Recombinant acid-resistant yeast having improved lactic-acid-producing ability
11898173 ยท 2024-02-13
Assignee
Inventors
Cpc classification
C12Y101/01008
CHEMISTRY; METALLURGY
C12N9/0008
CHEMISTRY; METALLURGY
International classification
Abstract
Disclosed are a recombinant acid-resistant yeast having improved lactic-acid-producing ability and a method of preparing lactic acid using the same. When producing lactic acid using the recombinant acid-resistant yeast according to the present invention, not only lactic-acid fermentation can be performed with lactic-acid-producing ability similar to that of bacterial fermentation using a remarkably smaller amount of a neutralizing agent than in the case of conventional bacterial fermentation, but also the production of ethanol and glycerol which are byproducts can be reduced. Thus, fermentation costs can be greatly reduced and the cost of subsequent purification processes can be reduced.
Claims
1. A recombinant strain having lactic-acid-producing ability, wherein the recombinant strain is constructed by deleting a gene encoding a pyruvate decarboxylase from the acid-resistant yeast YBC strain deposited under accession number KCTC13508BP and introducing in said acid-resistant yeast YBC strain deposited under accession number KCTC13508BP a gene encoding a lactate dehydrogenase derived from Staphylococcus epidermidis and comprising the sequence of SEQ ID NO: 1 at the position of the gene encoding the pyruvate decarboxylase.
2. The recombinant strain according to claim 1, wherein a gene encoding an alcohol dehydrogenase is further deleted or inactivated by deletion or disruption.
3. The recombinant strain according to claim 1, wherein a gene encoding a glycerol-3-phosphate dehydrogenase that converts dihydroxyacetone phosphate to glycerol-3-phosphate is further deleted or inactivated by deletion or disruption.
4. The recombinant strain according to claim 1, wherein an endogenous gene encoding a lactate dehydrogenase that converts lactate to pyruvate is further deleted or inactivated by deletion or disruption.
5. A recombinant strain having lactic-acid-producing ability, wherein the recombinant strain is constructed by (a) deleting (i) a GPD1 gene, which is a gene encoding an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate, (ii) a CYB2 gene, which is a gene encoding an enzyme that converts lactate into pyruvate, (iii) an ADH gene, which is a gene encoding an alcohol dehydrogenase, and (iv) a PDC gene, which is a gene encoding a pyruvate decarboxylase, from the acid-resistant yeast YBC strain deposited under accession number KCTC13508BP, and (b) introducing in said acid-resistant YBC strain deposited under accession number KCTC13508BP, a gene encoding a lactate dehydrogenase, wherein the gene encoding the lactate dehydrogenase is introduced at the positions of the deleted ADH gene, PDC gene and GPD1 gene, and wherein the gene encoding the lactate dehydrogenase is derived from Staphylococcus epidermidis and comprises the sequence of SEQ ID NO: 1.
6. A recombinant strain #26-5 deposited under accession number KCTC14215BP, wherein said recombinant strain #26-5 deposited under accession number KCTC14215BP is constructed by adaptive evolution at a high lactic-acid concentration of a recombinant strain having lactic-acid-producing ability constructed by (a) deleting (i) a GPD1 gene, which is a gene encoding an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate, (ii) a CYB2 gene, which is a gene encoding an enzyme that converts lactate into pyruvate, (iii) an ADH gene, which is a gene encoding an alcohol dehydrogenase, and (iv) a PDC gene, which is a gene encoding a pyruvate decarboxylase, from the acid-resistant yeast YBC strain deposited under KCTC13508BP, and (b) introducing a gene encoding a lactate dehydrogenase comprising the sequence of SEQ ID NO: 1 into the acid-resistant yeast YBC strain deposited under KCTC13508BP.
7. A recombinant yeast YBC6 strain constructed by introducing a gene encoding a lactate dehydrogenase derived from Staphylococcus epidermidis and comprising the sequence of SEQ ID NO: 1 at a position of a PDC gene of the recombinant strain #26-5 deposited under accession number KCTC14215BP, the recombinant yeast YBC6 strain having improved lactic-acid-producing ability at a high lactic-acid concentration and suppressed ethanol- and glycerol-producing ability compared to the YBC strain deposited under accession number KCTC13508BP.
8. A method for producing lactic acid comprising: (a) culturing the strain according to claim 1 to produce lactic acid; and (b) collecting the produced lactic acid.
9. A method for producing lactic acid comprising: (a) culturing the strain according to claim 5 to produce lactic acid; and (b) collecting the produced lactic acid.
10. A method for producing lactic acid comprising: (a) culturing the strain according to claim 6 to produce lactic acid; and (b) collecting the produced lactic acid.
11. A method for producing lactic acid comprising: (a) culturing the strain according to claim 7 to produce lactic acid; and (b) collecting the produced lactic acid.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The above and other objects, features and other advantages of the present invention will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
DETAILED DESCRIPTION OF THE INVENTION
(9) Unless defined otherwise, all technical and scientific terms used herein have the same meanings as appreciated by those skilled in the field to which the present invention pertains. In general, the nomenclature used herein is well-known in the art and is ordinarily used.
(10) Acid-resistant yeast is characterized by consuming sugar at a high rate even at an acidic pH, exhibiting a high growth rate, and converting the consumed sugar into a desired product under fermentation conditions. In previous research by the present inventors, an acid-resistant yeast strain (KCTC13508BP) was selected from yeasts having these characteristics in several yeast libraries, and the acid-resistant yeast strain (KCTC13508BP) had a high growth rate and a high sugar consumption rate even at a lactic-acid concentration of 40 g/L to 80 g/L (Korean Patent Application No. 10-2018-0044509).
(11) In the previous patent application by the present inventors, by controlling the metabolic circuit to improve the lactic-acid-producing ability and suppress the ethanol-producing ability of the acid-resistant yeast YBC strain, the present inventors produced a recombinant strain by deleting a gene encoding the cytochrome b2 enzyme, which converts lactate to pyruvate, from a strain obtained by deleting a gene encoding alcohol dehydrogenase and a gene encoding pyruvate decarboxylase from the YBC strain and introducing a lactate dehydrogenase gene into the YBC strain.
(12) In addition, in order to suppress glycerol production in the constructed strain, the present inventors constructed a recombinant strain by deleting a gene encoding a glycerol-3-phosphate dehydrogenase, which converts hydroxyacetone phosphate to glycerol 3-phosphate, from the strain.
(13) In the present invention, in order to restore the lactic-acid resistance of the recombinant strain, the recombinant strain was subcultured in a medium containing lactic acid at various concentrations up to 80 g/L, a strain having excellent lactic-acid resistance was selected therefrom and a foreign lactate dehydrogenase gene that had been substituted at the position of the PDC genome of the selected strain was replaced with a lactate dehydrogenase gene derived from S. epidermidis to construct a novel recombinant strain, and the recombinant strain was found to have high lactic-acid resistance, high lactic-acid-producing ability, and suppressed ethanol- and glycerol-producing ability.
(14) Therefore, in one aspect, the present invention is directed to a recombinant strain having lactic-acid-producing ability, the recombinant strain constructed by deleting a gene encoding pyruvate decarboxylase from an acid-resistant yeast YBC strain (KCTC13508BP) and introducing a gene encoding lactate dehydrogenase derived from Staphylococcus epidermidis at the position of the gene encoding pyruvate decarboxylase.
(15) In the present invention, the gene encoding the lactate dehydrogenase derived from Staphylococcus epidermidis may be represented by SEQ ID NO: 1.
(16) In the present invention, the recombinant strain may be characterized in that a gene encoding alcohol dehydrogenase is further deleted or inactivated and in that a gene encoding an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate is further deleted or inactivated.
(17) In the present invention, the recombinant strain may be characterized in that a gene encoding an enzyme that converts lactate to pyruvate is further deleted or inactivated.
(18) In another aspect, the present invention is directed to a recombinant strain having lactic-acid-producing ability, the recombinant strain constructed by deleting a GPD1 gene, which is a gene encoding an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate, a CYB2 gene, which is a gene encoding an enzyme that converts lactate into pyruvate, an ADH gene, which is a gene encoding alcohol dehydrogenase, and a PDC gene, which is a gene encoding pyruvate decarboxylase from an acid-resistant yeast YBC strain (KCTC13508BP), and introducing the gene encoding lactate dehydrogenase into the acid-resistant yeast YBC strain,
(19) wherein the gene encoding the lactate dehydrogenase is introduced at the positions of the deleted ADH gene, PDC gene and GPD1 gene, and
(20) the gene encoding lactate dehydrogenase introduced at the position of the PDC gene is a gene encoding lactate dehydrogenase derived from Staphylococcus epidermidis.
(21) In the present invention, the gene encoding the lactate dehydrogenase derived from Staphylococcus epidermidis is represented by SEQ ID NO: 1, and the protein sequence thereof is represented by SEQ ID NO: 2, wherein a codon usage is regulated for expression of the gene in the acid-resistant YBC strain.
(22) In the present invention, the gene encoding lactate dehydrogenase introduced at the positions of the deleted ADH gene and GPD1 gene may be derived from Staphylococcus epidermidis or Lactobacillus plantarum.
(23) Recombinant strains having lactic-acid-producing ability exhibit a high lactic acid yield. However, lactic acid produced in large amounts inside the cells and large changes in carbon flux within cells affect the redox balance and cell growth and regulatory mechanisms, resulting in changes such that the cell growth rate and sugar consumption rate (and ultimately the lactic-acid production rate) are reduced. The reasons for the reduced lactic-acid resistance induced by genetic engineering are as follows. Conventional wild-type microorganisms are strains that grow well even under the environment that lactic acid is present at a high concentration (4080 g/L) outside the cells, and at pH of 2 to 3, which is lower than pKa. This strain actively produces lactic acid inside cells after genetic engineering, so lactic acid production is inhibited by both lactic acid produced inside the cells and lactic acid that has penetrated the cell membrane (via mass transfer) from the outside of the cells. The increased intracellular lactic-acid concentration decreases the pH of the cells, thus exhibiting an effect of inhibiting various intracellular activities, including gene replication and protein production, resulting in lower lactic-acid resistance.
(24) In addition, this effect becomes stronger when the extracellular lactic-acid concentration is increased or the external pH is more acidic and thus a large fraction of the total lactic acid is present in a hydrated form. In order to solve the problem caused by recombinant strains, the strains are continuously cultured in the target environment, such as adaptive evolution/forced evolution, and cells that are modified while adapting to the environment are continuously selected to improve performance (Zhengming Zhu et al., Applied Microbiology and Biotechnology, 102:4615-4627, 2018; Eugene Fletcher et al., Metabolic Engineering 39 (2017) 19-28, 2017; Christopher P Long, Current Opinions in Chemical Engineering, 22:209-215, 2018). Compounds causing mutation or physical mutation-causing factors such as UV may be used for such forced evolution (Zhengming Zhu et al., Applied Microbiology and Biotechnology (2018) 102:4615-4627). Initially, it was attempted to apply other methods rather than the adaptive evolution described above in the present invention. However, random mutations that simultaneously increase a desired aspect of performance (e.g., acid resistance) and other aspects of performance (e.g., productivity) are very rare. Although about 100 strains were individually monitored, it was difficult to select useful strains therefrom. It was difficult to expand the group from which to perform selection in consideration of the need to develop an automated high-throughput system capable of selecting excellent colonies and a gene system (for example, a fluorescent reporter proportional to the expression level of LDH) capable of detecting excellent colonies from the group of cells that were cultured and mutated to 10.sup.8 colony/ml or more.
