respectively as described above.
(178) The amidation reaction condition comprises a reaction temperature of 0-100 C. and a reaction time of 1-48 hours. In one embodiment, the amidation reaction condition comprises a reaction temperature of 10-40 C. and a reaction time of 2-16 hours.
(179) The organic solvent is one or more of an alcohol solvent, an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In one embodiment, the alcohol solvent is one or more of methanol, ethanol and propanol, and in one embodiment, ethanol. In one embodiment, the epoxy solvent is dioxane and/or tetrahydrofuran. In one embodiment, the ether solvent is diethyl ether and/or methyl tert-butyl ether. In one embodiment, the haloalkane solvent is one or more of dichloromethane, trichloromethane and 1,2-dichloroethane. In one embodiment, the organic solvent is dichloromethane. With respect to the compound as shown by Formula (314), the amount of the organic solvent is 3-50 L/mol, and in one embodiment, 3-20 L/mol.
(180) The condensation agent for amidation reaction is benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate, 3-(diethoxyphosphoryl)-1,2,3-benzotrizin-4(3H)-one, 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride, 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline (EEDQ) or O-benzotriazol-tetramethyluronium hexafluorophosphate, and in one embodiment, 3-(diethoxyphosphoryl)-1,2,3-benzotrizin-4(3H)-one. The molar ratio of the condensation agent for amidation reaction to the compound as shown by Formula (314) is 1:1 to 10:1, and in one embodiment, 2.3:1 to 3:1.
(181) The organic base of tertiary amine is triethylamine or N,N-diisopropylethylamine, and in one embodiment, N,N-diisopropylethylamine. The molar ratio of the organic base of tertiary amine to the compound as shown by Formula (314) is 3:1 to 20:1, and in one embodiment, 3:1 to 10:1.
(182) The compounds of Formula (A-1) and (A-2) may be prepared by any suitable means. For example, when R.sub.k is a DMTr group, the compound of Formula (A-1) may be prepared by reacting calcium glycerate with DMTrCl. Similarly, the compound of Formula (A-2) may be prepared by firstly contacting 3-amino-1,2-propanediol with a cyclic anhydride and then reacting with DMTrCl, wherein the cyclic anhydride may have 4-13 carbon atoms, and in one embodiment, 4-8 carbon atoms. It will be readily understood by those skilled in the art that the selections of different cyclic anhydrides correspond to different values for q.sub.2 in the compound of Formula (A-2). For example, when the cyclic anhydride is succinic anhydride, q.sub.2=1; when the cyclic anhydride is glutaric anhydride, q.sub.2=2, and so on.
(183) In some variations, the compound of Formula (313) can also be prepared by successively reacting the compound as shown by Formula (314) with the cyclic anhydride, 3-amino-1,2-propanediol, and DMTrCl. It will be readily understood by those skilled in the art that these variations would not affect the structure and function of the compound of Formula (313), and these variations are readily achieved by those skilled in the art on the basis of the above methods.
(184) Similarly, the compound as shown by Formula (313) may be isolated from the reaction mixture by any suitable isolation methods. In some embodiments, the compound as shown by Formula (313) may be isolated by removal of solvent via evaporation followed by chromatography. For example, the following chromatographic conditions may be used for isolation: normal phase purification of silica gel: 200-300 mesh silica gel filler, with gradient elution of petroleum ether:ethyl acetate:dichloromethane:N,N-dimethylformamide=1:1:1:0.5-1:1:1:0.6; reverse phase purification: C18 and C8 reverse phase fillers, with gradient elution of methanol: acetonitrile=0.1:1-1:0.1. In some embodiments, the solvent may be directly removed to obtain a crude product of the compound as shown by Formula (313), which may be directly used in subsequent reactions.
(185) The compound as shown by Formula (314) may be obtained by the following preparation method comprising: contacting the compound as shown by Formula (313) with haloacetic acid in an organic solvent under deprotection reaction condition, followed by isolation:
(186) ##STR00052##
wherein R.sub.7 is selected from the groups as shown by Formula (330), (331), (332) or (333), and in one embodiment, R.sub.7 has the structure as shown by Formula (330):
(187) ##STR00053##
the definitions and options of n1, n3, m1, m2, m3, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, R.sub.15, L.sub.1 and S.sub.1 are respectively as described above.
(188) The haloacetic acid is selected from one or more of dichloroacetic acid, trichloroacetic acid, monochloroacetic acid and trifluoroacetic acid, and in one embodiment, dichloroacetic acid.
(189) The deprotection reaction condition comprises a reaction temperature of 0-100 C. and a reaction time of 0.1-24 hours, and in one embodiment, a reaction temperature of 10-40 C. and a reaction time of 0.5-16 hours.
(190) The organic solvent is one or more of an epoxy solvent, an ether solvent, an haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In one embodiment, the epoxy solvent is dioxane and/or tetrahydrofuran. In one embodiment, the ether solvent is diethyl ether and/or methyl tert-butyl ether. In one embodiment, the haloalkane solvent is one or more of dichloromethane, trichloromethane and 1,2-dichloroethane. In one embodiment, the organic solvent is dichloromethane. The amount of the organic solvent is 3-50 L/mol, and in one embodiment, 5-20 L/mol, with respect to the compound as shown by Formula (315).
(191) The molar ratio of the haloacetic acid to the compound as shown by Formula (315) is 5:1 to 100:1, and in one embodiment, 10:1 to 50:1.
(192) Similarly, the compound as shown by Formula (314) may be isolated from the reaction mixture by any suitable isolation methods. In some embodiments, the compound as shown by Formula (314) may be isolated by removal of solvent via evaporation followed by chromatography, for example, using the following chromatographic conditions for isolation: normal phase purification of silica gel: 200-300 mesh silica gel filler, with gradient elution of dichloromethane:methanol=100:30-100:40; reverse phase purification: C18 and C8 reverse phase fillers, with gradient elution of methanol:acetonitrile=0.1:1-1:0.1. In some embodiments, the solvent may be directly removed to obtain a crude product of the compound as shown by Formula (314), which may be directly used in subsequent reactions.
(193) The compound as shown by Formula (315) may be obtained by the following method comprising: contacting the compound as shown by Formula (317) with the compound as shown by Formula (316) in an organic solvent under condensation reaction condition in the presence of a condensation agent for amidation reaction and an organic base of tertiary amine, followed by isolation:
(194) ##STR00054##
wherein the definitions and options of n1, n3, m1, m2, m3, R.sub.7, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, R.sub.15, L.sub.1 and S.sub.1 are respectively as described above.
(195) The compound of Formula (316) can be, such as, those disclosed in J. Am. Chem. Soc. 2014, 136, 16938-16961. Alternatively, the compounds of Formula (316) may be prepared by those skilled in the art via various methods. For example, some compounds of Formula (316) may be prepared according to the disclosure in Example 1 of U.S. Pat. No. 8,106,022B2, which is incorporated herein by reference in its entirety.
(196) The condensation reaction condition comprises a reaction temperature of 0-100 C. and a reaction time of 0.1-24 hours, and in one embodiment, a reaction temperature of 10-40 C. and a reaction time of 0.3-16 hours.
(197) The molar ratio of the compound as shown by Formula (316) to the compound as shown by Formula (317) is 2:1 to 10:1, and in one embodiment, 2.3:1 to 3:1. The organic solvent is one or more of acetonitrile, an epoxy solvent, an ether solvent, an haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide and N,N-diisopropylethylamine. In one embodiment, the epoxy solvent is dioxane and/or tetrahydrofuran. In one embodiment, the ether solvent is diethyl ether and/or methyl tert-butyl ether. In one embodiment, the haloalkane solvent is one or more of dichloromethane, trichloromethane and 1,2-dichloroethane. In one embodiment, the organic solvent is acetonitrile. With respect to the compound as shown by Formula (317), the amount of the organic solvent is 3-30 L/mol, and in one embodiment, 3-20 L/mol.
(198) The condensation agent for amidation reaction is benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate, 3-(diethoxyphosphoryl)-1,2,3-benzotrizin-4(3H)-one (DEPBT), O-benzotriazol-tetramethyluronium hexafluorophosphate or 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride, and in one embodiment, 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride. The molar ratio of the condensation agent for amidation reaction to the compound as shown by Formula (317) is 2:1 to 10:1, and in one embodiment, 2.3:1 to 3:1.
(199) The organic base of tertiary amine is N-methylmorpholine, triethylamine or N,N-diisopropylethylamine, and in one embodiment, N-methylmorpholine. The molar ratio of the organic base of tertiary amine to the compound as shown by Formula (317) is 3:1 to 20:1, and in one embodiment, 3:1 to 10:1.
(200) Similarly, the compound as shown by Formula (313) may be isolated from the reaction mixture by any suitable isolation methods. In some embodiments, the compound as shown by Formula (313) is isolated by removal of solvent via evaporation followed by chromatography, for example, using the following chromatographic conditions for isolation:normal phase purification of silica gel: 200-300 mesh silica gel filler, with gradient elution of dichloromethane:methanol=100:3-100:7; reverse phase purification: C18 and C8 reverse phase fillers, with gradient elution of methanol: acetonitrile=0.1:1-1:0.1. In some embodiments, the solvent is directly removed to obtain a crude product of the compound as shown by Formula (313), which may be directly used in subsequent reactions.
(201) In some embodiments, the compound of Formula (317) reacts with a sufficient amount of one compound of Formula (316) in one batch to obtain the desired compound of Formula (313), wherein all S.sub.1-L.sub.1 moieties are identical. In some embodiments, the compound of Formula (317) is reacted with different compounds of Formula (316) in batches as desired, i.e., the compounds of Formula (316) having different L.sub.1 and/or S.sub.1, so as to obtain the compound of Formula (315) having more than two types of S.sub.1 and/or L.sub.1 therein. For example, 1 eq of the compound of Formula (317) may be firstly contacted with 2 eq of the first compound of Formula (316) to attach a first S.sub.1-L.sub.1 moieties to the two terminal primary amine groups in the compound of Formula (317), and then contacted with the (n3+n11) eq of the second compound of Formula (316) to attach a second S.sub.1-L.sub.1 moieties to the (n3+n11) secondary amine groups in the compound of Formula (317), wherein the definition and ranges of n3 and n1 are as described above.
(202) The compound as shown by Formula (317) may be obtained by the following method comprising: contacting the compound as shown by Formula (318) with aqueous methylamine solution under deprotection reaction condition in the presence of an organic solvent, followed by isolation:
(203) ##STR00055##
wherein the definitions and options of n1, n3, m1, m2, m3, R.sub.7, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14 and R.sub.15 are respectively as defined above.
(204) The deprotection reaction condition comprises a reaction temperature of 0-130 C. and a reaction time of 3-72 hours, and in one embodiment, a reaction temperature of 20-80 C. and a reaction time of 10-30 hours.
(205) The organic solvent is selected from alcohols, in one embodiment, is one of methanol, ethanol and isopropanol, and in one embodiment, methanol. The amount of the organic solvent is 1-20 L/mol, and in one embodiment, 1.5-10 L/mol, with respect to the compound as shown by Formula (318).
(206) The concentration of the aqueous methylamine solution is 30-40 wt %, and the molar ratio of methylamine to the compound as shown by Formula (318) is 10:1 to 500:1, and in one embodiment, 50:1 to 200:1.
(207) Similarly, the compound as shown by Formula (317) may be isolated from the reaction mixture using any suitable isolation methods. In some embodiments, the compound as shown by Formula (317) may be isolated by removal of solvent via evaporation followed by chromatography, for example, using the following chromatographic conditions for isolation: normal phase purification of silica gel: 200-300 mesh silica gel filler, with gradient elution of dichloromethane:methanol:aqueous ammonia (25 wt %)=1:1:0.05-1:1:0.25; reverse phase purification: C18 and C8 reverse phase fillers, with gradient elution of methanol:acetonitrile=0.1:1-1:0.1. In some embodiments, the solvent may be directly removed to obtain a crude product of the compound as shown by Formula (317), which may be directly used in subsequent reactions.
(208) The compound as shown by Formula (318) may be obtained by the following method comprising: contacting the compound as shown by Formula (319) with triphenylchloromethane (TrCl), diphenylethylphenylchloromethane, phenyldiethylphenylchloromethane or triethylphenylchloromethane, and in one embodiment, with triphenylchloromethane (TrCl) under substitution reaction condition in the presence of an organic solvent, followed by isolation:
(209) ##STR00056##
wherein the definitions and options of n1, n3, m1, m2, m3, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14 and R.sub.15 are respectively as described above.
(210) The substitution reaction condition comprises a reaction temperature of 0-100 C. and a reaction time of 5-72 hours, and in one embodiment, a reaction temperature of 10-40 C. and a reaction time of 10-30 hours.
(211) Triphenylchloromethane (TrCl), diphenylethylphenylchloromethane, phenyldiethylphenylchloromethane or triethylphenylchloromethane are commercially available. The molar ratio of triphenylchloromethane (TrCl), diphenylethylphenylchloromethane, phenyldiethylphenylchloromethane or triethylphenylchloromethane to the compound as shown by Formula (319) is 1:1 to 10:1, and in one embodiment, 1:1 to 3:1.
(212) The organic solvent is one or more of an epoxy solvent, an ether solvent, an haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In one embodiment, the epoxy solvent is dioxane and/or tetrahydrofuran. In one embodiment, the ether solvent is diethyl ether and/or methyl tert-butyl ether. In one embodiment, the haloalkane solvent is one or more of dichloromethane, trichloromethane and 1,2-dichloroethane. In one embodiment, the organic solvent is dichloromethane. With respect to the compound as shown by Formula (319), the amount of the organic solvent is 3-50 L/mol, and in one embodiment, 5-20 L/mol.
(213) Similarly, the compound as shown by Formula (318) may be isolated from the reaction mixture by any suitable isolation methods. In some embodiments, the compound as shown by Formula (318) may be isolated by removal of solvent via evaporation followed by chromatography, for example, using the following chromatographic conditions for isolation: normal phase purification of silica gel: 200-300 mesh silica gel filler, with gradient elution of methanol:dichloromethane=0.01:1-0.5:1 or gradient elution of methanol:dichloromethane:ethyl acetate:petroleum ether=0.1:1:1:1-1:1:1:1; reverse phase purification: C18 and C8 reverse phase fillers, with gradient elution of methanol:acetonitrile=0.1:1-1:0.1. In some embodiments, the solvent may be directly removed to obtain a crude product of the compound as shown by Formula (318), which may be directly used in subsequent reactions.
(214) The compound as shown by Formula (319) may be obtained by the following method comprising: contacting the compound as shown by Formula (320) with ethyl trifluoroacetate in an organic solvent under substitution reaction condition, followed by isolation:
(215) ##STR00057##
wherein the definitions and options of n1, n3, m1, m2, m3, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14 and R.sub.15 are respectively as described above.
(216) The organic solvent is one or more of acetonitrile, an epoxy solvent, an ether solvent, an haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In one embodiment, the epoxy solvent is dioxane and/or tetrahydrofuran. In one embodiment, the ether solvent is diethyl ether and/or methyl tert-butyl ether. In one embodiment, the haloalkane solvent is one or more of dichloromethane, trichloromethane and 1,2-dichloroethane. In one embodiment, the organic solvent is acetonitrile. With respect to the compound as shown by Formula (320), the amount of the organic solvent is 1-30 L/mol, and in one embodiment, 1-20 L/mol.
(217) The substitution reaction condition comprises a reaction temperature of 0-100 C. and a reaction time of 5-72 hours, and in one embodiment, a reaction temperature of 10-40 C. and a reaction time of 10-30 hours.
(218) The compound as shown by Formula (320) may be commercially available, or obtained by those skilled in the art via the known methods. For example, in the case that m1=m2=m3=3, n1=1, n3=2, and R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14 and R.sub.15 are all H, the compound as shown by Formula (320) is commercially available from Alfa Aesar Inc.
(219) The molar ratio of ethyl trifluoroacetate to the compound as shown by Formula (320) is 2:1 to 10:1, and in one embodiment, 3:1 to 5:1.