(25) Therefore, the adaptive evolution method was used, rather than a method using mutants, the cells of the recombinant yeast strain were continuously cultured at high sugar and lactic-acid concentrations, and the lactic-acid concentration was increased when cells grew well. In addition, a process including plating the corresponding cells on a solid medium containing lactic acid in the intermediate stage of culture, selecting colonies having a high growth rate (having a large size) from the solid medium, and separately flask-testing the lactic acid production ability of the colony was repeated. The selected strain was directly compared with the parent strain of the culture. This operation, when repeated, enables selection of strains having increased lactic-acid-producing ability and the desired lactic-acid resistance. The improved fermentation performance was detected through fermenter-based culture (see
(26) In another aspect, the present invention is directed to a method for producing a recombinant yeast strain having improved lactic acid resistance and lactic-acid-producing ability, the method comprising: (a) inducing adaptive evolution of the recombinant yeast strain to a high-lactic-acid concentration by sequentially culturing a recombinant yeast strain having lactic-acid-producing ability from in a low-concentration lactic acid medium to in a high-concentration lactic acid medium to; (b) selecting a recombinant yeast strain having improved lactic-acid-producing ability in the high-concentration lactic acid medium; and (c) introducing a gene encoding a lactate dehydrogenase derived from Staphylococcus epidermidis at the position of the PDC gene of the genome of the selected strain.
(27) In the present invention, the recombinant yeast strain having lactic-acid-producing ability in step (a) is a YBC5 strain constructed by deleting a GPD1 gene, which is a gene encoding an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate, a CYB2 gene, which is a gene encoding an enzyme that converts lactate into pyruvate, an ADH gene, which is a gene encoding alcohol dehydrogenase, and a PDC gene, which is a gene encoding pyruvate decarboxylase from an acid-resistant yeast YBC strain (KCTC13508BP), and introducing the gene encoding lactate dehydrogenase into the acid-resistant yeast YBC strain, wherein the gene encoding the lactate dehydrogenase is introduced at the positions of the deleted ADH gene, PDC gene and GPD1 gene.
(28) In another aspect, the present invention is directed to a recombinant strain #26-5 (Accession No.: KCTC 14215BP) obtained by adaptive evolution at a high lactic-acid concentration of the recombinant strain having lactic-acid-producing ability constructed by deleting a GPD1 gene, which is a gene encoding an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate, a CYB2 gene, which is a gene encoding an enzyme that converts lactate into pyruvate, an ADH gene, which is a gene encoding alcohol dehydrogenase, and a PDC gene, which is a gene encoding pyruvate decarboxylase from an acid-resistant yeast YBC strain (KCTC13508BP), and introducing the gene encoding lactate dehydrogenase into the acid-resistant yeast YBC strain.
(29) In another aspect, the present invention is directed to a recombinant yeast YBC6 strain constructed by introducing a gene encoding a lactate dehydrogenase derived from Staphylococcus epidermidis at the position of the PDC gene of the genome of a recombinant strain #26-5 (Accession No.: KCTC 14215BP), wherein the recombinant yeast YBC6 strain has improved lactic-acid-producing ability at a high lactic-acid concentration and suppressed ethanol- and glycerol-producing ability compared to the YBC strain (KCTC13508BP) or the YBC5 strain.
(30) Adaptive evolution is a very powerful tool, but causes side effects. The adaptive evolution performed in the present invention is the selection of strains adapted to grow well in the presence of high concentrations of lactic acid. The adaptive microorganism selected in this process can grow even when the concentration of free lactic acid is high, and a strain which has a defense mechanism against lactic-acid concentration and facilitates sugar metabolism even in the presence of lactic acid is obtained, because a strain having high lactic-acid-producing ability is selected during the selection process. This feature of the selected strain can increase the concentration of microorganisms in the reactor even when the concentration of lactic acid in the reactor increases during fermentation culture, and such a high concentration of microorganisms can increase the overall lactic-acid production rate. In particular, the parent strain used in the present invention is a strain that grows at a very fast rate and has a high glucose consumption rate at a high concentration of lactic acid, which is a characteristic before genetic manipulation. Thus, adaptive evolution can restore the reduced lactic acid resistance and consequent reduced growth rate in the presence of lactic acid during the process of converting carbon flux from ethanol to lactic acid through genetic manipulation. However, considering this adaptive evolution process from the perspective of microorganisms, there are several directions that microorganisms necessarily select. From the point of view of microorganisms, in an acidic pH lower than pKa, when the external concentration of lactic acid increases, unionized hydrated lactic acid is transferred to and penetrates the cells, which lowers the pH inside the cells. In a state where the effect of such lactic acid is great, in selecting a fermentation product (carbon flow) that can produce ATP and NADH while converting sugar, which is a growth substrate, while performing DNA replication and protein production, the direction of evolution in which growth is promoted and sugar metabolism is accelerated while enhancing the lactic acid production performance (for example, the production rate), which has the same effect as external stress, cannot be the direction of natural selection but it is natural for the organisms to select a direction in which fermentation products that have less effect on the current stressors than lactic acid are induced. In addition, the lactic-acid production pathway in the parent strain used in the present invention is a pathway introduced from the outside, and the wild-type microorganism was originally a microorganism that grew while producing ethanol as a main byproduct, so a carbon pathway that was strengthened to promote growth and increase the resistance of lactic acid is obviously ethanol, and it was identified that ethanol, a byproduct of the lactic-acid production process, was increased.
(31) In order to analyze the genetic factors that promoted the increase in lactic acid resistance and the increase in by-products induced by adaptive evolution, qPCR analysis (transcriptome analysis) was performed on microorganisms before and after adaptive evolution. An analysis on the entire genome other than qPCR analysis may be performed to detect the difference therebetween. However, there are many genes that have been modified by mutations in the genome, but in fact, only some of these genes are factors appearing as phenotypes through protein expression or regulatory mechanisms thereof. For this reason, it was considered that qPCR analysis would be more appropriate to find phenotypic genetic factors such as increased resistance and increased growth rate.
(32) In order to identify genes with differences in expression in the transcriptome analysis, genes in which the fold change in the expression in the adaptive evolutionary strain compared to the expression rate in the wild-type strain was reduced or increased by two time or less, or two times or more are screened among all analyzed RNA sequences and then the corresponding genes were analyzed using annotation (see Table 6).
(33) Among the gene pools with reduced expression, a specific gene is the LDH gene encoding lactate dehydrogenase. As described above, microorganisms that increase the lactic acid concentration, and the fastest growth rate and lactic acid production rate (in some cases, the highest lactic acid production concentration) are selected, but the preferred response of microorganisms capable of responding to inhibition by oxidative pressure or acidic pH due to lactic acid is to reduce the amount of lactic acid produced internally. The reduction in expression is accumulated in the microorganism during the adaptive evolution process. Of course, the selected strain also has excellent lactic acid-producing ability, but this is mainly considered to be due to rapidly increased concentration of microorganisms resulting from the fast growth rate and the increased sugar consumption rate or sugar transfer rate in cells. It is believed that the lactic acid-producing ability per cell is decreased due to such a decrease in expression.
(34) As a result of analyzing the gene pool with increased expression, it was observed that the expression of several gene groups performing the same functions increased together. These are categorized as follows.
(35) Category A is related to fermentation products and is a group of genes related to the production of ethanol occurring for the purpose of enhancing the carbon flux to achieve the growth rate, in addition to the decrease in the expression of lactate dehydrogenase. In particular, when detecting the conventional PDC (gene encoding pyruvate decarboxylase) and ADH (alcohol dehydrogenase) activity, genes which were tested as candidates but the predicted activity of which could not detected were found to be enhanced in the present adaptive evolution. Category E is related to a hexose transporter and is a group of genes associated with proteins that initially act on C6 sugars, i.e., sugars such as glucose and mannose outside, and transport the same into cells. Category B is a group of zinc finger proteins. Studies reported that oxidative stress induced by lactic acid affects functional groups related to zinc finger proteins, or enhancement related to zinc finger proteins involves in alleviation of reactive oxygen species (ROS) (Derek A. Abbott et al., Applied and Environmental Microbiology, 2320-2325, 2009), and the relationship between oxidative stress including lactic acid and zinc finger proteins is very high (Xixi Zhou et al, The journal of biological chemistry, 290:18361-18369, 2015; B Gao et al., Cell Death and Disease, 5:e1334, 2014; Ananda S. Prasad and Bin Bao, Antioxidants 8:164, 2019), the acid resistance of the selected strains is predicted to be partially related to these Zinc finger proteins. Category D is a group of genes related to sulfate/sulfite, and in particular, an increase in the expression of sulfate/sulfite reductase was observed, which is presumed to be due to a mechanism to relieve sulfate/sulfite-mediated oxidative stress through lactic acid-mediated oxidative stress. In addition, the expression of genes to support gene structures and cell structures against external stress was identified and were collectively referred to as Category D stress response.
(36) Through transcriptome analysis, various characteristics of the strains of the present invention were determined, and when the characteristics of each gene were studied in the further research including reverse engineering in the future, an additional development method can be designed.
(37) In the transcriptome analysis, the increase in the expression of genes related to glycerol production could not be detected, but it was detected from the phenotype identified by fermentation culture that the strain selected through adaptive evolution also exhibited increased glycerol-producing ability compared to the parent strain. Therefore, it was considered that the increased glycerol was caused by NADH regeneration through the glycerol production pathway due to deficient NADH regeneration resulting from the inactivation of LDH rather than the expression of related genes and thus glycerol would decrease again when LDH was activated (enhanced).
(38) In conclusion, more microorganisms can be acquired in the fermentor for the same period of time due to the increased lactic acid resistance, and the fermentation rate increased due to the increased sugar metabolism rate. However, at the same time, an increase in the by-products of the lactic acid process was observed due to the increased lactic acid resistance. This was a phenomenon which is due to the decrease in the expression of LDH and thus the increase in glycerol and the expression of genes related to ethanol production, resulting from the increase in resistance. As a solution to this problem, the enhancement of LDH and removal of the ethanol production-related genes may be considered. In the present invention, first, by performing further expression of LDH, the production rate in each cell was increased to further increase the overall production rate, by performing the reduction of the coenzyme, NADH with LDH, reduction of NADH responsible for the glycerol pathway, was decreased and consequently, the level of the increase of glycerol was lowered, and by enhancing lactic acid-producing ability that directly competes with ethanol-producing ability using pyruvic acid as a precursor node in the metabolic pathway, the production of ethanol was reduced. Thereafter, if necessary, the additionally expressed ethanol-producing gene may be removed.
(39) In one aspect of the present invention, the strain that has undergone adaptive evolution is the YBC5 strain, wherein an LDH gene derived from L. plantarum is substituted at the sites of g4423 (ADH), g3002-1 (PDC), and g2947 (CYB2) of the genome thereof, and a total of 6 copies of the gene are inserted due to the characteristics of the diploid YBC strain. In many cases, when the many copies of same genes are inserted, the expression of the same genes is suppressed due to the feedback inhibition of the cell, so the effect increasing in proportion to the number of copies is not exerted, and the presence of the same gene may affect the stability of the genome. For this reason, the present invention has found a novel method to enhance LDH. As described in the prior patent applications (Korean Patent Application No. 2018-0044509 and Korean Patent Application No. 2019-0124701) of present inventors, LDH inserted at the g4423 (ADH) site of the YBC5 strain exhibited very high activity, and LDH inserted at the g2947 (CYB2) site also exhibited sustained activity in the late fermentation due to the influence of the g2947 promoter. However, the LDH inserted at the g3002-1 (PDC) site exhibited a relatively low effect of increasing lactic acid-producing ability in the phenotype. In particular, qPCR showed that the inherent PDC of YBC exhibited a high expression rate through the highly active promoter of the g3002-1 (PDC). Thus, further studies were conducted on related phenomena.
(40) First, lactic acid-producing ability was determined by removing g3002-1 from the wild-type YBC strain and introducing LDH derived from L. plantarum into the strain. It was observed that the strain well exhibited a phenotype by the removal of PDC, but produced a very small amount of lactic acid. Considering that LDH derived from L. plantarum was strongly expressed due to g4423, the extreme difference in expression of the same gene at different genomic locations within the same strain was not a general phenomenon. When the LDH is expressed in RNA, it is expected that the translation to protein will proceed smoothly, and in conclusion, it is presumed that the same gene was not transcribed at the corresponding PDC site. In order to solve this phenomenon, the present inventors tried to establish various hypotheses, but could not find a hypothesis to solve this. Accordingly, the present inventors hypothesized that smooth expression is suppressed depending on the genomic site and the genetic structural problem of LDH derived from L. plantarum. To solve this, LDH derived from another strain was introduced to change the genomic structure and thereby to promote LDH expression.
(41) For the target LDH to be introduced, genes that have optimum acidic pH and excellent expression in yeast to suit the characteristics of the acid-resistant strain was selected. Finding these genes among the numerous genes present in nature using screening alone is almost impossible in consideration of the necessary resources, and is a task that requires genome mining and experimental verification along with many assumptions. The present inventors first tried to select genes having similar characteristics from the literature rather than such genome mining, inject into the g3002-1 site of the corresponding acid-resistant strain and then determine the activity thereof. The present inventors tried to find genes that were previously verified under similar conditions through a literature search, and targeted LDH derived from Staphylococcus epidermidis and LDH derived from Bos taurus, which were found to be effective among the genes tested in the subject literature (Jae Won Lee et al, J. Biotechnology 241, 2017).
(42) After introducing the target three genes into the g3002-1 site of the wild-type YBC strain (KCTC13508BP), the lactic acid-producing ability was compared therebetween. As a result, a very interesting fact was detected. The difference in the activity between the three genes was very great, among which the S. epidermidis-derived LDH (SeLDH) gene was found to exhibit a 39-fold increase in activity based on the lactic acid yield compared to L. plantarum-derived LDH (LpLDH), and as a result, the SeLDH gene alone achieved a yield of 0.39 g/g at the site of g3002-1, which is activity comparable to that of the LpLDH previously inserted at the g4423 site. As a result, the present inventors acquired a method capable of securing high activity at the g3002-1 site and restoring the LDH activity of the adaptively evolved strain.
(43) However, the LDH gene of S. epidermidis is in the form of FDP-activated LDH which requires FDP as a coenzyme among various LDHs (E. I Garvie, Bacterial Lactate Dehydrogenases, Microbiological Reviews, 1980), and this FDP is an intermediate product of glycolysis. Therefore, the activity of the LpLDH gene is highly likely to be affected by the availability of FDP, and the activity thereof is likely to be affected thereby, compared to when general sugars such as glucose, fructose, and sucrose are used as substrates, when other sugars are used. However, such restrictions are minimized, because the substrates mainly used in commercial processes are corn starch, which is mainly composed of glucose, fructose, and sucrose, and saccharification products thereof, sugarcane juice and by-products thereof.
(44) In one aspect of the present invention, the SeLDH gene was inserted into the strain selected through adaptive evolution, and the result showed that the strain exhibited further increased yield from 0.67 g/g to 0.75 g/g and showed great reduction of by-products as expected while attaining further increase in productivity from 2.54 g/L/h to 2.56 g/L/h and increase in concentration from 123 g/L to 130 g/L.
(45) The ATP-associated requirement for fermentation of the acid-resistant strain was found in the culture of the strain acquired by the present invention, as described in the existing literature (Antonius J. A. van Maris et al., Appl. Environ. Microbiol., 70; 2898, 2004). In order words, as extracellular lactic acid concentration increased, energy was required to transfer the intracellular lactic acid to the outside, and ATP supply was required for fermentation due to consumption of ATP. The consumption of ATP is due to the production of acid-resistant lactic acid when adding 2ATP/glucose that can be secured by forcing the production strain to produce lactic acid while blocking oxygen thereto in general fermentation. For this reason, energy required for cell maintenance is insufficient under the anaerobic conditions of general fermentation. Oxygen supply is required to supplement the energy, and supplied oxygen completely oxidizes the substrate in the TCA pathway to supply energy, ATP, but at the same time, some substrates are converted to CO.sub.2, rather than lactic acid, resulting in a decrease in lactic acid yield. Therefore, it is necessary to set optimal aeration conditions that minimize the loss of lactic acid yield while maintaining cell activity.
(46) In addition, the strain of the present invention is both a yeast and a gram-positive strain and thus this should be considered to set a fermentation method. As is well known, in the presence of high sugar concentration, gram-positive strains undergo anaerobic fermentation reactions such as ethanol fermentation or lactic acid fermentation other than TCA even under aerobic conditions. In contrast, gram-negative strains can inhibit the production of fermentation products under aerobic conditions, so only the cells can be increased, and the cell growth period and the fermentation product production period may be performed separately. However, these gram-negative strains cause cell growth under aerobic conditions and can secure a high cell concentration in the fermentor, but cells cannot be increased indefinitely in order to increase the fermentation rate, since many substrates consumed under aerobic conditions are converted to CO.sub.2 along with cell growth (in addition, it is natural that the cell concentration is limited depending on the nutrients and the limit substrate of the medium). On the other hand, gram-positive strains grow cells under aerobic conditions and also yield fermented products. Therefore, when the fermentation product is lactic acid, NAD required for the glycolysis process can be supplied by the NADH consumed by LDH, gram-positive strains are relatively advantageous in lactic acid yield because lactic acid can be increased while reducing carbon loss to CO.sub.2 compared to gram-negative strains in which NAD is supplied by converting (oxidizing) substrates to CO.sub.2 through respiration. However, rapid accumulation of fermentation products in the reactor may quickly reach the lactic acid concentration where growth inhibition occurs, and there may be limitations in proliferation to the desired cell concentration. Therefore, in order to overcome this, adjustment of the optimal oxygen supply rate is required to maximize the optimal seed concentration and the initial growth rate of fermentation, and to prevent excessive conversion of the substrate to CO.sub.2 due to excess oxygen. In addition, as soon as the concentration of lactic acid at which growth stops is reached, it is necessary to adjust the oxygen supply rate by reducing oxygen supply rate so as to maintain a microaerobic state in which excessive CO.sub.2 loss does not occur, while supplying ATP, which is the energy to discharge lactic acid to the outside of the cell, as described above. Therefore, the present fermentation does not need to maintain a high mixing rate in the fermentor for the addition of the compound for neutralization and mixing the compound, but it is necessary to control the minimum oxygen supply rate at which sufficient cell growth occurs in the early stage of fermentation and sufficient ATP supply can occur at the late stage of fermentation, while reducing CO.sub.2 loss due to excess oxygen, which is an important scale-up factor. Based on the optimization of the oxygen supply rate, an appropriate aeration rate and mixing rate can be found through many experiments, and an optimum value can also be found using parameters known in the art such as OUR and OTR.
(47) In one aspect of the present invention, the strain selected by adaptive evolution can achieve high cell concentration and fast lactic acid production rate due to increased resistance to lactic acid compared to the parent strain YBC strain (KCTC13508BP) or the mutant strains (YBC1, YBC2/YBC3/YBC4/YBC5) derived from the parent strain due to increased resistance to lactic acid. In another aspect of the present invention, LDH was enhanced in the strains selected by the adaptive evolution to achieve reduction of ethanol and glycerol production.
(48) In another aspect of the present invention, compared to the lactic acid-producing ability acquired by introducing the LDH gene derived from L. plantarum at the position of the PDC (g3002-1) gene of the genome of the parent strain YBC strain, the lactic acid-producing ability acquired by introducing the LDH gene derived from S. epidermidis at the position was found to be increased 30 times or more on a yiled basis.
(49) In the present invention, the gene encoding lactate dehydrogenase that is introduced is preferably an LDH gene derived from L. helveticus, an LDH gene derived from R. oryzae or an LDH gene derived from L. plantarum, an LDH gene derived from B. taurus, and an LDH gene derived from S. epidermidis. More preferably, the L. plantarum-derived LDH gene is introduced at the site of g4423 (ADH), and the S. epidermidis-derived LDH gene is introduced at the site of g3002-1 (PDC).
(50) In one aspect of the present invention, the strain #26-5 having remarkably increased lactic acid resistance obtained through adaptive evolution of the YBC5 strain (g4423::ldh/g3002-1::ldh/g2947::ldh/g1544) exhibits high lactic acid productivity and high lactic acid production concentration, thus remarkably improving an economic efficiency of the process. In addition, the YBC6 strain (g4423::LpLDH/g3002-1::SeLDH/g2947::LpLDH/g1544) constructed by substituting the LDH of g3002-1 of the #26-5 strain with LDH derived from S. epidermidis exhibits increased lactic acid production rate and production concentration, and suppressed production of ethanol and glycerol, thus increased yield, compared to YBC5 and #26-5. The fermentation properties of YBC6 exhibited the yield, production rate, and production concentration that have reached a level that can be commercialized as acid-resistant strains.
(51) Accordingly, in another aspect, the present invention is directed to a method of producing lactic acid comprising (a) culturing the recombinant strain to produce lactic acid, and (b) collecting the produced lactic acid.
(52) The present invention is capable of realizing an excellent acid-resistant strain having greatly increased lactate productivity, concentration and yield, which reach a level of commercialization, greatly reduced ethanol production, and greatly reduced glycerol byproducts.
(53) As used herein, the term acid-resistant yeast is defined as a yeast that can maintain a biomass consumption rate (such as a sugar consumption rate) of at least 10% or a specific growth rate of at least 10%, at a pH less than a pKa value of an organic acid when the medium contains an organic acid (particularly lactic acid) at a concentration of at least 1M, compared to when the medium does not contain an organic acid. More specifically, the term acid-resistant yeast is defined as yeast that can maintain a biomass consumption rate (such as a sugar consumption rate) of at least 10% or a specific growth rate of at least 10% at a pH of 2 to 4 compared to a pH of 5 or higher.
(54) The recombinant yeast according to the present invention can be produced by inserting the gene into a chromosome of a host yeast according to a conventional method, or by introducing a vector including the gene into the host yeast.
(55) As the host yeast, a host cell having high DNA introduction efficiency and high expression efficiency of the introduced DNA is commonly used. In one embodiment of the present invention, an acid-resistant yeast is used, but the present invention is not limited thereto and any type of yeast may be used as long as it can sufficiently express the target DNA.