(220) Similarly, the compound as shown by Formula (319) may be isolated from the reaction mixture using any suitable isolation methods. In some embodiments, the compound as shown by Formula (319) may be isolated by removal of solvent via evaporation followed by chromatography, for example, using the following chromatographic conditions for isolation: normal phase purification of silica gel: 200-300 mesh silica gel filler, with gradient elution of methanol:dichloromethane=0.01:1-0.5:1 or gradient elution of methanol:dichloromethane:ethyl acetate:petroleum ether=0.1:1:1:1-1:1:1:1; reverse phase purification: C18 and C8 reverse phase fillers, with gradient elution of methanol:acetonitrile=0.1:1-1:0.1. In some embodiments, the solvent may be directly removed to obtain a crude product of the compound as shown by Formula (319), which may be directly used in subsequent reactions.
(221) In the siRNA of the siRNA conjugate of the present disclosure, each pair of adjacent nucleotides is linked via a phosphodiester bond or phosphorothioate diester bond. The non-bridging oxygen or sulfur atom in the phosphodiester bond or phosphorothioate diester bond is negatively charged, and may be present in the form of hydroxy or sulfhydryl. Moreover, the hydrogen ion in the hydroxy or sulfhydryl may be partially or completely substituted with a cation. The cation may be any cation, such as a metal cation, an ammonium cation NH4.sup.+ or an organic ammonium cation. In order to increase solubility, in one embodiment, the cation is selected from one or more of an alkali metal cation, an ammonium cation formed by a tertiary amine and a quaternary ammonium cation. The alkali metal ion may be K.sup.+ and/or Na.sup.+, and the cation formed by a tertiary amine may be an ammonium cation formed by triethylamine and/or an ammonium cation formed by N,N-diisopropylethylamine. Thus, the siRNA conjugate of the present disclosure may be at least partially present in the form of salt. In one embodiment, non-bridging oxygen atom or sulfur atom in the phosphodiester bond or phosphorothioate diester bond at least partly binds to sodium ion, and thus the siRNA conjugate of the present disclosure is present or partially present in the form of sodium salt.
(222) Those skilled in the art clearly know that a modified nucleotide may be introduced into the siRNA of the conjugate of the present disclosure by a nucleoside monomer with a corresponding modification. The methods for preparing a nucleoside monomer having the corresponding modification and the methods for introducing a modified nucleotide into a siRNA are also well-known to those skilled in the art. All modified nucleoside monomers may be either commercially available or prepared by known methods.
(223) Use of the siRNA Conjugate of the Present Disclosure
(224) The siRNA conjugate of the present disclosure has excellent liver targeting specificity, and thus is able to efficiently deliver the conjugated siRNA to the liver and effectively regulate the expression of hepatitis B virus gene in hepatocytes. Hence, the siRNA conjugate of the disclosure has a wide application prospect.
(225) According to one embodiment of the present disclosure, the disclosure provides use of the siRNA conjugate of the present disclosure in the manufacture of a medicament for treating and/or preventing a pathological condition or disease caused by hepatitis B virus infection.
(226) According to one embodiment of the present disclosure, the disclosure provides a method for treating and/or preventing a pathological condition or disease caused by hepatitis B virus infection, which comprises administering an effective amount of the siRNA conjugate of the present disclosure to a patient.
(227) According to another embodiment of the present disclosure, the disclosure provides a method for inhibiting the expression of hepatitis B virus gene, which comprises contacting an effective amount of the siRNA conjugate of the present disclosure with hepatitis cells infected with hepatitis B virus.
(228) In some embodiments, the pathological condition or disease caused by hepatitis B virus infection is selected from one or more of chronic liver disease, hepatitis, hepatic fibrosis disease and liver proliferative disease. In one embodiment, the pathological condition or disease caused by hepatitis B virus is hepatitis B (HBV).
(229) The purpose of treating hepatitis B may be achieved through the mechanism of RNA interference by administering the siRNA conjugate of the present disclosure to a patient in need thereof. Therefore, the siRNA conjugate of the present disclosure may be used for preventing and/or treating hepatitis B, or for preparing a medicament for preventing and/or treating hepatitis B.
(230) As used herein, the term administration/administer refers to the delivery of the siRNA conjugate into a patient's body by a method or a route that at least partly locates the siRNA conjugate at a desired site to produce a desired effect. Suitable administration routes for the methods of the present disclosure include topical administration and systemic administration. In general, topical administration results in the delivery of more siRNA conjugate to a particular site compared with the whole body of the patient; whereas systemic administration results in the delivery of the siRNA conjugate to substantially the whole body of the patient. The present disclosure is primarily intended to provide a means for preventing and/or treating hepatitis B, for example, an administration mode capable of delivering a drug to the liver.
(231) The administration to a patient may be achieved by any suitable routes known in the art, including but not limited to, oral and parenteral route, such as intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, intratracheal administration (aerosol), pulmonary administration, nasal administration, rectal administration, and topical administration (including buccal administration and sublingual administration). The administration frequency may be once or more times daily, weekly, monthly, or yearly.
(232) The dose of the siRNA conjugate of the present disclosure may be a conventional dose in the art, which may be determined according to various parameters, especially age, weight and gender of a patient. Toxicity and efficacy may be measured in cell cultures or experimental animals by standard pharmaceutical procedures, for example, by determining LD50 (the lethal dose that causes 50% population death) and ED50 (the dose that can cause 50% of the maximum response intensity in a graded response, and that causes 50% of the experimental subjects to have a positive response in a qualitative response). The dose range for human may be derived based on data obtained from cell culture assays and animal studies.
(233) When administering the siRNA conjugate of the present disclosure, for example, to male or female C57BL/6J or C3H/HeNCrlVr mice of 6-12 weeks old and 18-25 g body weight, for the siRNA conjugate of the present disclosure, the amount of the siRNA may be 0.001-100 mg/kg body weight, such as 0.01-50 mg/kg body weight, 0.05-20 mg/kg body weight, or 0.1-10 mg/kg body weight, as calculated based on the amount of the siRNA in the siRNA conjugate.
(234) In addition, the purpose of inhibiting the expression of HBV genes in hepatitis cells infected with chronic HBV may also be achieved through the mechanism of RNA interference by introducing the siRNA conjugate of the present disclosure into the hepatitis cells infected with chronic HBV. In some embodiments, the cells are HepG2.2.15 cells. In the case where the expression of HBV genes in cells is inhibited by using the method provided by the present disclosure, the amount of siRNA in the provided siRNA, the pharmaceutical composition, and/or the siRNA conjugate is typically an amount sufficient to reduce the expression of the target gene and result in an extracellular concentration of 1 pM to 1 M, or 0.01 nM to 100 nM, or 0.05 nM to 50 nM or 0.05 nM to about 5 nM on the surface of the target cells. The amount required to achieve this local concentration will vary with various factors, including the delivery method, the delivery site, the number of cell layers between the delivery site and the target cells or tissues, the delivery route (topical or systemic), etc. The concentration at the delivery site may be significantly higher than that on the surface of the target cells or tissues.
(235) Kit
(236) The present disclosure provides a kit comprising an effective amount of the siRNA conjugate of the present disclosure.
(237) In other embodiments of the kit of the present disclosure, the siRNA conjugate may be kept in one container, while the kit comprises or does not comprise at least another container for providing or not providing pharmaceutically acceptable excipients. In addition to the siRNA conjugate and optional pharmaceutically acceptable excipients, the kit may further comprise additional ingredients, such as stabilizers or preservatives. The additional ingredients may be comprised in the kit, but present in a container other than that for providing the siRNA conjugate and optional pharmaceutically acceptable excipients. In these embodiments, the kit may comprise an instruction for mixing the siRNA conjugate with pharmaceutically acceptable excipients (if any) or other ingredients.
(238) In the kit of the present disclosure, the siRNA conjugate and optional pharmaceutically acceptable excipients may be provided in any form, e.g., in a liquid form, a dry form, or a lyophilized form. In some embodiments, the siRNA conjugate and optional pharmaceutically acceptable excipients are substantially pure and/or sterile. Sterile water may optionally be provided in the kits of the present disclosure.
(239) Hereinafter, the present disclosure will be further illustrated with reference to the Preparation Examples and Examples, but is not limited thereto in any respect.
EXAMPLES
(240) Hereinafter, the present disclosure will be described with reference to the examples. Unless otherwise specified, the reagents and culture media used in following examples are all commercially available, and the procedures used such as nucleic acid electrophoresis and real-time PCR are all performed according to methods described in Molecular Cloning (Cold Spring Harbor LaBboratory Press (1989)).
(241) Unless otherwise specified, ratios of the reagents provided below are all calculated by volume ratio (v/v).
Preparation Example 1 Preparation of Conjugates 1-3
(242) In this preparation example, Conjugates 1-2 (hereinafter also referred to as L10-siHB3M1SVP conjugate and L10-siHB3M1SP conjugate) were synthesized. Conjugate 3 (hereinafter also referred to as L10-siHB3M1SPs conjugate) is planned to be synthesized. The conjugates were those formed by conjugating the L-9 conjugation molecule to the siRNAs numbered as siHB3M1SVP, siHB3M1SP or siHB3M1SPs, respectively. The conjugated siRNA sequences in the conjugates are shown in Table 3.
(243) (1-1) Synthesis of Compound L-10
(244) Compound L-10 was synthesized according to the following method.
(245) ##STR00058## ##STR00059## ##STR00060##
(1-1-1) Synthesis of GAL-5 (a Terminal Segment of the Conjugation Molecule)
(246) ##STR00061##
(1-1-1a) Synthesis of GAL-2
(247) 100.0 g of GAL-1 (N-acetyl-D-galactosamine hydrochloride, CAS No.: 1772-03-8, purchased from Ning Bo hongxiang bio-chem Co., Ltd., 463.8 mmol) was dissolved in 1000 ml of anhydrous pyridine, to which 340 ml of acetic anhydride (purchased from Enox Inc., 3363.6 mmol) was added in an ice water bath to react under stirring at room temperature for 1.3 hours. The resultant reaction solution was poured into 10 L of ice water and subjected to suction filtration under reduced pressure. The residue was washed with 2 L of ice water, and then added with a mixed solvent of acetonitrile/toluene (v/v ratio=1:1) until completely dissolved. The solvent was removed by evaporation to give 130.0 g of product GAL-2 as a white solid.
(248) (1-1-1b) Synthesis of GAL-3
(249) GAL-2 (35.1 g, 90.0 mmol) obtained in step (1-1-1a) was dissolved in 213 ml of anhydrous 1,2-dichloroethane, to which 24.0 g of TMSOTf (CAS No.: 27607-77-8, purchased from Macklin Inc., 108.0 mmol) was added in an ice water bath and nitrogen atmosphere to react at room temperature overnight.
(250) The reaction solution was added with 400 ml dichloromethane for dilution, filtered with diatomite, and then added with 1 L saturated aqueous sodium bicarbonate solution and stirred evenly. The organic phase was isolated. The aqueous phase remained was extracted twice, each with 300 ml of dichloroethane, and the organic phases were combined and washed with 300 ml of saturated aqueous sodium bicarbonate solution and 300 ml of saturated brine, respectively. The organic phase was isolated and dried with anhydrous sodium sulfate. The solvent was removed by evaporation to dryness under reduced pressure to give 26.9 g of product GAL-3 as a light yellow viscous syrup.
(251) (1-1-1c) Synthesis of GAL-4
(252) GAL-3 (26.9 g, 81.7 mmol) obtained in step (1-1-1b) was dissolved in 136 ml of anhydrous 1,2-dichloroethane, added with 30 g of dry 4 molecular sieve powder followed by 9.0 g of 5-hexen-1-ol (CAS No.: 821-41-0, purchased from Adamas-beta Inc., 89.9 mmol), and stirred at room temperature for 30 minutes. 9.08 g of TMSOTf (40.9 mmol) was added in an ice bath and nitrogen atmosphere to react under stirring at room temperature overnight. The 4 molecular sieve powder was removed by filtration. The filtrate was added with 300 ml dichloroethane for dilution, filtered with diatomite, and then added with 300 ml of saturated aqueous sodium bicarbonate solution and stirred for 10 minutes for washing. The organic phase was isolated. The aqueous phase was extracted once with 300 ml of dichloroethane. The organic phases were combined and washed with 300 ml of saturated aqueous sodium bicarbonate solution and 300 ml of saturated brine, respectively. The organic phase was isolated and dried with anhydrous sodium sulfate. The solvent was removed by evaporation to dryness under reduced pressure to give 41.3 g of product GAL-4 as a yellow syrup, which was directly used in the next oxidation reaction without purification.
(253) (1-1-1d) Synthesis of GAL-5
(254) GAL-4 (14.9 g, 34.7 mmol) obtained according to the method described in step (1-1-1c) was dissolved in a mixed solvent of 77 ml of dichloromethane and 77 ml of acetonitrile, added with 103 ml of deionized water and 29.7 g of sodium periodate (CAS No.: 7790-28-5, purchased from Aladdin Inc., 138.8 mmol) respectively, and stirred in an ice bath for 10 minutes. Ruthenium trichloride (CAS No.: 14898-67-0, available from Energy Chemical, 238 mg, 1.145 mmol) was added to react at room temperature overnight. The resultant reaction solution was diluted by adding 300 ml of water under stirred, and adjusted to a pH of about 7.5 by adding saturated sodium bicarbonate. The organic phase was isolated and discarded. The aqueous phase was extracted three times, each with 200 ml of dichloromethane, and the organic phase was discarded. The aqueous phase was adjusted to a pH of about 3 with citric acid solids and extracted three times, each with 200 ml of dichloromethane, and the resultant organic phases were combined and dried with anhydrous sodium sulfate. The solvent was removed by evaporation to dryness under reduced pressure to give 6.83 g of product GAL-3 as a white foamy solid. .sup.1H NMR (400 MHz, DMSO) 12.01 (br, 1H), 7.83 (d, J=9.2 Hz, 1H), 5.21 (d, J=3.2 Hz, 1H), 4.96 (dd, J=11.2, 3.2 Hz, 1H), 4.49 (d, J=8.4 Hz, 1H), 4.07-3.95 (m, 3H), 3.92-3.85 (m, 1H), 3.74-3.67 (m, 1H), 3.48-3.39 (m, 1H), 2.20 (t, J=6.8 Hz, 2H), 2.11 (s, 3H), 2.00 (s, 3H), 1.90 (s, 3H), 1.77 (s, 3H), 1.55-1.45 (m, 4H).
(255) (1-1-2) Synthesis of M-11-T3
(256) ##STR00062##
(257) J-0 (1.883 g, 10 mmol, purchased from Alfa Aesar) was dissolved in 25 ml of acetonitrile, added with triethylamine (4.048 g, 40 mmol), and cooled to 0 C. in an ice water bath. Ethyl trifluoroacetate (5.683 g, 40 mmol) was added to react at room temperature for 22 hours. The solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump for 18 hours to give 5.342 g of crude solid product M-11-T3, which was directly used in subsequent reaction without further purification. MS m/z: C15H22F9N4O3, [M+H]+, calculated: 477.35. measured: 477.65.
(258) (1-1-3) Synthesis of M-11-T3-Tr
(259) ##STR00063##
(260) The crude product M-11-T3 (5.342 g, 10 mmol) was dissolved in 50 ml of dichloromethane. The resultant reaction solution was added with TrCl (3.345 g, 12 mmol) and triethylamine (1.518 g, 15 mmol) to react under stirring at room temperature for 20 hours. The reaction solution was washed twice, each with 20 ml of saturated sodium bicarbonate and once with 20 ml of saturated brine. The organic phase was dried with anhydrous sodium sulfate and filtered. The organic solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump overnight to give 7.763 g of crude solid product M-11-T3-Tr. MS m/z: C34H36F9N4O3, [M+Na]+, calculated: 741.25. measured: 741.53. The crude solid product M-11-T3-Tr was then used in the next step for synthesis of M-18-Tr without purification.
(261) (1-1-4) Synthesis of M-18-Tr
(262) ##STR00064##
(263) The crude product M-11-T3-Tr (7.763 g, 10 mmol) obtained in step (1-1-3) was dissolved in 100 ml of methanol, and added with 100 ml of aqueous methylamine solution (40 weight %) to react under stirring at 50 C. for 23 hours. Insoluble particles were removed by filtration. The solvent was removed by evaporation to dryness under reduced pressure, and the residue was added with 200 ml of mixed solvent of dichloromethane:methanol in a volume ratio of 1:1, washed with 50 ml of saturated sodium bicarbonate. The aqueous phase obtained was extracted three times, each with 50 ml of dichloromethane (DCM). The organic phases were combined, dried with anhydrous sodium sulfate and filtered. The solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump overnight, and purified by using a normal phase silica gel column (200-300 mesh). The column was packed with petroleum ether, added with 1 wt % triethylamine for neutralizing the acidity of silica gel, and eluted with a gradient elution of dichloromethane:methanol:aqueous ammonia (25 wt %)=1:1:0.05-1:1:0.25. The eluate was collected, the solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump to give 2.887 g of pure product M-18-Tr. .sup.1H NMR (400 MHz, DMSO) 7.47-7.39 (m, 6H), 7.32-7.24 (m, 6H), 7.19-7.12 (m, 3H), 2.60-2.47 (m, 4H), 2.46-2.19 (m, 13H), 1.70-1.55 (m, 4H), 1.40 (p, J=6.8 Hz, 2H). MS m/z: C.sub.28H.sub.39N.sub.4, [M+H]+, calculated: 431.65, measured: 432.61.
(264) (1-1-5) Synthesis of L-5-Tr
(265) ##STR00065##
(266) M-18-Tr (2.02 g, 4.69 mmol) obtained in step (1-1-4) and GAL-5 (6.93 g, 15.48 mmol) obtained in step (1-1-1) were mixed and dissolved in 47 ml of acetonitrile, and added with N-methylmorpholine (3.13 g, 30.96 mmol) and 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (DMTMM, 4.28 g, 15.48 mmol) to react under stirring at room temperature for 2 hours. The resultant reaction solution was diluted with 200 ml of dichloromethane for dilution. The organic phase was washed with 100 ml of a saturated sodium bicarbonate solution and 100 ml of saturated brine, dried with anhydrous sodium sulfate, and filtered. Then the solvent was removed by evaporation to dryness under reduced pressure to give a crude product. The crude product was purified by using a normal phase silica gel column (200-300 mesh). The column was packed with petroleum ether, added with 1 wt % triethylamine for neutralizing the acidity of silica gel, and eluted with a gradient elution of dichloromethane:methanol=100:5-100:7. The eluate was collected, and evaporated to dryness under reduced pressure to give 7.49 g of pure product L-5-Tr. .sup.1H NMR (400 MHz, DMSO) 7.83-7.10 (m, 4H), 7.67-7.60 (m, 1H), 7.44-7.34 (m, 6H), 7.33-7.24 (m, 6H), 7.20-7.15 (m, 3H), 5.22 (s, 3H), 4.97 (d, J=11.3 Hz, 3H), 4.49 (d, J=8.4 Hz, 3H), 4.06-3.07 (m, 9H), 3.95-3.83 (m, 3H), 3.77-3.64 (m, 3H), 3.45-3.35 (m, 3H), 3.12-2.87 (m, 8H), 2.30-2.15 (m, 3H), 2.11-1.98 (m, 22H), 1.95-1.84 (m, 11H), 1.81-1.61 (m, 14H), 1.54-1.36 (m, 14H). MS m/z: C85H119N7O30, [M+H]+, calculated: 1718.81. measured: 1718.03.
(267) (1-1-6) Synthesis of L-8
(268) ##STR00066##
(269) L-5-Tr (5.94 g, 3.456 mmol) obtained in step (1-1-5) was dissolved in 69 ml of dichloromethane, and added with dichloroacetic acid (13.367 g, 103.67 mmol) to react at room temperature for 2 hours. The resultant reaction solution was diluted by adding 100 ml of dichloromethane, washed and adjusted to pH 7-8 with saturated sodium bicarbonate solution. The aqueous phase was extracted six times, each with 30 ml of dichloromethane. The organic phases were combined, dried with anhydrous sodium sulfate, and filtered. Then the solvent was removed by evaporation to dryness under reduced pressure to give a crude product. The crude product was purified by using a normal phase silica gel (200-300 mesh). The column was adding with 10 wt % triethylamine for neutralizing the acidity of silica gel and equilibrated with 1 wt % triethylamine, and eluted with a gradient elution of dichloromethane:methanol=100:30-100:40. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give 4.26 g of pure product L-8. .sup.1H NMR (400 MHz, DMSO) 7.84 (d, J=9.0 Hz, 3H), 7.27-7.23 (m, 1H), 7.13-7.18 (m, 1H), 5.22 (d, J=3.1 Hz, 3H), 4.97 (dd, J=11.3, 3.1 Hz, 3H), 4.48 (d, J=8.4 Hz, 3H), 4.09-3.98 (m, 9H), 3.88 (dd, J=19.3, 9.3 Hz, 3H), 3.75-3.66 (m, 3H), 3.44-3.38 (m, 3H), 3.17-3.30 (m, 4H), 3.10-2.97 (m, 4H), 2.35-2.20 (m, 6H), 2.15-2.08 (m, 9H), 2.07-1.98 (m, 13H), 1.94-1.87 (m, 9H), 1.81-1.74 (m, 9H), 1.65-1.42 (m, 18H). MS m/z: C85H119N7O30, [M+H]+, calculated: 1477.59. measured: 1477.23.
(270) (1-1-7a) Synthesis of A-1
(271) ##STR00067##
(272) DMTrCl (4,4-dimethoxytrityl chloride, 38.12 g, 112.3 mmol) was dissolved in 430 ml of anhydrous pyridine, and added with calcium DL-glycerate hydrate (12.88 g, 43.0 mmol) to react at 43 C. for 22 hours. The resultant reaction solution was filtered. The residue was rinsed with 200 ml of DCM, and the filtrate was concentrated to dryness under reduced pressure. The residue was redissolved in 300 ml of dichloromethane and washed twice, each with 200 ml of 0.5 M triethylamine phosphate (pH=7-8). The aqueous phase was extracted twice, each with 200 ml of dichloromethane. The organic phases were combined, dried with anhydrous sodium sulfate, and filtered. The solvent was removed by evaporation to dryness under reduced pressure, and the residue was purified by using a normal phase silica gel column (200-300 mesh) which was eluted with a gradient elution of petroleum ether:ethyl acetate:dichloromethane:methanol=1:1:1:0.35-1:1:1:0.55. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure. The residue was redissolved in 500 ml of dichloromethane, and washed once with 200 ml of 0.5 M triethylamine phosphate. The aqueous phase was extracted twice, each with 200 ml of dichloromethane. The organic phases were combined, dried with anhydrous sodium sulfate, and filtered. The solvent was removed by evaporation to dryness under reduced pressure, and the residue was subjected to suction filtration to dryness in a vacuum oil pump overnight to give 20.7 g of product A-1 as a white solid. .sup.1H NMR (400 MHz, DMSO-d6) 7.46 (ddd, J=6.5, 2.3, 1.1 Hz, 1H), 7.40-7.28 (m, 7H), 6.89-6.81 (m, 4H), 4.84 (d, J=5.0 Hz, 1H), 4.36-4.24 (m, 1H), 4.29 (s, 6H), 3.92 (dd, J=12.4, 7.0 Hz, 1H), 3.67 (dd, J=12.3, 7.0 Hz, 1H), 2.52 (q, J=6.3 Hz, 6H), 1.03 (t, J=6.3 Hz, 9H). MS m/z: C24H23O6, [MH], calculated: 407.15. measured: 406.92.
(273) (1-1-7b) Synthesis of L-7
(274) ##STR00068##
(275) L-8 (2.262 g, 1.532 mmol) obtained in step (1-1-6) and A-1 (2.342 g, 4.596 mmol) obtained in step (1-1-7a) were mixed and dissolved in 16 ml of dichloromethane, added with 3-(diethoxyphosphoryl)-1,2,3-benzotrizin-4(3H)-one (DEPBT) (1.375 g, 4.596 mmol), and further added with diisopropylethylamine (1.188 g, 9.191 mmol) to react under stirring at 25 C. for 2 hours. The organic phase was washed with 10 ml of saturated sodium bicarbonate. The aqueous phase was extracted three times, each with 10 ml of dichloromethane. The organic phase was washed with 10 ml of saturated brine, and the aqueous phase was extracted twice, each with 10 ml of dichloromethane, and the organic phases were combined, dried with anhydrous sodium sulfate and filtered. The solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump overnight to give 4.900 g of crude product. The crude product was subjected to a column purification. The column was filled with 120 g normal phase silica gel (200-300 mesh), added with 20 m1 triethylamine for neutralizing the acidity of silica gel, equilibrated with petroleum ether containing 1 wt % triethylamine, and eluted with a gradient elution of petroleum ether:ethyl acetate:dichloromethane:N,N-dimethylformamide=1:1:1:0.5-1:1:1:0.6. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give 2.336 g of pure product L-7. .sup.1H NMR (400 MHz, DMSO) 7.90-7.78 (m, 4H), 7.75-7.64 (m, 1H), 7.38-7.18 (m, 9H), 6.91-6.83 (m, 4H), 5.25-5.10 (m, 4H), 4.97 (dd, J=11.2, 3.2 Hz, 3H), 4.48-4.30 (m, 4H), 4.02 (s, 9H), 3.93-3.84 (m, 3H), 3.76-3.66 (m, 9H), 3.45-3.35 (m, 3H), 3.24-2.98 (m, 10H), 2.30-2.20 (m, 2H), 2.11-1.88 (m, 31H), 1.80-1.40 (m, 28H). MS m/z: C90H128N7O35, [M-DMTr]+, calculated: 1564.65. measured: 1564.88.
(276) (1-1-8) Synthesis of the L-9 Conjugation Molecule
(277) ##STR00069##
(278) L-7 (2.300 g, 1.26 mmol) obtained in step (1-1-7), succinic anhydride (0.378 g, 3.78 mmol) and 4-dimethylaminopyridine (DMAP, 0.462 g, 3.78 mmol) were mixed and dissolved in 13 ml of dichloromethane, further added with diisopropylethylamine (DIEA, 0.814 g, 6.30 mmol), and stirred at 25 C. for 24 hours. The resultant reaction solution was washed with 5 ml of 0.5 M triethylamine phosphate. The aqueous phase was extracted three times, each with 5 ml of dichloromethane. The organic phases were combined and removed by evaporation to dryness under reduced pressure to give 2.774 g of crude product. The crude product was subjected to a column purification. The column was filled 60 g normal phase silica gel (200-300 mesh), added with 1 wt % triethylamine for neutralizing the acidity of silica gel, equilibrated with dichloromethane, and eluted with a gradient elution of 1 wt % triethylamine-containing dichloromethane:methanol=100:18-100:20. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give 1.874 g of pure product L-9 conjugation molecule. .sup.1H NMR (400 MHz, DMSO) 8.58 (d, J=4.2 Hz, 1H), 7.94-7.82 (m, 3H), 7.41-7.29 (m, 5H), 7.22 (d, J=8.1 Hz, 5H), 6.89 (d, J=8.3 Hz, 4H), 5.49-5.37 (m, 1H), 5.21 (d, J=3.0 Hz, 3H), 4.97 (d, J=11.1 Hz, 3H), 4.49 (d, J=8.2 Hz, 3H), 4.02 (s, 9H), 3.88 (dd, J=19.4, 9.4 Hz, 3H), 3.77-3.65 (m, 9H), 3.50-3.39 (m, 6H), 3.11-2.90 (m, 5H), 2.61-2.54 (m, 4H), 2.47-2.41 (m, 2H), 2.26-2.17 (m, 2H), 2.15-1.95 (m, 22H), 1.92-1.84 (m, 9H), 1.80-1.70 (m, 10H), 1.65-1.35 (m, 17H), 1.31-1.19 (m, 4H), 0.96 (t, J=7.1 Hz, 9H). MS m/z: C94H132N7O38, [M-DMTr]+, calculated: 1664.72. measured: 1665.03.
(279) (1-1-9) Synthesis of Compound L-10
(280) ##STR00070##
In this step, a compound L-10 was prepared by linking the L-9 conjugation molecule to a solid phase support.
(281) The L-9 conjugation molecule (0.233 g, 0.1126 mmol) obtained in step (1-1-8), O-benzotriazol-tetramethyluronium hexafluorophosphate (HBTU, 0.064 g, 0.1689 mmol) and diisopropylethylamine (DIEA, 0.029 g, 0.2252 mmol) were mixed and dissolved in 19 ml of acetonitrile, and stirred at room temperature for 5 minutes. The resultant reaction solution was added with Aminomethyl resin (H.sub.2NResin, 0.901 g, 100-200 mesh, amino loading: 400 mol/g, purchased from Tianjin Nankai HECHENG S&T Co., Ltd.). A reaction was performed on a shaker at 25 C. and 220 rpm/min for 15 hours, followed by filtration. The residue was rinsed twice (each with 30 ml of DCM), three times (each with 30 ml of acetonitrile), and once (with 30 ml of ethyl ether), and dried in a vacuum oil pump for 2 hours. Then starting materials (CapA, CapB, 4-dimethylaminopyridine (DMAP) and acetonitrile) were added according to the charge ratio shown in Table 2 for a capping reaction. The reaction was performed on a shaker at 25 C. and 200 rpm/min for 5 hours. The reaction liquid was filtered. The residue was rinsed three times, each with 30 ml of acetonitrile, subjected to suction filtration to dryness, and dried overnight in a vacuum oil pump to give 1.100 g of Compound L-10 (i.e., the L-9 conjugation molecule linked to a solid phase support), with a loading of 90.8 mol/g.
(282) TABLE-US-00013 TABLE 2 The charge ratio of capping reaction Starting Materials Amount Specs Lot No. Manufacturer CapA 20 ml CapB 2.3 ml DMAP 0.01 g analytical I1422139 Aladdin pure acetonitrile 2.3 ml spectroscopic O15161001 CINC pure (Shanghai) Co., Ltd
(283) In the above table, Cap A and Cap B are solutions of capping agents. Cap A is a mixed solution of 20% by volume of N-methylimidazole in pyridine/acetonitrile, wherein the volume ratio of pyridine to acetonitrile is 3:5. Cap B is a solution of 20% by volume of acetic anhydride in acetonitrile.
(284) (1-2) Synthesis of Sense Strands of Conjugates 1-3
(285) The sense strands of Conjugates 1-3 have the same sequences, and thus their preparation methods are also the same.
(286) Nucleoside monomers were linked one by one in 3 to 5 direction according to the arrangement sequence of nucleotides in the sense strand by the phosphoramidite solid phase synthesis method, starting the cycles from the Compound L-10 prepared in the above step. The linking of each nucleoside monomer included a four-step reaction of deprotection, coupling, capping, and oxidation or sulfurization. Therein, when two nucleotides is linked via a phosphoester linkage, a four-step reaction of deprotection, coupling, capping, and oxidation was included during linking of the later nucleoside monomer; and when two nucleotides is linked via a phosphorothioate linkage, a four-step reaction of deprotection, coupling, capping, and sulfurization was included during linking of the later nucleoside monomer. The synthesis conditions are as follows.
(287) The nucleoside monomers are provided in a 0.1 M acetonitrile solution. The condition for deprotection reaction in each step is identical, i.e., a temperature of 25 C., a reaction time of 70 seconds, a solution of dichloroacetic acid in dichloromethane (3% v/v) as a deprotection reagent, and a molar ratio of dichloroacetic acid to the protecting group on the solid phase support of 4,4-dimethoxytrityl of 5:1.
(288) The condition for coupling reaction in each step is identical, including a temperature of 25 C., a molar ratio of the nucleic acid sequence linked to the solid phase support to nucleoside monomers of 1:10, a molar ratio of the nucleic acid sequence linked to the solid phase support to a coupling reagent of 1:65, a reaction time of 600 seconds, and 0.5 M acetonitrile solution of 5-ethylthio-1H-tetrazole as a coupling reagent.