(56) The recombinant yeast can be prepared according to any transformation method. The term transformation refers to a phenomenon in which DNA is introduced into a host to enable DNA to be replicated as a factor of chromosomes or by chromosomal integration, and means a phenomenon in which genetic changes are artificially induced by introducing external DNA into a cell. General transformation methods include electroporation, lithium acetate-PEG, and the like.
(57) In addition, in the present invention, any commonly known genetically engineering method can be used as a method of inserting genes into the chromosomes of host microorganisms. For example, there are methods using retroviral vectors, adenoviral vectors, adeno-associated virus vectors, herpes simplex viral vectors, pox viral vectors, lentiviral vectors, non-viral vectors and the like. The vector means a DNA product containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in a suitable host. Vectors may be plasmids, phage particles or simply potential genomic inserts. When transformed into a suitable host, vectors may be replicated or perform functions independent of the host genomes, or some thereof may be integrated with the genomes. Plasmids are currently the most commonly used forms of vector, but linear DNA is also a commonly used form for genomic integration of yeast.
(58) Typical plasmid vectors include (a) a replication origin to efficiently conduct replication so as to include a predetermined amount of plasmid vector in each host cell, (b) an antibiotic resistance gene or auxotrophic marker gene to screen host cells transformed with plasmid vectors, and (c) a restriction enzyme cleavage site into which a foreign DNA fragment is inserted. Even if an appropriate restriction enzyme cleavage site is not present, the vector and foreign DNA can be easily ligated using a synthetic oligonucleotide adaptor or a linker according to a conventional method (Gibson assembly). If necessary, a method of synthesizing and using the entire desired sequence is also commonly used.
(59) Furthermore, when a nucleic acid sequence is aligned with another nucleic acid sequence based on a functional relationship therebetween, it is said to be operably linked thereto. This may be gene(s) and control sequence(s) linked in such a way so as to enable gene expression when a suitable molecule (e.g., a transcriptional activator protein) is linked to the control sequence(s). For example, DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a pre-protein involved in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence; a ribosome-binding site is operably linked to a coding sequence when it affects the transcription of the sequence; or the ribosome-binding site is operably linked to a coding sequence when positioned to facilitate translation.
(60) Generally, the term operably linked means that the linked DNA sequence is in contact therewith, or that a secretory leader is in contact therewith and is present in the reading frame. However, the enhancer need not be in contact therewith. The linkage of these sequences is carried out by ligation (linkage) at convenient restriction enzyme sites. When no such site exists, a synthetic oligonucleotide adaptor or a linker according to a conventional method is used.
(61) It should be understood that not all vectors function identically in expressing the DNA sequences of the present invention. Likewise, not all hosts function identically for the same expression system. However, those skilled in the art will be able to make appropriate selections from among a variety of vectors, expression control sequences and hosts without excessive burden of experimentation and without departing from the scope of the present invention. For example, selection of a vector should be carried out in consideration of a host because the vector should be replicated therein. The number of times the vector replicates, the ability to control the number of times the vector replicates, and the expression of other proteins encoded by the corresponding vector, such as the expression of antibiotic markers, should also be considered.
(62) In the present invention, the carbon source may include, but is not limited to, one or more selected from the group consisting of glucose, xylose, arabinose, sucrose, fructose, cellulose, galactose, glucose oligomer, and glycerol.
(63) In the present invention, the culture may be performed under conditions such that microorganisms, for example, E. coli, and the like no longer act (for example, cannot produce metabolites). For example, the culture may be carried out at a pH of 1.0 to 6.5, preferably a pH of 1.0 to 6.0, and more preferably a pH of 2.6 to 4.0, but is not limited thereto.
(64) Hereinafter, the present invention will be described in more detail with reference to examples. However, it will be obvious to those skilled in the art that these examples are provided only for illustration of the present invention and should not be construed as limiting the scope of the present invention.
Example 1: Adaptive Evolution #1 of Acid-Resistant Strain YBC
(65) In the previous research, the present inventors selected strains having acid resistance through testing on various yeast strains and determined the strain having the best acid resistance, namely, the YBC strain, by adding lactic acid to a medium at the beginning of the culture of yeast strains and monitoring the growth and sugar consumption rate of microorganisms, and deposited the strain with the accession number KCTC13508BP with the Biological Resource Center in the Korea Research Institute of Bioscience and Biotechnology.
(66) Phylogenetic analysis showed that the YBC strain (KCTC13508BP) is a strain similar to S. cerevisiae, is diploid, and is Crabtree-positive.
(67) The YBC5 strain genetically modified from the corresponding YBC strain achieved a yield that could be commercialized by suppressing the consumption of lactic acid and suppressing glycerol production while minimizing inhibition of ethanol production (Korean Patent Application No. 10-2020-0046779).
(68) The YBC5 strain was obtained by deleting an ADH (alcohol dehydrogenase) from the YBC strain and introducing an LDH gene into the strain to construct a YBC1 strain, removing the g3002-1 gene (PDC gene) from the YBC1 strain and expressing LDH therein to construct a YBC2 strain capable of producing lactic acid at high efficiency and having suppressed ethanol production, introducing an LDH gene into the YBC2 strain and removing g2947, a gene that consumes lactate to construct a YBC4 strain having removed lactic acid consumption ability and removing the GPD1 (g1544) gene (removing both allele 1 and allele 2, as a diploid strain) from the YBC4 strain to construct the YBC5 strain.
(69) The method of constructing the strain is as follows:
(70) The YBC1 strain is a strain obtained by removing the g4423 gene, which is the main ADH gene of the YBC strain, from the YBC strain and introducing the LDH gene of SEQ ID NO: 3 derived from Lactobacillus plantarum at the position of g4423. A gene cassette from which the ORF of each gene was removed and which contains 5 and 3 UTR was constructed based on the information of g4423 and UTR thereof and used as donor DNA. For each allele of g4423, the corresponding 5 UTR is represented by SEQ ID NO: 4 and SEQ ID NO: 5, and the 3 UTR is represented by SEQ ID NO: 6 and SEQ ID NO: 7. The donor DNA was produced using a cloning method using a restriction enzyme, Gibson assembly, and a method using gene synthesis as described above. The LDH of SEQ ID NO: 3 was synthesized and then introduced at the ORF site of g4423 to produce donor DNA, and the donor DNA was introduced into YBC to construct a recombinant strain YBC1.
(71) In addition, the g3002-1 gene is a gene that is positioned at the scaffold 72 in the genome sequencing of the YBC strain and acts as a PDC gene. The g3002-1 gene (gene positioned at the scaffold 72) was removed from the YBC1 strain and the LDH gene of SEQ ID NO: 3 was introduced thereinto to construct a recombinant strain YBC2.
(72) The cassette for substituting the gene of g3002 was constructed using the corresponding UTR as a recombination site. Similar to the method of introducing LDH into the site of the g4423 gene (ADH) of YBC1 described above, the cassette was constructed using the UTR of g3002-1. However, in order to simplify the process of gene substitution, a donor cassette for one allele was produced without considering allele variation, but it is also possible to produce a donor cassette for each allele. In addition, for the primers used for gene substitution, in addition to the primers used to produce the deletion strain, a pair of primers capable of detecting both LDH and the UTR of g3002-1 were separately used as follows to increase the accuracy of gene substitution verification.
(73) TABLE-US-00001 g3002-1UTR-LDH-fwd: (SEQIDNO:8) GCAGGATATCAGTTGTTTG g3002-1UTR-LDH-rev: (SEQIDNO:9) AATACCTTGTTGAGCCATAG
(74) In addition, the YBC4 strain is a strain constructed by deleting the g2947 gene, which is the main CYB2 gene of the YBC2 strain, from the YBC2 strain and introducing the LDH gene of SEQ ID NO: 3, derived from Lactobacillus plantarum, at the position of g2947. The g2947 gene is a gene positioned at scaffold 41 in the genome sequencing of the YBC strain. A gene cassette from which the ORF of each gene was removed and which contains 5 and 3 UTR was constructed based on the information of g2947 and UTR thereof and used as donor DNA. For each allele of g2947, the corresponding 5 UTR is represented by SEQ ID NO: 10 and SEQ ID NO: 11, and the 3 UTR is represented by SEQ ID NO: 12 and SEQ ID NO: 13. The donor DNA was produced using a cloning method using a restriction enzyme, Gibson assembly, and a method using gene synthesis, as described above.
(75) However, in order to simplify the process of gene substitution, a donor cassette for one allele was produced without considering allele variation, but it is also possible to produce a donor cassette for each allele.
(76) The YBC5 strain is a strain constructed by deleting the g1544 gene, which is the GPD1 gene of the YBC4 strain, from the YBC4 strain. The g1544 gene is a gene positioned at scaffold 19 in the genome sequencing of the YBC strain. A gene cassette from which the ORF of each gene was removed and which contains 5 and 3 UTR and antibiotic markers was constructed based on the information of g1544 and UTR thereof and used as donor DNA. For each allele of g1544, the corresponding 5 UTR is represented by SEQ ID NO: 14 and SEQ ID NO: 15, and the 3 UTR is represented by SEQ ID NO: 16 and SEQ ID NO: 17. The donor DNA was produced using a cloning method using a restriction enzyme, Gibson assembly, and a method using gene synthesis, as described above.
(77) In order to simplify the process of gene substitution, a donor cassette for one allele was produced without considering allele variation, but it is also possible to produce a donor cassette for each allele. In addition, the donor cassette may be produced and applied without using antibiotic markers when a currently commercialized genetic engineering technology (CRISPR) is used.
(78) The genotypes of the produced recombinant strains are as follows:
(79) YBC2 g4423::ldh/g3002-1::ldh
(80) YBC4 g4423::ldh/g3002-1::ldh/g2947::ldh
(81) YBC5 g4423::ldh/g3002-1::ldh/g2947::ldh/g1544
(82) However, in order to secure economic feasibility upon commercialization, the recombinant strain must achieve a production rate of 2.5 g/L/hr or more and a lactic acid concentration of 120 g/L or more at a pH of 3.7 or less. Therefore, in the following examples, treatment to increase the resistance to lactic acid was performed in order to increase the lactic acid production rate of the YBC5 strain.
(83) As shown in Table 1, the YBC5 strain was subcultured while gradually increasing the lactic acid concentration from 10 g/L to 80 g/L. During subculture, mutants occur in the cells through natural mutations, and strains that are highly adaptable to high concentrations of lactic acid grow relatively quickly and gradually become dominant species within the entire strain flora. This process was repeated while increasing the lactic acid concentration, and the growth rate of the entire strain flora was detected. In addition, the strain flora were plated on an agar plate containing lactic acid at an appropriate time point and colonies that are produced were separated. At this time, the selected colony was the largest colony due to rapid growth on a solid medium containing lactic acid. Through this process, 42 colonies were selected from colonies grown at liquid concentrations of 40, 50, 60, 70, and 80 g/L.
(84) TABLE-US-00002 TABLE 1 Concentration mYP Component (g/L) Peptone 5 Yeast extract 4 KH2PO4 5 MgSO47H2O 2 Uracil 0.15 Glucose 50 Lactic acid variable Round 1 2 3 4 5 6 7 8 LA(g/L) 10 20 30 40 50 60 70 80 m-YP(80%) 40.0 40.0 40.0 40.0 40.0 40.0 40.0 40.0 Glu(600 g/L) 5 5 5 5 5 5 5 5 LA(40%) 1.5 3.0 4.5 6.0 7.5 9.0 10.5 12.0 Seed(ml) 2 2 2 2 2 2 2 2 DW(ml) 11.5 10.0 8.5 7.0 5.5 4.0 2.5 1.0 Total (ml) 60.0 60.0 60.0 60.0 60.0 60.0 60.0 60.0
Changes in the concentration of lactic acid produced by the strain
flora in each lactic acid-containing culture medium in this process
are shown in Table 2.
(85) TABLE-US-00003 TABLE 2 Culture period Glu- Lac- Glyc- (h) OD(A600) pH cose tate Ethanol erol 10/1, 14:00 0 0.20 4.34 54.5 1.0 0.0 0.0 10/2, 15:00 25 6.72 2.52 9.2 38.0 0.8 0.0 LA10 10/1, 14:00 0 0.20 3.10 54.2 11.4 0.0 0.6 10/2, 15:00 25 5.72 2.56 13.9 42.5 0.8 0.6 LA20 10/2, 15:00 0 0.17 2.94 55.2 21.7 0.0 0.9 10/4, 09:00 42 6.50 2.53 6.8 58.0 0.0 1.3 LA30 10/4, 09:00 0 0.21 2.83 52.0 32.6 0.0 1.5 10/5, 10:00 25 4.06 2.76 43.4 37.3 0.0 1.6 LA40 10/5, 10:00 0 0.10 2.78 54.5 41.9 0.0 2.6 10/7, 9:00 47 5.40 2.56 21.6 64.4 1.1 3.4 LA50 10/7, 11:00 0 0.22 2.75 54.6 51.9 0.0 2.5 10/9, 8:00 45 1.34 2.75 53.6 55.4 0.0 2.8 10/10, 9:00 70 5.92 2.64 29.5 65.7 0.0 3.3 LA60 10/9, 8:00 0 0.07 2.73 54.6 61.6 0.0 3.1 3 d 72 0.25 2.72 51.0 60.6 0.0 3.4 5 d 120 6.23 3.43 18.1 81.2 0.0 3.7 LA70 10/12, 09:00 0 0.05 2.73 51.7 68.7 0.0 3.8 6 d 144 4.70 3.52 30.9 83.1 0.0 5.5 LA80_1 10/18, 09:00 0 NA 3.55 53.7 79.2 0.0 5.9 10/22, 15:00 102 6.14 3.37 5.4 105.6 1.0 8.5
(86) The 42 selected colonies were inoculated into 5 ml of conical tubes. Because it is a small-scale culture, was the most uniform amount derived from the colony was inoculated for a uniform inoculation OD. The medium used herein was m-YP medium (5 g/L of peptone, 4 g/L yeast extract, 5 g/L of KH.sub.2PO.sub.4, 2 g/L of MgSO.sub.4.7H.sub.2O, 0.15 g/L of uracil) supplemented with 6% (primary) or 12% (secondary) glucose and cultured at 30 C. and 150 rpm for 96 hours.
(87) Table 3 shows the result of 5 ml culture. In this culture, 15 colonies having high lactic acid production concentration, cell concentration, or lactic acid production yield were selected, and the following flask culture evaluation therefor was performed.
(88) The selected colonies are as follows: 3, 5, 6, 8, 10, 22, 24, 26, 27, 31, 32, 35, 37, 38, 41.
(89) TABLE-US-00004 TABLE 3 Colony pH Glu- Lac- # @3 d OD cose tate Ethanol Glycerol YLA 1 2.22 5.28 8.5 45.0 1.86 0.40 0.817 2 2.24 5.96 11.4 41.8 1.75 0.34 0.802 3 2.14 9.06 0.0 49.8 0.73 0.61 0.784 4 2.20 6.96 7.4 44.4 1.81 0.41 0.790 5 2.16 10.32 1.3 49.2 0.58 0.67 0.791 6 2.15 9.58 3.3 48.0 0.63 0.50 0.797 7 2.19 7.06 7.5 45.3 1.76 0.38 0.810 8 2.21 6.06 10.8 42.8 1.71 0.32 0.812 9 2.19 6.50 8.9 43.9 1.71 0.36 0.803 10 2.14 8.96 4.4 48.0 0.63 0.53 0.812 11 2.21 4.30 12.9 40.2 1.96 0.32 0.796 12 2.18 4.08 10.0 43.8 1.72 0.38 0.818 13 2.20 6.04 12.8 42.0 1.60 0.33 0.828 14 2.18 7.26 7.8 44.3 2.28 0.35 0.794 15 2.19 5.22 12.6 42.6 1.63 0.34 0.838 16 2.18 5.72 10.5 44.1 1.64 0.35 0.833 17 2.18 6.20 11.6 43.3 1.70 0.33 0.836 18 2.17 6.70 9.8 45.3 1.71 0.38 0.843 19 2.19 6.18 13.4 44.0 1.51 0.34 0.877 20 2.16 6.32 8.2 45.2 1.54 0.35 0.817 21 2.18 5.74 10.0 44.0 1.57 0.25 0.822 22 2.17 8.80 8.0 43.3 1.87 0.49 0.780 23 2.19 7.46 13.5 40.4 1.81 0.37 0.808 24 2.12 9.02 3.6 48.1 0.86 0.53 0.802 25 2.20 7.82 13.2 40.6 1.81 0.34 0.807 26 2.12 9.04 2.6 48.3 1.21 0.59 0.793 27 2.17 6.00 10.8 43.2 1.76 0.34 0.820 28 2.17 6.38 9.4 42.4 2.17 0.44 0.784 29 2.17 6.14 10.9 43.3 1.71 0.35 0.823 30 2.12 7.72 6.2 45.2 0.64 0.40 0.790 31 2.12 9.48 4.6 46.4 0.98 0.49 0.789 32 2.11 9.54 0.7 49.2 0.69 0.52 0.782 33 2.12 8.66 3.1 46.9 1.19 0.49 0.777 34 2.15 8.14 5.4 44.8 2.06 0.41 0.771 35 2.20 7.02 5.1 38.5 4.26 1.61 0.658 36 2.15 6.48 6.5 43.8 1.97 0.48 0.769 37 2.15 7.36 6.1 45.2 1.93 0.35 0.787 38 2.15 6.48 8.5 44.8 1.83 0.37 0.815 39 2.14 6.24 4.7 45.9 2.07 0.50 0.781 40 2.17 5.54 9.9 42.6 1.88 0.37 0.795 41 2.10 8.98 1.5 50.2 0.87 0.57 0.809 42 2.15 7.24 6.0 44.0 2.11 0.48 0.764 Colony pH Glu- Lac- # @4 d OD cose tate Ethanol Glycerol YLA 1 2.22 4.10 76.1 31.6 0.8 0.61 0.721 2 2.11 5.98 56.2 42.5 2.6 1.51 0.666 3 1.97 16.38 43.1 62.5 0.0 2.79 0.814 4 2.24 3.54 80.6 30.6 0.7 0.27 0.778 5 2.23 4.60 79.3 31.7 0.8 0.37 0.780 6 2.24 3.92 78.6 30.3 0.8 0.38 0.732 7 2.24 4.36 79.4 29.4 0.7 0.30 0.724 8 2.04 11.40 66.2 58.3 0.0 2.56 1.084 9 2.08 14.30 83.6 56.6 0.0 1.98 1.553 10 2.29 2.82 86.0 26.3 0.5 0.06 0.773 11 2.24 3.72 78.2 30.1 0.7 0.51 0.720 12 2.25 3.66 80.9 29.6 0.7 0.46 0.757 13 2.25 3.62 81.4 29.7 0.7 1.21 0.769 14 2.07 6.42 46.2 47.6 4.4 1.62 0.645 15 2.24 3.58 80.7 30.5 0.7 0.47 0.776 16 2.22 3.92 76.8 31.5 0.8 0.64 0.729 17 2.24 3.38 78.6 29.4 0.7 0.46 0.710 18 1.99 7.06 43.7 56.3 0.0 1.07 0.737 19 2.27 3.04 83.1 27.4 0.5 0.10 0.743 20 2.27 2.86 83.5 28.0 0.5 0.16 0.767 21 2.25 3.82 81.0 29.6 0.7 0.46 0.761 22 1.93 11.30 22.6 64.0 2.0 2.06 0.827 23 2.23 3.48 79.2 31.0 0.8 0.51 0.758 24 2.24 3.58 80.0 29.7 0.7 0.48 0.743 25 2.26 4.02 81.9 29.3 0.7 0.42 0.768 26 2.25 3.82 80.6 29.9 0.7 0.40 0.758 27 1.94 11.24 29.7 63.6 0.1 1.75 0.704 28 1.99 8.16 38.7 59.6 0.1 1.16 0.733 29 2.28 3.22 83.9 28.9 0.6 0.27 0.802 30 2.27 3.66 81.5 29.4 0.77 0.30 0.763 31 2.00 11.44 39.3 60.1 0.04 2.39 0.745 32 1.95 11.88 24.2 66.0 2.09 1.90 0.689 33 2.11 6.06 55.7 45.4 2.73 1.28 0.706 34 2.26 3.44 81.0 30.1 0.70 0.42 0.771 35 1.99 12.94 14.0 59.8 8.09 4.10 0.564 36 2.08 6.26 51.8 47.9 2.63 1.14 0.702 37 1.99 9.86 34.5 58.1 2.44 1.45 0.679 38 2.01 11.16 55.7 61.9 0.57 1.70 0.962 39 2.19 4.34 73.9 34.7 1.14 0.43 0.752 40 2.27 3.62 82.7 29.2 0.64 0.32 0.784 41 2.25 4.16 81.9 30.8 0.77 0.52 0.807 42 2.20 4.42 75.7 34.4 0.95 0.68 0.777
(90) Flask culture evaluation was performed on the selected colonies and the culture conditions are as follows. 10% glucose (primary) was added to m-YP medium (5 g/L peptone, 4 g/L yeast extract, 5 g/L KH.sub.2PO.sub.4, 2 g/L MgSO.sub.4.7H.sub.2O, 0.15 g/L uracil) to adjust a total volume of 50 ml. Microorganisms were inoculated into the medium and cultured at 30 C. and 150 rpm for 72 hours. In addition, 1 day after incubation, a CaCO.sub.3 solution was added in an amount of 20% of the sugar injection concentration.
(91) The analysis results of the flask culture are shown in Table 4.
(92) The result of flask culture was analyzed based on an evaluation logic introduced for comprehensive judgment. First, the top five colonies were selected for each item of production rate, lactic acid yield, growth rate, ethanol concentration (in low order), and glycerol concentration (in low order), and scores and weights in each item were assigned to the selected colonies and were summed up. As for the weights, for the purpose of adaptive evolution, the lactic acid production rate was given priority, and colonies having fast growth rate, but low lactic acid-producing ability were excluded. Table 5 shows the evaluation process and results thereof.