(289) The condition for capping reaction in each step is identical, including a temperature of 25 C. and a reaction time of 15 seconds, a mixed solution of Cap A and Cap B in a molar ratio of 1:1 as a capping agent, and a molar ratio of the capping agent to the nucleic acid sequence linked to the solid phase support of 1:1:1 (acetic anhydride:N-methylimidazole: the nucleic acid sequence linked to the solid phase support).
(290) The condition for oxidation reaction in each step is identical, including a temperature of 25 C., a reaction time of 15 seconds, and 0.05 M iodine water as an oxidation reagent; and a molar ratio of iodine to the nucleic acid sequence linked to the solid phase support in the coupling step of 30:1. The reaction is carried out in a mixed solvent of tetrahydrofuran:water:pyridine (3:1:1).
(291) The condition for sulfurization reaction in each step is identical, including a temperature of 25 C., a reaction time of 300 seconds, and xanthane hydride as a sulfuration reagent; and a molar ratio of the sulfuration reagent to the nucleic acid sequence linked to the solid phase support in the coupling step of 120:1. The reaction is carried out in a mixed solvent of acetonitrile:pyridine (1:1).
(292) The conditions for cleavage and deprotection are as follows: adding the synthesized nucleotide sequence linked to the support into 25 wt % aqueous ammonia to react at 55 C. for 16 hours, and the aqueous ammonia is in an amount of 0.5 ml/mol. The liquid was removed, and the residue is concentrated in vacuum to dryness.
(293) Purification and desalination: purification of the nucleic acid is achieved by using a preparative ion chromatography purification column (Source 15Q) with a gradient elution of NaCl. Specifically, eluent A: 20 mM sodium phosphate (pH 8.1), solvent:water/acetonitrile=9:1 (v/v); eluent B: 1.5 M sodium chloride, 20 mM sodium phosphate (pH 8.1), solvent:water/acetonitrile=9:1 (v/v); elution gradient: the ratio of eluent A:eluent B=100:0-50:50. The eluate is collected, combined and desalted by using a reversed phase chromatography purification column. The specific condition includes: using a Sephadex column for desalination (filler: Sephadex G25) and deionized water for eluting.
(294) Detection: the purity is determined by ion exchange chromatography (IEX-HPLC); and the molecular weight is analyzed by Liquid Chromatography-Mass Spectrometry (LC-MS).
(295) For the sense strand batch of Conjugate 1, the purity is 90.4%; the calculated value and the measured value of the molecular weight are 7627.5 and 7626.6, respectively. For the sense strand batch of Conjugate 2, the purity is 94.1%; the calculated value and the measured value of the molecular weight are 7627.5 and 7625.1, respectively. The fact that the measured values were in conformity with the calculated values indicates that a sense strand S of which 3 terminal is conjugated to the L-9 conjugation molecule was synthesized.
(296) (1-3) Synthesis of Antisense Strands of Conjugates 1-3
(297) (1-3A) Preparation of an Antisense Strand of Conjugate 1
(298) An antisense strand AS of Conjugate 1 is synthesized by starting the cycles using a universal solid phase support (UnyLinker loaded NittoPhase HL Solid Supports, Kinovate Life Sciences Inc.) in the phosphoramidite solid phase synthesis method. The reaction conditions of deprotection, coupling, capping, oxidation or sulfurization, cleavage and deprotection, and purification and desalting in the solid phase synthesis method were the same as those used for the synthesis of the sense strand.
(299) Detection: the purity is detected by ion exchange chromatography (IEX-HPLC), with a purity of 93.1%; and the molecular weight is analyzed by liquid chromatography-mass spectrometry (LC-MS), with a calculated value of 6920.17 and a measured value of 6919.9. The fact that the measured value is in conformity with the calculated value indicates that an antisense strand AS having the target sequence is synthesized.
(300) Therein, the vinyl phosphate and 2-methoxy modified uridine monomer (VP-Um) is synthesized according to the following method:
(301) ##STR00071## ##STR00072##
(1-3-1) Synthesis of VP-U-2
(302) A VP-U-2 molecule was synthesized according to the following method:
(303) ##STR00073##
(304) A 2-methoxy modified uracil nucleoside (2-OMe-U, 51.30 g, 91.6 mmol), tert-butyl diphenylchlorosilane (TBDPSCl, 50.35 g, 183.2 mmol), and imidazole (12.47 g, 183.2 mmol) were mixed and dissolved in 450 ml of N,N-dimethylformamide (DMF) to react under stirring at room temperature for 20 hours. DMF was removed by evaporation, and the residue was dissolved with 600 ml of dichloromethane and washed with 300 ml of saturated sodium bicarbonate. The aqueous phase was extracted three times, each with 300 ml of dichloromethane (DCM). The organic phases were combined, washed with 5% oxalic acid until the pH of the aqueous phase is <5. The solvent was evaporated to dryness to give a crude product VP-U-1, which was directly used in the subsequent synthesis of VP-U-2.
(305) The crude product VP-U-1 was dissolved in 100 ml of dichloromethane, and then stirred for 10 minutes in an ice bath. 450 ml of 2% p-toluenesulfonic acid solution (with a mixed solvent of methanol and dichloromethane in a volume ratio of 3:7) pre-cooled in a refrigerator at 4 C. was added to react for 10 minutes. The reaction was quenched by addition of 200 ml of saturated sodium bicarbonate. The organic phase was washed to pH=8 by addition of saturated sodium bicarbonate solution. The aqueous phases were combined and extracted twice, each 3 with 200 ml of dichloromethane. The organic phases were combined and washed once with 200 ml of saturated brine. The solvent was removed by evaporation to dryness, and the residue was purified by using a normal phase silica gel column (200-300 mesh). The column was packed with petroleum ether and eluted with a gradient elution of petroleum ether:ethyl acetate:dichloromethane:methanol=1:1:1:0.05-1:1:1:0.25. The eluate was collected, the solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump to give a total of 40.00 g of pure product VP-U-2. 1H NMR (400 MHz, DMSO-d6) 7.96 (d, J=7.8 Hz, 1H), 7.64 (dtd, J=5.1, 4.0, 2.2 Hz, 4H), 7.41-7.30 (m, 6H), 6.79 (d, J=4.7 Hz, 1H), 5.73 (d, J=7.6 Hz, 1H), 4.94 (t, J=7.0 Hz, 1H), 4.12 (td, J=4.6, 3.9 Hz, 1H), 4.05 (dd, J=4.8, 4.0 Hz, 1H), 3.96 (t, J=4.7 Hz, 1H), 3.68 (ddd, J=11.8, 7.0, 4.6 Hz, 1H), 3.57-3.46 (m, 1H), 3.39 (s, 3H), 1.05 (s, 8H). MS m/z: C26H33N2O6Si, [M+H]+, calculated: 497.21. measured: 497.45.
(306) (1-3-2) Synthesis of VP-U-4
(307) ##STR00074##
(308) VP-U-2 (19.84 g, 40.0 mmol), dicyclohexylcarbodiimide (DCC, 16.48 g, 80.0 mmol), pyridine (4.20 g, 53.2 mmol), and trifluoroacetic acid (6.61 g, 53.2 mmol) were mixed and dissolved in 200 ml of dimethyl sulfoxide (DMSO) to react under stirring at room temperature for 20 hours. Separately, tetraethyl methylene diphosphate (21.44 g, 74.4 mmol) was dissolved in 120 ml of THF, cooled in an ice bath, added with t-BuOK (11.36 g, 101.2 mmol) at a temperature of the ice bath to react for 10 min, warmed to room temperature to react for 0.5 hour and added into the above reaction liquid over about 1 hour. The reaction was carried out at a temperature of the ice bath for 1 hour and then warmed to room temperature to react for 18 hours. The reaction was quenched by addition of water. The aqueous phase was extracted three times, each with 200 ml of dichloromethane. The organic phases were combined and washed once with 200 ml of saturated brine. The solvent was evaporated to dryness, and the residue was purified by using a normal phase silica gel column (200-300 mesh). The column was packed with petroleum ether and eluted with a gradient elution of petroleum ether:ethyl acetate=1:1-1:4. The eluate was collected. The solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump to give a total of 14.00 g of pure product VP-U-4. 1H NMR (400 MHz, DMSO-d6) 7.96 (d, J=7.8 Hz, 1H), 7.64 (dtd, J=5.1, 4.0, 2.2 Hz, 4H), 7.41-7.30 (m, 6H), 6.82-6.71 (m, 2H), 5.90 (ddd, J=25.9, 15.0, 1.0 Hz, 1H), 5.73 (d, J=7.6 Hz, 1H), 4.36-4.21 (m, 3H), 4.18 (t, J=4.9 Hz, 1H), 4.05 (ddq, J=9.7, 8.5, 6.9 Hz, 2H), 3.87 (t, J=4.8 Hz, 1H), 3.39 (s, 3H), 1.32 (td, J=6.9, 0.7 Hz, 6H), 1.05 (s, 8H). MS m/z: C31H42N2O8PSi, [M+H]+, calculated: 629.24. measured: 629.51.
(309) (1-3-3) Synthesis of VP-U-5
(310) ##STR00075##
(311) VP-U-4 (14.00 g, 22.29 mmol) was dissolved in 100 ml of tetrahydrofuran, added with triethylamine trihydrofluoride (17.96 g, 111.45 mmol), and stirred at room temperature for 20 hours to react completely. The solvent was directly evaporated to dryness, the residue was dissolved in dichloromethane, then the solvent was evaporated to dryness again. The above dissolution and evaporation steps were performed twice, each with 50 ml of dichloromethane to give a crude product. The crude product was purified by using a normal phase silica gel column (200-300 mesh). The column was packed with petroleum ether and eluted with a gradient elution of petroleum ether:ethyl acetate:dichloromethane:methanol=1:1:1:0.05-1:1:1:0.25. The eluate was collected, the solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump to give a total of 6.70 g of pure product VP-U-5. 1H NMR (400 MHz, DMSO-d6) 7.96 (d, J=7.8 Hz, 1H), 6.77 (dd, J=15.0, 6.2 Hz, 1H), 5.99-5.82 (m, 2H), 5.73 (d, J=7.6 Hz, 1H), 5.27 (d, J=5.1 Hz, 1H), 5.10 (dd, J=5.3, 4.7 Hz, 1H), 4.29 (ddq, J=9.8, 8.6, 7.0 Hz, 2H), 4.17 (ddd, J=6.2, 5.2, 1.0 Hz, 1H), 4.12-3.98 (m, 3H), 3.39 (s, 2H), 1.32 (td, J=6.9, 0.6 Hz, 6H). MS m/z: C15H24N2O8P, [M+H]+, calculated: 391.13. measured: 391.38.
(312) (1-3-4) Synthesis of VP-U-6:
(313) ##STR00076##
(314) VP-U-5 (391 mg, 1.0 mmol), pyridine trifluoroacetate (0.232 g, 1.2 mmol), N-methylimidazole (0.099 g, 1.2 mmol), and bis(diisopropylamino)(2-cyanoethoxy)phosphine (0.452 g, 1.5 mmol) were added into 10 ml of anhydrous dichloromethane under argon atmosphere to react under stirring at room temperature for 5 hours. The solvent was evaporated to dryness, and then the residue was purified by column chromatography (200-300 mesh normal phase silica gel, with a gradient elution of dichloromethane:acetonitrile (containing 0.5 wt % triethylamine)=3:1-1:3). The eluate was collected and concentrated to by remove the solvent to give a total of 508 mg of target product VP-U-6. 31P NMR (161 MHz, DMSO-d6) 150.34, 150.29, 17.07, 15.50. MS m/z: C24H41N4O9P2, [M+H]+, calculated: 591.23. measured: 591.55. The above data indicated that VP-U-6 was the target product VP-Um, which was involved in the synthesis of RNA strands as a nucleoside monomer.
(315) (1-3B) Preparation of an Antisense Strand of Conjugate 2
(316) The antisense strand of Conjugate 2 differs from that of Conjugate 1 only in the modification of the first nucleotide at 5-terminal. During the preparation of an antisense strand according to the phosphoramidite solid phase synthesis method, after the linking of 2-methoxy modified uridine monomer (Um) as the last nucleoside monomer, the monomer of Formula (CPR-I) (purchased by Suzhou GenePharma Inc. as Cat #13-2601-XX) was linked to 5 terminal of the antisense strand by a four-step reaction of deprotection, coupling, capping, and oxidation, so as to form a 5-phosphate modification.
(317) ##STR00077##
(318) During the synthesis, the universal solid phase support, the conditions of deprotection, coupling, capping, oxidation or sulfurization reaction, cleavage and deprotection, purification and desalting used were the same as those used in the synthesis of the sense strand.
(319) The purity was detected by ion exchange chromatography (IEX-HPLC), with a purity of 99.0%; and the molecular weight was analyzed by liquid chromatography-mass spectrometry (LC-MS), with a calculated value of 6924.43 and a measured value of 6924.0. The fact that the measured value is in conformity with the calculated value indicates that an antisense strand AS having the target sequence is synthesized.
(320) (1-3C) Preparation of an Antisense Strand of Conjugate 3
(321) The synthesis process is the same as that of the antisense strand of Conjugate 2, except that the above oxidation reaction condition is replaced with a sulfurization reaction condition in the linking of the CPR-I monomer. It is expected that an antisense strand of Conjugate 3 with a 5-phosphorothioate modification can be prepared.
(322) (1-4) Synthesis of Conjugates 1 and 2
(323) For Conjugate 1, the S strand and AS strand were respectively dissolved in water for injection to get a solution of 40 mg/mL. They are mixed in an equimolar ratio, heated at 50 C. for 15 min, and then cooled at room temperature, such that they could form a double-stranded structure via hydrogen bonds. After the conjugate was diluted to a concentration of 0.2 mg/mL by using ultra-pure water (homemade by Milli-Q ultra-pure water instrument, with resistivity of 18.2M*cm (25 C.)), the molecular weight was measured by a LC-MS instrument (purchased from Waters Corp., model: LCT Premier). As a result, the calculated values of the molecular weight for S and AS were respectively 7627.5 and 6920.17, and the measured values thereof were respectively 7626.9 and 6920.1. The fact that the measured values were in conformity with the calculated values indicated that the synthesized Conjugate 1 had the designed target double-stranded nucleic acid sequence with the L-9 conjugation molecule.
(324) For Conjugate 2, it was prepared and assayed for molecular weight by the same methods. As a result, the calculated values of the molecular weight for S and AS were respectively 7627.5 and 6924.43, and the measured values thereof were respectively 7626.5 and 6923.4. The fact that the measured values were in conformity with the calculated values indicated that the synthesized Conjugate 2 was the designed target double-stranded nucleic acid sequence with the L-9 conjugation molecule, since the measured values were in conformity with the calculated values.
(325) The structures of Conjugates 1 and 2 are as shown by Formula (3).
Preparation Example 2 Preparation of Conjugates 4-12 and Comparative Conjugate 1
(326) It was expected that the subject conjugates can be prepared by using the same method as that in Preparation Example 1, except that: 1) the siRNAs respectively have the sequences as shown in Table 3 corresponding to Conjugates 4-12 and Comparative Conjugate 1; and 2) in the case where the target sequence comprises unmodified nucleotide, in the cleavage and deprotection conditions, after treatment with aqueous ammonia, the product is dissolved in N-methylpyrrolidone in an amount of 0.4 ml/mol, followed by addition of 0.3 ml/mol of triethylamine and 0.6 ml/mol of triethylamine trihydrofluoride, with respect to the amount of the single strand nucleic acid, thereby removing the 2-TBDMS protection on ribose.
(327) The conjugated siRNA sequences in the subject conjugates are shown in Table 3. Therein, the siRNA comprised in the Comparative Conjugate 1 is the negative control siRNA which shows no inhibitory effect on HBV gene.
(328) TABLE-US-00014 TABLE3 siRNAconjugates siRNA SEQ Conjugate NO SequenceDirection5-3 IDNO Conjugate1 L10- S GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUm 24 siHB3M1SVP Am AS VP- 67 UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm CmsUmsUm Conjugate2 L10- S GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUm 24 siHB3M1SP Am AS P- 68 UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm CmsUmsUm Conjugate3 L10- S GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUm 24 siHB3M1SPs Am AS Ps- 69 UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm CmsUmsUm Conjugate4 L10- S GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmA 12 siHB3M1VP m AS VP- 70 UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmC mUmUm Conjugate5 L10- S GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmA 12 siHB3M1P m AS P- 71 UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmC mUmUm Conjugate6 L10-siHB3M1 S GmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmA 12 m AS UmAfUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmC 15 mUmUm Conjugate7 L10-siHB3M1S S GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUm 24 Am AS UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm 27 CmsUmsUm Conjugate8 L10- S GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUm 30 siHB3M2SVP Am AS VP- 72 UmsAfsUmUmCmGfUmUfGfAmCmAmUmAfCmUfUmUmC msUmsUm Conjugate9 L10- S GmsAmsAmAmGfUmAfUfGfUmCmAmAmCmGmAmAmUm 30 siHB3M3SP Am AS P- 68 UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm CmsUmsUm Conjugate L10- S GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUm 23 10 siHB2M1SP Um AS P- 73 AmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm CmsCmsAm Conjugate L10- S UmsGmsGmAmAmAmGmUmAfUfGfUmCmAmAmCmGmAm 56 11 siHB5M1SVP AmUmAm AS VP- 74 UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm CmCmAmsUmsUm Conjugate L10-siHB3 S GAAAGUAUGUCAACGAAUA 75 12 AS UAUUCGUUGACAUACUUUCUU 76 Conjugate P10- S GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUm 24 13 siHB3M1SVP Am AS VP- 67 UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm CmsUmsUm Conjugate R5- S GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUm 24 14 siHB3M1SVP Am AS VP- 67 UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm CmsUmsUm Conjugate LA5- S GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUm 24 15 siHB3M1SVP Am AS VP- 67 UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm CmsUmsUm Conjugate LB5- S GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUm 24 16 siHB3M1SVP Am AS VP- 67 UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm CmsUmsUm Conjugate V8- S GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUm 24 17 siHB3M1SVP Am AS VP- 67 UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm CmsUmsUm Conjugate W8- S GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUm 24 18 siHB3M1SVP Am AS VP- 67 UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm CmsUmsUm Conjugate X8- S GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUm 24 19 siHB3M1SVP Am AS VP- 67 UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm CmsUmsUm Conjugate Z5- S GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUm 24 20 siHB3M1SVP Am AS VP- 67 UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm CmsUmsUm Comp. L10-siNCM1SP S UmsUmsCmUmCmCmGfAfAfCmGmUmGmUmCmAmCmGm 77 Conjugate1 Um AS P- 78 AmsCfsGmUmGmAfCmAmCmGmUmUmCmGfGmAfGmAm AmsCmsUm Comp. K4- S GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUm 24 Conjugate2 siHB3M1SVP Am AS VP- 67 UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUm CmsUmsUm
Preparation Example 3 Preparation of the Conjugate P10-siHB3M1SVP (Conjugate 13)
(329) (3-1) Synthesis of Compound P-10
(330) Compound P-10 was synthesized according to the following method.
(331) ##STR00078## ##STR00079## ##STR00080##
(3-1-1) Synthesis of GAL5-C4-1
(332) GAL-5 (13.43 g, 30.0 mmol) obtained according to the method described in (1-1-1) above, t-butyl 4-aminobutyrate hydrochloride (5.87 g, 30.0 mmol), O-benzotriazol-tetramethyluronium hexafluorophosphate (13.65 g, 36.0 mmol) and diisopropylethylamine (11.63 g, 90.0 mmol) were added into 40 ml of N,N-dimethylformamide, dissolved uniformly and then stirred at room temperature to react for 5 hours. The resultant reaction solution was added with 300 ml of saturated aqueous sodium bicarbonate solution, extracted three times, each with 200 ml of ethyl acetate. The organic phases were combined and washed once with 200 ml of saturated brine. The organic phases were isolated and dried with anhydrous sodium sulfate. The solvent was removed by evaporation under reduced pressure, and the residue was subjected to suction filtration to dryness in a vacuum oil pump to give 30.3 g of crude product GAL5-C4-1 as oil, which was directly used in the next reaction.
(333) (3-1-2) Synthesis of GAL5-C4-2
(334) The crude product GAL5-C4-1 (30.3 g, 30 mmol) obtained in step (3-1-1) was dissolved in 180 ml of formic acid and stirred at room temperature to react for 16 hours. The solvent was evaporated to dryness. The residue was purified by column chromatography (200-300 mesh normal phase silica gel, with a gradient elution of dichloromethane:methanol=100:18-100:20). The reaction eluate was collected and concentrated to remove the solvents to give a total of 14.84 g of the target product GAL5-C4-2.
(335) (3-1-3) Synthesis of P-6:
(336) M-18-Tr (2.02 g, 4.69 mmol) obtained according to the method described in step (1-1-4) and GAL5-C4-2 (8.24 g, 15.48 mmol, obtained by combining two batches of products) obtained in step (3-1-2) were mixed and dissolved in 47 ml of acetonitrile, added with N-methylmorpholine (3.13 g, 30.96 mmol) followed by 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (DMTMM, 4.28 g, 15.48 mmol) to react under stirring at room temperature for 2 hours. The resultant reaction solution was diluted with 20 ml of dichloromethane. The organic phase was washed with 10 ml of saturated sodium bicarbonate solution and 10 ml of saturated brine, respectively. The organic phases were combined, dried with anhydrous sodium sulfate, and filtered. The solvent was removed by evaporation to dryness under reduced pressure to give a crude product, which was purified by using a normal phase silica gel column (200-300 mesh). The column was packed with petroleum ether, added with 1 wt % triethylamine for neutralizing the acidity of silica gel, and eluted with a gradient elution of dichloromethane:methanol=100:5-100:7. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give a total of 8.27 g of pure product P-6.
(337) (3-1-4) Synthesis of P-7:
(338) P-6 (6.82 g, 3.436 mmol) obtained in (3-1-3) above was dissolved in 69 ml of dichloromethane, and added with dichloroacetic acid (13.367 g, 103.67 mmol) to react at room temperature for 2 hours. The resultant reaction solution was diluted by adding 100 ml of dichloromethane, washed and adjusted to pH 7-8 with saturated sodium bicarbonate solution. The aqueous phase was extracted six times, each with 30 ml of dichloromethane. The organic phases were combined, dried with anhydrous sodium sulfate, and filtered. Then the solvent was removed by evaporation to dryness under reduced pressure to give a crude product. The crude product was purified by using a normal phase silica gel (200-300 mesh). The column was added with 10 wt % triethylamine for neutralizing the acidity of silica gel, equilibrated with 1 wt % triethylamine and eluted with a gradient elution of dichloromethane:methanol=100:30-100:40. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give a total of 4.82 g of P-7. MS m/z: C78H127N10O33, [M+H]+, calculated: 1732.91. measured: 1735.73.
(339) (3-1-5) Synthesis of P-8:
(340) ##STR00081##
(341) P-7 (2.653 g, 1.532 mmol) and A-1 (2.342 g, 4.596 mmol) were mixed and dissolved in 16 ml of dichloromethane, and added with 3-diethoxyphosphoryl-1,2,3-benzotrizin-4(3H)-one (DEPBT) (1.375 g, 4.596 mmol) followed by diisopropylethylamine (1.188 g, 9.191 mmol) to react under stirring at 25 C. for 2 hours. The organic phase was washed with 10 ml of saturated sodium bicarbonate. The aqueous phase was extracted three times, each with 10 ml of dichloromethane. The organic phase was washed with 10 ml of saturated brine. The aqueous phase was extracted twice, each with 10 ml of dichloromethane, and the organic phases were combined, dried with anhydrous sodium sulfate and filtered. The solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump overnight to give a crude product. The crude product was subjected to a column purification. The column was filled with 120 g normal phase silica gel (200-300 mesh), added with 20 ml triethylamine for neutralizing the acidity of silica gel, equilibrated with 3 petroleum ether containing 1 wt % triethylamine and eluted with a gradient elution of petroleum ether:ethyl acetate:dichloromethane:N,N-dimethylformamide=1:1:1:0.5-1:1:1:0.6. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give a total of 2.793 g of pure product P-8.
(342) (3-1-6) Synthesis of P-9
(343) P-8 (490 mg, 0.231 mmol), succinic anhydride (69 mg, 0.693 mmol) and 4-dimethylaminopyridine (DMAP, 68 mg, 0.334 mmol) were mixed and dissolved in 2.3 ml of dichloromethane, and added with diisopropylethylamine (DIPEA, 149 mg, 1.133 mmol) to 13 react under stirring at 23 C. for 21 hours. The resultant reaction solution was diluted with 30 ml dichloromethane, and then washed with 100 ml of 0.3 M triethylamine phosphate. The aqueous phase was extracted three times, each with 10 ml of dichloromethane. The organic phases were combined, and the solvent was removed by evaporation to dryness under reduced pressure to give a crude product. The crude product was subjected to a column purification. The column was filled with 80 g normal phase silica gel (200-300 mesh), added with 1 wt % triethylamine for neutralizing the acidity of silica gel, equilibrated with dichloromethane and eluted with a gradient elution of 1 wt % triethylamine-containing dichloromethane:methanol=100:18-100:20. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give a total of 200 mg of pure product P-9 conjugation molecule. MS m/z: C106H153N10O41, [M-DMTr]+, calculated: 1921.05. measured: 1920.97.
(344) (3-1-7) Synthesis of P-10
(345) P-10 was prepared by using the same method as that in step (1-1-9) of Preparation Example 1, except that the P-9 conjugation molecule was used to replace the L-9 conjugation molecule, thereby obtaining the P-9 conjugation molecule linked to a solid phase support.
(346) (3-2) Synthesis of the Conjugate P10-siHB3M1SVP
(347) Conjugate 13 was prepared by using the same method as that in steps (1-2)-(1-4) of Preparation Example 1, except that Compound P-10 was used to replace Compound L-10 to start the synthesis of a sense strand. It was expected that the conjugate P10-siHB3M1SVP having a structure as shown by Formula (4) can be obtained.
Preparation Example 4 Preparation of the Conjugate R5-siHB3M1SVP (Conjugate 14)
(348) (4-1) Synthesis of Compound R-5
(349) Compound R-5 was synthesized by the following method.
(350) ##STR00082## ##STR00083## ##STR00084##
(4-1-1) Synthesis of GAL-C7-1
(351) GAL-3 (26.4 g, 80.2 mmol) obtained according to the method described in step (1-1-1b) was dissolved in 134 ml of anhydrous 1,2-dichloroethane, and added with 60 g of 4 molecular sieve powder followed by 7-octen-1-ol (11.3 g, 88.2 mmol) to react under stirring at room temperature for 10 minutes. Trimethylsilyl trifluoromethanesulphonate (8.9 g, 40.1 mmol) was added in an ice bath and nitrogen atmosphere to react under stirring at room temperature for 24 hours. The 4 molecular sieve powder was removed by filtration. 500 ml of saturated aqueous sodium bicarbonate solution was added to the filtrate for washing. The organic phase was isolated. The aqueous phase was extracted once with 100 ml of dichloromethane. The organic phases were combined and washed once with 250 ml of saturated brine. The organic phase was isolated and dried with anhydrous sodium sulfate. The solvent was removed by evaporation under reduced pressure and the residue was subjected to suction filtration to dryness in a vacuum oil pump to give 33.3 g of product GAL-C7-1 as a yellow syrup, which was directly used in the next oxidation reaction without purification.
(352) (4-1-2) Synthesis of GAL-C7-2
(353) GAL-C7-1 (33.3 g, 72.8 mmol) obtained in step (4-1-1) was dissolved in a mixed solvent of 160 ml of dichloromethane and 160 ml of acetonitrile, added with 216 ml of water and solid sodium periodate (62.3 g, 291.2 mmol) respectively, stirred in an ice water bath for 10 minutes, and added with a catalyst ruthenium trichloride (498 mg, 2.4 mmol). The reaction was naturally warmed to room temperature and stirred for 23 hours. The resultant reaction solution was diluted by adding 200 ml of water under stirring, and adjusted to pH 7.5 by adding saturated sodium bicarbonate. The organic phase was isolated and discarded. The aqueous phase was extracted three times, each with dichloromethane. The organic phases were discarded. The aqueous phase was adjusted to a pH of about 3 with citric acid solid and extracted three times (each with 200 ml of dichloromethane), and the organic phases were combined and dried with anhydrous sodium sulfate. The solvent was removed by evaporation under reduced pressure, and then the residue was purified by column chromatography (200-300 mesh normal phase silica gel, with a gradient elution of dichloromethane:methanol=100:18-100:20) to give 22.4 g of product GAL-C7-2 as a white foamy solid. MS m/z: C21H32NO11, [M+H]+, calculated: 476.50. measured: 475.94.
(354) (4-1-3) Synthesis of R-1
(355) M-18-Tr (2.02 g, 4.69 mmol) obtained according to the method described in step (1-1-4) and GAL-C7-2 (7.36 g, 15.48 mmol) were mixed and dissolved in 47 ml of acetonitrile, added with N-methylmorpholine (3.13 g, 30.96 mmol) followed by 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (DMTMM, 4.28 g, 15.48 mmol) to react under stirring at room temperature for 2 hours. The resultant reaction solution was diluted with 200 ml of dichloromethane. The organic phase was washed with 100 ml of saturated sodium bicarbonate solution and 100 ml of saturated brine, respectively. The organic phases were combined, dried with anhydrous sodium sulfate, and filtered. The solvent was removed by evaporation to dryness under reduced pressure to give a crude product, which was purified by a normal phase silica gel column (200-300 mesh). The column was packed with petroleum ether, added with 1 wt % triethylamine for neutralizing the acidity of silica gel, and eluted with a gradient elution of dichloromethane:methanol=100:5-100:7. The eluate was collected and the solvent was removed by evaporation to dryness under reduced pressure to give 7.82 g of pure product R-1.
(356) (4-1-4) Synthesis of R-2:
(357) R-1 (6.23 g, 3.456 mmol) was dissolved in 69 ml of dichloromethane, and added with dichloroacetic acid (13.367 g, 103.67 mmol) to react at room temperature for 2 hours. The resultant reaction solution was diluted by adding 100 ml of dichloromethane, washed and adjust to pH 7-8 with saturated sodium bicarbonate solution. The aqueous phase was extracted six times, each with 30 ml of dichloromethane. The organic phases were combined, dried with anhydrous sodium sulfate, and filtered. Then the solvent was removed by evaporation to dryness under reduced pressure to give a crude product. The crude product was purified by a normal phase silica gel column (200-300 mesh). The column was added with 10 wt % triethylamine for neutralizing the acidity of silica gel, equilibrated with 1 wt % triethylamine, and eluted with a gradient elution of dichloromethane:methanol=100:30-100:40. The solvent was removed by evaporation to dryness under reduced pressure to give 4.49 g of pure product R-2.
(358) (4-1-5) Synthesis of R-3:
(359) R-2 (2.391 g, 1.532 mmol) and A-1 (2.342 g, 4.596 mmol) were mixed and dissolved in 16 m1 of dichloromethane, and added with 3-(diethoxyphosphoryloxy)-1,2,3-benzotrizin-4(3H)-one (DEPBT, 1.375 g, 4.596 mmol) followed by diisopropylethylamine (1.188 g, 9.191 mmol) to react under stirring at 25 C. for 2 hours. The organic phase was washed with 10 ml of saturated sodium bicarbonate. The aqueous phase was extracted three times, each with 10 ml of dichloromethane. The organic phase was washed with 10 ml of saturated brine. The aqueous phase was extracted twice, each with 10 ml of dichloromethane. The organic phases were combined, dried with anhydrous sodium sulfate and filtered. The solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump overnight to give a crude product. The crude product was subjected to a column purification. The column was filled with 120 g normal phase silica gel (200-300 mesh), added with 20 ml triethylamine for neutralizing the acidity of silica gel, equilibrated with petroleum ether containing 1 wt % triethylamine, and eluted with a gradient elution of petroleum ether:ethyl acetate:dichloromethane:N,N-dimethylformamide=1:1:1:0.5-1:1:1:0.6. The solvent was removed by evaporation to dryness under reduced pressure to give 2.642 g of pure product R-3.