(93) TABLE-US-00005 TABLE 4 30% Lactic acid productivity (g/L/h) Colony 1 2 3 3 1.36 1.74 1.11 26 0.89 1.70 1.14 8 1.42 1.69 1.08 32 1.35 1.69 1.10 5 1.35 1.67 1.10 31 1.22 1.67 1.12 YBC5 1.50 1.66 1.08 6 1.51 1.66 1.08 24 1.41 1.66 1.07 22 1.41 1.65 1.17 38 1.46 1.63 1.10 10 1.45 1.62 1.12 27 0.84 1.59 1.18 41 1.37 1.56 1.08 48 1.43 1.56 1.06 37 1.35 1.41 1.09 23 1.34 1.39 1.02 35 1.44 1.17 0.90 25% Lactic acid yield on Glucose (g/g) Colony 1 2 3 3 0.78 0.80 0.77 26 0.75 0.80 0.79 22 0.74 0.79 0.81 27 0.73 0.79 0.81 8 0.74 0.78 0.75 32 0.71 0.78 0.76 5 0.69 0.77 0.76 31 0.75 0.77 0.77 YBC5 0.72 0.76 0.75 6 0.75 0.76 0.75 10 0.73 0.76 0.77 24 0.72 0.76 0.74 48 0.76 0.75 0.73 38 0.72 0.75 0.76 41 0.71 0.73 0.75 23 0.70 0.71 0.71 37 0.72 0.65 0.75 35 0.63 0.63 0.63 Growth rate (20%) Colony # (l/h) 27 0.170 26 0.169 31 0.159 5 0.144 32 0.141 3 0.141 37 0.138 8 0.136 6 0.134 24 0.134 38 0.129 YBC5 0.126 10 0.124 41 0.122 22 0.120 48 0.113 23 0.104 35 0.094 15% Ethanol/LA Colony 1 2 3 27 0.016 0.024 0.012 31 0.022 0.025 0.002 26 0.023 0.026 0.001 8 0.023 0.027 0.003 5 0.035 0.027 0.001 YBC5 0.030 0.028 0.005 37 0.030 0.029 0.014 22 0.024 0.029 0.010 32 0.027 0.029 0.008 3 0.026 0.030 0.009 6 0.035 0.035 0.009 38 0.047 0.035 0.025 24 0.035 0.039 0.024 10 0.032 0.040 0.036 48 0.035 0.054 0.030 41 0.048 0.061 0.057 23 0.069 0.074 0.070 35 0.094 0.097 0.099 10% Glycerol/LA Colony 1 2 3 26 0.006 0.008 0.011 27 0.007 0.009 0.010 22 0.007 0.009 0.012 37 0.010 0.010 0.011 3 0.011 0.011 0.015 32 0.011 0.011 0.015 31 0.007 0.012 0.013 8 0.006 0.012 0.013 10 0.012 0.012 0.013 6 0.008 0.012 0.015 23 0.016 0.013 0.012 48 0.013 0.013 0.015 YBC5 0.011 0.013 0.016 5 0.011 0.013 0.015 41 0.016 0.014 0.014 24 0.010 0.014 0.015 38 0.015 0.014 0.015 35 0.050 0.044 0.034
(94) TABLE-US-00006 TABLE 5 Colony # Grade Weights(%) Score Productivity 3 5 30 1.50 26 4 30 1.20 8 3 30 0.90 32 2 30 0.60 5 1 30 0.30 Yield 3 5 25 1.25 26 4 25 1.00 22 3 25 0.75 27 2 25 0.50 8 1 25 0.25 Growth rate 27 5 20 1.00 26 4 20 0.80 31 3 20 0.60 5 2 20 0.40 32 1 20 0.20 EtOH/LA 27 5 15 0.75 31 4 15 0.60 26 3 15 0.45 8 2 15 0.30 5 1 15 0.15 Glycerol/LA 26 5 10 0.50 27 4 10 0.40 22 3 10 0.30 37 2 10 0.20 3 1 10 0.10 Colony # Grade Weights(%) Score Total 26 5 10 0.50 3.95 26 4 30 1.20 26 4 25 1.00 26 4 20 0.80 26 3 15 0.45 3 5 30 1.50 2.85 3 5 25 1.25 3 1 10 0.10 27 5 20 1.00 2.65 27 5 15 0.75 27 4 10 0.40 27 2 25 0.50 8 3 30 0.90 1.45 8 2 15 0.30 8 1 25 0.25 31 4 15 0.60 1.20 31 3 20 0.60 22 3 25 0.75 1.05 22 3 10 0.30 5 2 20 0.40 0.85 5 1 30 0.30 5 1 15 0.15 32 2 30 0.60 0.80 32 1 20 0.20 37 2 10 0.20 0.20 Priority Colony# Total 1 26 3.95 2 3 2.85 3 27 2.65 4 8 1.45 5 31 1.20
As shown in Table 5, colony No. 26 (hereinafter referred to as #26 strain) was selected, and the main reason for the selection is that it is a colony in which the increase of by-products is minimized compared to the increase in lactic acid-producing ability. When only the lactic acid-producing ability and yield were considered, while excluding the increase in by-products, colony No. 3 showed better results, but the overall performance was first considered in the 1.sup.st round. The increasing trend of these by-products was also observed in the subsequent adaptive evolution.
Example 2: Adaptive Evolution #2 of Acid-Resistant Yeast Strain YBC
(95) The #26 strain selected in the 1.sup.st round of adaptive evolution of Example 1 had an increase in performance compared to YBC5 (refer to the result of comparison with YBC5 in Table 4), but did not reach the performance to suit commercialization, so further operation for improvement was performed.
(96) Since the #26 strain had an increase in resistance to lactic acid concentration, the culture was started at a high concentration of lactic acid and the number of subcultures at each concentration increased. The culture was performed without the addition of CaCO.sub.3, a neutralizing agent, in order to improve the growth properties under extreme conditions.
(97) The lactic acid that is used was prepared by removing impurities from a medium actually produced through fermentation with a 0.2 m filter, and then performing concentration to prepare a 40-50% solution, and then mixed with an YP medium (20 g/L peptone, 10 g/L yeast extract) depending on the desired lactic acid concentration. The sugar concentration was 10%, and the subculture medium was inoculated in an amount of 10% of the total volume of the fresh medium and culture was performed.
(98)
(99) Flask culture was performed on the selected colonies under the same conditions as in Example 1. The reference performance at this time was the performance of the #26 strain. Colony No. 5 was selected through a selection process similar to that of Example 1, and it was named designated as the #26-5 strain for distinction from the 1.sup.st round result. The result of culture of #26-5 is shown in
(100) The 3.sup.rd round of adaptive evolution was conducted in order to further increase resistance compared to the strain #26-5. The target strains used herein were strain #26-5 and the strain flora cultured in the 2.sup.nd round. The growth in the two flasks was compared at the beginning of the 3.sup.rd round. As a result, the growth of the strain flora continuously grown from the 2.sup.nd round was more excellent. The adaptive evolution using strain #26-5 as the starting culture strain was stopped due to the high possibility of the presence of a mutant with stronger resistance than the #26-5 strain selected within the strain flora. The result of the 3.sup.rd round is shown in (b) of
(101) Although the colonies produced in the additional 3.sup.rd round have higher lactic acid resistance than #26-5 and thus can grow more at a high lactic acid concentration, compared to #26-5, the ratio of lactic acid in the fermentation product further decreases, and production of ethanol and glycerol as by-products was further increased. Here, any one of the strain #26-5 and the strain isolated in the 3.sup.rd round should be selected as a target strain for commercialization which will be further developed in the future. It was necessary to make a decision to choose either further development (research on restoration of lactic acid-producing ability and high by-product reduction) on strains having high lactic acid resistance in the mid- to long-term, or #26-5 having relatively low lactic acid resistance but still good lactic acid resistance. In the present invention, further research was conducted on #26-5, which was expected to be developed within a shorter period.
Example 3: Comparison of Gene Expression Before and after Adaptive Evolution
(102) In this example, changes in gene expression for YBC5 and #26-5 due to adaptive evolution were observed based on qPCR. Total RNA was extracted from samples cultured in each YPDU medium at 30 C. and 200 rpm for 24 hours, the RNA was analyzed through NGS, and then the change in the expression level of the same gene was analyzed and shown in Table 6.