(360) (4-1-6) Synthesis of R-4
(361) R-3 (795 mg, 0.4074 mmol), succinic anhydride (82 mg, 0.8148 mmol) and 4-dimethylaminopyridine (DMAP, 100 mg, 0.8148 mmol) were mixed and dissolved in 4 ml of dichloromethane, and added with diisopropylethylamine (DIEA, 100 mg, 0.8148 mmol) to react under stirring at 25 C. for 18 hours. The resultant reaction solution was washed with 5 ml of 0.5 M triethylamine phosphate. The aqueous phase was extracted three times, each with 5 ml of dichloromethane. The organic phases were combined, and the solvent was removed by evaporation to dryness under reduced pressure to give a crude product. The crude product was subjected to a column purification. The column was filled with 30 g normal phase silica gel (200-300 mesh), added with 1 wt % triethylamine for neutralizing the acidity of silica gel, equilibrated with dichloromethane, and eluted with a gradient elution of 1 wt % triethylamine-containing dichloromethane:methanol=100:18-100:20. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give 505 mg of pure product of R-4 conjugation molecule.
(362) (4-1-7) Synthesis of R-5
(363) R-5 was prepared by using the same method as that in step (1-1-9) of Preparation Example 1, except that R-4 conjugation molecule was used to replace the L-9 conjugation molecule, thereby obtaining the R-4 conjugation molecule linked to a solid phase support.
(364) (4-2) Synthesis of the conjugate R5-siHB3M1SVP
(365) Conjugate 14 was prepared by using the same method as that in steps (1-2)-(1-4) of Preparation Example 1, except that Compound R-5 was used to replace Compound L-10 to start the synthesis of a sense strand. It was expected that the conjugate R5-siHB3M1SVP with a structure as shown by Formula (7) can be obtained.
Preparation Example 5 Preparation of the Conjugate LA5-siHB3M1SVP (Conjugate 15)
(366) It was expected that Compound LA-5 can be synthesized according to the following process route:
(367) ##STR00085## ##STR00086##
(368) Conjugate 15 was prepared by using the same method as that in steps (1-2)-(1-4) of Preparation Example 1, except that Compound LA-5 was used to replace Compound L-10 to start the synthesis of a sense strand. It was expected that the conjugate LA5-siHB3M1SVP with a structure as shown by Formula (12) can be obtained.
Preparation Example 6 Preparation of the Conjugate LB5-siHB3M1SVP (Conjugate 16)
(369) (6-1) Synthesis of Compound LB-5
(370) ##STR00087## ##STR00088## ##STR00089##
(6-1-1) Synthesis of LB-1
(371) L-8 (5.0 g, 3.386 mmol) obtained according to the method described in step (1-1-6), adipic anhydride (870 mg, 6.772 mmol) and 4-dimethylaminopyridine (DMAP, 827 mg, 6.772 mmol) were mixed, dissolved in 130 ml of dichloromethane, and added with diisopropylethylamine (DIEA, 2.2 g, 16.931 mmol) to react under stirring at 25 C. for 4 hours. The resultant reaction solution was added with 70 ml dichloromethane for dilution and then washed with 0.5 M triethylamine phosphate. The aqueous phase was extracted four times, each with 10 ml of dichloromethane. The organic phases were combined, and the solvent was removed by evaporation to dryness under reduced pressure to give a crude product. The crude product was subjected to a column purification. The column was filled with 120 g normal phase silica gel (200-300 mesh), added with 1 wt % triethylamine for neutralizing the acidity of silica gel, equilibrated with dichloromethane, and eluted with a gradient elution of petroleum ether:ethyl acetate:dichloromethane:methanol=1:1:1:0.2-1:1:1:1. The solvent was removed by evaporation to dryness under reduced pressure to give 4.267 g of pure product LB-1.
(372) (6-1-2) Synthesis of LB-2
(373) LB-1 (4.697 g, 2.753 mmol, combination of 2 batches of products) obtained according to the method described in step (6-1-1), 3-amino-1,2-propanediol (313 mg, 3.442 mmol), 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (DMTMM, 953 mg, 3.442 mmol) and N-methylmorpholine (700 mg, 6.884 mmol) were sequentially added to the mixed solution of 30 ml of acetonitrile and 3 ml of methanol to react under stirring at room temperature overnight. The solvent was evaporated to dryness, and the residue was purified by column chromatography (200-300 mesh normal phase silica gel, with a gradient elution of dichloromethane:methanol=1:0.07-1:0.5). The eluate was collected and concentrated to remove the solvents to give 3.27 g of target product LB-2.
(374) (6-1-3) Synthesis of LB-3
(375) LB-2 (2.27 g, 1.353 mmol) was dissolved in 14 ml of anhydrous pyridine, and added with 4,4-dimethoxytrityl chloride (688 mg, 2.03 mmol) to react under stirring at room temperature overnight. The reaction was quenched by addition of 150 ml of methanol. The solvent was evaporated to dryness, and the residue was purified by column chromatography (200-300 mesh normal phase silica gel, with a gradient elution of dichloromethane:methanol=1:0.05-1:0.2). The eluate was collected and concentrated to remove the solvent to give 1.647 g of target product LB-3.
(376) (6-1-4) Synthesis of LB-4
(377) LB-3 (822 mg, 0.413 mmol), succinic anhydride (83 g, 0.83 mmol) and 4-dimethylaminopyridine (DMAP, 102 mg, 0.83 mmol) were mixed, dissolved in 4 ml of dichloromethane, added with DIPEA (270 mg, 2.075 mmol), and stirred at 25 C. to react overnight. The resultant reaction solution was washed with 0.5 M triethylamine phosphate three times. The aqueous phase was extracted three times, each with 2 ml of dichloromethane. The organic phases were combined, and the solvent was removed by evaporation to dryness under reduced pressure to give a crude product. The crude product was subjected to a column purification. The column was filled with normal phase silica gel (200-300 mesh), added with 5 wt % triethylamine for neutralizing the acidity of silica gel, equilibrated with petroleum ether, and eluted with a gradient elution of 1 wt % triethylamine-containing dichloromethane:methanol=100:5-100:20. The solvent was removed by evaporation to dryness under reduced pressure to give 787 mg of pure product LB-4 conjugation molecule.
(378) (6-1-5) Synthesis of LB-5
(379) LB-5 was prepared by using the same method as that in step (1-1-9) of Preparation Example 1, except that the LB-4 conjugation molecule was used to replace the L-9 conjugation molecule, thereby obtaining the LB-4 conjugation molecule linked to a solid phase support.
(380) (6-2) Synthesis of the Conjugate LB5-siHB3M1SVP
(381) Conjugate 16 was prepared by using the same method as that in steps (1-2)-(1-4) of Preparation Example 1, except that Compound LB-5 was used to replace Compound L-10 to start the synthesis of a sense strand. It was expected that the conjugate LB5-siHB3M1SVP with a structure as shown by Formula (13) can be obtained.
Preparation Example 7 Synthesis of the Conjugate V8-siHB3M1SVP (Conjugate 17)
(382) It was expected that Compound V-8 can be synthesized according to the following process route:
(383) ##STR00090## ##STR00091##
(384) Conjugate 17 was prepared by using the same method as that in steps (1-2)-(1-4) of Preparation Example 1, except that Compound V-8 was used to replace Compound L-10 to start the synthesis of the sense strand. It was expected that the conjugate V8-siHB3M1SVP with a structure as shown by Formula (14) can be obtained.
Preparation Example 8 Preparation of the Conjugate W8-siHB3M1SVP (Conjugate 18)
(385) (8-1) Synthesis of W-8 Compound
(386) Compound W-8 was synthesized according to the following process:
(387) ##STR00092## ##STR00093## ##STR00094##
(8-1-1) Synthesis of W-1
(388) W-0 (2.024 g, 10 mmol) was dissolved in 25 ml of acetonitrile, added with triethylamine (4.048 g, 40 mmol), and cooled to about 0 C. in an ice water bath. Ethyl trifluoroacetate (5.683 g, 40 mmol) was added to react at room temperature for 22 hours. The solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump for 18 hours to give 5.835 g of crude solid product W-1.
(389) (8-1-2) Synthesis of W-2
(390) The crude product W-1 (5.835 g, 10 mmol) was dissolved in 50 ml of dichloromethane. The resultant reaction solution was added with TrCl (3.345 g, 12 mmol) and triethylamine (1.518 g, mmol) to react under stirring at room temperature for 20 hours. The resultant reaction solution was washed twice (each with 20 ml of saturated sodium bicarbonate) and once with 20 ml of saturated brine. The organic phases were combined, dried with anhydrous sodium sulfate and filtered. The organic solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump overnight to give 8.012 g of crude solid product W-2. The crude solid product W-2 was used in the next deprotection reaction without treatment.
(391) (8-1-3) Synthesis of W-3
(392) The crude product W-2 (8.012 g, 10 mmol) was dissolved in 100 ml of methanol, and added with 100 ml of aqueous methylamine solution (40 wt %) to react under stirring at 50 C. for 23 hours. Insoluble particles were removed by filtration. The solvent was removed by evaporation to dryness under reduced pressure. The residue was added with 200 ml of mixed solvent of DCM:methanol in a volume ratio of 1:1, and the resultant organic phase was washed with 50 ml of saturated sodium bicarbonate. The aqueous phase was extracted three times, each with 50 ml of dichloromethane. The organic phases were combined, dried with anhydrous sodium sulfate and filtered. The solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump overnight, and purified by using a normal phase silica gel column (200-300 mesh). The column was packed with petroleum ether, added with 1 wt % triethylamine for neutralizing the acidity of silica gel, and eluted with a gradient elution of dichloromethan:methanol:aqueous ammonia (25 wt %)=1:1:0.05-1:1:0.25. The eluate was collected. The solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump to give 3.062 g of pure product W-3.
(393) (8-1-4) Synthesis of W-4
(394) W-3 (0.675 g, 1.517 mmol) and GAL-C7-2 (2.60 g, 5.46 mmol) were mixed and dissolved in 47 ml of acetonitrile, added with diisopropylethylamine (1.57 g, 12.14 mmol) followed by 3-(diethoxyphosphoryloxy)-1,2,3-benzotrizin-4(3H)-one (DEPBT, 1.816 g, 6.04 mmol) to react under stirring at room temperature for 2.5 hours. The resultant reaction solution was diluted with 100 ml of dichloromethane. The organic phase was washed with 80 ml of saturated sodium bicarbonate solution and 80 ml of saturated brine, respectively. The organic phases were combined, dried with anhydrous sodium sulfate, and filtered. The solvent was removed by evaporation to dryness under reduced pressure to give a crude product, which was purified by using a normal phase silica gel column (200-300 mesh). The column was packed with petroleum ether, added with 1 wt % triethylamine for neutralizing the acidity of silica gel, and eluted with a gradient elution of dichloromethane:methanol=100:5-100:7. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give 1.610 g of pure product W-4.
(395) (8-1-5) Synthesis of W-5
(396) W-4 (1.61 g, 0.886 mmol) was dissolved in 125 ml of dichloromethane, and added with dichloroacetic acid (3.5 ml, 42.43 mmol) to react at room temperature for 1 hour. The resultant reaction solution was neutralized by adding 150 ml of pyridine. The solvent was removed by evaporation to dryness under reduced pressure to give a crude product. The crude product was purified by a normal phase silica gel column (200-300 mesh). The column was added with 10 wt % triethylamine for neutralizing the acidity of silica gel, equilibrated with 1 wt % triethylamine and eluted with a gradient elution of dichloromethane:methanol=100:30-100:40. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give 1.26 g of pure product W-5.
(397) (8-1-6) Synthesis of W-6
(398) W-5 (1.25 g, 0.793 mmol) and A-1 (1.21 g, 2.38 mmol) obtained according to the method described in step (1-1-7a) were mixed and dissolved in 12 ml of dichloromethane, and added with 3-(diethoxyphosphoryloxy)-1,2,3-benzotrizin-4(3H)-one (DEPBT, 0.712 g, 2.38 mmol) followed by diisopropylethylamine (0.615 g, 4.76 mmol) to react under stirring at 25 C. for 3 hours. The organic phase was washed with 80 ml of saturated sodium bicarbonate. The aqueous phase was extracted three times, each with 10 ml of dichloromethane. The organic phases were combined and washed with 10 ml of saturated brine. The organic phases were combined, dried with anhydrous sodium sulfate and filtered. The solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump overnight to give a crude product, which was subjected to a column purification. The column was filled with 185 g normal phase silica gel (200-300 mesh), added with 20 m1 triethylamine for neutralizing the acidity of silica gel, equilibrated with petroleum ether containing 1 wt % triethylamine and eluted with a gradient elution of petroleum ether:ethyl acetate:dichloromethane:N,N-dimethylformamide=1:1:1:0.1-1:1:1:0.7. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give 1.57 g of pure product W-6.
(399) (8-1-7) Synthesis of W-7
(400) W-6 (1.238 g, 0.63 mmol), succinic anhydride (0.189 g, 1.89 mmol) and 4-dimethylaminopyridine (DMAP, 0.231 g, 1.89 mmol) were mixed and dissolved in 7 ml of dichloromethane, and added with DIEA (0.407 g, 3.15 mmol) to react under stirring at 25 C. for 24 hours. The reaction solution was washed with 5 ml of 0.5 M triethylamine phosphate. The aqueous phase was extracted three times, each with 5 ml of dichloromethane. The organic phases were combined, and the solvent was removed by evaporation to dryness under reduced pressure to give a crude product. The crude product was subjected to a column purification. The column was filled with 30 g normal phase silica gel (200-300 mesh), added with 1 wt % triethylamine for neutralizing the acidity of silica gel, equilibrated with dichloromethane and eluted with a gradient elution of 1 wt % triethylamine-containing dichloromethane:methanol=100:18-100:20. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give 1.033 g of pure product W-7 conjugation molecule. MS m/z: C101H146N7O38, [M-DMTr]+, calculated: 1763.92. measured: 1763.21.
(401) (8-1-8) Synthesis of W-8
(402) W-8 was prepared by using the same method as that in step (1-1-9) of Preparation Example 1, except that the W-7 conjugation molecule was used to replace the L-9 conjugation molecule, thereby obtaining the W-7 conjugation molecule linked to a solid phase support.
(403) (8-2) Synthesis of the conjugate W8-siHB3M1SVP
(404) Conjugate 18 was prepared by using the same method as that in steps (1-2)-(1-4) of Preparation Example 1, except that Compound W-8 was used to replace Compound L-10 to start the synthesis of a sense strand. It was expected that the conjugate W8-siHB3M1SVP with a structure as shown by Formula (13) can be obtained.
Preparation Example 9 Preparation of the Conjugate X8-siHB3M1SVP (Conjugate 19)
(405) It was expected that Compound X-8 can be synthesized according to the following process route:
(406) ##STR00095## ##STR00096## ##STR00097##
(407) Conjugate 19 was prepared by using the same method as that in steps (1-2)-(1-4) of Preparation Example 1, except that Compound X-8 was used to replace Compound L-10 to start the synthesis of a sense strand. It was expected that the conjugate X8-siHB3M1SVP with a structure as shown by Formula (21) can be obtained.
Preparation Example 10 Preparation of the Conjugate Z5-siHB3M1SVP (Conjugate 20)
(408) (10-1) Synthesis of Compound Z-5
(409) Compound Z-5 was synthesized according to the following process:
(410) ##STR00098## ##STR00099## ##STR00100##
(10-1-1) Synthesis of Z-1
(411) W-3 (1.50 g, 3.37 mmol) obtained according to the method described in step (8-1-3) and GAL5-C4-2 (7.18 g, 13.48 mmol) obtained according to the method described in step (3-1-2) were mixed and dissolved in 34 ml of dichloromethane, and added with diisopropylethylamine (3.48 g, 26.96 mmol) followed by 3-(diethoxyphosphoryloxy)-1,2,3-benzotrizin-4(3H)-one (DEPBT, 4.04 g, 13.48 mmol) to react under stirring at room temperature for 4.5 hours. The resultant reaction solution was diluted with 100 ml of dichloromethane. The organic phase was washed with 80 ml of saturated sodium bicarbonate solution and 80 ml of saturated brine, respectively. The organic phases were combined, dried with anhydrous sodium sulfate, and filtered. The solvent was removed by evaporation to dryness under reduced pressure to give a crude product. The crude product was purified by using a normal phase silica gel column (200-300 mesh). The column was packed with petroleum ether, added with 1 wt % triethylamine for neutralizing the acidity of silica gel, and eluted with a gradient elution of dichloromethane:methanol=30:1-15:1. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give 3.97 g of pure product Z-1. MS m/z: C98H143N10O33, [M+H]+, calculated: 1987.98. measured: 1987.90.
(412) (10-1-2) Synthesis of Z-2
(413) Z-1 (3.97 g, 2.00 mmol) was dissolved in 250 ml of dichloromethane, and added with dichloroacetic acid (10.941 g, 84.85 mmol) to react at room temperature for 1 hour. Pyridine was added to neutralize the resultant reaction solution to be neutral. The solvent was removed by evaporation to dryness under reduced pressure to give a crude product. The column was filled with 220 g normal phase silica gel (200-300 mesh), and added with 10 wt % pyridine for neutralizing the acidity of silica gel, equilibrated with 1 wt % pyridine and eluted with a gradient elution of dichloromethane:methanol=10:1-2:1. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give 3.49 g of pure product Z-2. MS m/z: C79H129N10O33, [M+H]+, calculated: 1746.94. measured: 1746.90.
(414) (10-1-3) Synthesis of Z-3
(415) Z-2 (3.49 g, 2.0 mmol) and A-1 (3.06 g, 6.0 mmol) obtained according to the method described in step (1-1-7a) were mixed and dissolved in 30 ml of dichloromethane, and added with 3-(diethoxyphosphoryloxy)-1,2,3-benzotrizin-4(3H)-one (DEPBT, 1.80 g, 6.0 mmol) followed by diisopropylethylamine (1.55 g, 12.0 mmol) to react under stirring at 25 C. for 3 hours. The resultant reaction solution was diluted with 100 ml dichloromethane. The organic phase was washed two times, each with 30 ml of saturated sodium bicarbonate. The aqueous phase was extracted with 10 ml of dichloromethane. The organic phases were combined and washed with 50 ml of saturated brine. The obtained organic phases were combined and dried with anhydrous sodium sulfate, and filtered. The solvent was removed by evaporation to dryness under reduced pressure, and the residue was foam-dried in a vacuum oil pump overnight to give a crude product. The crude product was subjected to a column purification. The column was filled with 200 g normal phase silica gel (200-300 mesh), added with 20 ml triethylamine for neutralizing the acidity of silica gel. The column was equilibrated with petroleum ether containing 1 wt % triethylamine and eluted with a gradient elution of dichloromethane:methanol=25:1-15:1. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give 2.2 g of pure product Z-3. MS m/z: C103H151N10O38, [M+H]+, calculated: 2136.02. measured: 2136.20.
(416) (10-1-4) Synthesis of Z-4
(417) Z-3 (2.10 g, 0.983 mmol) was dissolved in 14.8 ml of dichloromethane containing DIEA (0.635 g, 4.915 mmol), 4-dimethylaminopyridin (DMAP, 240 mg, 1.966 mmol) was added to the resultant solution and stirred to clarity. Succinic anhydride (197 mg, 1.966 mmol) was added to react under stirring at 25 C. for 18 hours. The resultant reaction solution was diluted by adding 50 ml dichloromethane. The organic phase was washed with 80 ml of 0.5 M triethylamine phosphate. The aqueous phase was extracted two times, each with 50 ml of dichloromethane. The organic phases were combined, and the solvent was removed by evaporation to dryness under reduced pressure to give a crude product. The crude product was subjected to a column purification. The column was filled with 188 g normal phase silica gel (200-300 mesh), added with 1 wt % triethylamine for neutralizing the acidity of silica gel, equilibrated with dichloromethane and eluted with a gradient elution of 1 wt % triethylamine-containing dichloromethane:methanol=10:1-3:1. The eluate was collected, and the solvent was removed by evaporation to dryness under reduced pressure to give 1.95 g of pure product Z-4 conjugation molecule. MS m/z: C107H155N10O41, [M+H]+, calculated: 1935.07, measured: 1935.29.
(418) (10-2) Synthesis of Z-5
(419) Z-5 was prepared by using the same method as that in step (1-1-9) of Preparation Example 1, except that the Z-4 conjugation molecule was used to replace the L-9 conjugation molecule, thereby obtaining the Z-4 conjugation molecule linked to a solid phase support.
(420) (3-2) Synthesis of the Conjugate Z5-siHB3M1SVP
(421) Conjugate 20 was prepared by using the same method as that in steps (1-2)-(1-4) of Preparation Example 1, except that Compound Z-5 was used to replace Compound L-10 to start the synthesis of a sense strand. It was expected that the conjugate Z5-siHB3M1SVP with a structure as shown by Formula (22) can be obtained.
Preparation Example 11 Preparation of the Conjugate K4-siHB3M1SVP (Comparative Conjugate 2)
(422) (11-1) Synthesis of Compound K-4
(423) Compound K-4 was synthesized according to the following process:
(424) ##STR00101## ##STR00102##
(11-1-1) Synthesis of K-1
(425) A-1 (3.0 g, 6.0 mmol) obtained according to the method described in step (1-1-7a), PyBOP (6.2 g, 12.0 mmol), HOBt (1.6 g, 2.0 mmol) and diisopropylethylamine (DIEA, 3.9 g, 30.0 mmol) were added into 60 ml of dichloromethane to react under stirring at room temperature for 10 minutes. Then the solution was added into K-0 (5.6 g, 30.0 mmol) to react at room temperature for 1 hour and 50 minutes. The reaction solution was poured into 30 ml saturated sodium bicarbonate solution. The aqueous phase was extracted three times, each with 30 ml of dichloromethane. The organic phases were combined, washed with saturated sodium chloride solution, dried with anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by a normal phase silica gel column (200-300 mesh). The column was eluted with a gradient elution of dichloromethan:methanol:aqueous ammonia (25 wt %)=10:2:0.1-4:4:1. The eluate was collected, the solvent was removed by concentration, and the residue was foam-dried in a vacuum oil pump to give 2.2 g of product K-1 as a white solid. .sup.1H NMR (400 MHz, DMSO-d6) 8.02 (s, 1H), 7.43 (d, J=7.8 Hz, 2H), 7.34-7.17 (m, 7H), 6.87 (d, J=8.6 Hz, 4H), 4.05 (d, J=5.2 Hz, 1H), 3.74 (s, 6H), 3.20-3.01 (m, 5H), 2.60-2.38 (m, 12H), 1.60-1.39 (m, 8H), 1.24 (s, 1H). MS m/z: C33H47N4O5, [M+H]+, calculated: 579.35, measured: 579.26.
(426) (11-1-2) Synthesis of K-2
(427) GAL-5 (483 mg, 1.08 mmol) obtained according to the method described in step (1-1-1), 3-diethoxyphosphoryl-1,2,3-benzotrizin-4(3H)-one (359 mg, 1.2 mmol), diisopropylethylamine (DIEA, 310 mg, 2.4 mmol) were added into 3 ml of dichloromethane under stirring at room temperature for 30 minutes. The mixture was added with K-1 (174 mg, 0.3 mmol) to react at room temperature for 16 hours. The reaction solution was poured into 10 ml saturated sodium bicarbonate solution. The aqueous phase was extracted three times, each with 10 ml of dichloromethane. The organic phases were combined, washed with 10 ml of saturated sodium chloride solution, dried with anhydrous sodium sulfate and filtered. The obtained organic phase was concentrated, and the residue was purified by a normal phase silica gel column (200-300 mesh). The column was eluted with the elution of dichloromethane:methanol=20:1. The eluate was collected, the solvent was removed by concentration, and the residue was foam-dried in a vacuum oil pump to give 205 mg of product K-2 as a yellow solid.
(428) (11-1-3) Synthesis of K-3
(429) K-2 (205 mg, 0.11 mmol), succinic anhydride (22 mg, 0.22 mmol), 4-dimethylaminopyridine (DMAP, 27 mg, 0.22 mmol) and diisopropylethylamine (DIEA, 71 mg, 0.55 mmol) were added into 1.1 ml of dichloromethane to react under stirring at room temperature overnight. The reaction solution was washed three times, each with 0.5 ml of 0.5 M triethylamine phosphate. Each aqueous phase was reverse extracted once with 0.5 ml of dichloromethane. The organic phases were dried with anhydrous sodium sulfate, concentrated to remove the solvent. The residue was foam-dried in a vacuum oil pump to give 218 mg of K-3 conjugation molecule as a light yellow solid.
(430) (11-1-4) Synthesis of K-4
(431) K-4 was prepared by the same method as that in step (1-1-9) of Preparation Example 1, except that the K-3 conjugation molecule was used instead of the L-9 conjugation molecule to obtain the K-3 conjugation molecule linked to a solid phase support.
(432) (11-2) Synthesis of the conjugate K4-siHB3M1SVP
(433) Comparative Conjugate 2 was prepared by using the same method as that in steps (1-2)-(1-4) of Preparation Example 1, except that Compound K-4 was used to replace Compound L-10 to start the synthesis of a sense strand. It was expected that the conjugate K4-siHB3M1SVP with a structure as shown by Formula (23) can be obtained:
(434) ##STR00103##
wherein Nu is the siRNA in the conjugate K4-siHB3M1SVP.
Preparation Example 12 Preparation of the siRNA
(435) The siRNA sequences provided in the present disclosure as listed in Table 4 were obtained by conventional solid phase synthesis methods. An equimolar mixture of sense and antisense strand was dissolved in DEPC water, and then conventionally annealed to form a double-stranded siRNA.
(436) TABLE-US-00015 TABLE4 siRNAsequences SEQ siRNA No. Sequencedirection5-3 IDNO siRNA1 siHB3M1SVP Sense GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmG 24 strand mAmAmUmAm Antisense VP- 67 strand UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfC mUfUmUmCmsUmsUm siRNA2 siHB3M1S Sense GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmG 24 strand mAmAmUmAm Antisense UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfC 27 strand mUfUmUmCmsUmsUm siRNA3 siHB3M1SPs Sense GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmG 24 strand mAmAmUmAm Antisense Ps- 69 strand UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfC mUfUmUmCmsUmsUm Sense GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmG 24 strand mAmAmUmAm siRNA4 siHB3M1SP Antisense P- 68 strand UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfC mUfUmUmCmsUmsUm NC siNCM1SP Sense UmsUmsCmUmCmCmGfAfAfCmGmUmGmUmC 77 strand mAmCmGmUm Antisense P- 78 strand AmsCfsGmUmGmAfCmAmCmGmUmUmCmGfG mAfGmAmAmsCmsUm
(437) In Table 4, siRNAs 1-4 are the siRNAs of the present disclosure that specifically target the P gene region of HBV; NC was a negative control siRNA that had no inhibitory effect on HBV gene.
(438) After the preparation of the siRNAs or conjugates of the present disclosure above, they were lyophilized to solid powder via standard process and stored until used. When being used, they can be reconstituted to a solution at a desired concentration dissolved in, for example, water for injection, normal saline (NS), phosphate buffer (PB), or phosphate buffered solution (PBS).
Experimental Example 1 the On-Target Activity and Off-Target Activity of the siRNA Conjugates in In Vitro psiCHECK System
(439) HEK293A cells used in this experimental example were provided by Nucleic Acid Technology Laboratory, Institute of Molecular Medicine, Peking University and cultured in DMEM complete media (Hyclone company) containing 20% fetal bovine serum (FBS, Hyclone company), 0.2v % Penicillin-Streptomycin (Gibco, Invitrogen company) at 37 C. in an incubator containing 5% CO.sub.2/95% air.
(440) In this experimental example, Conjugate 2 was investigated in in vitro psiCHECK system for the on-target activity and off-target effect.
(441) According to the method described in Kumico Ui-Tei et. al., Functional dissection of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammalian gene silencing with significantly reduced off-target effect. Nucleic Acids Research, 2008.36(7), 2136-2131, plasmids for detection were constructed and co-transfected with the siRNA conjugates to be detected into HEK293A cells; and the expression levels of the dual luciferase reporter gene reflect the on-target activity and off-target effect of the siRNA conjugates. Specific steps are as follows:
(442) [1] Construction of Plasmids for Detection
(443) Four recombinant plasmids were constructed using psiCHECK-2 (Promega) plasmid, in which GSCM represents the on-target plasmid; and PSCM, GSSM and PSSM represent the off-target plasmids: (1) GSCM, containing a target sequence, wherein the target sequence is completely complementary to the nucleotide sequence at positions 2-19 from 3 terminal of the antisense strand in Conjugate 2, and is used to detect the on-target activity of the antisense strand. (2) PSCM, containing a target sequence, wherein the target sequence is completely complementary to the nucleotide sequence at positions 1-18 from 3 terminal of the sense strand in Conjugate 2, and is used to detect the off-target activity of the sense strand. (3) GSSM, containing a target sequence, wherein the target sequence is completely complementary to the nucleotide sequence at positions 2-8 from 3 terminal of the antisense strand in Conjugate 2, while the remaining part of the target sequence corresponds to but is completely mismatched with the nucleotide sequence at positions 9-21 from 5 terminal of the antisense strand in Conjugate 2; that is, when the nucleotide at any position in positions 9-21 from 5 terminal of the antisense strand in Conjugate 2 is G, C, A or U, the nucleotide at the corresponding position in the target sequence is T, A, C or G respectively. GSSM is used to detect the off-target activity of the seed region of the antisense strand. (4) PSSM, containing a target sequence, wherein the target sequence is completely complementary to the nucleotide sequence at positions 1-8 from 5 terminal of the sense strand in Conjugate 2, while the remaining part of the target sequence corresponds to but is completely mismatched with the nucleotide sequence at positions 9-19 from 5 terminal of the sense strand in Conjugate 2; that is, when the nucleotide at any position in positions 9-21 from 5 terminal of the sense strand in Conjugate 2 is G, C, A or U, the nucleotide at the corresponding position in the target sequence is T, A, C or G respectively. PSSM is used to detect the off-target activity of the seed region of the sense strand.
(444) Each of the above target sequences were synthesized by Suzhou GenePharma Inc. The sequence information is shown in Table 5.
(445) TABLE-US-00016 TABLE5 targetsequences Plasmid SEQ name No. Sequencedirection5-3 IDNO GSCM GSCM-s Sensestrand TCGAGTGGAAAGTATGTCAACGAATTGC 79 GSCM-as Antisensestrand GGCCGCAATTCGTTGACATACTTTCCAC 80 PSCM PSCM-s Sensestrand TCGAGAATTCGTTGACATACTTTCCAGC 81 PSCM-as Antisensestrand GGCCGCTGGAAAGTATGTCAACGAATTC 82 GSSM GSSM-s Sensestrand TCGAGGTTCCCTGCGTGAAACGAATTGC 83 GSSM-as Antisensestrand GGCCGCAATTCGTTTCACGCAGGGAACC 84 PSSM PSSM-s Sensestrand TCGAGCCGGATGGTCACGACTTTCCAGC 85 PSSM-as Antisensestrand GGCCGCTGGAAAGTCGTGACCATCCGGC 86
(446) The target sequence was cloned into the Xho I/Not I site of the psiCHECK-2 plasmid.