(103) [Table 6]
(104) Changes in gene expression of YBC5 and #26-5 strains and corresponding genes, Category A: Product related, Category B: Zinc finger protein, Category C: Sulfate/Sulfite related protein, Category D: Stress response, Category E: Hexose transporter
(105) TABLE-US-00007 Fold Contig ID Change* Uniprot annotation result of Contig SEQ ID NO: Category c2862_g1_i1 17.8 sp|P56511|LDH_LACPE L-lactate 18 A dehydrogenase OS = Lactobacillus pentosus GN = ldh PE = 1 SV = 1 c4821_g17_i3 2.00 sp|P32467|HXT4_YEAST Low-affinity glucose 19 E transporter HXT4 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = HXT4 PE = 1 SV = 1 c4795_g1_i1 2.01 sp|P29496|MCM5_YEAST Minichromosome 20 D maintenance protein 5 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = MCM5 PE = 1 SV = 1 c4321_g4_i2 2.04 sp|Q12531|YP015_YEAST Zinc finger protein 21 B YPR015C OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = YPR015C PE = 4 SV = 1 c144_g1_i1 2.06 sp|P53631|HXT17_YEAST Hexose transporter 22 E HXT17 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = HXT17 PE = 3 SV = 1 c2309_g1_i1 2.09 sp|Q02685|RMI1_YEAST RecQ-mediated 23 D genome instability protein 1 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = RMI1 PE = 1 SV = 1 c3558_g1_i1 2.09 sp|Q12145|YP013_YEAST Zinc finger protein 24 B YPR013C OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = YPR013C PE = 1 SV = 1 c1715_g1_i1 2.10 sp|P40352|RAD26_YEAST DNA repair and 25 D recombination protein RAD26 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = RAD26 PE = 1 SV = 1 c4733_g1_i1 2.16 sp|P39692|MET10_YEAST Sulfite reductase 26 C [NADPH] flavoprotein component OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = MET10 PE = 1 SV = 2 c4679_g6_i1 2.23 sp|P39959|YEW0_YEAST Zinc finger protein 27 B YER130C OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = YER130C PE = 4 SV = 2 c4955_g2_i1 2.28 sp|P33400|PACC_YEAST pH-response 28 D transcription factor pacC/RIM101 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = RIM101 PE = 1 SV = 2 c8855_g1_i1 2.39 sp|Q08032|CDC45_YEAST Cell division 29 D control protein 45 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = CDC45 PE = 1 SV = 1 c7636_g1_i1 2.42 sp|Q12749|SMC6_YEAST Structural 30 D maintenance of chromosomes protein 6 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = SMC6 PE = 1 SV = 1 c4682_g2_i1 2.50 sp|Q02805|ROD1_YEAST Protein ROD1 31 D OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = ROD1 PE = 1 SV = 1 c4154_g1_i1 2.50 sp|P18408|MET16_YEAST Phosphoadenosine 32 C phosphosulfate reductase OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = MET16 PE = 1 SV = 2 c422_g1_i1 2.50 sp|P47169|MET5_YEAST Sulfite reductase 33 C [NADPH] subunit beta OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = MET5 PE = 1 SV = 1 c3775_g2_i1 2.57 sp|Q6FJA3|PDC1_CANGA Pyruvate 34 A decarboxylase OS = Candida glabrata (strain ATCC 2001/CBS 138/JCM 3761/NBRC 0622/NRRL Y-65) GN = PDC1 PE = 3 SV = 1 c4997_g1_i1 2.62 sp|Q12139|YP022_YEAST Zinc finger protein 35 B YPR022C OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = YPR022C PE = 1 SV = 1 c7526_g1_i1 2.63 sp|P47169|MET5_YEAST Sulfite reductase 36 C [NADPH] subunit beta OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = MET5 PE = 1 SV = 1 c10116_g1_i1 2.83 sp|P53721|RCF2_YEAST Respiratory 37 D supercomplex factor 2, mitochondrial OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = RCF2 PE = 1 SV = 1 c2453_g4_i1 2.86 sp|P53035|MIG2_YEAST Regulatory protein 38 A, B, D MIG2 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = MIG2 PE = 1 SV = 1 c8818_g1_i1 2.88 sp|Q05937|STP3_YEAST Zinc finger protein 39 B STP3 OS = Saccharomyces cerevisiae (strain ATCC 204508/288c) GN = STP3 PE = 1 SV = 1 c4613_g5_i1 2.89 sp|P39005|KRE9_YEAST Cell wall synthesis 40 D protein KRE9 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = KRE9 PE = 3 SV = 1 c4552_g7_i1 2.92 sp|P30624|LCF1_YEAST Long-chain-fatty- 41 D acid--CoA ligase 1 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = FAA1 PE = 1 SV = 1 c5170_g1_i1 2.94 sp|P39003|HXT6_YEAST High-affinity hexose 42 E transporter HXT6 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = HXT6 PE = 1 SV = 2 c2749_g2_i1 3.11 sp|Q04894|ADH6_YEAST NADP-dependent 43 A alcohol dehydrogenase 6 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = ADH6 PE = 1 SV = 1 c2564_g1_i1 3.16 sp|P38079|YRO2_YEAST Protein YR02 44 D OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = YRO2 PE = 1 SV = 1 c2992_g1_i1 3.33 sp|Q12117|MRH1_YEAST Protein MRH1 45 D OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = MRH1 PE = 1 SV = 1 c4074_g1_i1 3.56 sp|Q6FXQ8|MET3_CANGA Sulfate 46 C adenylyltransferase OS = Candida glabrata (strain ATCC 2001/CBS 138/JCM 3761/NBRC 0622/NRRL Y-65) GN = MET3 PE = 3 SV = 1 c4925_g1_i1 3.84 sp|Q12531|YP015_YEAST Zinc finger protein 47 B YPR015C OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = YPR015C PE = 4 SV = 1 c4569_g1_i1 3.97 sp|Q99252|ECM3_YEAST Protein ECM3 48 D OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = ECM3 PE = 1 SV = 1 cl919_g1_i1 4.14 sp|P40489|XBP1_YEAST Transcriptional 49 D repressor XBP1 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = XBP1 PE = 1 SV = 1 c2966_g3_i1 4.76 sp|P39003|HXT6_YEAST High-affinity hexose 50 E transporter HXT6 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = HXT6 PE = 1 SV = 2 c6180_g1_i1 5.05 sp|Q12340|YRM1_YEAST Zinc finger 51 B transcription factor YRM1 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = YRM1 PE = 1 SV = 1 c494_g1_i1 5.31 sp|Q12325|SUL2_YEAST Sulfate permease 2 52 C OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = SUL2 PE = 1 SV = 1 c2966_g2_i1 5.34 sp|P39003|HXT6_YEAST High-affinity hexose 53 E transporter HXT6 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = HXT6 PE = 1 SV = 2 c849_g1_i1 5.36 sp|Q12145|YP013_YEAST Zinc finger protein 54 B YPR013C OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = YPR013C PE = 1 SV = 1 c2966_g1_i1 6.09 sp|A6ZT02|HXT4_YEAS7 Low-affinity glucose 55 E transporter HXT4 OS = Saccharomyces cerevisiae (strain YJM789) GN = HXT4 PE = 3 SV = 1 c2749_g1_i1 6.51 sp|Q04894|ADH6_YEAST NADP-dependent 56 A alcohol dehydrogenase 6 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = ADH6 PE = 1 SV = 1 c7728_g1_i1 7.51 sp|Q12442|IZH2_YEAST ADIPOR-like 57 D receptor IZH2 OS = Saccharomyces cerevisiae (strain ATCC 204508/S288c) GN = IZH2 PE = 1 SV = 2 *Evolution strain/origin strain fold change means expression decrease, and evolution strain/origin strain fold change + means expression increase
(106) Expression levels of various genes were increased or decreased in the strains of the selected colonies through adaptive evolution, but the most striking difference is the weakened part of LpLDH (LDH derived from Lactobacillus plantarum), which is responsible for lactic acid production. It has clearly shown that the LDH enhancement study is needed. However, despite the weakening of LDH, as a result of selection of only strains that produce rapidly lactic acid by the present inventors, it was found that the expression of several transporter genes that transport sugar into cells from the outside was enhanced in the strain #26-5. This is considered to be the main reason for acquiring rapid lactic acid-producing ability, despite the weakening of LpLDH.
(107) Acid-resistant recombinant #26-5 strain was deposited with KCTC on Jun. 15, 2020 (Accession No. KCTC 14215).
Example 4: Fermenter Operation Using Selected Adaptive Evolution Strain
(108) In this example, the #26-5 strain selected as adaptive evolution in Example 3 was cultured in a bioreactor and the lactic acid fermentation performance thereof was determined.
(109) The #26-5 strain was primarily and secondarily seeded in 40 ml and 380 ml, respectively, in mYP medium (10 g/L peptone, 5 g/L yeast extract, 5 g/L KH.sub.2PO.sub.4, 2 g/L MgSO.sub.4.7H.sub.2O, 0.3 g/L uracil), cultured at 30 C. at 200 rpm for 2 days, and all cells were harvested. The cells were inoculated in 1.18 L mYP medium and then cultured at 30 C. At this time, the concentration of each of the components of the mYP medium was adjusted with respect to a volume of 1.7 L including both the additional sugar solution and CaCO.sub.3 solution. The culture was initiated at an inoculation OD of 1.73, and 100 ml of 42.33% CaCO.sub.3 was mixed with 450 ml of 62.5% sugar solution in separate feeding bottles, and the mixture of sugar and CaCO.sub.3 was injected into a bioreactor while the bottle was continuously mixed at 400 rpm with a magnetic stirrer such that CaCO.sub.3 was homogenized in the solution. In addition to this method of injecting a mixture of CaCO.sub.3 with a sugar solution, in some fermentations, CaCO.sub.3 may be injected in a predetermined amount (5-10 ml) once every 2 hours, separately from the sugar solution. However, the mixture of CaCO.sub.3 with a sugar solution was injected in consideration of the fact that it is possible to minimize the increase in CO.sub.2 concentration due to the introduction of CaCO.sub.3 and thereby to improve fermentation performance when injecting small amounts as evenly as possible. In commercial fermentation, CaCO.sub.3 may be directly injected without mixing with water, so a decrease in lactic acid concentration due to additional water can be avoided. However, in a laboratory scale, sterilized CaCO.sub.3 was injected as a solution phase. In addition, CaCO.sub.3 may be injected at a uniform mix ratio of the sugar and CaCO.sub.3 during the entire fermentation process. In some cases, most of CaCO.sub.3 was added within 24 hours after inoculation at which initial strain growth actively occurs, and only sugar solution was injected thereafter (based on fermentation ID 60). The injection rate and aeration rate of the sugar and CaCO.sub.3 mixture were different in respective batches, but based on the fermentation ID F60 in Table 7, the injection rate of the mixed solution was 13.5 ml/hr during the initial 2 hours, and was 15.3 ml/hr thereafter. Based on F60, the culture was performed at an aeration rate of 0.7 lpm and at a stirring rate of 700 rpm during the cell growth phase. After 20 hours, the culture condition was gradually changed therefrom to an aeration rate of 0.35 lpm and a stirring rate of 600 rpm.
(110) The results of fermentation culture using strain #26-5 are shown in
(111) The result of #26-5 strain fermentation showed that the production rate of lactic acid is 2.54 g/L/hr, the yield is 0.67 g/g, and the lactic acid concentration is 123 g/L. That is, lactic acid production rate and concentration are excellent, but there is a problem of a decrease in yield compared to YBC5. This problem is caused by production of each of ethanol and glycerol at 7 g/L during the fermentation. This problem is due to the LDH weakening and ethanol-producing gene expression that occurred as side effects of adaptive evolution, which has the effects of increasing the fermentation rate and resistance to lactic acid. The method to offset these side effects is to enhance LDH and remove the corresponding ethanol-producing gene, among which the method of enhancing LDH was performed in Examples 5 to 7. The concentration of sugar shown in
(112)
(113) The functions and importance of aeration in acid-resistant fermentation have already been described above, and aeration should be maximized until 24 hours, which is the cell growth period, and maintained at a minimum value thereafter. However, even during the cell growth phase, excessive aeration caused a decrease in the lactic acid yield (refer to F57 fermentation in Table 7). The effect of the aeration rate for maintaining cell activity after 24 hours on the yield were very sensitive, so in the case of lowering to 0.3 lpm or less from the optimal aeration rate of 0.35 lpm, based on 2 L culture, the lactic acid production rate was remarkably lowered or in serious cases, the lactic acid production stopped, and the yield decreased in inverse proportion with the aeration rate when aeration rate is 0.4 lpm or more. The aeration rate may be expressed as the oxygen transfer rate or the oxygen inflow rate into the cells. However, the aeration rate is affected by the structure of the reactor, the shape of the stirrer, and the air discharge form of the sparger and thus should be re-optimized when these factors are changed. This is not very difficult for those who have knowledge associated with microbial cell culture to perform the re-optimization.
(114) The fermentation results for various condition changes are shown in Table 7 below.
(115) TABLE-US-00008 TABLE 7 Results of optimization of conditions including sugar injection and aeration in culture using #26-5 strains Fermentation performance Lactic Lactic acid Lactic acid acid production production Culture Final yield rate concentration ID Fermentation conditions pH (g/g) (g/L/hr) (g/L) F55 Seed 188 ml, total volume 1.68 L, intermittent 3.46 0.74 2.23 106 injection of 20% CaCO.sub.3 compared to sugar separately from sugar solution, Aeration 1.0 lpm --> 0.3 lpm, Stirring rate 600 rpm--> 500 rpm F56 Seed 188 ml, total volume 1.65 L, intermittent 3.4 0.72 2.25 107 injection of 20% CaCO.sub.3 compared to sugar separately from sugar solution (reduced injection interval), Aeration 1.0 lpm --> 0.3 lpm, Stirring rate 600 rpm--> 500 rpm F57 Seed 188 ml, total volume 1.65 L, intermittent 3.52 0.63 2.11 102 injection of 20% CaCO.sub.3 compared to sugar separately from sugar solution (reduced injection interval), Aeration 1.0 lpm --> 2.0 1pm --> 0.6 lpm, Stirring rate 600 rpm--> 900 rpm F58 Seed 188 ml, total volume 1.53 L, consecutive 3.42 0.65 2.19 105 injection by mixing with 20% CaCO.sub.3 sugar solution compared to sugar, Aeration 1.0 lpm --> 0.4 lpm, Stirring rate 600 rpm--> 800 rpm --> 500 rpm F59 Seed 384 ml, total volume 1.73 L, 3.23 0.68 2.39 116 consecutive injection by mixing with 15% CaCO.sub.3 sugar solution compared to sugar, Aeration 1.0 lpm --> 1.1 lpm ---> 0.4 lpm, Stirring rate 600 rpm--> 700 rpm --> 500 rpm F60 Seed 380 ml, total volume 1.73 L, 3.14 0.67 2.54 123 consecutive injection by mixing with 15% CaCO.sub.3 sugar solution compared to sugar, Aeration 0.7 lpm --> 0.35 lpm, Stirring rate 700 rpm--> 600 rpm
Example 5: Comparison of Effect of LDH Introduced at Site g3002-1 of YBC Strain
(116) 2 copies of each of LpLDH derived from L. plantarum (SEQ ID NO: 3), LDH derived from Bos taurus (BtLDH) (SEQ ID NO: 58) or LDH derived from S. epidermidis (SeLDH) (SEQ ID NO: 1) were introduced at the PDC (g3002-1) site of the YBC strain.
(117) The method of constructing the strain is as follows:
(118) The g3002-1 gene, the main PDC gene of the YBC strain, was removed and the yeast codon-optimized LDH gene of SEQ ID NO: 3 derived from Lactobacillus plantarum was introduced at the site of g3002-1 to obtain a strain. Based on the information of g3002-1 and UTR thereof, the ORF of each gene was removed, LpLDH was introduced at the site thereof, and a gene cassette containing the 5 and 3 UTRs of g3002-1 was produced and used as donor DNA (see an example of gene cassette in
(119) In order to verify the correct execution of the genetic manipulation, the transformant was identified using the following primers, and if necessary, the correct transformant was identified through sequencing of the genome part.
(120) Similarly, the strain introduced with the BtLDH gene was designated as YBCbt, the strain introduced with the SeLDH gene was designated as YBCse, and the primers used to identify the genome are as follows.
(121) TABLE-US-00009 Forwardforidentifying3002-1ORF: (SEQIDNO:63) GCAGGATATCAGTTGTTTG Reverseforidentifying3002-1ORF: (SEQIDNO:64) ATAGAGAAGCTGGAACAG Forwardforidentifying3002-1UTR: (SEQIDNO:65) GCAGGATATCAGTTGTTTG Reverseforidentifying3002-1UTR: (SEQIDNO:66) CAGAATCTTAGAAAGGAGG ForwardforidentifyingintroductionofLpLDH, BtLDHandSeLDH: (SEQIDNO:67) GCAGGATATCAGTTGTTTG ReverseforidentifyingintroductionofLpLDH: (SEQIDNO:68) AATACCTTGTTGAGCCATAG ReverseforidentifyingintroductionofBtLDH: (SEQIDNO:69) ACCTTCTTGTTGTCTAGC ReverseforidentifyingintroductionofSeLDH: (SEQIDNO:70) ATAACTCTTTCAGCTGGC
(122) An experiment was performed on the transformant genotype of which was identified through 50 ml flask culture at 30 C. and 150 rpm. The inoculation OD was 0.1, the medium used herein was YP medium (20 g/L peptone, 10 g/L yeast extract), 6% of glucose was used and uracil 150 mg/L was added.
(123) The results are shown in Table 8.
(124) TABLE-US-00010 TABLE 8 Comparison of effect of LDH introduced at g3002-l (PDC) site ID Lactic acid (g/L) Yield (g/g) LpLDH 1.1 0.01 BtLDH 4.6 0.07 3.2 (sugar concentration 2%) 0.16 (sugar concentration 2%) SeLDH 24.5 0.39
(125) As shown in Table 8, there was a marked difference in lactic acid production due to the change of LDH in the same genome. In particular, the two results that LpLDH substituted at the g4423 genome site of YBC exhibited very strong expression corresponding to the yield of 0.5 g/g or more, but was hardly expressed at the site of g3002-1, and that LDH activity was obtained at the g3002-1 site, comparable to that the case of the g4423 site by changing the origin of LDH to SeLDH, are new phenomena that have not been reported to date.
Example 6: Effect of SeLDH Substituted at Site g3002-1 of YBC1 and YBC5 Strains
(126) In order to verify the high activity of SeLDH at the g3002-1 site identified in the example above, the same genetic manipulation was performed on the strains YBC1 and #26-5 (from YBC5).
(127) The genotypes of target YBC1 and YBC5 are as follows.
(128) YBC1: g4423::LpLDH
(129) #26-5 (from YBC5) g4423::LpLDH, g3002-72::LpLDH, g2947::LpLDH, g1544
(130) The cassette and method used herein were similar to those of Example 5. In the case of YBC5, LpLDH at the target position should be substituted with SeLDH, but the primers were changed as follows in order to amplify the part with low similarity between the two LDH sequences and identify the correct transformant based thereon.
(131) Forward for identifying presence of LpLDH: GCAGGATATCAGTTGTTTG (SEQ ID NO: 71)
(132) Reverse for identifying presence of LpLDH: TTTCAAACCAGTACCACCA (SEQ ID NO: 72)
(133) Forward 1 for identifying presence of SeLDH: GCAGGATATCAGTTGTTTG (SEQ ID NO: 73)
(134) Reverse 1 for identifying presence of SeLDH: GAAGAAGAATACAAAGCACC (SEQ ID NO: 74)
(135) Forward 2 for identifying presence of SeLDH: GCAGGATATCAGTTGTTTG (SEQ ID NO: 75)
(136) Reverse 2 for identifying presence of SeLDH: CACCAGCTTTAACAGTAAC (SEQ ID NO: 76)
(137) The strain constructing by introducing SeLDH at the g3002 position of the YBC1 strain is designated as YBC2se, and the strain constructing by introducing SeLDH at the g3002 position of the YBC5 strain is designated as YBC6, and genotypes thereof are as follows.
(138) YBC2se: g4423::LpLDH, g3002-72::SeLDH
(139) YBC6: g4423::LpLDH, g3002-72::SeLDH, g2947::LpLDH, g1544
(140) An experiment was performed on the transformant genotype of which was identified through 50 ml flask culture at 30 C. and 150 rpm. At this time, the inoculation OD was 0.1, the medium used herein was YP medium (20 g/L peptone, 10 g/L yeast extract), 5% of glucose was used for YBC2 and YBC2se, 10% of glucose was used for YBC5 and YBC6, and 150 mg/L of uracil was added.
(141) The results are shown in Tables 9 and 10 below.
(142) TABLE-US-00011 TABLE 9 Identification of the effect of SeLDH in YBC1 (w/o pH control) ID Yield (g/g) YBC2 0.66 YBC2se 0.88
(143) TABLE-US-00012 TABLE 10 Identification of the effect of SeLDH in YBC5 (w/o pH control) ID Yield (g/g) #26-5 0.55 YBC6 0.76
(144) As shown in Table 9 and Table 10, YBC2se located at the PDC gene of the YBC1 strain exhibits a high yield under similar conditions compared to YBC2 in which LpLDH is substituted at the same position. Strong LDH expression of SeLDH in addition to PDC blocking cause great improvement in the lactic acid production compared to ethanol production, resulting in a yield substantially similar to the theoretical yield, in consideration of the reduction in the yield related to the production of ATP required to transport lactic acid to the outside of the cells under acid-resistant conditions. In addition, the strain #26-5, which was imparted with improved productivity but reduced yield, by the conventional adaptive evolution, exhibited a great increase in yield under the same conditions as well. This means that the activity of the LDH, which was reduced by adaptive evolution, was greatly improved through SeLDH strongly expressed at the site of g3002-1.
Example 7: Fermenter Operation Using YBC6 Strain
(145) In this example, the YBC6 strain was cultured in a bioreactor and the lactic acid fermentation performance thereof was determined.
(146) The YBC6 strain was primarily and secondarily seeded in 40 ml and 380 ml, respectively, in mYP medium (10 g/L peptone, 5 g/L yeast extract, 5 g/L KH.sub.2PO.sub.4, 2 g/L MgSO.sub.4.7H.sub.2O, 0.3 g/L uracil), cultured at 30 C. at 200 rpm for 2 days, and all cells were harvested. The cells were inoculated in 1.18 L mYP medium and then cultured at 30 C. At this time, the concentration of each of the components of the mYP medium was adjusted with respect to a volume of 1.7 L including both the additional sugar solution and CaCO.sub.3 solution. The culture was initiated at an inoculation OD of 1.74, and 100 ml of 42.33% CaCO.sub.3 was mixed with 450 ml of 64.4% sugar solution in separate feeding bottles, and the mixture of sugar and CaCO.sub.3 was injected into a bioreactor while the bottle was continuously mixed at 400 rpm with a magnetic stirrer such that CaCO.sub.3 was homogenized in the solution. However, the mixture of CaCO.sub.3 with a sugar solution was injected in consideration of the fact that it is possible to minimize the increase in CO.sub.2 concentration (obstruction of oxygen transfer) due to the introduction of CaCO.sub.3 and thereby to improve fermentation performance when injecting as evenly as possible. In commercial fermentation, CaCO.sub.3 may be directly injected without mixing with water. However, in a laboratory scale, sterilized CaCO.sub.3 was injected as a solution phase. In addition, CaCO.sub.3 may be injected at a uniform mix ratio of the sugar and CaCO.sub.3 during the entire fermentation process. However, in this fermentation, most of CaCO.sub.3 was added within 24 hours after inoculation at which initial strain growth actively occurs, and only the sugar solution was injected thereafter. The injection rate of the sugar and CaCO.sub.3 mixture was elevated from 4.5 to 18 ml/hr during the initial 8 hours, and was 22.5 ml/hr thereafter. The culture was performed at an aeration rate of 0.5 lpm and at a stirring rate of 600 rpm during the cell growth phase. After 12 hours, the culture was performed at an aeration rate of 0.35 lpm and a stirring rate of 600 rpm, which are gradually changed therefrom. After 33 hours, the culture was performed at an aeration rate of 0.4 lpm and a stirring rate of 600 rpm.
(147) The results of fermentation culture using YBC6 strain are shown in
(148) The concentration of sugar shown in
(149) The results of culture showed a lactic acid yield of 0.75 g/g a fermentation rate of 2.56 g/L/h and a lactic acid concentration of 130 g/L at pH 3.16, which is the best result among the performance of acid-resistant strains published to date. Cargill's patent relating to acid-resistant strain culture (U.S. Pat. No. 7,232,664) suggests a yield of 0.75 g/g, a fermentation rate of 2.5 g product/L/h, and a lactic acid concentration of 120 g/L as standards for commercialization performance of acid-resistant lactic acid strains. The results of this example achieved the above criteria in all indicators. The example of the U.S. Pat. No. 7,232,664 discloses the total yield of 0.67 g/g, the mean fermentation rate of 0.8 g lactic acid/g-cell/h and the concentration of 114 g/L. The result of the present fermentation showed superior yield and performance than that of this example.
(150)
(151) Name of depository institution: Korea Research Institute of Bioscience and Biotechnology
(152) Accession number: KCTC14215BP
(153) Deposit Date: 20200615
(154) Although specific configurations of the present invention have been described in detail, those skilled in the art will appreciate that this description is provided to set forth preferred embodiments for illustrative purposes and should not be construed as limiting the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the accompanying claims and equivalents thereto.