(447) [2] Transfection
(448) In a 96-well plate, the siRNA conjugate and each of the above plasmids were co-transfected according to the instruction of Lipofectamine 2000 (Invitrogen), each plasmid corresponding to several specific concentrations of Conjugate 2. Specifically, 10 ng of plasmid was transfected per well, using 0.2 L of Lipofectamine 2000 per well. For the on-target plasmid GSCM, the final concentration (calculated as the concentration of siRNA) of Conjugate 2 was from 1 nM to 0.000977 nM (fold serial dilutions of 11 concentrations). For the other three off-target plasmid, the final concentration of Conjugate 2 was from 10 nM to 0.000038 nM (4-fold serial dilutions of 10 concentrations). Those untreated with the conjugate in each group were used as control, with 3 replicate wells per group.
(449) [3] Detection
(450) 24 hours after co-transfection, the HEK293A cells were lysed by using a dual luciferase reporter gene assay kit (Promega, cat.E2940) according to the instruction to detect the 13 expression level of the dual luciferase reporter gene. The Renilla luciferase protein level was normalized to the firefly luciferase protein level. The dose-response curves were plotted by the activity results measured at different siRNA concentrations, and the curves were fitted using the function log(inhibitor) vs. responseVariable slope of Graphpad 5.0 software. The IC.sub.50 of Conjugate 2 targeting GSCM was calculated based on the dose-response curve.
(451)
wherein: Y is the expression level of remaining mRNA, X is the logarithm of the concentration of transfected siRNA conjugates, Bot is the Y value at the bottom of the steady stage, Top is the Y value at the top of the steady stage, Logic.sub.50 is the X value at which Y is the median value between the bottom and the top, and HillSlope is the slope of the curve.
(452) For GSCM, the IC.sub.50 value of Conjugate 2 is 0.0513 nM (R.sup.2=0.9911); For PSCM, GSSM and PSSM, Conjugate 2 shows no significantly inhibitory effect at each siRNA concentration, indicating that the siRNA conjugate of the present disclosure not only has higher activity in vitro, but also exhibits low off-target effect.
Experimental Example 2 Stability of the siRNA Conjugates of the Present Disclosure in the Lysosome Lysate In Vitro
(453) The sequence of the negative control siRNA used in this experimental example is as follows:
(454) TABLE-US-00017 Sensestrand: (SEQIDNo:9) 5-CmCmUmUmGAGGCmAUmACmUmUmCmAAAdT-S-dT-3 Antisensestrand: (SEQIDNo:10) 5-UfUmUfGAAGUfAUGCCUfCAAGGdT-S-dT-3
(455) This siRNA was synthesized by phosphoramidite solid phase synthesis method. The negative control and Conjugate 2 were formulated with 0.9% NaCl aqueous solution respectively into the solutions with a concentration of 20 M (calculated as the concentration of siRNA), which were marked as negative control and Conjugate 2.
(456) 1) Detection of the Stability in Murine Lysosome Lysate
(457) Preparation of test samples treated with the lysosome lysate: Conjugate 2 and the negative control (20 M, each 6 l) were individually mixed well with 27.2 L of aqueous sodium citrate solution (pH 3.0), 4.08 L of deionized water and 2.72 L of murine lysosome lysate (Rat Liver Tritosomes, purchased from Xenotech Inc., Cat No. R0610.LT, Lot No. 1610069), at a final concentration of acid phosphatase of 0.2 mU/L, and incubated at a constant temperature of 37 C. 5 L mixed solution was taken at each time point of 0 h, 1 h, 2 h, 4 h, 6 h, and 24 h, respectively, added to 15 L of 9 M urea solution for denaturation, then added with 4 L of 6 loading buffer (purchased from Solarbio Inc., Cat No. 20160830), then immediately cryopreserved in a 80 C. freezer to quench the reaction. 0 h represents the moment when the sample was taken out immediately after the samples to be tested are mixed well with the lysosome lysate.
(458) Preparation of reference samples untreated with the lysosome lysate: Conjugate 2 and the negative control (20 M, each 1.5 L) at equal moles were mixed well with 7.5 L of aqueous sodium citrate solution (pH 5.0) and 1 L of deionized water, added to 30 L of 9 M urea solution for denaturation, then added with 8 L of 6 loading buffer, then immediately cryopreserved in a 80 C. freezer to quench the reaction. The reference sample of the negative control was marked as M1, the reference sample of Conjugate 2 was marked as M2. 16 wt % of non-denatured polyacrylamide gel was prepared. 20 L each of the test samples and the reference samples above was loaded onto the gel to perform electrophoresis under 20 mA constant current for 10 minutes and then under 40 mA constant current for 30 minutes. After finishing the electrophoresis, the gel was placed on a shaker and stained with Gelred dye (BioTium, Cat No. 13G1203) for 10 minutes. The gel was subjected to imaging, observation and photocopying. The results are shown in
(459) 2) Detection of the Stability in Human Lysosome Lysate
(460) The stabilities of the negative control and Conjugate 2 in the human lysosome lysate were measured using the same method as that in 1), except that the murine lysosome lysate was replaced with the human lysosome lysate (Human Liver Lysosomes, purchased from Xenotech Inc., Cat No. R0610.L, Lot No. 1610316). The results are shown in
(461) The results indicate that the siRNA conjugates of the present disclosure can remain undegraded for at least 24 hours both in human lysosome lysate and in murine lysosome lysate, showing satisfactory stability.
Experimental Example 3 Inhibitory Efficiency of the siRNA Conjugates Against the Expression of HBV mRNA in HBV Model Mice
(462) 1) In this experimental example, the inhibition efficiencies of Conjugates 1 and 2 against the expression of HBV mRNA in HBV model mice C57BL/6J-Tg (Alb1HBV) 44Bri/J were investigated.
(463) The HBV model mice C57BL/6J-Tg (Alb1HBV) 44Bri/J used in this experimental example were purchased from Department of Laboratory Animal Science, Peking University Health Science Center. Conjugate 2 was formulated with 0.9% NaCl aqueous solution into a solution with a concentration of 0.2 mg/ml (calculated as the concentration of siRNA). Conjugate 1 was formulated with 0.9% NaCl aqueous solution into solutions with the concentration of 0.2 mg/ml and 0.06 mg/ml (calculated as the concentration of siRNA).
(464) HBsAg content in mouse serum was measured using Hepatitis B Virus Surface Antigen Assay Kit (Enzyme-linked Immunosorbent Assay, ELISA) (Shanghai Kehua Bio-engineering Co., Ltd.). Mice with S/COV>10 were selected, randomly divided into two groups (all female, 6 mice in each group) and respectively recorded as the control group and the test group. Animals in each group were subcutaneously injected with various drugs on day 1 in the administration volume of 5 mL/kg. The drug dosages for all animals were calculated according to the body weight. Therein, the mice in the control group were injected with normal saline; the mice in the test group were injected with Conjugate 2 at an administration dosage of 1 mg/kg. All the animals were sacrificed on day 28 after administration, and were subjected to a gross anatomy to observe whether the internal organs were diseased. The diseased tissues discovered by visual observation were preserved with 10% formalin for further pathological observation. The liver was collected and kept with RNA later (Sigma Aldrich), and the liver tissue was homogenized with a tissue homogenizer. Then the total RNA was extracted and obtained by Trizol according to the standard procedures for total RNA extraction.
(465) The expression level of HBV mRNA in liver tissue was detected by real-time fluorescent qPCR. Specifically, the extracted total RNA was reverse transcribed into the cDNA by using ImProm-II reverse transcription kit (Promega) according to the instruction, and then the inhibitory efficiency of siRNAs against the expression of HBV mRNA in liver tissue was detected by using the fluorescent qPCR kit (Beijing Cowin Biosicences Co., Ltd). In this fluorescent qPCR method, GAPDH gene was used as an internal control gene, the HBV and GAPDH were detected by using the primers for HBV and GAPDH, respectively.
(466) Sequences of the primers for detection are shown in Table 6.
(467) TABLE-US-00018 TABLE6 Sequencesoftheprimersfordetection Genes UpstreamPrimers DownstreamPrimers HBV 5-GTCTTTTGGGTTT 5-GCAACGGGGTAAAGG TGCTGCC-3 TTCAG-3 (SEQIDNO:87) (SEQIDNO:88) GAPDH 5-GGTCGGAGTCAAC 5-CCAGCATCGCCCCAC GGATTT-3 TTGA-3 (SEQIDNO:89) (SEQIDNO:90)
(468) In this fluorescent qPCR method, the inhibitory activity of siRNA was expressed as the inhibition percentage against HBV mRNA and calculated by the following equation:
The inhibition percentage against HBV mRNA=(1the remaining expression of HBV gene)100%
The remaining expression of HBV gene=(the copy number of HBV gene in the test group/the copy number of GAPDH gene in the test group)/(the copy number of HBV gene in the control group/the copy number of GAPDH gene in the control group)*100%
(469) The results are shown in Table 7.
(470) Through the same method, the inhibition efficiencies in vivo of Conjugate 1 at different doses (n=5) against the expression of HBV mRNA were detected. The results are shown in Table 7.
(471) TABLE-US-00019 TABLE 7 The inhibition of siRNA conjugates against the expression of HBV mRNA in mice liver Administra- Inhibition percentage siRNA tion dose against HBV P mRNA conjugate No. (mg/kg) in liver (%) Conjugate 2 L10-siHB3M1SP 1 77.41 Conjugate 1 L10-siHB3M1SVP 1 88.27 Conjugate 1 L10-siHB3M1SVP 0.3 57.95
(472) As can be seen from the above results, all conjugates of the present disclosure show high inhibitory activity against the expression of HBV mRNA in mice in vivo, indicating that the siRNA conjugates of the present disclosure have excellent delivery efficiency in vivo.
(473) 2) Through the same method as that in 1), the inhibition efficiency in vivo of Conjugate 3-Conjugate 20 against HBV mRNA was detected. It can be expected that Conjugate 3-Conjugate 20 containing the siRNAs with different lengths and similar modification schemes have higher inhibitory activity against mRNA; and that Conjugate 3-Conjugate 20 containing the same siRNA and similar conjugate molecules also have higher inhibitory activity against mRNA.
Experimental Example 4 the Time-Dependent Test of the Inhibitory Efficiency of the siRNA Conjugates Against the Expression Levels of HBsAg, HBeAg and HBV DNA in HBV Model Mice Serum
(474) HBV model mice C57B/6N-Tg (1.28 HBV)/Vst (genotype A) used in this experimental example were purchased from Beijing Vitalstar Biotechnology Co., Ltd. Conjugate 1 was formulated with 0.9% NaCl aqueous solution into solutions with the concentration of 0.6 mg/ml and 0.2 mg/ml (calculated as the concentration of siRNA).
(475) The mice with a serum HBsAg content >10.sup.4 COI were selected (half male and half female), randomly divided into three groups (6 mice in each group) and respectively recorded as the control group, the high-dose group and the low-dose group. Animals in each group were subcutaneously injected with various drugs on day 1 in the administration volume of 5 mL/kg. The drug dosages for all animals were calculated according to the body weight. All animals were administered in the morning. If the blood sampling was required, the administration would be performed after the blood sampling. Therein, the animals in the control group were injected with normal saline; the animals in the test groups were injected with Conjugates 1 at different concentrations (3 mg/kg for the high-dose group; 1 mg/kg for the low-dose group). The blood was taken from mouse orbital venous plexus before administration and on days 7, 13, 21, 28, 42, 56, 70, 84, 98, 112, 126, 140 and 154 after administration, and the levels of HBsAg, HBeAg and HBV DNA in serum was measured for each time point.
(476) About 100 l orbital blood was taken each time, and the serum was no less than 20 l after centrifugation, resuspended with PBS to 500 l, and delivered to Clinical Laboratory Center of Beijing Dian Diagnostics to measure the contents of HBsAg, HBeAg and HBV DNA in serum, which were expressed in COL COI and IU/ml, respectively.
(477) The normalized levels of the indicators to be measured (HBsAg, HBeAg and HBV DNA) were calculated according to the following equation:
the normalized level of the indicators to be measured=(the remaining content of the indicators to be measured after administration/the content of the indicators to be measured before administration)100%
The inhibition percentage of the indicators to be measured=(1the normalized level of the indicators to be measured)*100%
(478) The experimental data are all expressed as
(479) The results are shown in
(480) As can be seen from
(481) As can be seen from
(482) As can be seen from
(483) The above results show that the conjugates of the present disclosure show stable and efficient inhibition against the expression of HBV gene over an extended time period, and especially exhibit sustained inhibition against the surface antigens, showing excellent effects.
Experimental Example 5 Inhibitory Activity of siRNA in In Vitro psiCHECK System
(484) The inhibitory activity of each siRNA in Preparation Example 12 in in vitro psiCHECK system was investigated in this experimental example.
(485) The detection plasmid GSCM in Experiment Example 1 and the siRNA to be detected (siRNAs 1-4 and NC) were co-transfected into HEK293A cells; and the expression levels of the dual luciferase reporter gene reflect the inhibitory activity of the siRNA. Specific steps are as follows:
(486) In a 96-well plate, the siRNA and GSCM plasmid were co-transfected according to the instruction of Lipofectamine 2000 (Invitrogen). Specifically, 10 ng of plasmid was transfected per well, using 0.2 L of Lipofectamine 2000 per well. The final concentrations of the siRNA were 0.1 nM, 0.01 nM and 0.001 nM. Those untreated with the siRNA in each group were used as control, with 3 replicate wells per group.
(487) 24 hours after co-transfection, the HEK293A cells were lysed by using a dual luciferase reporter gene assay kit (Promega, Cat No. E2940) according to the instruction to detect the expression level of the dual luciferase reporter gene. The Renilla luciferase protein level was normalized to the firefly luciferase protein level. The results are shown in
(488) The results show that siRNAs 1-4 all have good inhibitory activity in vitro. At the concentration of 0.1 nM, the inhibition percentage of each siRNA is above 80%.
Experimental Example 6 Stability of the siRNA in Human Plasma In Vitro
(489) siRNAs 1-4 (20 M, 12 l) obtained in Preparation Example 12 were individually mixed well with 108 L of 90% human plasma (diluted in PBS) and incubated at a constant temperature of 37 C. 10 L samples were taken at each time point of 0 h, 2 h, 4 h, 6 h, 24 h, 48 h and 72 h, respectively, and immediately frozen in liquid nitrogen and cryopreserved in a 80 C. freezer. After sampling at each time point, each sample was diluted S-fold with 1*PBS (pH 7.4) and then taken in a volume of 10 L for use. Meanwhile, each of the siRNAs was taken at equal moles (20 M, 1 L) and mixed well with 49 L of 1PBS (pH 7.4), and 10 L of the mixture was taken as the reference sample untreated with human plasma (respectively marked as M11-M14). 16 wt % of non-denatured polyacrylamide gel was prepared. Each sample above was mixed with 4 L of loading buffer (aqueous solution of 20 mM EDTA, 36 wt % glycerol, and 0.06 wt % bromophenol blue) and then loaded onto the gel to perform electrophoresis under 20 mA constant current for 20 minutes and then under 40 mA constant current for about 60 minutes. After finishing the electrophoresis, the gel was placed on a shaker and stained with Gelred dye (BioTium, Cat No. 13G1203) for 15 minutes. The gel was subjected to imaging, observation and photocopying. The results are shown in
(490) The results show that there is no significant difference in band brightness between the siRNAs of the present disclosure and the reference sample at different time points, and the bands are clear without tailing, which indicates that the siRNAs do not degrade and have good stability.
(491) The preferred embodiments of the present disclosure are described above in detail, but the present disclosure is not limited to the specific details of the above-described embodiments. Various simple variations of the technical solution of the present disclosure can be made within the scope of the technical concept of the present disclosure, and these simple variations are within the scope of the present disclosure.
(492) It is to be noted that each of the specific technical features described in the above embodiments can be combined in any suitable manner as long as no contradiction is caused. In order to avoid unnecessary repetition, the various possible combination manners are no longer described in the present disclosure.
(493) In addition, the various different embodiments of the present disclosure may also be carried out in any combination as long as it does not contravene the idea of the present disclosure, which should also be regarded as the disclosure of the present disclosure.